Compositions and Methods for Improving Mitochondrial Function

Abstract

The present invention provides compositions comprising a compound or a compound precursor, which can be used for a variety of therapeutic uses, including, for example, treating and / or preventing diseases or disorders associated with decreased or insufficient mitochondrial activity, including aging or stress, diabetes, obesity, and neurodegenerative diseases. The compounds generally refer to urolithins and their precursors, including, but not limited to, ellagitannins and urolithin A. These same compounds and compositions can also be advantageously used in generally healthy individuals to increase or maintain the metabolic rate, reduce the body fat percentage, increase or maintain muscle mass, control body weight, improve or maintain intellectual performance (including memory), improve or maintain muscle performance, improve or maintain mood, and control stress.

Description

[0001] This application is a divisional application of the patent application for invention titled "Compositions and Methods for Improving Mitochondrial Function" with the application date of December 1, 2015 and the application number of 201510862701.0.

[0002] Related Applications

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 61 / 426,957, filed on December 23, 2010, under 35 U.S.C. § 119(e). Technical Field

[0004] The present invention relates to the use of ellagic acid in the preparation of a medicament for treating or preventing a mitochondrial function-related disorder selected from obesity, decreased metabolic rate, metabolic syndrome, diabetes, neurodegenerative diseases, cognitive disorders, mood disorders, stress, and anxiety disorders; for body weight control related to mitochondrial function; or for increasing muscle performance or intellectual performance related to mitochondrial function. Background Art

[0005] Ellagitannin is a monomeric polyphenol, oligomeric polyphenol, and polymeric polyphenol that is rich in certain fruits, berries, and nuts such as pomegranates, raspberries, strawberries, black raspberries, walnuts, and almonds. Fruits and berries are widely consumed fresh and as beverages such as fruit juices, and they have been reported to promote health.

[0006] In commercial juice processing methods, ellagitannins, which are particularly abundant in certain fruit peels, are extracted in large amounts into the juice. Ellagitannins belong to the chemical class of hydrolysable tannins, which upon hydrolysis release ellagic acid. In vitro studies have suggested that ellagitannins in the concentration range of 10 - 100 micromoles (μM) have potential antioxidant, anti-atherosclerotic, antithrombotic, anti-inflammatory and anti-angiogenic effects. Fruits may have different ellagitannins (e.g., those that predominate in juice prepared from pomegranates), and the predominant ellagitannin is punicalagin [2,3 - hexahydroxydiphenoyl - 4,6 - gallagyl glucose], which exists as a mixture of isomers. The reported potent antioxidant properties of pomegranate juice have been attributed to the high content of punicalagin isomers, which can reach levels of >2 g / L of juice. Ellagitannins have also been identified as anti-atherosclerotic active compounds in pomegranate juice. It has also been proposed that pomegranate ellagitannins and pomegranate fruit extracts inhibit the proliferation of human cancer cells and modulate inflammatory subcellular signaling pathways and apoptosis. See, e.g., Seeram et al. (2005) J Nutr Biochem. 16:360 - 7; Adams et al. (2006) J Agric Food Chem. 54:980 - 85; Afaq et al. (2005) Photochem Photobiol. 81:38 - 45; Afaq et al. (2005) Int J Cancer. 113:423 - 33. It has also been reported that pomegranate fruit extracts reduce prostate tumor growth and prostate specific antigen (PSA) levels in athymic nude mice implanted with CWR22Rv1 prostate cells. Malik et al. (2005) Proc Natl Acad Sci. 102:14813 - 8.

[0007] Unfortunately, ellagitannins are generally poorly absorbed by the human intestine. However, many metabolites derived from ellagitannins are absorbed by the human intestine, including certain metabolites ultimately formed in the intestine by commensal microorganisms (i.e., the gut microbiota).

[0008] Ellagitannins release ellagic acid under in vivo physiological conditions, and ellagic acid is then gradually metabolized by the gut microbiota in the intestine to produce urolithin D, urolithin C, urolithin A (UA) and urolithin B (UB). Once these metabolites are absorbed, they undergo glucuronidation, and once they enter the liver, they are further metabolized to produce glucuronides and / or sulfates, resulting in a combination of metabolites secreted in the bile.

[0009] Urolithins are metabolites of ellagic acid, punicalagin (PA), punicalin (PB), tellimagrandin (TL), and other ellagitannins (Cerda, Espin et al. 2004; Cerda, Periago et al. 2005). Ellagic acid (EA) is rich in pomegranate juice (Gil, Tomas-Barberan et al. 2000). The ellagitannin tellimagrandin (TL) has been previously isolated and characterized from pomegranates and other plants (Tanaka, Nonaka et al. 1986; Tanaka, Nonaka et al. 1986; Satomi, Umemura et al. 1993). The chemical structures of UA, PA, PB, EA, and TL are shown in Figure 1 below.

[0010] Considerable work has been done to understand the mechanisms of metabolic disorders, neurodegeneration, and cognitive decline in order to better design therapeutic modalities, including those based on natural products. One of the key findings is the impact of diminished mitochondrial energy production (corresponding to increased oxidative stress and apoptosis), which plays an important role in degenerative diseases and the aging process. It has now been established that a variety of degenerative diseases are caused by mutations in mitochondrial genes encoded by mitochondrial DNA (mtDNA) or nuclear DNA (nDNA). Importantly, somatic mtDNA mutations accumulate with age in post-mitotic tissues, which are associated with the age-related decline in mitochondrial function, and are considered an important factor in aging and senescence. Genetic diseases can result from mtDNA base substitution and rearrangement mutations and can affect the central nervous system (CNS), myocardium and skeletal muscle, as well as the kidney, endocrine, and blood systems.

[0011] Mitochondria produce most of the cell's energy through oxidative phosphorylation (OXPHOS), and they produce most of the toxic reactive oxygen species (ROS) as a byproduct. Genetic defects that inhibit OXPHOS also cause the redirection of OXPHOS electrons towards ROS production, thereby increasing oxidative stress. The decline in mitochondrial energy production and the increase in oxidative stress can affect the mitochondrial permeability transition pore (mtPTP) to initiate programmed cell death (apoptosis). The interaction of these three factors is thought to play an important role in the pathophysiology of degenerative diseases and the aging process that affects all tissues of the body.

[0012] In a normal brain, optimal cognitive function depends mainly on neuronal activity and communication between neurons, with highly complex cells capable of transmitting electrical signals and causing chemical neurotransmission. Neuronal function depends on long and complex cellular processes that can extend several centimeters or even meters to connect neurons or target cells and can make more than 100,000 synaptic contacts. Thus, neurons are highly dependent on energy supply and are therefore exposed to oxidative stress damage. Cognitive function depends on a delicate balance of intracellular signaling occurring within the complex network of neurons. Optimal cognitive function can be impaired by numerous factors such as aging, cellular stress, chronic stress, and neurodegenerative disorders. Cognitive decline can be characterized by a decrease in the ability to think, learn, remember, be alert, and / or impaired psychological skills, as well as by depression and anxiety.

[0013] It has also been demonstrated that mitochondrial function is important in metabolic disorders. Diabetes and obesity have been associated with impaired mitochondrial function. It has been proposed that the coupling efficiency of mitochondria or the proportion of oxygen consumption required to produce ATP is related to the level of obesity, with high coupling efficiency potentially leading to a greater deposition of fat stores (Harper, Green et al. 2008). In diabetes, recent work has suggested that mitochondrial dysfunction is the cause of insulin insensitivity in muscle cells and adipocytes, stemming from either insufficient energy supply or defects in the insulin signaling pathway (Wang, Wang et al. 2010). Summary of the Invention

[0014] The present invention relates to compositions comprising a compound or a compound precursor that can be used for a variety of therapeutic uses, including, for example, treating and / or preventing diseases or disorders associated with decreased or insufficient mitochondrial activity, including aging or stress, diabetes, obesity, and neurodegenerative diseases. These same compounds and compositions can also be advantageously used in generally healthy individuals to increase or maintain metabolic rate, reduce body fat percentage, increase or maintain muscle mass, control body weight, improve or maintain intellectual performance (including memory), improve or maintain muscle performance, improve or maintain mood, and control stress.

[0015] An object of the present invention provides a plant extract, an active fraction thereof, or one or more active components or metabolites isolable or synthetic therefrom for preventing or treating a disease state that begins with or is characterized by: (i) insufficient mitochondrial activity; (ii) metabolic disorders such as diabetes and obesity; (iii) cognitive decline; or (iv) mood disorders.

[0016] Accordingly, in a first aspect, the present invention provides a fruit extract, an active fraction thereof, or one or more active components isolable therefrom that is used as a mitochondrial function inducer.

[0017] As used herein, the term "fraction" refers to a purified or partially purified extract.

[0018] In another aspect, the present invention provides a fruit extract, an active fraction thereof, or one or more active components isolable therefrom for preventing or treating a disease state that begins with or is characterized by a decline in mitochondrial function.

[0019] In another aspect, the present invention provides the use of a fruit or extract as defined above, or an active fraction thereof, or one or more active components isolable therefrom for the preparation of a medicament for: (i) preventing or treating a disease state that begins with or is characterized by a decline in mitochondrial function; or (ii) improving cognitive or muscle function. Such disease states may include, but are not limited to, neurodegenerative diseases, cognitive impairments, mood disorders, anxiety disorders, metabolic disorders, diabetes, and obesity.

[0020] In another aspect, the present invention provides a method for preparing a medicament for: (i) preventing or treating a disease state that begins with or is characterized by a decline in mitochondrial function; or (ii) improving cognitive or muscle function; the method being characterized in that a fruit as defined above, or an extract or active fraction thereof, or one or more active components isolable therefrom is used as an essential ingredient of the medicament.

[0021] In another aspect, the present invention provides a pharmaceutical composition comprising an active component and a pharmaceutically acceptable carrier, the active component being derived from a fruit or extract or active fraction as defined above, or one or more active components isolable therefrom.

[0022] An object of the present invention is to provide a plant extract, an active fraction thereof, or one or more active components or metabolites isolable or synthetic therefrom for treating a disease or disorder in a subject that would benefit from increased mitochondrial activity, for (i) improving brain function, (ii) improving metabolic function, including diabetes or obesity, (iii) improving muscle performance, and (iv) increasing tissue ATP levels.

[0023] An object of the present invention is to provide extracts, compositions, and compounds that are neuroprotective, neurotrophic, and / or promote neurite outgrowth and thereby improve cognitive function, as well as methods of using such compounds and compositions.

[0024] One object of the present invention is to provide compounds and compositions for improving, protecting and maintaining brain function and cognition. Another object of the present invention is to improve, control mood disorders and protect against mood disorders. Another object of the present invention is to protect against stress-induced or stress-related disorders or symptoms.

[0025] One object of the present invention is to provide neuroprotective compounds for protecting the brain from injury and improving cognitive performance and memory in normal adults. Another object of the present invention is to provide new compounds that stimulate neuronal plasticity. It is well known that neuronal plasticity is a key process necessary for memory and cognitive function. Such compounds can affect the neurite growth halo, the number of branches per cell, the mean processes per cell and even the number of synapses formed.

[0026] The present invention also relates to several polyphenolic compounds and their derivatives related to ellagitannins (bioactive natural compounds found in pomegranates and other fruits), and bioactive natural extracts containing these compounds. These compounds include ellagitannins, punicalagin and ellagic acid, all of which are present in pomegranates but can also be isolated from other fruits and berries, as well as metabolites of these compounds. As disclosed herein, it has now been demonstrated that these compounds have beneficial effects on (i) mitochondrial function, (ii) cell metabolism and (iii) neuronal plasticity.

[0027] The beneficial effects of different compounds were tested using in vitro modeling of neurite growth halo and process formation in neuronal cell cultures and primary cells. As mentioned above, aging, neurodegeneration and chronic stress have a negative impact on the neurite growth halo. Notably, it has been found that the compounds of the present invention have neuroprotective properties, exhibit strong stimulatory activity in PC-12 cells and primary midbrain neurons, and improve cognitive function and memory in animal models.

[0028] In one aspect, the present invention relates to compositions, such as pharmaceuticals, comprising the compounds of the present invention or mixtures thereof. The compositions may also optionally contain additional therapeutic agents or may be administered in combination with other therapeutic compounds. Also provided is a packaged product containing the above composition and a label and / or instructions regarding the use for improving memory and cognitive performance and / or for treating diseases or disorders related to typical brain injuries found in the elderly.

[0029] One aspect of the present invention is a medicament comprising an effective amount of pomegranate extract, which is used for treating or preventing a disease selected from the following: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0030] One aspect of the present invention is a medicament comprising an effective amount of ellagitannin, which is used for treating or preventing a disease selected from the following: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0031] One aspect of the present invention is a medicament comprising an effective amount of punicalagin, which is used for treating or preventing a disease selected from the following: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0032] One aspect of the present invention is a medicament comprising an effective amount of ellagic acid, which is used for treating or preventing a disease selected from the following: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0033] One aspect of the present invention is a medicament comprising an effective amount of urolithin, which is used for treating or preventing a disease selected from the following: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0034] In each of the foregoing aspects, in one embodiment, the disease is obesity.

[0035] In each of the foregoing aspects, in one embodiment, the disease is decreased metabolic rate.

[0036] In each of the foregoing aspects, in one embodiment, the disease is metabolic syndrome.

[0037] In each of the foregoing aspects, in one embodiment, the disease is diabetes.

[0038] In each of the foregoing aspects, in one embodiment, the disease is cardiovascular disease.

[0039] In each of the foregoing aspects, in one embodiment, the disorder is hyperlipidemia.

[0040] In each of the foregoing aspects, in one embodiment, the disorder is a neurodegenerative disease.

[0041] In each of the foregoing aspects, in one embodiment, the disorder is a cognitive disorder.

[0042] In each of the foregoing aspects, in one embodiment, the disorder is a mood disorder.

[0043] In each of the foregoing aspects, in one embodiment, the disorder is stress.

[0044] In each of the foregoing aspects, in one embodiment, the disorder is an anxiety disorder.

[0045] In each of the foregoing aspects, in one embodiment, the drug is for weight control.

[0046] In each of the foregoing aspects, in one embodiment, the drug is for increasing muscle performance.

[0047] In each of the foregoing aspects, in one embodiment, the drug is for increasing intellectual performance.

[0048] One aspect of the present invention is a method of increasing or maintaining mitochondrial function. The method comprises the step of contacting a cell with an effective amount of urolithin or a precursor thereof to increase the function of the mitochondria.

