Translation accelerator, template nucleic acid, method for producing translation template, and method for producing protein

Abstract

The subject of the present invention is to provide a translation promoter that improves the synthesis efficiency of a target protein. The subject can be solved by the following translation promoter: a translation promoter in a cell-free protein synthesis system, the translation promoter is composed of a nucleic acid as a 3' non-translated region, the 3' non-translated region is adjacently linked to the 3' end of a coding region encoding an amino acid sequence of a target protein, the 3' non-translated region is composed of a first region and a second region, the first region is adjacent to the 3' end of the coding region and is composed of 10 to 40 nucleic acid sequences; the second region is linked to the first region and is composed of a poly A sequence of 2 to 40 A consecutively, and the first region has a hairpin structure.

Description

Technical Field

[0001] The disclosure of the present application relates to a translation facilitator, a template nucleic acid, a method for producing a translation template, and a method for producing a protein. Background Art

[0002] A synthesis system for synthesizing protein in a cell-free manner is a protein synthesis system in which a medium containing intracellular elements related to protein synthesis is prepared, and transcription from template DNA to translation is performed in a cell-free manner. There are many such cell-free protein synthesis systems. As such a synthesis system, there is a system in which a template DNA as a transcription template is applied to a medium to synthesize a protein as a final product, and a system in which mRNA as a translation template is applied to a medium to synthesize a protein.

[0003] In any of these systems, it is necessary to synthesize a transcription template DNA as the initial raw material. The synthesis of the transcription template DNA usually begins by cloning the cDNA encoding the protein to be synthesized, combining the cloned cDNA into a plasmid, and constructing a DNA region for expression containing a promoter, a coding region, a terminator, etc. Then, the DNA region is cut out from the plasmid, or PCR (polymerase chain reaction) is directly performed on the plasmid as a template DNA.

[0004] The structure of template DNA is considered to have an impact on the expression efficiency in the cell-free protein synthesis system, and various attempts have been made to construct the vector of the expression cassette. For example, it is reported that a specific translation promoting sequence is introduced into the 5' untranslated region (5'UTR) (patent documents 1, 2). In addition, it is also recorded that by extending the 3' untranslated region (3'UTR), the life of the mRNA as a translation template is long, or the translation efficiency is improved (patent document 3). It is also reported that the 3'UTR of mRNA is preferably more than 1000 bases (patent documents 4, 5).

[0005] In addition, regarding a cell-free protein synthesis system using a yeast extract, the use of 3'UTR is also mentioned (Non-Patent Document 1).

[0006] On the other hand, it is also known that a transcription template DNA can be obtained by a nucleic acid amplification reaction in a 3'UTR of less than 200 bases, and mRNA and protein can be efficiently obtained by applying this transcription template DNA to a cell-free protein synthesis system (see Patent Document 6).

[0007] Prior Art Literature

[0008] Patent Literature

[0009] Patent Document 1: Japanese Patent Application Publication No. 2009-72207;

[0010] Patent Document 2: Japanese Patent Application Publication No. 2013-158342;

[0011] Patent Document 3: Japanese Patent Application Publication No. 2007-97438;

[0012] Patent Document 4: Japanese Patent Application Publication No. 2008-35701;

[0013] Patent Document 5: Japanese Patent Application Publication No. 2005-247857;

[0014] Patent document 6: International Publication No. 2016 / 143799.

[0015] Non-patent literature

[0016] Non-patent literature 1: Biotechonology Journal, 2014, 9, 641-651. Summary of the invention

[0017] In cell-free protein synthesis, mRNA as a translation template needs to be synthesized from template DNA. Therefore, from the viewpoint of mRNA synthesis efficiency, the one with a short 3'UTR that is not related to the synthesis of the target protein is preferred. However, the one with a high synthesis efficiency of the target protein is preferred.

[0018] The disclosure in the present application is made to solve the above-mentioned conventional problems, and after careful research, it is newly discovered that: (1) a nucleic acid of a 3' non-translated region is connected adjacent to the 3' end of a coding region encoding an amino acid sequence of a target protein, (2) a first region adjacent to the 3' end of the coding region and consisting of 10 to 40 nucleic acid sequences, and a second region connected to the first region and consisting of a poly A sequence of 2 to 40 consecutive A's, (3) the first region has a hairpin structure, and (4) thereby, despite a relatively short 3' non-translated region, the protein synthesis efficiency can be improved.

[0019] That is, the purpose of the disclosure of the present application is to provide a translation promoter, a template nucleic acid, a method for producing a translation template, and a method for producing a protein, which can improve the synthesis efficiency of a target protein even in a short 3' untranslated region.

[0020] The disclosure of the present application relates to the translation accelerator, template nucleic acid, method for producing a translation template, and method for producing a protein shown below.

[0021] (1) A translation promoter, which is a translation promoter in a cell-free protein synthesis system, wherein:

[0022] The translation promoter is composed of a nucleic acid as a 3' untranslated region, and the 3' untranslated region is adjacent to the 3' end of the coding region encoding the amino acid sequence of the target protein.

[0023] The 3' untranslated region is composed of a first region and a second region,

[0024] The first region is adjacent to the 3' end of the coding region and is composed of 10 to 40 nucleic acid sequences;

[0025] The second region is linked to the first region and is composed of a poly-A sequence of 2 to 40 consecutive A's.

[0026] The first region has a hairpin structure.

[0027] (2) A template nucleic acid for use in a cell-free protein synthesis system, the template nucleic acid comprising:

[0028] Promoter region;

[0029] a coding region encoding an amino acid sequence of a target protein operably linked via the promoter region; and

[0030] The 3' untranslated region of the coding region is composed of the translation promoter according to claim 1.

[0031] (3) The template nucleic acid according to (2) above, wherein the coding region is a region encoding a fusion protein containing a protein tag at the C-terminus of an arbitrary protein as the target protein.

[0032] (4) The template nucleic acid according to (2) or (3) above, wherein the coding region is a region encoding a fusion protein containing a protein tag at the N-terminus of any protein as the target protein.

[0033] (5) The template nucleic acid according to any one of (2) to (4) above, wherein the template nucleic acid is a transcription template DNA.

[0034] (6) The template nucleic acid according to any one of (2) to (4) above, wherein the template nucleic acid is a translation template mRNA.

[0035] (7) A method for producing a translation template for use in a cell-free protein synthesis system, the method comprising the following steps:

[0036] In the absence of cells and in the presence of elements for transcribing the transcription template DNA into mRNA, a translation template mRNA is synthesized using the template nucleic acid described in any one of (2) to (5) above.

[0037] (8) A method for producing a protein, comprising the following steps:

[0038] In the absence of cells and in the presence of elements for translating the translation template mRNA into protein, protein is synthesized using the template nucleic acid described in (6) above. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 is a schematic diagram illustrating the outline of a translation facilitator and a template nucleic acid;

[0040] Figure 2 is a schematic diagram illustrating the outline of the transcription template DNA used in Examples and Comparative Examples;

[0041] Figure 3 is a schematic diagram illustrating the steps of preparing a transcription template DNA by PCR;

[0042] Figure 4 It is a figure which shows the structure of the 3'UTR sequence of Examples 1-2 and Comparative Examples 1-3 analyzed using CentroidFold, a secondary structure prediction software of mRNA;

[0043] Figure 5 is a three-dimensional image showing the expression levels of proteins of Examples 1 to 2 and Comparative Examples 1 to 3;

[0044] Figure 6 It is a diagram showing the structures of the 3'UTR sequences of Examples 3 to 5 analyzed using CentroidFold, a secondary structure prediction software for mRNA;

[0045] Figure 7 is a three-dimensional image showing the expression levels of proteins in Examples 3 to 5 and Comparative Example 4;

[0046] Figure 8 It is a diagram showing the structures of the 3'UTR sequences of Examples 6 to 9 and Comparative Example 5 analyzed using CentroidFold, a secondary structure prediction software for mRNA;

[0047] Fig. 9 is a three-dimensional image showing the expression levels of proteins in Examples 6 to 8 and Comparative Example 5;

[0048] Fig.10 It is a three-dimensional image showing the expression levels of proteins in Example 9 and Comparative Example 5. DETAILED DESCRIPTION

[0049] Below, the production method of translation facilitator, template nucleic acid, translation template and protein disclosed in the application are described in detail. In addition, the following description is for ease of understanding, and the scope of technical matters disclosed in the application is not limited to the following description. Except for the following illustration, of course, appropriate changes can also be made within the scope of the disclosed purpose of the application without prejudice.

[0050] (Translation accelerator)

[0051] Reference Figure 1 , the implementation method of the translation promoter is described. Figure 1 1 is a schematic diagram for explaining the outline of a translation promoter. The translation promoter 1 is linked adjacent to the 3' end of the coding region 2 encoding the amino acid sequence of the target protein in the template nucleic acid used in the cell-free protein synthesis system. In addition, the translation promoter 1 is composed of a nucleic acid as a 3' non-translated region, and the nucleic acid itself is not synthesized as a protein. The translation promoter 1 involved in the embodiment is composed of a first region 1a adjacent to the 3' end of the coding region 2, and a second region 1b linked to the first region 1a.

[0052] The first region 1a has a hairpin structure. In addition, in this specification, "hairpin structure" refers to a stable loop structure formed in a pair with other nucleic acids in the nucleic acid constituting the first region 1a. As long as the first region 1a is a sequence that can form a hairpin structure, there is no particular restriction on the nucleic acid sequence. In addition, about the length (number of nucleic acids) of the nucleic acid constituting the first region 1a, if the nucleic acid sequence is too short, it is difficult to form a hairpin structure, or the stop codon is contained in the hairpin structure or close to it, therefore, for example, more than 10, more than 13, more than 15, more than 20. On the other hand, about the upper limit, as long as it is within the range that protein synthesis can be performed, there is no particular restriction. However, in general, the template nucleic acid DNA comprising promoter 3, coding region 2 and 3' non-translated region 1 is obtained by nucleic acid amplification reactions such as PCR. Therefore, from the viewpoint of primer design and the viewpoint of cost, it is preferably short. Therefore, from the viewpoint of efficiency, the length of the nucleic acid constituting the first region 1a can be less than 50, less than 45, less than 40, less than 30. In addition, the number of “ring structures” formed in the first region 1 a may be one or two or more.

[0053] The second region 1b is composed of a poly A sequence of continuous A (adenine). If the length (number of nucleic acids) of A is too small, the efficiency of protein synthesis will not be improved, so it is, for example, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, or 15 or more. On the other hand, as with the first region 1a, there is no particular limitation on the upper limit as long as it is within the range that cell-free protein synthesis can be performed, but from the viewpoint of primer design and cost, the length (number) of A (adenine) constituting the second region 1b may be 50 or less, 45 or less, 40 or less, 35 or less, or 30 or less.

[0054] Although the mechanism by which the translation promoter according to the embodiment improves the synthesis efficiency of the target protein is not clear, as shown in the Examples and Comparative Examples described below, by sequentially arranging the first region 1a and the second region 1b at the 3' end of the coding region 2, the synthesis efficiency of the protein is improved.