[0049] One aspect of the present invention is a method of treating, preventing, or controlling mitochondrial-related diseases or disorders associated with altered mitochondrial function or decreased mitochondrial density. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat a disease or disorder associated with altered mitochondrial function or decreased mitochondrial density.

[0050] One aspect of the present invention is a method of increasing the metabolic rate. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to increase the metabolic rate.

[0051] One aspect of the present invention is a method of preventing or treating metabolic syndrome. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to prevent or treat metabolic syndrome.

[0052] One aspect of the present invention is a method of preventing or treating obesity. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to prevent or treat obesity.

[0053] One aspect of the present invention is a method for preventing or treating cardiovascular diseases. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or its precursor to prevent or treat cardiovascular diseases.

[0054] One aspect of the present invention is a method for treating hyperlipidemia. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or its precursor to treat hyperlipidemia. In one embodiment, the hyperlipidemia is hypertriglyceridemia. In one embodiment, the hyperlipidemia is elevated free fatty acids.

[0055] One aspect of the present invention is a method for treating metabolic disorders. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or its precursor to treat metabolic disorders. In one embodiment, the metabolic disorder is diabetes. In one embodiment, the metabolic disorder is obesity.

[0056] One aspect of the present invention is a method for treating neurodegenerative diseases. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat a neurodegenerative disease. In one embodiment, the neurodegenerative disease is selected from: AIDS dementia complex, Alzheimer’s disease, amyotrophic lateral sclerosis, adrenoleukodystrophy, Alexander disease, Alper’s disease, ataxia telangiectasia, Battendisease, bovine spongiform encephalopathy,BSE), Canavan disease, corticobasal degeneration, Creutzfeldt-Jakob disease, dementia with Lewy bodies, fatal familial insomnia, frontotemporal lobar degeneration, Huntington’s disease, Kennedy’s disease, Krabbe disease, Lyme disease, Machado-Joseph disease, multiple sclerosis, multiple system atrophy, neuroacanthocytosis, Niemann-Pick disease, Parkinson’s disease, Pick’s disease, primary lateral sclerosis, progressive supranuclear palsy, Refsum disease, Sandhoff disease, diffuse myelinoclastic sclerosis, spinocerebellar ataxia, subacute combined degeneration of spinal cord, tabes dorsalis, Tay-Sachs disease, toxic encephalopathy, transmissible spongiform encephalopathy, and wobbly hedgehog syndrome. In one embodiment, the neurodegenerative disease is selected from: Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease, and Parkinson's disease. In one embodiment, the neurodegenerative disease is Alzheimer's disease.,

[0057] One aspect of the present invention is a method for improving cognitive function. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to improve cognitive function. In one embodiment, the cognitive function is selected from: perception, memory, attention, speech comprehension, speech production, reading comprehension, imagery formation, learning, and reasoning. In one embodiment, the cognitive function is selected from: perception, memory, attention, and reasoning. In one embodiment, the cognitive function is memory.

[0058] One aspect of the present invention is a method for treating cognitive impairment. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat cognitive impairment. In one embodiment, the cognitive impairment is selected from: delirium, dementia, learning disorder, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD). In one embodiment, the cognitive impairment is a learning disorder. In one embodiment, the cognitive impairment is attention deficit disorder (ADD). In one embodiment, the cognitive impairment is attention deficit hyperactivity disorder (ADHD).

[0059] One aspect of the present invention is a method for treating stress-induced or stress-related cognitive deficits. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat the stress-induced or stress-related deficits.

[0060] One aspect of the present invention is a method for treating mood disorders. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat mood disorders. In one embodiment, the mood disorder is selected from: depression, postpartum depression, dysthymia, and bipolar disorder. In one embodiment, the mood disorder is depression. In one embodiment, the mood disorder is dysthymia.

[0061] One aspect of the present invention is a method for treating stress-induced or stress-related mood disorders (e.g., dysthymia). The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat the stress-induced or stress-related mood disorder.

[0062] One aspect of the present invention is a method for treating anxiety disorders. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat an anxiety disorder. In one embodiment, the anxiety disorder is selected from: generalized anxiety disorder, panic disorder, panic disorder with agoraphobia, agoraphobia, social anxiety disorder, obsessive-compulsive disorder, and post-traumatic stress disorder. In one embodiment, the anxiety disorder is generalized anxiety disorder. In one embodiment, the anxiety disorder is post-traumatic stress disorder.

[0063] One aspect of the present invention is a method for treating stress-induced or stress-related anxiety. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat stress-induced or stress-related anxiety.

[0064] One aspect of the present invention is a method for enhancing muscle performance. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to increase muscle performance. In one embodiment, the muscle performance is selected from: strength, speed, and endurance.

[0065] One aspect of the present invention is a method for treating a muscle or neuromuscular disease. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat a muscle or neuromuscular disease. In one embodiment, the muscle or neuromuscular disease is myopathy. In one embodiment, the muscle or neuromuscular disease is muscular dystrophy. In one embodiment, the muscle or neuromuscular disease is Duchenne muscular dystrophy.

[0066] One aspect of the present invention is a method for promoting neurite growth halo. The method comprises the step of contacting a nerve cell with an effective amount of urolithin or a precursor thereof to promote neurite growth halo. In one embodiment, the contacting comprises: administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to promote neurite growth halo.

[0067] The following embodiments may relate to each aspect and embodiment of the described invention and are related to each other where appropriate.

[0068] In one embodiment, the urolithin or its precursor is isolated urolithin.

[0069] In one embodiment, the urolithin or its precursor is an isolated urolithin precursor.

[0070] In one embodiment, the urolithin is selected from: urolithin A, urolithin B, urolithin C, urolithin D, and their metabolites, including, for example, their glucuronidated, methylated, and sulfated forms, and combinations of these urolithins.

[0071] In one embodiment, the urolithin or its precursor is administered as a natural food selected from berries, grapes, pomegranates, rose hips, and nuts.

[0072] In one embodiment, the urolithin or its precursor is administered as a processed food product, including, for example, fruit juice, concentrate, or extract, based on a natural food selected from berries, grapes, pomegranates, rose hips, and nuts.

[0073] In one embodiment, the urolithin or its precursor is administered as pomegranate juice, concentrate, or extract.

[0074] In one embodiment, the urolithin or its precursor is administered as ellagitannin.

[0075] In one embodiment, the urolithin or its precursor is administered as punicalagin.

[0076] In one embodiment, the urolithin or its precursor is administered as ellagic acid.

[0077] In one embodiment, the urolithin or its precursor is administered as urolithin.

[0078] In one embodiment, the urolithin or its precursor is administered orally.

[0079] In one embodiment, the urolithin or its precursor is administered parenterally.

[0080] In one embodiment, the urolithin or its precursor is administered at least weekly. In different embodiments, the urolithin or its precursor is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 times per week.

[0081] In one embodiment, the urolithin or its precursor is administered at least daily. In different embodiments, the urolithin or its precursor is administered 1, 2, 3, 4, 5, 6, 7, or 8 times per day.

[0082] In one embodiment, the urolithin or its precursor is administered at a dose equal to or equivalent to 0.1–150 milligrams (mg) of urolithin per kilogram (kg) of body weight. In one embodiment, the urolithin or its precursor is administered at a dose equal to or equivalent to 2–120 mg of urolithin / kg of body weight. In one embodiment, the urolithin or its precursor is administered at a dose equal to or equivalent to 4–90 mg of urolithin / kg of body weight. In one embodiment, the urolithin or its precursor is administered at a dose equal to or equivalent to 8–30 mg of urolithin / kg of body weight.

[0083] In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 0.001 micromoles (μM). In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 0.01 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 0.1 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 1 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 10 μM.

[0084] In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a sustained serum level of at least 0.001 micromoles (μM). In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a sustained serum level of at least 0.01 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a sustained serum level of at least 0.1 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a sustained serum level of at least 1 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a sustained serum level of at least 10 μM.

[0085] In one embodiment, the subject is not receiving urolithin or its precursor to treat other conditions that require administration of urolithin or its precursor or metabolite, and the other conditions are selected from: atherosclerosis, thrombosis, cancer, unwanted angiogenesis, infection, and inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0086] Figure 1 Depicts the structural formulas of urolithin A (UA), ellagic acid (EA), tellimagrandin (TL), punicalagin (PA), and punicalin (PB).

[0087] Figure 2Depicts ellagic acid (EA) and its metabolites: urolithin D (UD), urolithin C (UC), urolithin A (UA), and urolithin B (UB), which are produced by the gut microbiota in animals (including humans).

[0088] Figure 3 A pair of bar graphs of Figure 3 depict the mitochondrial gene expression levels in response to specified concentrations of ellagic acid (upper panel) and urolithin A (lower panel).

[0089] Figure 4 The bar graph of Figure 4 depicts the citrate synthase (CS) activity measured in vitro in the presence of specified concentrations of punicalagin, ellagic acid, urolithin A, or a negative control.

[0090] Figure 5 A set of immunoblots (IB) of Figure 5 depicts the effects of specified concentrations of ellagic acid (EA) and urolithin A (UA) on the levels of AMP-activated protein kinase (AMPK) and activated, phosphorylated AMPK (P-AMPK). P-AMPK: phosphorylated AMPK. Control: negative control; RSV: resveratrol positive control.

[0091] Figure 5 The bar graph of Figure 5 depicts Figure 5 Densitometric analysis of the bands in Figure 5 A, showing the relative levels of activated P-AMPK after treatment compared to cells treated with the control.

[0092] Figure 6 The bar graph of Figure 6 depicts the total cell number of PC-12 cell cultures after treatment with 0.5 μM of the specified compound. PA, punicalagin; PB, granatin B; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin I.

[0093] Figure 7 The bar graph of Figure 7 depicts the average neurite growth halo (μm) in PC-12 cells after treatment with 0.5 μM of the specified compound. The growth halo is represented per cell. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; PA, punicalagin; PB, granatin B; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin I.

[0094] Figure 8 The bar graph of Figure 8 depicts the percentage of PC-12 cells showing extensive neurite growth halo (>20 μm) after treatment with 0.5 μM of the specified compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; PA, punicalagin; PB, granatin B; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin I.

[0095] Figure 9The bar graph depicts the average neurite formation in PC-12 cells after treatment with 0.5 μM of the designated compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; PA, punicalagin; PB, punicacortein; UA, urolithin A; EA, ellagic acid; Tl, neosophorin.

[0096] Figure 10 The bar graph depicts the average growth halo of each primary dopaminergic tyrosine hydroxylase (TH)-positive neuronal cell after treatment with 0.1 μM of the designated compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, neosophorin.

[0097] Figure 11 The bar graph depicts the percentage of primary dopaminergic TH-positive neurons that exhibited extensive neurite growth halos (>20 μm) after treatment with 0.1 μM of the designated compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, neosophorin.

[0098] Figure 12 The bar graph depicts the average number of neurites formed in primary dopaminergic TH-positive neurons after treatment with 0.1 μM of the designated compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, neosophorin.

[0099] Figure 13 The bar graph depicts the maximum neurite length in primary dopaminergic TH-positive neurons after treatment with 0.1 μM of the designated compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, neosophorin.

[0100] Figure 14 The bar graph depicts the average branching of each primary dopaminergic TH-positive neuron after treatment with 0.1 μM of the designated compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, neosophorin.

[0101] Figure 15 The bar graph depicts the average number of dendrites of each primary dopaminergic TH-positive neuron after treatment with 0.1 μM of the designated compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, neosophorin.

[0102] Figure 16 The bar graph depicts the average dendritic length of each primary dopaminergic TH-positive neuron after treatment with 0.1 μM of the indicated compound. SP, SP600125; dbcAMP, dibutyryl cyclic AMP; UA, urolithin A; EA, ellagic acid; Tl, tellimagrandin.

[0103] The three sets of bar graphs in Figure 17 depict the effects of urolithin A, punicalagin, and pomegranate extract (PE) treatment on the onset of obesity in high-fat diet (HFD)-fed mice. Urolithin A was administered as a food mixture; PE and punicalagin were administered by gavage. (A) Body weight tracking expressed as the percentage increase relative to the initial body weight. (B) Percentage of fat mass measured by EchoMRI after 5 weeks of treatment. (C) Percentage of lean mass measured by EchoMRI after 5 weeks of treatment. Group composition: HFD control (food mixture): n = 10; HFD control (gavage): n = 10; HFD + urolithin A (food mixture): n = 9; HFD + punicalagin (gavage): n = 8; HFD + PE (gavage): n = 7. Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test). For panel A, results were analyzed by two-way ANOVA. p values are indicated.

[0104] Figure 18 The two pairs of bar graphs depict the effects of ellagic acid and urolithin A on lean mass and fat mass in mice fed a standard chow diet. (A) Percentage of lean mass (muscle) measured by EchoMRI after 2 weeks of treatment. (B) Percentage of fat mass (muscle) measured by EchoMRI after 2 weeks of treatment. Group composition: chow diet control (food mixture): n = 8; chow diet + ellagic acid (food mixture): n = 7; chow diet + urolithin A (food mixture): n = 7. Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test).

[0105] Figure 19A pair of graphs and corresponding bar graphs depict the effects of ellagic acid and urolithin A on oxygen consumption in mice fed a standard chow diet. (A) Oxygen consumption tracking over a 20 h period. Solid bars correspond to the dark period (7 PM to 7 AM). Other bars correspond to the light period. (B) Oxygen consumption expressed as area under the curve (AUC). Group composition: Chow diet control (chow mix): n = 8; Chow diet + ellagic acid (chow mix): n = 7; Chow diet + urolithin A (chow mix): n = 7. Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test). For panel A, results were analyzed by two-way ANOVA. p values (chow diet control vs. chow diet + treatment) are indicated.

[0106] Figure 20 A series of graphs and corresponding series of bar graphs depict the effects of urolithin A, punicalagin, and pomegranate extract (PE) on oxygen consumption in mice fed a high-fat diet (HFD). (A) Oxygen consumption tracking over a 20 h period. Solid bars correspond to the dark period (7 PM to 7 AM). Other bars correspond to the light period. (B) Oxygen consumption expressed as area under the curve (AUC). Group composition: HFD control (chow mix): n = 10; HFD control (gavage): n = 10; HFD + urolithin A (chow mix): n = 9; HFD + punicalagin (gavage): n = 8; HFD + PE (gavage): n = 7. Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test). For panel A, results were analyzed by two-way ANOVA.

[0107] Figure 21 A pair of graphs and corresponding bar graphs depict the effects of ellagic acid and urolithin A on the respiratory exchange ratio (RER) in mice fed a standard chow diet. (A) RER tracking over a 20 h period. Solid bars correspond to the dark period (7 PM to 7 AM). Other bars correspond to the light period. (B) RER expressed as mean RER. Group composition: Chow diet control (chow mix): n = 8; Chow diet + ellagic acid (chow mix): n = 7; Chow diet + urolithin A (chow mix): n = 7. Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test). For panel A, results were analyzed by two-way ANOVA. p values (chow diet control vs. chow diet + treatment) are indicated.

[0108] Figure 22A series of graphs and corresponding bar graphs depict the effects of urolithin A, punicalagin, and pomegranate extract (PE) on the respiratory exchange ratio (RER) in mice fed a high-fat diet (HFD). (A) RER tracking over a 20-h period. (B) RER expressed as mean RER. Group composition: HFD control (food mixture): n = 10; HFD + urolithin A (food mixture): n = 9; HFD + punicalagin (food mixture): n = 10; HFD + PE (food mixture): n = 10. Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test). For panel A, results were analyzed by two-way ANOVA (2-way ANOVA).

[0109] Figure 23 Two sets of graphs depict the effects of urolithin A, punicalagin, and pomegranate extract (PE) on triglycerides and free fatty acids in mice fed a high-fat diet (HFD). (A) Plasma levels of triglycerides in HFD-fed mice treated for 14 weeks. (B) Plasma levels of free fatty acids in HFD-fed mice treated for 14 weeks. Group composition: HFD control (food mixture): n = 10; HFD control (gavage): n = 10; HFD + urolithin A (food mixture): n = 9; HFD + punicalagin (gavage): n = 8; HFD + PE (gavage): n = 7. Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test).

[0110] Figure 24 A series of graphs depict the effects of urolithin A, ellagic acid, and punicalagin on glycemia in mice fed a high-fat diet (HFD). (A) Glucose tolerance test in HFD-fed mice treated with a food mixture containing urolithin A for 10 weeks. (B) Glucose tolerance test in HFD-fed mice treated with a food mixture containing ellagic acid for 10 weeks. (C) Glucose tolerance test in HFD-fed mice treated with a food mixture containing punicalagin for 10 weeks. Group composition: HFD control (food mixture): n = 10; HFD + urolithin A (food mixture): n = 9; HFD + punicalagin (food mixture): n = 10. Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test).

[0111] Figure 25The line and bar graphs depict the effects of urolithin A (UA) on basal and uncoupled respiration (oxygen consumption) in old (10-day-old) Caenorhabditis elegans (C. elegans). (A) Basal and uncoupled respiration (FCCP) in 10-day-old control worms treated with 0.1% DMSO and 10-day-old worms treated with 30 μM urolithin A (in 0.1% DMSO). (B) Representative area under the curve (AUC) of uncoupled (FCCP) respiration in 10-day-old control worms treated with vehicle (0.1% DMSO) or 30 μM urolithin A (in 0.1% DMSO). Results are expressed as mean ± SEM. *p < 0.05 (Student's t-test). OCR, oxygen consumption rate.

[0112] Figure 26 The bar graph depicts the effect of urolithin A on mitochondria in the muscle of C. elegans. The transgenic C. elegans strain SJ4103 shows fluorescence caused by muscle-specific expression of a green fluorescent protein (GFP) targeted to the mitochondrial membrane. The presence of mitochondria in the muscle of C. elegans is shown by an increase in fluorescence. Results are expressed as mean ± SEM. *p = 0.0014 (Student's t-test).

[0113] Figure 27 The bar graph depicts the mobility of mice subjected to chronic stress with or without pomegranate extract treatment.

[0114] Figure 28 The bar graph depicts the degree of "rigidity" response of mice in an anxiety-inducing context with or without pomegranate extract treatment.

[0115] Figure 29 The bar graph depicts the effect of pomegranate extract administration on the degree of inhibition of anxiety-induced hindlimb standing in mice.

[0116] Figure 30 The bar graph depicts the effect of pomegranate extract administration on the degree of inhibition of anxiety-induced grooming behavior in mice.

[0117] Figure 31 The line graph depicts the disappearance of memory of a specific adverse context when repeatedly exposed to a non-adverse context. Data are shown for the following mice: mice that have experienced early-life stress, control mice with normal hindlimb standing, and mice that have experienced early-life stress but were treated with ellagitannin punicalagin. Rigidity (%) is expressed as the percentage of the rigidity time during the initial exposure to the context.

[0118] Figure 32 The graph depicts the effect of chronic stress on effective learning of mice in the Morris water maze.

[0119] Figure 33 The bar graph depicts the effect of pomegranate extract administration on the learning performance of chronically stressed mice in the Morris water maze.

[0120] Figure 34 The graph depicts the cumulative distance to the hidden platform over several trials during the training period in the Morris water maze (a measure of cognitive learning). Data are shown for the following mice: mice that have experienced early-life stress, control mice standing upright on their hind legs normally, and mice that have experienced early-life stress but have been treated with ellagitannin punicalagin. The distance to the platform is the sum of the cumulative distances between the mice and the hidden platform over all measured intervals (25 intervals / second) during the observation period (60 seconds).

[0121] Figure 35 The bar graph depicts the memory of aged rats in the social recognition test when treated with pomegranate extract 1108 or control (Ctrl).

[0122] Figure 36 The bar graph depicts the Morris water maze results of aged rats treated with pomegranate extract 1108 or control (Ctrl).

[0123] Figure 37 The bar graph depicts the percentage of correct alternations in the Y-maze of Alzheimer's disease mouse model 5XFAD (treated and untreated) and normal control mice. Significance: **p < 0.01, *p < 0.05, one-way ANOVA.

[0124] Figure 38 The bar graph depicts the Morris water maze results of transgenic Alzheimer's disease model mice (hAPP-Tg) treated with pomegranate-derived extracts 31008, 61109, 71109, or control (vehicle). Results for wild-type mice (Non-Tg) treated with control (vehicle) are also shown.

[0125] Figure 39 The bar graph depicts the light / dark box results of mice that have experienced early-life stress relative to control mice standing upright on their hind legs normally and mice that have experienced early-life stress and have been treated with ellagitannin punicalagin. Results are expressed as mean ± SEM. Significance: *p < 0.05, (Student's t-test).

[0126] Figure 40The bar graph depicts the results of the elevated zero maze for mice that have experienced early life stress relative to control mice standing on their hind legs normally, and for mice that have experienced early life stress and been treated with punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05, (Student's t-test).

[0127] Figure 41 The bar graph depicts the results of the forced swim test for mice that have experienced early life stress relative to control mice standing on their hind legs normally, and for mice that have experienced early life stress and been treated with punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05, **p<0.01 (Student's t-test).

[0128] Figure 42 The bar graph depicts the training results in a contextual fear training paradigm during the first mild electric shock (which was administered at 4 min). Results are shown for mice that have experienced early life stress relative to control mice standing on their hind legs normally, and for mice that have experienced early life stress and been treated with punicalagin. Results are expressed as mean ± SEM.

[0129] Figure 43 The bar graph depicts the extinction of memory for a specific adverse context when repeatedly exposed to a non-adverse context. Data are shown for the following mice: mice that have experienced early life stress, unstressed control mice standing on their hind legs normally, and mice that have experienced early life stress and been treated with punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05, #p = 0.05 (Student's t-test). Normal unstressed animals were compared to animals with early life stress (i.e., maternal separation). Punicalagin-treated animals with early life stress were compared to untreated animals with early life stress.

[0130] Figure 44 The line graph confirms the level of motor learning measured by the latency to fall from a rotarod (in seconds). Data are shown for the following mice: mice that have experienced early life stress, control mice standing on their hind legs normally, and mice that have experienced early life stress and been treated with punicalagin. Results are expressed as mean ± SEM.

[0131] Figure 45The figure depicts the escape latency (in seconds) during the training period in the Morris water maze (a measure of cognitive learning). Data are shown for the following mice: mice that have experienced early-life stress, control mice standing upright on their hind legs normally, and mice that have experienced early-life stress and have been treated with punicalagin. Results are expressed as mean ± SEM. Significance: *p<0.05 (Student's t-test).

[0132] Figure 46 The bar graph depicts the effect of pomegranate-derived compounds on context recognition in normal mice, which were untreated or treated with punicalagin or urolithin A. Results are expressed as mean ± SEM. Significance: *p<0.05 (Student's t-test).

[0133] Figure 47 The bar graph depicts the effect of pomegranate-derived compounds on memory retention regarding a specific context in normal mice, which were untreated or treated with punicalagin or urolithin A. Results are expressed as mean ± SEM. Significance data were analyzed using one-way ANOVA or repeated-measures ANOVA, followed by Fisher's post hoc LSD multiple comparison test. *p<0.05.

[0134] Figure 48 The line graph confirms muscle performance and motor skills measured by the latency to fall off a rotarod (in seconds). Data are shown for the following mice: untreated control mice standing upright on their hind legs normally, and mice that have been treated with punicalagin. Significance: *by ANOVA, p<0.05.

[0135] Figure 49 The line graph confirms the level of muscle performance and endurance measured by the ability of mice to run on a high-speed treadmill. Data are shown for the following mice: untreated control mice standing upright on their hind legs normally, and mice that have been treated with urolithin A. Significance: *p<0.05, **p<0.01 (Student's t-test). DETAILED DESCRIPTION

[0136] In biology and psychology, the term "stress" denotes the consequence of a human or other animal failing to respond appropriately to a physiological, mood, or physical threat, whether actual or imagined. Endocrinologist Hans Selye first adopted the term "stress" in a biological context in the 1930s. He later broadened and popularized the concept to include inappropriate physiological responses to any demand. It encompasses a wide range of phenomena, from mild stimuli to severe dysfunctions that can cause serious health damage.

[0137] All of these psychobiological features of stress may represent manifestations of oxidative stress, which is an imbalance between the production and manifestation of reactive oxygen species and the ability of biological systems to readily detoxify reactive intermediates or repair the damage formed. Disruption of the normal redox state of tissues can cause toxic effects through the production of peroxides and free radicals, which can damage all components of cells, including proteins, lipids, and DNA. Some reactive oxygen species can even act as messengers through a phenomenon called "redox signaling."

[0138] In humans, oxidative stress is involved in many diseases. Examples include: atherosclerosis, Parkinson's disease, heart failure, myocardial infarction, Alzheimer's disease, schizophrenia, bipolar disorder, fragile X syndrome, and chronic fatigue syndrome.

[0139] One source of reactive oxygen species in humans under normal conditions is the leakage of activated oxygen from mitochondria during oxidative phosphorylation.

[0140] Other enzymes capable of producing superoxide (O2 - ) are xanthine oxidase, NADPH oxidase, and cytochrome P450. A variety of enzymes, including several oxidases, produce hydrogen peroxide (another strong oxidant). Reactive oxygen species play an important role in cell signaling (a process called redox signaling). Thus, in order to maintain proper cellular homeostasis, a balance must be achieved between the production and consumption of reactive oxygen species.

[0141] Well-studied cellular antioxidants are superoxide dismutase (SOD), catalase, and glutathione peroxidase. Less well-studied enzyme antioxidants include peroxiredoxin and the newly discovered thioredoxin. Other enzymes with antioxidant properties (although this is not their main role) include paraoxonase, glutathione-S-transferase, and aldehyde dehydrogenase.

[0142] After irradiation and hyperoxia, oxidative stress contributes to tissue damage. It is suspected to be important in neurodegenerative diseases, which include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), and Huntington's disease. Oxidative stress is also thought to be associated with certain cardiovascular diseases because the oxidation of low-density lipoprotein (LDL) in the vascular endothelium is a precursor to plaque formation. Oxidative stress also plays a role in the ischemic cascade caused by oxygen reperfusion injury after hypoxia. This cascade includes stroke and heart attack. Oxidative stress has also been involved in chronic fatigue syndrome.

[0143] It is noted that the inventors have discovered that certain compounds derived from ellagitannins can be used to treat and prevent physiological and psychological manifestations of stress, including oxidative stress. Without wishing to be bound by any particular mechanism of action, it is believed that the compounds exert beneficial effects on mitochondria, thereby promoting and restoring important mitochondrial functions and counteracting stress-induced mitochondrial dysfunction. According to the present invention, it has been found that these same compounds can be used to treat and prevent any of a variety of conditions, diseases, and disorders associated with mitochondrial dysfunction, including, but not limited to, neurodegenerative diseases and cognitive impairments, metabolic disorders (including insulin resistance), mood disorders, and anxiety disorders.

[0144] Ellagitannin (ET) is a polyphenol included within the so-called "hydrolyzable tannins", in which hexahydroxy-diphenic acid forms a diester with a sugar (most commonly β-D-glucose). ET can exist as a complex polymer reaching molecular weights of up to 4000 and higher. These polymers can be hydrolyzed with acid or base to yield ellagic acid (EA), which can be used indirectly to quantify ET. EA is in turn a source of other metabolites, including urolithins.

[0145] Many plant species containing ellagitannins have been used to treat diseases, particularly in Asia (Okuda et al., 2009). These include: Agrimonia pilosa (agrimoniin), Camellia japonica (camelliatannin A), Cornus officinalis (cornussin A), Geranium thunbergii (geraniin), Geum japonicum (gemin-A), Liquidambar formosana (casuarictin), Mallotus japonicus (mallotinic acid), Oenothera erythrosepala (oenothein B), Punica granatum (pomegranate, pomegranate) (punicalagin B), Rosa rugosa (rose) (rugosin), and Terminalia chebula (chebulagic acid), among others. The main uses of these medicinal plants have been associated with their antioxidant, antidiarrheal, antimicrobial, and immunomodulatory activities.

[0146] Ellagitannins are also present in large amounts in many berries, including strawberries, red and black raspberries (Zafrilla et al., 2001), bilberries and blackberries. They have also been found in apples, cherries, cloudberries, cranberries, currants, grapes, limes, mangoes, pineapples, pomegranates, plums, and rhubarb. Serrano et al. (2009) Mol Nutr Food Res. 53: S310 - 29. Ellagitannin Rubusuaviin C can be isolated from the leaves of Chinese sweet tea Rubus suavissimus S. Lee. Detectable amounts of ellagitannins have also been identified in nuts, including walnuts (Fukuda et al., 2003), pistachios, cashews, chestnuts, acorns (Cantos et al., 2003), pecans (Villarreal - Lozoya et al., 2007) and peanuts.