[0055] When the translation promoter is applied to a transcription template DNA, it is present as a double-stranded DNA at the 3' end of the DNA. When the translation promoter is applied to a translation template mRNA, it is present as a single-stranded RNA at the 3' end of the mRNA.

[0056] (Template nucleic acid)

[0057] Reference Figure 1 , an implementation method of the template nucleic acid is described. Figure 1 1 is a schematic diagram for explaining the outline of the template nucleic acid. The template nucleic acid 10 includes a promoter region 3, a coding region 2 encoding the amino acid sequence of the target protein, and a translation promoter 1. Since the translation promoter 1 has been explained, the promoter region 3 and the coding region 2 will be explained below.

[0058] As long as the promoter region 3 functions as a transcription start portion when performing gene transcription, the sequence is not particularly limited, and a promoter sequence known in the art can be adopted. As the sequence constituting the promoter region 3, known T7 promoter sequence, SP6 promoter sequence, T3 promoter sequence, etc. can be cited, but they are only illustrative and not limiting.

[0059] The coding region 2 is not particularly limited as long as it is a nucleic acid sequence encoding amino acids of a target protein and is operably linked via the promoter region 3 .

[0060] In addition, Figure 1In the example shown, the coding region 2 is linked immediately after the promoter region 3, but a sequence encoding a protein tag (C-terminal protein tag) may be linked to the promoter region 3 side of the coding region 2, and the protein tag (C-terminal protein tag) is attached to the target protein synthesized by the coding region 2. By including the protein tag sequence, the target protein can be synthesized as a tagged fusion protein. Similarly, a sequence encoding a protein tag (N-terminal protein tag) may be linked to the translation promoter 1 side of the coding region 2, and the protein tag (N-terminal protein tag) is attached to the target protein synthesized by the coding region 2. Only one of the C-terminal protein tag sequence and the N-terminal protein tag sequence may be linked, or both may be linked.

[0061] The C-terminal protein tag and the N-terminal protein tag include, for example, a His (polyhistidine) tag, a GST (glutathione S-transferase) tag, an MBP (maltose binding protein) tag, a myc tag, a FLAG tag, and a BCCP (biotin carboxyl carrier protein) tag. In addition, as visually detectable substances, for example, GFP (Green Fluorescent Protein), BFP (Blue Fluorescent Protein), CFP (Cyan Fluorescent Protein), RFP (Red Fluorescent Protein), YFP (Yellow Fluorescent Protein), EGFP (Enhanced Green Fluorescent Protein), ECFP (Enhanced Cyan Fluorescent Protein), ERFP (Enhanced Red Fluorescent Protein), EYFP (Enhanced Yellow Fluorescent Protein), TMR (TetraMethyl-Rhodamine), luciferase, etc. In addition, the above-mentioned C-terminal protein tag and N-terminal protein tag are only examples, and other protein tags may also be used.

[0062] Furthermore, the C-terminal protein tag sequence and the N-terminal protein tag sequence may be directly linked to the N-terminus and / or C-terminus of any protein sequence, or may be linked via an appropriate linker sequence.

[0063] Template nucleic acid is one of the elements used in the cell-free protein synthesis system described later. Template nucleic acid is a transcription template DNA, and can also be a translation template mRNA. In addition, the transcription template DNA can be a straight chain synthesized by PCR, etc., or a circular body such as a plasmid. When the template nucleic acid is a double-stranded DNA form that can be used in the cell-free protein synthesis system, when the sense strand has a poly-A sequence as a translation promoter, the antisense strand has a poly-T sequence accordingly. In addition, when the transcription template DNA and the translation template mRNA have a translation promoter, the translation promoter is provided at the 3' end side.

[0064] Template nucleic acid can be obtained by known chemical methods or genetic engineering methods, but it is preferred to obtain a gene or cDNA as a template by utilizing a nucleic acid amplification reaction such as PCR as described below. In addition, translation template mRNA can be obtained by a known method for synthesizing translation template mRNA applied to a two-step method, etc.

[0065] (Method for producing transcription template DNA)

[0066] The method for producing a transcription template DNA for a cell-free protein synthesis system may include: a step of synthesizing the transcription template DNA by subjecting a DNA containing a coding region of a target protein to a nucleic acid amplification reaction. The transcription template DNA may be obtained, for example, by subjecting a DNA containing a coding region to a nucleic acid amplification reaction by PCR using an appropriately designed primer set, the coding region encoding the amino acid sequence of the target protein.

[0067] In addition, the transcription template DNA can also be obtained using a vector. The template nucleic acid is obtained by inserting a DNA containing at least a coding region encoding the amino acid sequence of a protein into a vector. The vector prepared in this way can be used as the transcription template DNA itself, or a DNA fragment equivalent to the transcription template DNA can be cut out from the vector for use.

[0068] The transcription template DNA can be used in a cell-free protein synthesis system as a PCR reaction solution (that is, without purification of the transcription template DNA), or can be used in a cell-free protein synthesis system after being appropriately purified.

[0069] (Method for producing translation template mRNA)

[0070] The production method of the translation template for the cell protein synthesis system may include the following steps: in the absence of cells and in the presence of elements for transcribing the transcription template DNA into mRNA, the translation template mRNA is synthesized using the transcription template DNA. More specifically, for the transcription template DNA from the PCR reaction solution or the vector containing the transcription template DNA, the RNA polymerase and the RNA synthesis substrate (4 ribonucleoside triphosphates) suitable for the promoter region possessed by the transcription template DNA are incubated for a suitable time, for example, at about 20°C to 60°C, preferably at about 30°C to 42°C, under the composition containing the components required for the transcription reaction, thereby obtaining the translation template mRNA. In addition, the above example represents the step of synthesizing the translation template mRNA from the transcription template DNA. Alternatively, although it is also related to the length of the mRNA, the mRNA can be directly synthesized by nucleic acid synthesis.