[0147] They are also rich in pomegranates (Gil et al., 2000) and muscadine grapes (Lee and Talcott, 2002), and are important components of wood, especially oak (Glabasnia and Hofmann, 2006). Through migration from wood to the food matrix during different aging processes, ellagitannins can be incorporated into food products such as wines and whiskies. Ellagic acid has also been found in several types of honey, and it has been proposed as a floral marker for heather honey (Ferreres et al., 1996). Free ellagic acid and different glycoside derivatives are also present in these food products, including glucosides, rhamnosides, arabinosides and the corresponding acetyl esters (Zafrilla et al., 2001).

[0148] Numerous studies have confirmed that the ellagitannin content of several food products can be very high (Table 1). For example, a cup of pomegranate juice (200 mL) can provide up to a total of 1 g of ellagitannins and ellagic acid, a serving of raspberries (100 g of raspberries) can provide approximately 300 mg, a serving of strawberries can provide 70 mg, and 4 walnuts can provide approximately 400 mg of ellagitannins.

[0149] Representative dietary ellagitannins include: punicalagin from pomegranates, sanguiin - H - 6 from strawberries and raspberries, and pedunculagin from walnuts. All of these release ellagic acid upon hydrolysis, although other metabolites can also be produced and are characteristic of various ellagitannins (e.g., gallagic and ter - gallagic acids).

[0150] Table 1. Ellagitannin (ET) and ellagic acid (EA) contents in different food products

[0151]

[0152]

[0153] f.w., fresh weight

[0154] d.w., dry weight

[0155] Ellagitannins have a great structural variability, leading to the formation of dimeric and oligomeric derivatives. They also have a wider distribution than gallotannins. Other ellagitannins and their reported sources are shown in Table 2.

[0156] Table 2. Other ellagitannins.

[0157]

[0158]

[0159]

[0160] Numerous potentially bioactive ellagitannins can be isolated from different species of the genus Terminalia. Specifically, punicalagin and granatin B have been identified in several Terminalia species, including, for example, Terminalia catappa, Terminalia chebula, Terminalia myriocarpa, and T. citrine. Punicalagin has also been isolated from Cistus creticus (a Mediterranean shrub) and Combretum molle (an African shrub).

[0161] Ellagic acid is usually present in plant tissues in relatively low amounts. It is thought to be derived from ellagitannins, which spontaneously convert to ellagic acid when decomposed from hexahydroxydiphenic acid. Some other sources of ellagic acid are shown in Table 3.

[0162] Table 3. Sources containing ellagic acid.

[0163]

[0164] Pomegranate (Punica granatum) fruits are ancient medicinal foods that have been used in folk medicine for centuries. They are consumed fresh and as juice, and are an excellent source of ellagitannins and ellagic acid. Ellagitannins in pomegranate peels and juice include: punicalin, punicalagin, corilagin, casuarictin, bergenin / gallagyldilacton, longistemin, neopunicalin, punicaletin A, and punicaletin B. Other parts of the pomegranate plant contain other ellagitannins, including punicalfolin, granatin A, granatin B, granatin C, granatin D, and punigluconin. Commercial juices contain gallagyl-type ellagitannins, including punicalagin isomers (1500 - 1900 mg / L), unclassified hydrolysable tannins (400 - 500 mg / L), and ellagic acid and its glycosides (120 - 260 mg / L) (Gil et al., 2000). Punicalagin is rich in pomegranate peels, which are ellagitannins where gallagic acid and ellagic acid are linked to glucose molecules. Punicalagin isomers and ellagic acid derivatives are not present in aril juice, but during industrial juice processing, they are extracted from the husks and membranes surrounding the arils and are released in large amounts into the juice.

[0165] The extract of the present invention can be prepared as follows: First, the fruit is juiced. For example, pomegranates can be juiced using standard industrial juicing methods known in the art, which may include: juicing the whole fruit by applying pressure to the entire fruit, or first dehulling the pomegranate and then applying pressure to the residue, which consists of arils, the membrane material surrounding the arils, and the husk material generated during dehulling. Alternatively, the husk (which is a rich source of ellagitannins, especially punicalagin) can be juiced, including water extraction. Alternative, non-aqueous extraction methods can use other solvents, such as ethanol, acetone, or methanol, as examples.

[0166] The extract is typically an aqueous extract that can consist essentially of fruit juice, optionally with additional water added. Such an aqueous extract can be concentrated, enriched, or refined by, for example, standard techniques, such as evaporation under reduced pressure and filtration methods. Examples of concentrates are those concentrated at least 2-fold, more often at least 4-fold (e.g., at least 8-fold, at least 40-fold, at least 100-fold, at least 200-fold, or at least 1000-fold).

[0167] The extract can be fractionated to isolate one or more active components therefrom, for example, by molecular weight filtration, or chromatography on a suitable solid support, or by solvent extraction, the solid support being, for example, agarose gel (in the case of size exclusion chromatography) or an ion exchange column (using HPLC on appropriately treated silica or alumina (such as ODS-coated silica)).

[0168] In vitro digestion simulation studies have confirmed that, in general, ellagitannins are very stable under the physiological conditions of the stomach. Acidic conditions (HCl, pH 1.8–2.0) and gastric enzymes do not hydrolyze the original ellagitannins to release free ellagic acid (EA), and no degradation of ellagitannins was observed (Tomas-Barberan et al., 2009). Although the stomach seems to be the primary site for the absorption of free EA, ellagitannins are not absorbed. However, under the physiological conditions of the small intestine, the release of free EA from ellagitannins occurs. This hydrolysis seems to be due to the pH conditions (neutral to weakly alkaline pH, 7.0–7.3), rather than the action of pancreatic enzymes and bile salts (Larrosa et al., 2006).

[0169] Animal studies have also been used to evaluate the bioavailability and metabolism of EA and ellagitannins. Doyle and Griffiths (1980) reported the rapid absorption and metabolism of EA in rats. These authors detected urolithin A (UA) and other metabolites (most likely urolithin B (UB)) in feces and urine. Both UA and UB have been confirmed to have a microbiota origin, as neither was found in germ-free animals. Unchanged EA was not detected in urine or feces. These urolithins are mainly absorbed by enterocytes and glucuronidated. In this case, no methyl ethers are produced, as UA and UB do not have ortho-dihydroxy groups in their molecules and are therefore not substrates for catechol-O-methyltransferase (COMT). In the case of UB, cytochrome P450 can introduce additional hydroxyl groups, and this increases the likelihood of glucuronidation and enhances the excretion of metabolites. Teel and Martin (1988) found that free EA and some conjugates (sulfates, glucuronides, and glutathione conjugates) were detected in the urine, bile, and blood of mice. 3 The absorption of H-EA occurs mainly within 2 hours after oral administration. The levels in blood, bile, and tissues are low, and the absorbed compound is excreted in urine. After 24 h, more than half of the administered 3 H-EA remains in the gastrointestinal tract.

[0170] The metabolism of different dietary ellagitannin (ET) and ellagic acid (EA) derivatives has been evaluated in humans. In a study including 40 healthy volunteers (divided into 4 groups), different ET-containing foods were administered, including strawberries (250 g), raspberries (225 g), walnuts (35 g), and oak-aged red wine (300 mL). Both strawberries and raspberries contain ET sanguiin H-6; walnuts contain ET longistylin; and oak-aged wine contains ET vescalagin. After administration, five urine samples were collected at 8, 16, 32, 40, and 56 h. Using LC-MS / MS analysis, no ET or EA was detected in the urine. However, in all subjects, from 32 h to 56 h (globally with the consumed foods), microbial metabolites were detected in the samples: 3,8-dihydroxy-6H-dibenzo[b,d]pyran-6-one (urolithin B) conjugated with glucuronic acid. According to the results obtained, urolithin B derivatives were excreted independently of the consumed ET. A common monomeric moiety in the consumed ET is EA (m / z - at 301), which indicates that this subunit belonging to the ET molecule is the key molecule for the production of urolithin B derivatives. In humans consuming pomegranate juice, a similar metabolic conversion of ellagitannins to ellagic acid and urolithins has been observed (Cerda, Espín et al. 2004; Cerda, Periago et al. 2005).

[0171] One of the main factors in the metabolism and bioavailability of ellagitannins is their microbial conversion to provide a series of urolithin derivatives ( Figure 2 ). Among them, the best characterized and known are urolithin A and B, but intermediates with 3 and 4 hydroxyl groups are also produced, absorbed in the small intestine, and excreted in the bile after conjugation with methyl ethers and glucuronides (Espín et al., 2007). Animal experiments have shown that these metabolites start to form in the small intestine, which indicates that anaerobic bacteria may be responsible for this effect. This metabolism continues along the gastrointestinal tract, starting from urolithin D and C and ending with the production of urolithin A and B. Differences in the production of these metabolites in human volunteers suggest that they may be produced by the activity of specific microorganisms present in the intestine.

[0172] In the gastrointestinal tract and in other tissues (mainly in the liver), EA and ellagitannin microbial metabolites are further metabolized by phase I (hydroxylation) and phase II (methylation, glucuronidation, and sulfation) enzymes to produce more soluble metabolites that can be distributed in tissues and then excreted in the urine.

[0173] Thus, UB can be hydroxylated to produce UA, and UA can be further hydroxylated to produce trihydroxy derivatives.

[0174] Phase II products are also produced, and methylether (a product of COMT) and different glucuronide conjugates are detected in different tissues and in urine. Sulfate conjugates of ellagitannin metabolites are less in animals and humans compared to glucuronide conjugates. These conjugates are first produced in enterocytes and further metabolized in the liver, and then excreted into urine or bile.

[0175] In summary, ellagitannins are generally not absorbed in the intestine. Instead, they release EA in the intestine, and the EA is poorly absorbed only in the stomach and small intestine. EA is mainly metabolized by unknown bacteria in the intestinal lumen to produce urolithins. Microbial metabolism begins in the small intestine, and the first metabolites produced retain four phenolic hydroxyl groups (urolithin D, four hydroxyls), and they are further metabolized along the intestine to remove hydroxyl units, thus producing urolithin C (three hydroxyls), urolithin A (two hydroxyls) and B (one hydroxyl) in the distal part of the colon ( Figure 2 ). The absorbed metabolites are conjugated with glucuronic acid (one or two units) and / or methylether (when an ortho-dihydroxy group is present). Urolithin A and B conjugates are the main metabolites detected in plasma and urine, although some trihydroxy derivatives (hydroxy-UA) or EA-dimethyl ether glucuronide have also been detected in smaller amounts. Tetrahydroxy-urolithins, trihydroxy-urolithins and EA derivatives are generally not detected in peripheral plasma, but they are absorbed in the small intestine and are transported to the liver, where they are further metabolized and excreted into the small intestine together with bile, thus establishing an enterohepatic circulation, such that urolithins have a relatively long lifespan in plasma and urine.

[0176] In addition to natural food sources, many papers on the biosynthesis, isolation, and biological activities of tannins (especially ellagitannins) have appeared in the last 20 years (e.g., Xie et al., 1995, Yoshida et al., 1982, 1984, 1985, 1986, 1989, 1990a / b, 1991a-d, 1992a / b, 1995, Nonaka et al., 1980, 1984, 1989a-c, 1990, Tanaka et al., 1986a / b, 1990, 1992a / b, 2001, Hatano et al., 1988, 1989, 1990a-c, 1991, 1995, Lin et al., 1990, Nishizawa et al., 1982, 1983, Haddock et al., 1982a / b, Kashiwada et al., 1992a / b, 1993, Kadota et al., 1990, Okuda et al., 1982a-e, 1983a / b, El-Mekkawy et al., Chemistry and Biology of Ellagitannins 1541995, Tsai et al., 1992, Han et al., 1995, Chen et al., 1995, Morimoto et al., 1986a / b, Saijo et al., 1989). Obtaining pure ellagitannins by isolation from natural sources can be cumbersome and yields only relatively small amounts of the pure natural product. See, e.g., Okuda et al., (1982) Chem Pharm Bull. 30:4230-4233; Okuda et al. (1982) Chem Pharm Bull. 30:234–4236. Thus, it is notable that many total synthesis methods for ellagitannins are known. See, e.g., Khanbabaee, K., Strategies for the synthesis of ellagitannins, in: Chemistry and Biology ofEllagitannins, Ed. S. Quideau, World Scientific Publishing, Singapore, 2009, pp. 152-202, including the references cited therein.

[0177] Using different in vitro assays, the antioxidant activities of food extracts rich in ellagitannins have been determined, and have been widely reported for strawberries (Meyers et al., 2003, Aaby et al., 2005, 2007), raspberries (Liu et al., 2002, Beekwilder et al., 2005), cloudberries ( et al., 2001) and other Rubus berries (Wada and Ou, 2002), pomegranate (Gil et al., 2000) and walnut (Anderson et al., 2001) and the high activity of their ellagitannins. These foods also rank among the top compared to other plant-based foods.

[0178] The effect of the consumption of ellagitannin-rich foods on the in vivo antioxidant status is poorly understood. In elderly women, the total antioxidant capacity of serum increased by about 10% during a 4-hour period after consuming 240 g of strawberries (Cao et al., 1998). Single administration of a standardized pomegranate extract (Mertens-Talcott et al., 2006) and long-term consumption of pomegranate juice (Rosenblat et al., 2006) also improved several antioxidant parameters in human volunteers. However, daily consumption of walnuts for 3 weeks had no effect on the antioxidant status of subjects with metabolic syndrome (Davis et al., 2007).

[0179] Cancer cell growth depends on the balance between proliferation and apoptosis. Dysregulated cell proliferation and inhibition of apoptosis are key steps in the initiation and progression of cancer. There is substantial evidence that extracts of ellagitannin-rich foods reduce the growth of cancer cells in vitro as follows: inhibiting cell proliferation, inducing apoptotic cell death, and regulating cell cycle kinetics and signal transduction pathways.

[0180] In vitro studies with cancer cell lines have shown that strawberries (Meyers et al., 2003, Olsson et al., 2004, Ramos et al., 2005, Wang et al., 2005, Wu et al., 2007), Rubus (Liu et al., 2002, Olsson et al., 2004, Wu et al., 2007), cloudberry (Wu et al., 2007) and rose hips (Olsson et al., 2004) inhibit cell proliferation, induce apoptosis and cause cell cycle arrest in human colon, liver, lung, breast or cervical cancer cells. In these studies, the contribution of ellagitannins to the activity of berry extracts was not evaluated. However, a recent study (Ross et al., 2007) suggested that the antiproliferative activity of Rubus is mainly related to ellagitannins.

[0181] It has also been reported that pomegranate juice and its ellagitannins inhibit proliferation, induce apoptosis, and inhibit inflammatory cell signaling in colon cancer cell lines (Seeram et al., 2005; Adams et al., 2006; Larrosa et al., 2006). Similarly, polyphenols in muscadine grape skins inhibit the growth of colon cancer cells and induce apoptosis (Yi et al., 2005). Fractions isolated from red muscadine grapes and rich in ellagic acid, ellagic acid glycosides, and ellagitannins induce apoptosis, reduce cell number, and cause alterations in cell cycle kinetics in colon cancer cells (Mertens-Talcott et al., 2006).

[0182] Pomegranate juice is effective against prostate cancer cells in vitro, but not against normal prostate epithelial cells. Treatment of highly invasive human prostate cancer cells with pomegranate fruit extracts results in inhibition of cell growth and viability and induction of apoptosis (Malik et al., 2005; Malik and Mukhtar, 2006).

[0183] In accordance with the present invention, it has now been found that ellagitannins and their metabolites, including ellagic acid and especially urolithins, unexpectedly exhibit protective and restorative effects on mitochondria. Without wishing to be bound by any particular mechanism, it is believed that different types of stress lead to stress damage to mitochondria, thereby reducing their ability to perform many of the functions necessary for overall cellular function. The methods of the present invention can be used to treat conditions associated with mitochondrial stress damage, which can present in any of a number of ways, including, but not limited to, mitochondrial diseases.

[0184] Mitochondria are the "powerhouses" of the cell. These double-membrane organelles play a key role in generating the vast majority of cellular energy (ATP) through oxidative phosphorylation. Mitochondria are also essential for other key metabolic functions, such as fatty acid β-oxidation, catabolism of amino acids, ketogenesis, and the generation of reactive oxygen species (ROS) with important signaling functions and the control of calcium homeostasis.

[0185] The mitochondrial matrix contains the enzymatic machinery for fatty acid β-oxidation, which in this process generates acetyl-CoA and reducing equivalents in the form of reduced nicotinamide adenine dinucleotide (NADH) and reduced flavin adenine dinucleotide (FADH2) from acyl chains. Acetyl-CoA fuels the tricarboxylic acid (TCA) cycle (also known as the citric acid cycle or Krebs cycle), which also generates NADH and FADH2. These products contribute electrons to the electron transport chain (ETC), resulting in the generation of a proton gradient across the inner mitochondrial membrane. Dissipation of this gradient by mitochondrial ATP synthase generates energy in the form of ATP.

[0186] ETC is composed of four large multi-subunit complexes (Complexes I to IV), which transport the electrons generated by the TCA cycle to the final acceptor molecule oxygen (O2), thereby forming H2O at Complex IV. The transport of electrons is accompanied by the release of a large amount of free energy, and most of the free energy is used for the translocation of protons (H + ) from the matrix to the intermembrane space (proton motive force); the remaining free energy is dissipated as heat. As H + flows back into the matrix through the mitochondrial ATP synthase, the energy contained in the H + electrochemical gradient is then coupled to ATP production. Thus, oxidative phosphorylation results from electron transfer, the generation of a proton gradient, and the subsequent proton flow coupled to the mitochondrial ATP synthase.

[0187] ROS can also activate uncoupling proteins (UCPs), which dissipate the proton gradient without producing ATP. UCPs are regarded as natural regulators of this process, responding to ROS production by reducing the formation of a large proton gradient and controlling ROS production. Additionally, UCPs and respiratory uncoupling are involved in numerous important physiological and pathological processes, such as adaptive thermogenesis, regulation of fatty acid oxidation, participation in inflammation, prevention of ROS formation, glucose homeostasis, body weight regulation, and aging.

[0188] Citrate synthase is the initial enzyme of the mitochondrial TCA cycle. This enzyme catalyzes the reaction between acetyl coenzyme A (acetyl-CoA) and oxaloacetate to form citrate. The activity of this enzyme reflects mitochondrial biogenesis and mitochondrial oxidative phosphorylation, as its activity increases proportionally with mitochondrial density (the number of mitochondria per cell) and mitochondrial respiratory activity. As a result, citrate synthase measurement can generally evaluate the mitochondrial functional state, with higher activity indicating increased oxidative phosphorylation and ATP synthesis, and lower activity indicating the opposite.

[0189] To better understand the underlying molecular mechanisms leading to improved mitochondrial function, a profile of key mitochondrial genes (encoding mitochondrial and genomic DNA) covering oxidative phosphorylation, mitochondrial chain complexes, the TCA cycle, uncoupling proteins, transcription factors, cofactors, and ROS scavenging proteins can be performed.

[0190] The conventional teaching in biology and medicine is that mitochondrial function serves only as the "energy factory" of the cell. However, more than 95% (2900 / 3000) of the genes encoding mitochondrial proteins are involved in other functions related to the specialized duties of the differentiated cells in which they reside. These duties evolve during development from embryo to adult and mature and adapt to the postnatal environment as tissues grow. These other, ATP-independent functions are closely involved in most of the important metabolic pathways by which cells build, break down, and recycle their molecular building blocks. In the absence of mitochondria, cells cannot even produce the RNA and DNA required for their growth and function. The building blocks of RNA and DNA are purines and pyrimidines. Mitochondria contain the rate-limiting enzymes for pyrimidine biosynthesis (dihydroorotate dehydrogenase) and heme synthesis (d-aminolevulinate synthase) required for hemoglobin production. In the liver, mitochondria are specialized to detoxify ammonia in the urea cycle. Mitochondria are also required for cholesterol metabolism, estrogen and testosterone synthesis, neurotransmitter metabolism, and free radical generation and detoxification. Mitochondria perform all these functions, in addition to oxidizing the fats, proteins, and carbohydrates ingested in the diet.

[0191] Mitochondrial diseases are the result of genetic or spontaneous mutations in mitochondrial DNA or nuclear DNA that cause alterations in the function of proteins or RNA molecules normally present in mitochondria. However, problems with mitochondrial function may affect only certain tissues, due to factors that occur during development and growth and that are not yet fully understood. Even when considering tissue-specific isoforms of mitochondrial proteins, it is difficult to explain the variable patterns of affected organ systems in clinically observed mitochondrial disease syndromes.

[0192] Mitochondrial diseases result from the failure of mitochondria, specialized compartments present in every cell of the body except red blood cells. Mitochondria are responsible for generating more than 90% of the energy required by the body to sustain life and support growth. When they fail, less and less energy is produced within the cell. Subsequently, cell damage and even cell death occur. If this process is repeated throughout the body, the entire system begins to fail, and the life of the person in whom it occurs is severely impaired. Mitochondrial diseases primarily affect children, but adult onset is being recognized more often.

[0193] Mitochondrial diseases appear to cause most of the damage to the cells of the brain, heart, liver, skeletal muscle, kidneys, and endocrine and respiratory systems.

[0194] Many symptoms of mitochondrial diseases are non-specific. The symptoms may also exhibit a paroxysmal course and deteriorate cyclically. In a review article on mitochondrial medicine, migraine, as well as paroxysmal conditions of myalgia, gastrointestinal symptoms, tinnitus, depression, chronic fatigue, and diabetes, have been mentioned among the different manifestations of mitochondrial diseases (Chinnery and Turnbull (1997) QJM 90:657-67; Finsterer (2004) Eur J Neurol. 11:163-86). In patients with mitochondrial diseases, clinical symptomatology usually occurs at times of higher energy demand related to physiological stressors, such as illness, fasting, excessive exercise, and extreme environmental temperatures. In addition, psychological stressors often trigger symptomatology, presumably due to higher brain energy demands that patients are unable to match with sufficient ATP production.

[0195] Depending on the affected cells, symptoms may include: loss of motor control, muscle weakness and pain, gastrointestinal disorders and dysphagia, hypoplasia, heart disease, liver disease, diabetes, respiratory complications, seizures, vision / hearing problems, lactic acidosis, developmental delay, and susceptibility to infection.

[0196] Mitochondrial diseases include, but are not limited to, Alpers disease; Barth syndrome; β-oxidation defects; carnitine deficiency; carnitine-acyl-carnitine deficiency; chronic progressive external ophthalmoplegia syndrome; coenzyme Q10 deficiency; complex I deficiency; complex II deficiency; complex III deficiency; complex IV deficiency; complex V deficiency; CPT I deficiency; CPT II deficiency; creatine deficiency syndrome; cytochrome c oxidase deficiency; glutaric aciduria type II; Kearns-Sayre syndrome; lactic acidosis; LCHAD (long-chain acyl-CoA dehydrogenase deficiency); Leber's hereditary optic neuropathy; Leigh disease; fatal infantile cardiomyopathy; Luft disease; MAD (medium-chain acyl-CoA dehydrogenase deficiency); mitochondrial cytopathy; mitochondrial DNA depletion; mitochondrial encephalomyopathy, lactic acidosis, and stroke-like symptoms; mitochondrial encephalopathy; mitochondrial myopathy; mitochondrial recessive ataxia syndrome; myoclonic epilepsy with ragged red fibers; myoneurogenic gastrointestinal encephalopathy; neuropathy, ataxia, retinitis pigmentosa, and ptosis; Pearson syndrome; POLG mutations; pyruvate carboxylase deficiency; pyruvate dehydrogenase deficiency; SCHAD (short-chain acyl-CoA dehydrogenase deficiency); and very-long-chain acyl-CoA dehydrogenase deficiency.

[0197] One aspect of the present invention is a medicament comprising an effective amount of pomegranate extract, which is used for treating or preventing a disease selected from the following: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0198] As used herein, "food product" refers to a product prepared from natural foods. Non-limiting examples of food products include fruit juices, wines, concentrates, jams, jellies, preserves, sauces and extracts. As used herein, "nutritional supplement" refers to a product suitable for consumption or other administration (primarily for its health-promoting properties rather than its enthalpy).

[0199] As used herein, the term "metabolic syndrome" refers to a group of medical conditions that, when they occur together, increase the risk of developing cardiovascular disease and diabetes. It affects one in five Americans, and the prevalence increases with age. Some studies have shown that the prevalence in the United States is estimated to be 25% of the population. According to the International Diabetes Foundation's globally consistent definition (2006), metabolic syndrome is central obesity + any two of the following:

[0200] · Elevated triglycerides: >150 mg / dL (1.7 mmol / L), or specific treatment for this lipid abnormality;

[0201] · Decreased HDL cholesterol: <40 mg / dL (1.03 mmol / L) in men and <50 mg / dL (1.29 mmol / L) in women, or specific treatment for this lipid abnormality;

[0202] · Elevated blood pressure: systolic blood pressure >130 or diastolic blood pressure >85 mmHg, or treatment for previously diagnosed hypertension; and

[0203] · Elevated fasting plasma glucose: (FPG) >100 mg / dL (5.6 mmol / L), or previously diagnosed type II diabetes.

[0204] One aspect of the present invention is a medicament comprising an effective amount of ellagitannin, which is used for treating or preventing a disease selected from the following: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0205] In certain embodiments, according to this and other aspects of the invention, ellagitannins are selected from: 2-O-galloylpunicalagin, Casaurictin, castalagin, Vecalagin, castalin, casuarictin, casuarinin, chebulagic acid, corilagin, emblicanin A, corilagin E, epigallocatechin A, lagerstannin B, gemin D, punicalagin A, punicalagin B, maclurin, aucubin, Lambertianin C, aristolochic acid A, granatin A, granatin B, granatin C, granatin C, granatin D, punicalfolin, punicalin, punical glucuronic acid, roburin A, roburin B, roburin C, roburin D, roburin E, Rubusuaviin C, sanguiin H-4, sanguiin H-5, sanguiin H-6, sanguiin H-10, stachyurin, parvifolin, neosamidin I, Tellimigrandin II, chebulinic acid, terminaliafolin A, terminaliafolin B, Tergallagin, and pachysandrine / gallagyldilacton. Of course, other ellagitannins are also contemplated by the present invention.

[0206] One aspect of the invention is a medicament comprising an effective amount of punicalin for treating or preventing a disorder selected from: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress, and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0207] One aspect of the invention is a medicament comprising an effective amount of ellagic acid for treating or preventing a disorder selected from: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress, and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0208] One aspect of the invention is a medicament comprising an effective amount of urolithin for treating or preventing a disorder selected from: obesity, decreased metabolic rate, metabolic syndrome, diabetes, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive impairment, mood disorder, stress, and anxiety disorder; for weight control; or for increasing muscle performance or intellectual performance.

[0209] In certain embodiments, according to this and other aspects of the invention, the urolithin is urolithin A. In certain embodiments, according to this and other aspects of the invention, the urolithin is urolithin B. In certain embodiments, according to this and other aspects of the invention, the urolithin is urolithin C. In certain embodiments, according to this and other aspects of the invention, the urolithin is urolithin D.

[0210] In each of the foregoing aspects, in one embodiment, the disorder is obesity.

[0211] In each of the foregoing aspects, in one embodiment, the disorder is a decreased metabolic rate.

[0212] In each of the foregoing aspects, in one embodiment, the disorder is metabolic syndrome.

[0213] In each of the foregoing aspects, in one embodiment, the disorder is diabetes.

[0214] In each of the foregoing aspects, in one embodiment, the disorder is cardiovascular disease.

[0215] In each of the foregoing aspects, in one embodiment, the disorder is hyperlipidemia.

[0216] In each of the foregoing aspects, in one embodiment, the disorder is a neurodegenerative disease.

[0217] In each of the foregoing aspects, in one embodiment, the disorder is cognitive impairment.

[0218] In each of the foregoing aspects, in one embodiment, the disorder is a mood disorder.

[0219] In each of the foregoing aspects, in one embodiment, the disorder is stress.

[0220] In each of the foregoing aspects, in one embodiment, the disorder is an anxiety disorder.

[0221] In each of the foregoing aspects, in one embodiment, the drug is for weight control.

[0222] In each of the foregoing aspects, in one embodiment, the drug is for increasing muscle performance.

[0223] In each of the foregoing aspects, in one embodiment, the drug is for increasing intellectual performance.

[0224] One aspect of the invention is a method of increasing or maintaining mitochondrial function. The method comprises the step of contacting a cell with an effective amount of a urolithin or a precursor thereof to increase the function of the mitochondria.