[0071] The method for producing translation template mRNA can be implemented as a part of the transcription / translation system of the cell-free protein synthesis system, or can be implemented as a step before applying the translation template mRNA to the translation system. The translation template mRNA obtained in this way can be applied to the translation system as its reaction solution.

[0072] (Protein production method)

[0073] The method for producing protein may include the following steps: in the absence of cells and in the presence of elements for translating from translation template mRNA into protein, using translation template mRNA to synthesize protein. The method for producing protein may also include the following steps: in the absence of cells and in the presence of elements for transcribing transcription template DNA into mRNA, using transcription template DNA to synthesize translation template mRNA. Furthermore, the method for producing protein may also include: subjecting the DNA containing the coding region of the target protein to nucleic acid amplification reaction to synthesize the transcription template DNA. In the method for producing protein disclosed in the present application, protein synthesis can be effectively performed because translation template mRNA and transcription template DNA containing a translation promoter are used.

[0074] The following examples are given to specifically illustrate the embodiments disclosed in the present application, but these examples are only used to illustrate the embodiments and do not limit or restrict the scope of the invention disclosed in the present application.

[0075] [Example]

[0076] [Steps of Cell-free Protein Synthesis]

[0077] The cell-free protein synthesis steps in Examples are described.

[0078] (1) Structure of template DNA for transcription

[0079] Reference Figure 2 The following describes the outline of the transcription template DNA used in the Examples and Comparative Examples. Figure 2 As shown, the transcription template DNA consists of the following:

[0080] 5' untranslated region (5'UTR): T7 promoter 3, enhancer;

[0081] Coding region 2: CSF3 (Granulocyte colony-stimulating factor protein), Linker_C, FLAG tag;

[0082] • 3' untranslated region (3'UTR).

[0083] In the Examples and Comparative Examples described below, experiments were performed by replacing only the 3'UTR portion with various sequences. The sequences other than the 3'UTR portion are as follows.

[0084] [Table 1]

[0085]

[0086]

[0087] (2) Preparation of PCR-based transcription template DNA

[0088] Reference Figure 3 , the steps of preparing the transcription template DNA by PCR are described. Figure 3 Primers were designed as shown in Table 5, and a transcription template DNA was prepared by two-stage PCR. The reaction solution composition and procedure of PCR are shown below. In addition, the procedure shown in Table 5 is a special procedure when the primers shown in SEQ ID NOs. 30 and 31 are used.

[0089] [Table 2]

[0090] First PCR reaction solution

[0091] Reaction solution capacity 10× PCR buffer 5μl 2mM dNTPs 5μl <![CDATA[25mM MgSO4]]> 3μl 10 μM First_CSF3_F 1μl 10 μM First_CSF3_R 1μl Plasmid DNA 1μl PCR DNA polymerase 1μl Ultrapure water 33μl total 50μl

[0092] [Table 3]

[0093] Second PCR reaction solution

[0094]

[0095]

[0096] [Table 4]

[0097] First / Second PCR Program

[0098] [Table 5]

[0099] Second PCR 2-1, 2-2 dedicated program

[0100]

[0101] In addition, the reagents and equipment used are as follows.

[0102] PCR enzyme: KOD-Plus-Neo from Toyobo Co., Ltd.

[0103] Primers, artificial genes: Eurofin Genomics Co., Ltd. commissioned synthesis service

[0104] Thermal Cycler: Eppendorf, Mastecycler X50s

[0105] (3) Transcriptional response

[0106] Next, the prepared transcription template DNA was used to prepare translation template mRNA. The transcription reaction was performed at 37°C for 3 hours using the following reaction solution of PSS4050 manufactured by Neoprotein and 2 to 5 μl of the previously prepared second PCR reaction solution (containing the transcription template DNA).

[0107] [Table 6]

[0108]

[0109] Add 10 μl of 4M ammonium acetate to 25 μl of transcription reaction solution, mix thoroughly, then add 100 μl of 100% ethanol, invert and mix, centrifuge for a few seconds in a desktop centrifuge, and let stand at -20°C for 10 minutes. Then, centrifuge (12,000 rpm, 15 minutes, 4°C). After removing the supernatant, centrifuge for a few seconds in a desktop centrifuge. Remove the supernatant again and let stand until the precipitate is dry. Then, add 40 μl of RNase-free water (DEPC water) to 25 μl of transcription reaction solution, and fully suspend the precipitate with a chip. According to the PSS4050 protocol, the nucleic acid concentration is measured so that the amount of mRNA in 110 μl of translation solution is 35 μg, fill to 80 μl, and use it as a translation template mRNA solution.

[0110] (4) Translation reaction

[0111] Next, the translation reaction solution of the following composition was placed in an incubator at 16°C for 10 hours. In addition, a composition solution in which the translation template mRNA was removed from the following composition was prepared, and then the composition solution was returned to room temperature, and then the translation template mRNA was added and pumped in a manner that did not generate foam to allow the reaction. PSS4050 manufactured by New Protein Co., Ltd. was used for wheat germ extract and amino acid mix.

[0112] [Table 7]

[0113] Reaction solution capacity Wheat Germ Extract 10μl Amino Acid Mix 20μl mRNA solution 80μl total 110μl

[0114] After the reaction, the reaction solution was collected in an Eppendorf tube and centrifuged (15,000 rpm, 15 minutes, 4°C), and the supernatant was used as a protein solution after translation. The analysis procedure of the obtained protein expression level is as follows.