[0225] One aspect of the present invention is a method for treating, preventing, or controlling mitochondrial-related diseases or disorders associated with altered mitochondrial function or decreased mitochondrial density. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat a disease or disorder associated with altered mitochondrial function or decreased mitochondrial density.

[0226] One aspect of the present invention is a method for increasing the metabolic rate. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to increase the metabolic rate. As described elsewhere herein, precursors of urolithin may include, but are not limited to, ellagitannins, punicalagin, and ellagic acid.

[0227] One aspect of the present invention is a method for preventing or treating metabolic syndrome. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to prevent or treat metabolic syndrome.

[0228] One aspect of the present invention is a method for preventing or treating obesity. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to prevent or treat obesity.

[0229] One aspect of the present invention is a method for preventing or treating cardiovascular disease. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to prevent or treat cardiovascular disease.

[0230] One aspect of the present invention is a method for treating hyperlipidemia. The method comprises the step of administering to a subject in need thereof an effective amount of urolithin or a precursor thereof to treat hyperlipidemia. In one embodiment, the hyperlipidemia is hypertriglyceridemia. In one embodiment, the hyperlipidemia is elevated free fatty acids.

[0231] One aspect of the present invention is a method for treating metabolic disorders. The method comprises the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat a metabolic disorder. In one embodiment, the metabolic disorder is diabetes. In one embodiment, the metabolic disorder is obesity.

[0232] Aging

[0233] For neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), and amyotrophic lateral sclerosis (ALS), the greatest risk factor is aging. Mitochondria have been thought to contribute to aging through the accumulation of mitochondrial DNA (mtDNA) mutations and the net production of reactive oxygen species (ROS). Although most mitochondrial proteins are encoded by the nuclear genome, mitochondria contain multiple copies of their own DNA. Human mtDNA is a circular molecule of 16,569 base pairs that encodes 13 polypeptide components of the respiratory chain, as well as the rRNA and tRNA necessary to support protein synthesis within mitochondria, using its own genetic code. Genetic mutations in mtDNA are known to cause a variety of diseases, most of which affect the brain and muscles - tissues with high energy demands. It has been hypothesized that somatic mtDNA mutations that occur during aging contribute to the physiological decline that occurs in conjunction with aging and age-related neurodegeneration. It is well established that mtDNA accumulates mutations with aging, particularly large-scale deletions and point mutations. In the mtDNA control region, point mutations at specific sites can accumulate to high levels in certain tissues: T414G (in cultured fibroblasts), A189G and T408A (in muscle), and C150T (in white blood cells). However, these control region "hotspots" have not been observed in the brain. Point mutations at single nucleotides appear to occur at low levels in the brain, although the overall level may be high. Using a polymerase chain reaction (PCR)-cloning-sequencing strategy, the average level of point mutations in two protein-coding regions of brain mtDNA from elderly subjects was found to be approximately 2 mutations / 10 kb. The non-coding regions (which may be under lower selective pressure) may accumulate 2-4 times as many. The accumulation of these deletions and point mutations with aging is associated with a decline in mitochondrial function. For example, a negative correlation has been found between cytochrome oxidase activity in brain cells and an increased level of point mutations in the cytochrome oxidase gene (CO1).

[0234] The net production of ROS is another important mechanism by which mitochondria are thought to contribute to aging. Mitochondria contain multiple electron carriers capable of producing ROS, as well as an extensive network of antioxidant defenses. Mitochondrial damage, including its own oxidative damage, can cause an imbalance between ROS production and removal, leading to a net production of ROS. The importance of mitochondrial ROS net production for aging is supported by the following observations: enhancing mitochondrial antioxidant defenses can increase lifespan. In Drosophila, overexpression of the mitochondrial antioxidant enzyme manganese superoxide dismutase (MnSOD) and methionine sulfoxide reductase extends lifespan. This strategy has been successful in short-lived Drosophila strains, but has no effect in strains that are already long-lived. However, it has recently been demonstrated that overexpression of catalase targeted to mitochondria in experiments increases the lifespan of a long-lived mouse strain.

[0235] Cognitive decline during aging has been observed in aged animals and is thought to occur as a result of changes in the synaptic physiology of aged neurons. These changes are thought to lead to an overall global loss of the integrated functions of neuronal signaling in the brain (Bishop, Lu et al. 2010), and an increased susceptibility to the long-term effects of oxidative stress and inflammation (Joseph, Shukitt-Hale et al. 2005). The major cause of cell loss that occurs during normal aging is thought to be oxidative stress caused by free radicals generated by inefficient and partially uncoupled oxidative pathways. Indeed, it has been demonstrated that aging traits common among different species (Caenorhabditis elegans, Drosophila melanogaster, mice, rats, chimpanzees, and humans) have served as evidence of reduced mitochondrial function. This explanation is further validated by the observation that significant impairment of mitochondrial function shortens the lifespan of Caenorhabditis elegans (Rea, Ventura et al. 2007) and mice (Trifunovic, Wredenberg et al. 2004; Kujoth, Hiona et al. 2005). Improvement of mitochondrial function by overexpression of catalase in mice results in an extended lifespan (Schriner, Linford et al. 2005).

[0236] As aging progresses and mitochondrial function declines, neurons in the brain become more susceptible to age-dependent pathologies and cell death. This leads to a loss of connections between neurons and impaired neuronal function (neurotransmitter loss, firing deficits). There is also more evidence that neurons respond to unrepaired DNA damage by silencing gene expression through epigenetic mechanisms, leading to further inhibition of cell function. Additionally, aged neuronal cells in all species exhibit enhanced expression of genes involved in stress response pathways.

[0237] Many markers of these changes have been observed in in vitro cultures of aged neuronal cells, which exhibit reduced neurite outgrowth halos and process formation. This reduction can be reversed by neuronal growth factors (Rozovsky, Wei et al. 2005).

[0238] Neurodegenerative disorders

[0239] Neurodegenerative diseases are a heterogeneous group of disorders characterized by the progressive selective loss of anatomically or physiologically related neuronal systems. Prototypical examples include Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), and Huntington's disease (HD).

[0240] The early stages of neurodegeneration have many of the same markers as the declines observed in aging. Interestingly, it has been noted that diseases such as Alzheimer's disease exhibit an increasing prevalence with age, with over 50% of adults over the age of 85 showing the disease (Hebert, Scherr et al. 2003). As discussed above, declining mitochondrial function appears to be a hallmark of aging. This decline in neuronal function may have a significant impact on neuronal populations with high bioenergetic demands, one such group of neurons being the large pyramidal neurons that degenerate in Alzheimer's disease (Bishop, Lu et al. 2010). The decline of these types of neurons caused by impaired mitochondrial function may be the root cause of the onset of neurodegenerative diseases. A model of the effect of neurodegenerative disorders on neuronal survival can be established in vitro. When N2 neuronal cells are incubated with A-β (Aβ) peptide, which is thought to be a causative agent of Alzheimer's disease, there is a significant effect on the neurite growth halo, an effect that can be reversed by antioxidants. Manczak et al. (2010) J Alzheimers Dis. 20 Suppl 2:S609-31.

[0241] The most common form of cell death in neurodegeneration is through the intrinsic mitochondrial apoptotic pathway. This pathway controls the activation of caspase-9 by regulating the release of cytochrome c from the mitochondrial intermembrane space. The concentration of ROS (a normal byproduct of mitochondrial respiratory chain activity) is mediated in part by mitochondrial antioxidants such as manganese superoxide dismutase (SOD2) and glutathione peroxidase. The overproduction of ROS (oxidative stress) is an important feature of all neurodegenerative disorders. In addition to the production of ROS, mitochondria are also involved in life-sustaining functions, including: calcium homeostasis, mitochondrial fission and fusion, lipid concentration in the mitochondrial membrane, and mitochondrial permeability transition (MPT). Mitochondrial diseases that lead to neurodegeneration may involve all of these functions at least to some extent (DiMauro and Schon, 2008).

[0242] There is evidence that mitochondrial dysfunction and oxidative stress play a causative role in the pathogenesis of neurodegenerative diseases, including the four best-known diseases: Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis (also known as Lou Gehrig's disease).

[0243] Alzheimer's disease (AD) is clinically characterized by progressive cognitive decline and pathologically by the presence of senile plaques composed mainly of amyloid-β peptide (Aβ) and neurofibrillary tangles (which consist mainly of hyperphosphorylated tau). Approximately 5–10% of cases are familial and occur in an autosomal dominant, early-onset manner. Three proteins are known to be associated with such familial cases: amyloid precursor protein (APP) (which is sequentially cleaved by β- and γ-secretases to produce Aβ) and presenilin 1 and 2 (PS1 and PS2) (one or the other of which is a component of each γ-secretase complex). A large body of literature supports the role of mitochondrial dysfunction and oxidative damage in the pathogenesis of AD. Oxidative damage occurs early in the AD brain, prior to the onset of significant plaque pathology. Oxidative damage also precedes Aβ deposition in transgenic APP mice, where upregulation of genes associated with mitochondrial metabolism and apoptosis occurs even earlier and co-localizes with neurons that develop oxidative damage.

[0244] Several pathways linking oxidative stress and AD pathology have recently been revealed. Oxidative stress may activate signaling pathways that alter APP or tau processing. For example, oxidative stress increases β-secretase expression by activating c-Jun N-terminal kinase and p38 mitogen-activated protein kinase (MAPK) and increases abnormal tau phosphorylation by activating glycogen synthase kinase 3. Inactivation of key molecules induced by oxidants may also be important. In proteomic studies, the prolyl isomerase PIN1 was found to be particularly sensitive to oxidative damage. PIN1 catalyzes protein conformational changes that affect APP and tau processing. Knockout of Pin1 increases amyloid formation, APP processing, and intracellular Aβ levels in mice. Pin1-knockout mice also exhibit tau hyperphosphorylation, motor and behavioral deficits, and neuronal degeneration. Oxidation-induced damage to PIN1 and similarly sensitive proteins is thus important in promoting neurodegeneration.

[0245] Mitochondria also play an important role in Parkinson's disease (PD), which is clinically characterized by progressive rigidity, bradykinesia, and tremor and pathologically by the loss of pigmented neurons in the substantia nigra and the presence of Lewy bodies (characteristic cytoplasmic inclusions immunoreactive for α-synuclein and ubiquitin).

[0246] Mitochondria are first implicated in PD because MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), whose metabolite MPP+ inhibits complex I of the mitochondrial electron transport chain, causes parkinsonism in abusers of the synthetic hallucinogen. This model has been refined in experimental animals, where chronic infusion of rotenone (another complex-I inhibitor) or MPTP clinically results in a parkinsonian phenotype and pathologically in substantia nigra degeneration (which is immunoreactive for cytoplasmic inclusions of α-synuclein and ubiquitin). The toxic mechanism in these complex-I inhibition models may involve oxidative stress. Complex-I inhibition and oxidative stress are implicated in naturally occurring PD when complex-I deficiency and glutathione depletion are found in the substantia nigra of patients with idiopathic PD and in pre-symptomatic PD patients.

[0247] Many genes associated with PD also involve mitochondria in disease pathogenesis. To date, mutations or polymorphisms in mtDNA and at least nine named nuclear genes have been identified as causing PD or influencing PD risk: α-synuclein, parkin, ubiquitin carboxyl-terminal hydrolase L1, DJ-1, phosphatase and tensin homolog (PTEN)-induced kinase 1 (PINK1), leucine-rich repeat kinase 2 (LRRK2), nuclear receptor NURR1, HTRA2, and tau. Among the nuclear genes, α-synuclein, parkin, DJ-1, PINK1, LRRK2, and HTRA2 are directly or indirectly involved in mitochondria. In a few cases, inherited mtDNA mutations cause parkinsonism, usually as a feature of a larger syndrome. In one family, the Leber's hereditary optic neuropathy G11778A mutation is associated with l-DOPA-responsive parkinsonism, occurring indeterminately with dementia, dystonia, ophthalmoplegia, and ataxia. Notably, the mutation is in a subunit of complex I. Mutations in the nuclear-encoded mtDNA polymerase-γ (POLG) gene impair mtDNA replication and result in multiple mtDNA deletions, usually causing chronic progressive external ophthalmoplegia and myopathy. In such families, POLG mutations also co-segregate with parkinsonism.

[0248] Amyotrophic lateral sclerosis (ALS) is clinically characterized by progressive weakness, atrophy, and spasticity of muscle tissue, which reflects degeneration of upper and lower motor neurons in the cortex, brainstem, and spinal cord. Approximately 90% of cases are sporadic (SALS), and 10% are familial (FALS). Approximately 20% of familial cases are caused by mutations in Cu / Zn-superoxide dismutase (SOD1). In both SALS and FALS, autopsy and biopsy samples from the spinal cord, nerves, and muscle exhibit abnormalities in mitochondrial structure, number, and localization. Defects in the activity of respiratory chain complexes have also been detected in muscle and spinal cord.

[0249] Huntington's disease (HD) is clinically characterized by chorea, psychiatric disorders, and dementia, and pathologically by the loss of medium spiny neurons in the cortex and striatum. HD is inherited in an autosomal dominant manner and is attributed to the expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene, which results in an expanded polyglutamine segment in the corresponding protein. The normal number of CAG (Q) repeats is less than 36; repeat numbers greater than 40 are associated with human disease. Multiple lines of evidence have confirmed the involvement of mitochondrial dysfunction in HD. Nuclear magnetic resonance spectroscopy has revealed increased lactate in the cortex and basal ganglia. Biochemical studies have shown a decline in the activity of complexes II and III of the electron transport chain in human HD brains. In striatal cells derived from mutant Htt-knockin mouse embryos, mitochondrial respiration and ATP production are significantly impaired.

[0250] One aspect of the invention is a method of treating neurodegenerative diseases, age-related neuronal death or dysfunction. As used herein, "neurodegenerative disease" or equivalent "neurodegenerative disorder" refers to any condition associated with the progressive loss of functional neurons in the central nervous system. In one embodiment, the neurodegenerative disease is associated with age-related cell death. Exemplary neurodegenerative diseases include, but are not limited to, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (also known as ALS and Lou Gehrig's disease), and AIDS dementia complex, adrenoleukodystrophy, Alexander's disease, Alpers' disease, ataxia telangiectasia, Batten disease, bovine spongiform encephalopathy (BSE), Canavan disease, corticobasal degeneration, Creutzfeldt-Jakob disease, dementia with Lewy bodies, familial fatal insomnia, frontotemporal dementia, Kennedy's disease, Krabbe disease, Lyme disease, Machado-Joseph disease, multiple sclerosis, multisystem atrophy, neuroacanthocytosis, Niemann-Pick disease, Pick's disease, primary lateral sclerosis, progressive supranuclear palsy, Refsum disease, Sandhoff disease, diffuse demyelinating sclerosis, spinocerebellar ataxia, subacute combined degeneration of the spinal cord, tabes dorsalis, Tay-Sachs disease, toxic encephalopathy, transmissible spongiform encephalopathy, and hedgehog wobbler syndrome.