[0115] <Reagents used>

[0116] Gel: 4-15% Tris-Glycine gel (manufactured by Bio-Rad)

[0117] Membrane: 0.2 μm PVDF membrane (manufactured by Bio-Rad)

[0118] Primary antibody: FLAG antibody (mouse; manufactured by Wako Pure Chemical Industries, Ltd.)

[0119] Secondary antibody: goat anti mouse HRP antibody (manufactured by Southern Biotech)

[0120] Protein blotting luminescent reagent: SuperSignal West Pico (manufactured by Thermo Fisher Scientific)

[0121] <Analysis steps>

[0122] (1) 1 μL of the supernatant of the protein solution after translation, 2.5 μL of 4× sample buffer, 1 μL of 2M DTT, and 5.5 μL of ultrapure water were mixed to adjust the volume to 10 μL.

[0123] (2) Heat at 70°C for 10 minutes using a block heater.

[0124] (3) The heated sample is subjected to SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis).

[0125] (4) After SDS-PAGE, the gel and membrane were equilibrated with Toubin Buffer for 15 minutes.

[0126] (5) Electrophoretically transfer the proteins in the gel to the membrane using a semi-dry transcription device.

[0127] (6) Wash the membrane with ultrapure water for 2 minutes.

[0128] (7) The membrane was blocked with PBS + 2% skim milk + 0.05% Tween 20 for 30 minutes.

[0129] (8) Add antibodies to an appropriate amount of the skim milk solution in (7) to make the primary antibody (1:2000) and the secondary antibody (1:1000).

[0130] (9) The antibody solution was packed with a membrane and reacted at room temperature for 1 hour.

[0131] (10) After the reaction is completed, remove the membrane from the package and wash it with the buffer solution in (7) for 5 minutes x 3 times.

[0132] (11) Wash the membrane with ultrapure water for 2 minutes.

[0133] (12) Apply the luminescent reagent evenly on the membrane and leave it for 3 minutes.

[0134] (13) Using the chemiluminescence imaging system Fusion Solo 7S (manufactured by VILBER), the luminescence amount of the membrane was obtained as a three-dimensional image with an exposure time of 1 second.

[0135] [Examples 1-2, Comparative Examples 1-3]

[0136] (Evaluation of hairpin structure + poly A sequence)

[0137] (1) Structure of template DNA for transcription

[0138] As 3'UTR in Examples 1 to 2 and Comparative Examples 1 to 3, a transcription template DNA having the following sequence was used. The specific sequence is shown in Table 8.

[0139] Name 1-1 (Comparative Example 1): Poly A sequence (length 10) + nucleic acid sequence (length 47, with hairpin structure)

[0140] Name 1-2 (Comparative Example 2): First region (length 20, no hairpin structure) + poly A sequence (length 10)

[0141] Name 1-3 (Comparative Example 3): First region (length 20, no hairpin structure) + poly A sequence (length 10)

[0142] Name 1-4 (Example 1): first region (length 20, with hairpin structure) + poly A sequence (length 10)

[0143] Name 1-5 (Example 2): first region (length 20, with hairpin structure) + poly A sequence (length 10)

[0144] [Table 8]

[0145] name Sequence of 3′UTR (5′ to 3′ terminator + UTR 20_fold + poly A 10) Serial Number 1-1 (Comparative Example 1) TAA AAAAAAAAAA GAGCTCTTGG ATCCGGCCAT AAGGGCCTGA TCCTTCGAGG GGGGGCC 6 1-2 (Comparative Example 2) TAG AATAA GGCCATTTTTACCGG AAAAAAAAA 7 1-3 (Comparative Example 3) TAG AATAA GGCCCTTTTTTCCCGG AAAAAAAAAA 8 1-4 (Example 1) TAG AATAA GTGCTCGGGCtGGCC AAAAAAAAAA 9 1-5 (Example 2) TAG AATAA GTGCTCGGGCtGGtC AAAAAAAAAA 10

[0146] in addition, Figure 4 The structures of the 3'UTR sequences of Examples 1 to 2 and Comparative Examples 1 to 3 were analyzed using CentroidFold (http: / / rtools.cbrc.jp / centroidfold / ), a secondary structure prediction software for mRNA.

[0147] (2) Comparison of protein synthesis

[0148] According to the above-mentioned [Procedure of Cell-free Protein Synthesis], proteins were synthesized using the transcription template DNA of Examples 1 to 2 and Comparative Examples 1 to 3. The primers used are as follows. In addition, regarding the "second reverse primer (2nd Reverseprimer) CR2", different primers were used according to Examples 1 to 2 and Comparative Examples 1 to 3, and the same primers were used for the other primers.

[0149] [Table 9]

[0150] First gene-specific PCR primer 10 μM

[0151] name sequence Serial Number CSF3_CF CACAAAACAT TTCCCTACAT ACAACTTTCA ACTTCCTATT ATGGCTGGAC CTGCCACC 11 CSF3_CR AGTACCTCCC TGCTGGAGAC CGGGCTGGGC AAGGTGGCG 12

[0152] Second reverse primer CR1 100nM

[0153]

[0154]

[0155] Second reverse primer CR2 10 μM

[0156] name sequence Serial Number CR2 1-1 GGCCCCCCCTCGAAGG 15 CR2 1-2 TTTTTTTTTT CCGGTAAAAATGGCC TTATT CTACTTGTCA TCG 16 CR2 1-3 TTTTTTTTTT CCGGGAAAAAGGGCC TTATT CTACTTGTCA TCG 17 CR2 1-4 TTTTTTTTT GGCCAGCCCG AGCACTTATT CTACTTGTCA TCG 18 CR2 1-5 TTTTTTTTT GACCAGCCCG AGCACTATT CTACTTGTCA TCG 19

[0157] Second forward primer CF1 10 μM

[0158] name sequence Serial Number CF1 CCCGCGAAATTAATACGACTCACTATAGGGGCTCACCTATCTCTCTACACAAAACATTTCC 20

[0159] Figure 5 It is a three-dimensional image showing the expression levels of proteins in Examples 1 to 2 and Comparative Examples 1 to 3. Figure 5 It can be seen that in the cases of Comparative Examples 2 and 3 where the first region of the 3′UTR did not have a hairpin structure, the protein expression level was approximately the same as that of Comparative Example 1. On the other hand, when the first region of the 3′UTR had a hairpin structure and a poly A sequence was provided after the first region, the protein expression level was significantly increased.