[0251] In one embodiment, the method is for treating age-related neuronal death or dysfunction. Such methods involve neurodegeneration not attributable to a specific neurodegenerative disease (e.g., Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease, and Parkinson's disease).

[0252] In one embodiment, the neurodegenerative disease is selected from: Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease, and Parkinson's disease.

[0253] In one embodiment, the neurodegenerative disease is Alzheimer's disease.

[0254] The method comprises the steps of: administering to a subject in need of treatment for a neurodegenerative disease a therapeutically effective amount of urolithin or a precursor thereof, thereby treating the neurodegenerative disease.

[0255] For this and other methods according to the invention, "urolithin" as used herein refers to any one or combination of urolithin A, urolithin B, urolithin C, and urolithin D (see, e.g., Figure 1 and Figure 2 ). In one embodiment, the urolithin is urolithin A, urolithin B, urolithin C, urolithin D, or any combination of urolithin A, urolithin B, urolithin C, and urolithin D. In one embodiment, the urolithin is urolithin A, urolithin B, or a combination of urolithin A and urolithin B. In one embodiment, the urolithin is urolithin A. In one embodiment, the urolithin is provided as an isolated urolithin, e.g., isolated from a natural source or prepared by total synthesis. The isolated urolithin can be synthesized de novo. See, e.g., U.S. Patent Application Publication No. 2008 / 0031862 to Ghosal, the entire content of which is incorporated herein by reference.

[0256] In one embodiment, urolithin A (3,8-dihydroxydibenzo-α-pyrone) was synthesized in a two-stage synthesis. Stage 1 is a copper-catalyzed reaction (Hurtley reaction) that occurs in the presence of a base, in which the starting materials 2-bromo-5-methoxybenzoic acid and resorcinol are reacted together to produce a dihydro-dibenzo-pyrone scaffold. In Stage 2, the benzopyrone is demethylated with BBr3 to produce 3,8-dihydroxydibenzo-α-pyrone (urolithin A).

[0257] A mixture of 2-bromo-5-methoxybenzoic acid 1 (27.6 g), resorcinol 2 (26.3 g) and sodium hydroxide (10.5 g) in water (120 mL) was heated under reflux for 1 h. Then 5% aqueous copper sulfate solution (3.88 g CuSO4·5H2O in 50 mL water) was added and the mixture was refluxed for an additional 30 min. The mixture was cooled to room temperature and the solid was filtered on a Buchner funnel. The residue was washed with cold water (50 mL) to give a pale red solid (38.0 g), which was triturated in hot MeOH (200 mL). The suspension was left at 4 °C overnight. The resulting pale red precipitate was filtered and washed with cold MeOH (75 mL) to give the title compound 3 as a light brown solid. 1 1H NMR was based on the structure of 3.

[0258] At 0 °C, to a suspension of 3 (10.0 g; 41 mmol; 1.0 equiv) in anhydrous dichloromethane (100 mL) was added a solution of 1 M boron tribromide in anhydrous dichloromethane (11.93 mL of pure BBr3 in 110 mL of anhydrous dichloromethane). The mixture was left at 0 °C for 1 h and then allowed to warm to room temperature. The solution was stirred at this temperature for 17 h. The yellow precipitate was filtered and washed with cold water (50 mL) to give a yellow solid, which was heated to reflux in acetic acid (400 mL) for 3 h. The hot solution was filtered rapidly and the precipitate was washed with acetic acid (50 mL) and then with ether (100 mL) to give the title compound 4 as a yellow solid. The structure and purity were determined by 1 1H 13 and 13C-NMR.

[0259]

[0260] In one embodiment, the “urolithin” used herein is or can include glucuronidated, methylated or sulfated urolithin.

[0261] According to this and other methods of the invention, the “urolithin precursor” used herein refers to ellagitannin or ellagitannin metabolite, including but not limited to ellagic acid (EA). In one embodiment, the urolithin precursor is punicalagin (PA). In one embodiment, the urolithin precursor is punicacortein (PB). See, for example, Figure 1 . In one embodiment, the urolithin precursor is ellagic acid (EA). In one embodiment, the urolithin precursor is provided as an isolated urolithin precursor, for example, isolated from natural food sources or prepared by total synthesis. Isolated urolithin precursors are generally purified from natural sources or synthesized de novo; some urolithin precursors (including EA) are commercially available from suppliers such as Sigma Aldrich.

[0262] Also according to this and other methods of the invention, precursors of urolithins also include natural foods containing ellagitannins and ellagic acid, especially natural foods rich in ellagitannins, ellagic acid, or both ellagitannins and ellagic acid. Such foods include certain berries, grapes, pomegranates, rose hips, and nuts. In one embodiment, the natural food is pomegranate.

[0263] In addition, precursors of urolithins include processed foods and beverages prepared from such natural foods. The processed foods can be in any form, including, for example, jams, jellies, preserves, sauces, pastes, fruit juices, wines, extracts, concentrates, etc. In one embodiment, the processed food is pomegranate juice.

[0264] In one embodiment, the urolithin precursor is provided as an extract, for example, a fruit extract.

[0265] In one embodiment, the urolithin precursor is provided as a concentrate, for example, a fruit concentrate or a fruit juice concentrate.

[0266] The method of the invention can be used alone or in combination with any method or compound known to be useful for treating neurodegenerative diseases. For example, in one embodiment, the method of the invention can be combined with any one or more of the following: acetylcholinesterase inhibitors such as donepezil galantamine and rivastigmine and N-methyl-D-aspartic acid (NMDA) receptor antagonists such as memantine

[0267] One aspect of the invention is a method of improving cognitive function. As used herein, "cognitive function" refers to any mental process related to symbolic operations, such as perception, memory, attention, speech comprehension, speech production, reading comprehension, image formation, learning, and reasoning. In one embodiment, "cognitive function" refers to any one or more of perception, memory, attention, and reasoning. In one embodiment, "cognitive function" refers to memory.

[0268] The method includes the step of administering to a subject in need of improving cognition a therapeutically effective amount of a urolithin or its precursor, thereby improving cognitive function.

[0269] Methods for measuring cognitive function are well known and can include, for example, tests of any aspect of cognitive function, either alone or in combination. One such test is the Prudhoe Cognitive Function Test. Margallo-Lana et al. (2003) J IntellectDisability Res. 47:488-492. Another such test is the Mini Mental State Exam (MMSE), which is used to evaluate time and space orientation, registration, attention and calculation, recall, language use and comprehension, repetition, and complex commands. Folstein et al. (1975) J Psych Res. 12:189-198. Other tests that can be used to measure cognitive function include the Alzheimer Disease Assessment Scale-Cognitive (ADAS-Cog) (Rosen et al. (1984) Am J Psychiatry. 141(11):1356-64) and the Cambridge Neuropsychological Test Automated Battery (CANTAB) (Robbins et al. (1994) Dementia. 5(5):266-81). Such tests can be used to objectively evaluate cognitive function such that changes in cognitive function can be measured and compared, for example, in response to treatment according to the methods of the present invention.

[0270] The methods of the present invention can be used alone or in combination with any method or compound known to improve cognitive function. For example, in one embodiment, the methods of the present invention are combined with the use of caffeine or nicotine or both.

[0271] In one embodiment, the subject does not have a cognitive disorder. For example, the methods can be used to enhance the cognitive function of a subject with normal cognitive function.

[0272] One aspect of the present invention is a method for treating a cognitive disorder. As used herein, cognitive disorder refers to any condition that impairs cognitive function. In one embodiment, "cognitive disorder" refers to any one or more of delirium, dementia, learning disorder, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD). In one embodiment, the cognitive disorder is a learning disorder. In one embodiment, the cognitive disorder is attention deficit disorder (ADD). In one embodiment, the cognitive disorder is attention deficit hyperactivity disorder (ADHD).

[0273] The method comprises the following steps: administering a therapeutically effective amount of urolithin or its precursor to a subject in need of treatment for cognitive impairment to treat the cognitive impairment.

[0274] The method of the present invention can be used alone or in combination with any method or compound known to be useful for treating cognitive impairment. For example, in one embodiment, the method of the present invention is combined with the use of a stimulant such as methylphenidate (e.g., ), dextroamphetamine mixed amphetamine salts dextromethamphetamine and lisdexamphetamine

[0275] One aspect of the present invention is a method for treating or preventing stress-induced or stress-related cognitive dysfunction. As used herein, "stress-induced or stress-related cognitive dysfunction" refers to cognitive dysfunction induced by or related to stress. The method comprises the following steps: administering a therapeutically effective amount of urolithin or its precursor to a subject in need of treatment or prevention of stress-induced or stress-related cognitive dysfunction to treat or prevent stress-induced or stress-related cognitive dysfunction.

[0276] Mood disorder

[0277] The metabolism of brain tissue (including maintaining transmembrane potential, signal transduction, and synaptic remodeling) requires a high level of energy. An increase in psychiatric symptoms and disorders, particularly depression, may be present in patients with mitochondrial diseases.

[0278] Mitochondrial structure and function measured by a variety of different techniques have been shown to be abnormal in patients with mood disorders, including major depression, and in other affective spectrum disorders.

[0279] Two studies have revealed that a several-fold increased likelihood of developing depression can be maternally inherited with mtDNA, strongly suggesting that mtDNA sequence variants may induce mitochondrial dysfunction, which can render an individual prone to developing depression (Boles et al., 2005; Burnett et al., 2005).

[0280] The association between mitochondrial dysfunction and unipolar depression has been explored in several studies. In studies of autopsy brains from subjects with suspected or diagnosed major depression, most of whom were (presumably) medicated, no increase in the common 5-kb mtDNA deletion was detected (Kato et al., 1997; Sabunciyan et al., 2007; Shao et al., 2008, Stine et al., 1993). Alterations in translation products associated with mitochondrial function were found in the frontal cortex, prefrontal cortex, and third visual cortex (Karry et al., 2004; Whatley et al., 1996). Alterations in 4 mitochondrial proteins have been reported in the anterior cingulate cortex (Beasley et al., 2006). Decreased gene expression of 6 / 13 mtDNA-encoded transcripts in frontal cortex tissue (Brodmann areas (BA) 9 and 46) (Shao et al., 2008) and decreased gene expression of nDNA-encoded mitochondrial mRNAs and proteins in the cerebellum (Ben-Shachar and Karry, 2008) have also been reported in major depression. In a recent study, levels of the electron transport chain complex I subunit (NDUFS7) and complex I activity were found to be lower than normal controls or at the lower end of the normal control range in autopsy prefrontal cortex in half of the cases of severe depressive disorder (Andreazza et al., 2010). In 2 subsequent studies, the authors were unable to detect any effect of medication on the results.

[0281] A decrease in the ratio of respiratory chain enzymes and the rate of ATP production and an increased prevalence of small mtDNA deletions (but not an increase in the common 5-kb mtDNA deletion) were found in muscle from patients with severe unipolar depression with accompanying somatic symptoms and a lifetime diagnosis. Medication did not appear to affect the results (Gardner et al., 2003b). The following finding suggests clinical relevance: essentially every depressed subject with a very high degree of somatic complaints demonstrated a low rate of ATP production in biopsied muscle (Gardner and Boles, 2008a).

[0282] One aspect of the invention is a method of treating mood disorders (also referred to as affective disorders). As used herein, "mood disorder" refers to a disturbance of mood state, such as that described in the Diagnostic and Statistical Manual of Mental Disorders published by the American Psychiatric Association. Mood disorders include, but are not limited to: major depression, postpartum depression, dysthymia, and bipolar disorder. In one embodiment, the mood disorder is major depression.

[0283] The method comprises the following steps: administering a therapeutically effective amount of urolithin or its precursor to a subject in need of treatment for a mood disorder to treat the mood disorder.

[0284] The method of the present invention can be used alone or in combination with any method or compound known to be useful for treating mood disorders. For example, in one embodiment, the method of the present invention is combined with the use of antidepressants. Antidepressants are well known in the art and include selective serotonin reuptake inhibitors (SSRI), serotonin-norepinephrine reuptake inhibitors (SNRI), noradrenergic and specific serotonergic antidepressants, norepinephrine reuptake inhibitors, norepinephrine-dopamine reuptake inhibitors, selective serotonin reuptake inhibitors, norepinephrine-dopamine disinhibitors, tricyclic antidepressants, and monoamine oxidase inhibitors.

[0285] One aspect of the present invention is a method for treating or preventing stress-induced or stress-related mood disorders. As used herein, "stress-induced or stress-related mood disorder" refers to a disorder of mood states induced by stress or related to stress. Such mood disorders are sometimes referred to as reactive mood disorders and can be distinguished from other mood disorders (e.g., so-called organic mood disorders). The method comprises the following steps: administering an effective amount of urolithin or its precursor to a subject in need of treatment or prevention of a stress-induced or stress-related mood disorder to treat or prevent the stress-induced or stress-related mood disorder.

[0286] One aspect of the present invention is a method for treating anxiety disorders. As used herein, "anxiety disorder" refers to a dysfunctional state of fear and anxiety, e.g., fear and anxiety that are disproportionate to a stressful situation or anticipation of a stressful situation. In one embodiment, the anxiety disorder is any one or combination of generalized anxiety disorder, panic disorder, panic disorder with agoraphobia, agoraphobia, social anxiety disorder, obsessive-compulsive disorder, and post-traumatic stress disorder. In one embodiment, the anxiety disorder is any one or combination of generalized anxiety disorder, obsessive-compulsive disorder, panic disorder, post-traumatic stress disorder, and social anxiety disorder. In one embodiment, the anxiety disorder is generalized stress disorder. In one embodiment, the anxiety disorder is post-traumatic stress disorder. In one embodiment, the anxiety disorder is stress-induced anxiety disorder.

[0287] The method comprises the following steps: administering an effective amount of urolithin or its precursor to a subject in need of treatment for an anxiety disorder to treat the anxiety disorder.