[0160] In addition, Comparative Example 1 corresponds to "A10+47bp" in which the protein expression level is most improved in Example 7 (FIG. 18) of Patent Document 6, and Figure 4 The hairpin structure is shown. However, the order of the first region and the second region of the translation promoter disclosed in the present application is reversed, and as a result, the expression amount of the protein is reduced. Based on the above results, it is confirmed that the first region has a hairpin structure, and the second region composed of a poly A sequence is formed on the 3' end side of the first region having a hairpin structure, which has the effect of significantly increasing the amount of protein synthesis.

[0161] [Examples 3 to 5, Comparative Example 4]

[0162] (Study of the length of the first area)

[0163] Next, the relationship between the length of the first region and the protein expression level was studied.

[0164] (1) Structure of template DNA for transcription

[0165] As 3'UTR in Examples 3 to 5 and Comparative Example 4, a transcription template DNA having the following sequence was used. The specific sequence is shown in Table 10.

[0166] Name 2-1 (Comparative Example 4): First region (length 0) + poly A sequence (length 10)

[0167] Name 2-2 (Example 3): First region (length 10) + poly A sequence (length 10)

[0168] Name 2-3 (Example 4): First region (length 30) + poly A sequence (length 10)

[0169] Name 2-4 (Example 5): First region (length 40) + poly A sequence (length 10)

[0170] [Table 10]

[0171] name Sequence of 3′UTR (5′ to 3′ terminator + first region 0-40 + poly A 10) Serial Number 2-1 (Comparative Example 4) TAG AAAAAAAAAA 21 2-2 (Example 3) TAG AATAA GTGCT AAAAAAAAAA 22 2-3 (Example 4) TAG AATAA AGTAA ATATA GTGCTCGGGCGGGCC AAAAAAAAAA 23 2-4 (Example 5) TAG AATAA AGTAA ATATA CACGAGCCCG GTGCTCGGGCGGGCC AAAAAAAAA 24

[0172] in addition, Figure 6 The structures of the 3′UTR sequences of Examples 3 to 5 were analyzed using the mRNA secondary structure prediction software CentroidFold (http: / / rtools.cbrc.jp / centroidfold / ). Figure 6 As shown, although the lengths of the first regions of Examples 3 to 5 are different, they all have a hairpin structure.

[0173] (2) Comparison of protein synthesis

[0174] According to the above-mentioned [Procedure for Cell-free Protein Synthesis], proteins were synthesized using the transcription template DNAs of Examples 3 to 5 and Comparative Example 4. The primers used are shown below. Sequences with the same sequence number mean the same sequence.

[0175] [Table 11]

[0176] First gene-specific PCR primer 10 μM

[0177]

[0178]

[0179] Second reverse primer CR1 100nM

[0180]

[0181] Second reverse primer CR2 10 μM

[0182]

[0183] Second forward primer CF1 10 μM

[0184] name sequence Serial Number CF1 CCCGCGAAATTAATACGACTCACTATAGGGCTCACCTATCTCTCTACACAAAACATTTCC 20

[0185] Figure 7 It is a three-dimensional image showing the expression levels of proteins in Examples 3 to 5 and Comparative Example 4. Figure 7 It can be seen that, compared with Comparative Example 4 (2-1) in which the length of the first region of the 3′UTR is 0 (no hairpin structure), the protein expression level is also increased in any case where the length of the nucleic acid in the first region is 10 (2-2, Example 3), 30 (2-3, Example 4), and 40 (2-5, Example 5). From the above results, it can be seen that the length of the first region can be appropriately adjusted within the range in which a hairpin structure can be formed.

[0186] [Examples 6 to 9, Comparative Example 5]

[0187] (Study on the length of poly A sequences)

[0188] Next, the relationship between the length of the poly A sequence and the protein expression level was studied.

[0189] (1) Structure of template DNA for transcription

[0190] As 3'UTR in Examples 6 to 9 and Comparative Example 5, a transcription template DNA having the following sequence was used. The specific sequence is shown in Table 12.

[0191] Name 3-1 (Comparative Example 5): First region (length 20) + poly A sequence (length 0)

[0192] Name 3-2 (Example 6): First region (length 20) + poly A sequence (length 10)

[0193] Name 3-3 (Example 7): First region (length 20) + poly A sequence (length 20)

[0194] Name 3-4 (Example 8): First region (length 20) + poly A sequence (length 40)

[0195] Name 3-5 (Example 9): First region (length 20) + poly A sequence (length 2)

[0196] [Table 12]

[0197] name Sequence of 3′UTR (5′ to 3′ terminator + first region 20_fold + poly A 0-40) Serial Number 3-1 (Comparative Example 5) TAG AATAA GTGCTCGGGCGGGCC 33 3-2 (Example 6) TAG AATAA GTGCTCGGGCGGGCC AAAAAAAAAA 34 3-3 (Example 7) TAG AATAA GTGCTCGGGCGGGCC AAAAAAAAAA AAAAAAAAAA 35 3-4 (Example 8) TAG AATAA GTGCTCGGGCGGCC AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA 36 3-5 (Example 9) TAG AATAA GTGCTCGGGCGGGCC AA 37

[0198] in addition, Figure 8 The structures of the 3′UTR sequences of Examples 6 to 9 and Comparative Example 5 were analyzed using the mRNA secondary structure prediction software CentroidFold (http: / / rtools.cbrc.jp / centroidfold / ). Figure 8 As shown, the first region used in Examples 6 to 9 and Comparative Example 5 has a hairpin structure.

[0199] (2) Comparison of protein synthesis

[0200] According to the above-mentioned [Procedure for Cell-free Protein Synthesis], proteins were synthesized using the transcription template DNAs of Examples 6 to 9 and Comparative Example 5. The primers used are shown below. In addition, sequences with the same sequence number mean the same sequence.

[0201] [Table 13]

[0202] First gene-specific PCR primer 10 μM

[0203] name sequence Serial Number CSF3_CF CACAAAACAT TTCCCTACAT ACAACTTTCA ACTTCCTATT ATGGCTGGAC CTGCCACC 11 CSF3_CR AGTACCTCCC TGCTGGAGAC CGGGCTGGGC AAGGTGGCG 12

[0204] Second reverse primer CR1 100nM

[0205] name sequence Serial Number CR1_U20 GGCCCTCCCG AGCACTTATTCTACTTGTCA TCGTCATCCT TGTAGTCAGT ACCTCCCTGC TGG <![CDATA[ 14 ]]>

[0206] Second reverse primer CR2 10 μM

[0207]

[0208]

[0209] Second forward primer CF1 10 μM

[0210] name sequence Serial Number CF1 CCCGCGAAATTAATACGACTCACTATAGGGCTCACCTATCTCTCTACACAAAACATTTCC 20

[0211] Fig. 9 It is a three-dimensional image showing the expression levels of proteins in Examples 6 to 8 and Comparative Example 5. Fig. 9 It can be seen that for the poly A sequence linked to the first region, when the length of poly A is 10 (3-2, Example 6), the expression level of the protein increases, and as the length of poly A increases, the expression level of the protein slowly decreases. However, when the length of poly A is between 10 and 40, the expression level of the protein is greater than that of Comparative Example 5 (3-1, the length of poly A is 0).

[0212] then, Fig.10 is a three-dimensional image showing the protein expression levels in Example 9 (3-5, 2 poly A) and Comparative Example 5. Fig.10 It is known that even when two A's are linked after the first region, the expression level of the protein is increased compared to Comparative Example 5 in which the poly A is 0. Therefore, the length of the poly A can be appropriately adjusted to 2 or more.

[0213] From the above results, it can be seen that when the first region having a hairpin structure is combined with a poly A sequence to prepare a translation promoter, two or more poly A sequences are sufficient, and the upper limit of the poly A sequence can be appropriately selected in consideration of the design efficiency of the template nucleic acid, etc.

[0214] Industrial Applicability

[0215] The translation promoter disclosed in the present application can increase the amount of protein synthesized using a cell-free protein synthesis system, and is therefore useful in industries requiring cell-free protein synthesis, such as the pharmaceutical industry and research institutions. Sequence Listing <110> New Protein Co., Ltd. <120> Translation enhancers <130> M19072PCT <160> 42 <170> PatentIn Version 3.5 <210> 1 <211> 27 <212> DNA <213> Artificial sequence <220> <223> T7 promoter <400> 1 cccgcgaaat taatacgact cactata 27 <210> 2 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Enhancer <400> 2 gggctcacct atctctctac acaaaacatt tccctacata caactttcaa cttcctatt 59 <210> 3 <211> 621 <212> DNA <213> Artificial sequence <220> <223> CSF3 <400> 3 atggctggac ctgccaccca gagccccatg aagctgatgg ccctgcagct gctgctgtgg 60 cacagtgcac tctggacagt gcaggaagcc acccccctgg gccctgccag ctccctgccc 120 cagagcttcc tgctcaagtg cttagagcaa gtgaggaaga tccagggcga tggcgcagcg 180 ctccaggaga agctggtgag tgagtgtgcc acctacaagc tgtgccaccc cgaggagctg 240 gtgctgctcg gacactctct gggcatcccc tgggctcccc tgagcagctg ccccagccag 300 gccctgcagc tggcaggctg cttgagccaa ctccatagcg gccttttcct ctaccagggg 360 ctcctgcagg ccctggaagg gatctccccc gagttgggtc ccaccttgga cacactgcag 420 ctggacgtcg ccgactttgc caccaccatc tggcagcaga tggaagaact gggaatggcc 480 cctgccctgc agcccaccca gggtgccatg ccggccttcg cctctgcttt ccagcgccgg 540 gcaggagggg tcctggttgc ctcccatctg cagagcttcc tggaggtgtc gtaccgcgtt 600 ctacgccacc ttgcccagcc c 621 <210> 4 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Adapter_C <400> 4 ggactccagc agggaggtac t 21 <210> 5 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Label tag <400> 5 gactacaagg atgacgatga caag 24 <210> 6 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 6 taaaaaaaaa aaagagctct tggatccggc cataagggcc tgatccttcg aggggggggcc 60 <210> 7 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 7 tagaataagg ccatttttac cggaaaaaaa aaa 33 <210> 8 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 8 tagaataagg ccctttttcc cggaaaaaaa aaa 33 <210> 9 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 9 tagaataagt gctcgggctg gccaaaaaaa aaa 33 <210> 10 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 10 tagaataagt gctcgggctg gtcaaaaaaa aaa 33 <210> 11 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 11 cacaaaacat ttccctacat acaactttca acttcctatt atggctggac ctgccacc 58 <210> 12 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 12 agtacctccc tgctggagac cgggctgggc aaggtggcg 39 <210> 13 <211> 94 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 13 ccctcgaagg atcaggccct tatggccgga tccaagagct cttttttttt tttacttgtc 60 atcgtcatcc ttgtagtcag tacctccctg ctgg 94 <210> 14 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 14 ggccctcccg agcacttatt ctacttgtca tcgtcatcct tgtagtcagt acctccctgc 60 tgg 63 <210> 15 <211> 16 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 15 ggccccccct cgaagg 16 <210> 16 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 16 tttttttttt ccggtaaaaa tggccttat ctacttgtca tcg 43 <210> 17 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 17 tttttttttt ccgggaaaaa gggccttat ctacttgtca tcg 43 <210> 18 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 18 tttttttttt ggccagcccg agcacttatt ctacttgtca tcg 43 <210> 19 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 19 tttttttttt gaccagcccg agcacttatt ctacttgtca tcg 43 <210> 20 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 20 cccgcgaaat taatacgact cactataggg ctcacctatc tctctacaca aaacatttcc 60 <210> twenty one <211> 13 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> twenty one tagaaaaaaa aaa 13 <210> twenty two <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> twenty two tagaataagt gctaaaaaaa aaa 23 <210> twenty three <211> 43 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> twenty three tagaataaag taaatatagt gctcgggcgg gccaaaaaaa aaa 43 <210> twenty four <211> 53 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> twenty four tagaataaag taaatataca cgagcccggt gctcgggcgg gccaaaaaaa aaa 53 <210> 25 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 25 tcatccttgt agtcagtacc tccctgctgg agaccgggct gggcaaggtg gcg 53 <210> 26 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 26 ctacttgtca tcgtcatcct tgtagtcagt acctccctgc tgg 43 <210> 27 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 27 agcacttatt ctacttgtca tcgtcatcct tgtagtcagt acctccctgc tgg 53 <210> 28 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 28 ggccctcccg agcactatat ttactttatt ctacttgtca tcgtcatcct tgtagtc 57 <210> 29 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 29 ggccctcccg agcaccgggc tcgtgtatat ttactttat ctacttgtca tcgtcatcct 60 tgtagtc 67 <210> 30 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 30 tttttttttt ctacttgtca tcgtc 25 <210> 31 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Primers <400> 31 tttttttttt agcacttatt cta 23 <210> 32 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 32 tttttttttt ggcccgcccg agcac 25 <210> 33 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 33 tagaataagt gctcgggcgg gcc 23 <210> 34 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 34 tagaataagt gctcgggcgg gccaaaaaaa aaa 33 <210> 35 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 35 tagaataagt gctcgggcgg gccaaaaaaa aaaaaaaaaa aaa 43 <210> 36 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 36 tagaataagt gctcgggcgg gccaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 60 aaa 63 <210> 37 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Artificial 3'UTR <400> 37 tagaataagt gctcgggcgg gccaa 25 <210> 38 <211> 15 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 38 ggcccgcccg agcac 15 <210> 39 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 39 tttttttttt ggcccgcccg agcac 25 <210> 40 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 40 tttttttttt tttttttttt ggcccgcccg agcac 35 <210> 41 <211> 55 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 41 tttttttttt tttttttttt tttttttttt tttttttttt ggcccgcccg agcac 55 <210> 42 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 42 ttggcccgcc cgagcac 17

Claims

1. A translation promoter, wherein the translation promoter is a translation promoter in a cell-free protein synthesis system, wherein The translation promoter is composed of a nucleic acid as a 3' untranslated region, and the 3' untranslated region is adjacent to the 3' end of the coding region encoding the amino acid sequence of the target protein. The 3' untranslated region is composed of a first region and a second region, The first region is adjacent to the 3' end of the coding region and is composed of 10 to 40 nucleic acid sequences; The second region is linked to the first region and is composed of a poly-A sequence of 2 to 20 consecutive A's. The first region has a hairpin structure.

2. A template nucleic acid for use in a cell-free protein synthesis system, the template nucleic acid comprising: Promoter region; a coding region encoding an amino acid sequence of a target protein operably linked via the promoter region; as well as The 3' untranslated region of the coding region is composed of the translation promoter according to claim 1.

3. The template nucleic acid according to claim 2, wherein The coding region is a region that encodes a fusion protein including a protein tag at the C-terminus of an arbitrary protein as the target protein.

4. The template nucleic acid according to claim 2, wherein The coding region is a region that encodes a fusion protein including a protein tag at the N-terminus of an arbitrary protein as the target protein.

5. The template nucleic acid according to claim 3, wherein The coding region is a region that encodes a fusion protein including a protein tag at the N-terminus of any protein as the target protein.

6. The template nucleic acid according to any one of claims 2 to 5, wherein The template nucleic acid is a transcription template DNA.

7. The template nucleic acid according to any one of claims 2 to 5, wherein The template nucleic acid is a translation template mRNA.

8. A method for producing a translation template for use in a cell-free protein synthesis system, the method comprising the following steps: In the absence of cells and in the presence of elements for transcribing a transcription template DNA into mRNA, a translation template mRNA is synthesized using the template nucleic acid according to any one of claims 2 to 6.

9. A method for producing a protein, comprising the following steps: In the absence of cells and in the presence of elements for translating the translation template mRNA into protein, protein is synthesized using the template nucleic acid according to claim 7.

Images