[0288] The method of the present invention can be used alone or in combination with any method or compound known to be useful for treating anxiety disorders. For example, in one embodiment, the method of the present invention is combined with the use of the following drugs: psychotherapy, benzodiazepines, buspirone or any one or combination of β-blockers. Benzodiazepines are well known in the art and include, but are not limited to, clonazepam lorazepam and alprazolam Other drugs that can be used in combination with the method of the present invention include imipramine and venlafaxine

[0289] One aspect of the present invention is a method for treating or preventing stress-induced or stress-related anxiety disorders. As used herein, "stress-induced or stress-related anxiety disorder" refers to a dysfunctional state of fear and anxiety induced by stress or related to stress. Such anxiety disorders are sometimes referred to as reactive anxiety disorders and can be distinguished from other anxiety disorders (e.g., so-called organic anxiety disorders). The method comprises the step of administering to a subject in need of treatment or prevention of a stress-induced or stress-related anxiety disorder an effective amount of urolithin or a precursor thereof to treat or prevent the stress-induced or stress-related anxiety disorder.

[0290] One aspect of the present invention is a method for promoting neurite growth halo. In one embodiment, the method is an in vitro method. In one embodiment, the method is an in vivo method. As used herein, "neurite" refers to any protrusion from the cell body of a neuron. In one embodiment, such a protrusion is an axon. In one embodiment, such a protrusion is a dendrite. This term is often used when describing immature or developing neurons (especially neurons in cultured cells) because it is difficult to distinguish axons from dendrites before the end of differentiation. Neurites are often filled with microtubule bundles, and their growth is stimulated by nerve growth factor (NGF), as well as tau protein, microtubule-associated protein 1 (MAP1), and microtubule-associated protein 2 (MAP2). The neural cell adhesion molecule N-CAM binds to another N-CAM and fibroblast growth factor receptor simultaneously to stimulate the tyrosine kinase activity of the receptor, thereby inducing neurite growth.

[0291] Neurite growth halo can be measured morphologically or functionally. Morphological measurements generally require microscopy to measure the length and / or number of neurites.

[0292] As used herein, "promote" means enhance or induce. In one embodiment, "promote" means induce. For example, the neurite growth halo in a negative control sample may be negligible, while the neurite growth halo in an experimental sample or a treated sample may not be negligible. In one embodiment, "promote" means enhance. For example, the neurite growth halo in a negative control sample may not be negligible, while the neurite growth halo in an experimental sample or a treated sample may be statistically significantly greater than that of the negative control. Of course, "promote" as used herein can include both enhance and induce.

[0293] In one embodiment, the method comprises the step of contacting a nerve cell with an effective amount of urolithin or its precursor to promote neurite growth halo.

[0294] In one embodiment, the method comprises the step of administering a therapeutically effective amount of urolithin or its precursor to a subject in need thereof to promote neurite growth halo.

[0295] The method of the present invention can be used alone or in combination with any method or compound known to be useful for promoting neurite growth halo. For example, in one embodiment, the method of the present invention can be combined with any one or more of the following: NGF, tau protein, MAP1, MAP2, N-CAM, or a reagent that induces the expression of any one or more of NGF, tau protein, MAP1, MAP2, N-CAM, or fibroblast growth factor receptor.

[0296] Screening compounds for neuroprotective activity using in vitro neuronal cells

[0297] During aging and neurodegeneration, the progressive decline in cognitive function is mainly due to the loss of entities that maintain neuronal communication. These entities mainly consist of neuronal cell bodies, neurites, and synaptic contacts that connect them to target cells. Neurons exhibit very complex morphology. The most complex neuronal cell types (such as motor neurons with axonal projections up to 1 meter in length, or substantia nigra dopaminergic neurons that form more than 150,000 synaptic contacts) are often the most vulnerable during normal aging or disease. To maintain such a complex architecture and effectively transmit electrical and neurochemical signals, neurons are highly dependent on energy supply. Therefore, axonal transport, synaptic activity, and the maintenance of ion gradients are highly dependent on mitochondrial function. To achieve these highly demanding cellular functions, neurons have difficulty maintaining mitochondrial activity and ensuring a delicate balance of oxidative stress over time. Such imbalances are often regarded as the cause of neuronal dysfunction or premature degeneration.

[0298] Thus, it is envisioned that any treatment that promotes neuron survival, or the formation of neuronal processes and synaptic contacts that constitute the complex architecture of neurons, will positively impact neuronal function. Measurement of the effect of a compound on neuronal function typically relies on the lengthy monitoring of animal behavioral outcomes, which is not suitable for medium or high-throughput screening of bioactivity. In vitro models based on neuroblastoma cell lines or primary neuron cultures represent an accepted alternative for assessing the effect of a compound on important morphological parameters that reflect the ability of neurons in the mammalian brain to maintain their normal function. Metrics such as the number of processes, their length or complexity, will reveal the effect of the compound on key steps in intracellular signaling. Although it should be borne in mind that such parameters only indirectly reflect the performance of higher brain functions, they will provide a valuable estimate of compound potency, which can be translated into improved cognitive or motor function in normal or diseased conditions.

[0299] Metabolic disorders

[0300] Mitochondrial function in key metabolic tissues (liver, muscle, adipose tissue, pancreas) is involved in the pathogenesis of metabolic diseases. In each such tissue, mitochondrial oxidative activity must appropriately fully oxidize the nutrient load, particularly fatty acids. Failure of complete oxidation can lead to the accumulation of lipid intermediates, incomplete fatty acid oxidation products, and ROS. These cellular events together contribute to fat accumulation, insulin resistance, altered insulin secretion, low-grade inflammation, and oxidative stress, which are all components of type II diabetes and obesity.

[0301] The importance of mitochondrial activity in the pathogenesis of metabolic diseases has been established in several studies in humans. For example, insulin resistance in skeletal muscle has been associated with defects in mitochondrial oxidative phosphorylation, with a 30% decrease in mitochondrial activity observed in the insulin-resistant offspring of type II diabetic patients compared to control subjects. Petersen KF, et al. (2004) New Engl J Med. 350:664 - 71. It has also been observed that obese patients exhibit a 20% decrease in mitochondrial activity and a 35% decrease in mitochondrial size compared to healthy lean subjects. Petersen KF, et al. (2003) Science 300:1140 - 2. Finally, age-related mitochondrial decline promotes insulin resistance in the elderly. Thus, a 40% decrease in mitochondrial oxidation and phosphorylation activity has been reported in the elderly compared to young subjects. These observations link mitochondrial dysfunction to metabolic disorders, particularly "diabesity" (Kelley DE, et al. (2002) Diabetes 51:2944 - 50).

[0302] Mitochondrial oxidative activity (also known as oxidative phosphorylation) can be regarded as a key determinant underlying the risk of metabolic diseases. A decrease in mitochondrial activity can be mediated by genetic factors (e.g., family history, ethnicity), epigenetic mechanisms, developmental exposures, eating behavior, and aging.

[0303] When persistent fuel excess (e.g., from overeating or impaired fat storage) exceeds energy demands and / or oxidative capacity, and / or there is insufficient appropriate compensatory mechanism (e.g., due to mitochondria being unable to adapt to higher cellular oxidative demands because of insufficient activity or malfunction), there is an increased risk of metabolic disorders. The resulting lipid accumulation and oxidative stress can alter transcriptional responses and damage mitochondria, further reducing oxidative phosphorylation capacity, causing harmful effects of fuel excess, and thus increasing the risk of metabolic disorders.

[0304] The sufficiency of complete oxidation of fatty acids depends on the balance between: (i) net mitochondrial oxidative activity (depending on the need to generate energy to meet cellular demands, e.g., contraction and ion transport), and (ii) fuel availability (depending on food intake, body fat percentage, and fat storage capacity). Equilibrium is achieved when oxidative activity equals or exceeds the fuel load.

[0305] Under normal homeostatic conditions, oxidative activity and cellular fuel availability can be altered to ensure that mitochondrial function is appropriate for the surrounding metabolic environment. For example, exercise can increase the cellular demand for energy, and weight loss and / or reduced food intake can decrease fuel availability. In this context, inter-individual differences in oxidative capacity and / or activity, fuel load, or the ability to regulate mitochondrial activity (acute response), increase mitochondrial capacity (chronic response), or resolve oxidative stress, will determine the set point of metabolic balance. Such differences can become prominent, especially in an obesogenic environment (characterized by an environment that promotes increased total food intake, unhealthy food intake, and physical inactivity). Thus, individuals with high oxidative capacity or adaptive responses will have a high tolerance for large fuel loads. In contrast, individuals with reduced oxidative capacity and / or suboptimal adaptive responses will not tolerate moderately high fuel loads, leading to lipid accumulation, incomplete oxidation, ROS production, and insulin resistance.

[0306] Insufficient compensation can lead to chronic insulin resistance and metabolic disorders over time. Compensatory mechanisms that increase oxidative capacity (e.g., exercise) or reduce fuel load (weight loss) can address insufficient oxidative capacity. However, for most overweight / obese and type II diabetes or prediabetes subjects, these lifestyle changes often appear insufficient or unachievable.

[0307] Mitochondria are particularly important for skeletal muscle function because the intermittent contractions pose high oxidative demands on this tissue. Mitochondria play a key role in ensuring sufficient levels of ATP required for the contraction of muscle myofibrillar sarcomeres. This high demand for ATP by myofibrillar sarcomeres may have promoted distinct sub-sarcolemmal and myofibrillar sarcomere-associated mitochondrial populations in muscle. In addition, muscle cells must maintain metabolic flexibility, that is, the ability to rapidly regulate substrate oxidation as a function of the surrounding hormonal and energetic conditions. For example, healthy muscle tissue oxidizes lipids mainly in the fasting state, as evidenced by a low respiratory quotient (RQ), and then switches to carbohydrate oxidation (increased RQ) during the fed state. The availability of fuels, particularly lipids, and the ability to oxidize them within mitochondria are also crucial for sustained exercise. Thus, mitochondrial functional capacity may directly affect muscle metabolic function and, because of its large contribution to overall mass, may have a significant impact on whole-body metabolism. This possibility is supported by the finding that mitochondrial content in skeletal muscle is increased in individuals with high metabolism and resistance to weight gain (Luft syndrome).

[0308] Insulin resistance and diabetes

[0309] Skeletal muscle is the largest insulin-sensitive organ in humans, accounting for over 80% of insulin-stimulated glucose consumption. Thus, insulin resistance in this tissue has a major impact on whole-body glucose homeostasis. Indeed, multiple metabolic defects have been observed in muscles from insulin-resistant but normoglycemic subjects (at high risk for diabetes development), including: (i) reduced insulin-stimulated glycogen synthesis; (ii) altered insulin signal transduction; and (iii) increased muscle lipid accumulation. Although it remains unclear whether any of these defects causally contribute to insulin resistance, intramyocellular lipid excess is strongly correlated with the severity of insulin resistance (even after correcting for obesity) and has been observed in muscles of multiple fiber types. In addition, lipid excess has been experimentally associated with the induction of insulin resistance and altered insulin signal transduction. Thus, a possible mechanism by which impaired mitochondrial function promotes insulin resistance is via altered fatty acid metabolism. Increased tissue lipid load (such as in obesity) and / or sustained inactivity may lead to the accumulation of fatty acyl-CoA, diacylglycerol, ceramides, products of incomplete oxidation, and ROS, all of which have been experimentally associated with reduced insulin signaling and action. Other mechanisms that may link impaired mitochondrial oxidative function to insulin resistance include: (i) reduced ATP synthesis for energy-requiring functions such as insulin-stimulated glucose uptake; (ii) abnormalities in calcium homeostasis (required for exercise-induced glucose uptake); and (iii) reduced ATP production during exercise, which may over time contribute to reduced aerobic capacity, muscle fatigue, and reduced voluntary exercise - further promoting the vicious cycle of inactivity-stimulated insulin resistance defects.

[0310] Mitochondrial capacity is important for the key function of pancreatic β-cell-regulated insulin secretion. Rapid (first-phase) and more prolonged (second-phase) insulin secretion depend on glucose metabolism and mitochondrial oxidative capacity; glucose oxidation increases the ATP / ADP ratio, thereby inhibiting plasma membrane K-ATP channels and allowing voltage-gated calcium channels to open. Increased cytoplasmic calcium then triggers exocytosis of insulin granules docked at the plasma membrane (first phase). Subsequent recruitment of granules to the plasma membrane (second phase) appears to depend on mitochondrial metabolites generated by anaplerosis. Transient and controlled production of ROS also requires mitochondrial metabolism and is required for the mitochondrial signaling pathway that triggers granule exocytosis.

[0311] Mitochondrial diabetes develops only after aging, with an average age of onset between 35 - 40 years (for maternally inherited diabetes and deafness (MIDD)) and 48 years (for 14577T / C, a mitochondrial DNA missense mutation in maternally inherited type II diabetes). This contrasts with diabetes in young children in syndromes such as maturity - onset diabetes of the young 2 (MODY2), in which mutations in glucokinase (the first step of glycolysis) result in attenuated glucose - stimulated ATP production and insulin secretion. These data suggest that mitochondrial diabetes is more likely to result from a gradual decline in β - cell function rather than from acute functional deficits caused by insufficient ATP production.

[0312] Mitochondrial function in the tissues involved in the pathogenesis of diabetes (liver, muscle, adipose tissue, and pancreatic β - cells) is crucial for multiple aspects of cellular metabolism. In each such tissue, mitochondrial oxidative activity must appropriately fully oxidize the nutrient load, particularly fatty acids. Failure of complete oxidation can lead to the accumulation of lipid intermediates, incomplete fatty acid oxidation products, and ROS, thereby inducing insulin resistance (in muscle, liver, adipose) and altered secretion (in β - cells).

[0313] A mild deficiency of mitochondrial activity, and / or the inability to increase activity and capacity in response to cellular energy demands, can account for the reduced exercise capacity observed in individuals with a family history of diabetes. This phenotype promotes decreased voluntary exercise over time and increases the likelihood of imbalance between mitochondrial activity and fatty acid load. Secondly, chronic imbalances in energy metabolism caused by overnutrition, obesity, and inactivity can directly contribute to increased cellular and mitochondrial ROS production. Excessive ROS can in turn induce insulin resistance and mitochondrial dysfunction. For example, a high - fat high - sucrose diet in diabetes - prone C57BL6 mice causes mitochondrial alterations, along with concomitant enhanced ROS production and impaired insulin sensitivity. Similarly, in vitro exposure of myocytes to saturated fatty acids or high - fat feeding in mice leads to changes in mitochondrial structure and insulin resistance, which can be reversed by antioxidants. Thus, oxidative stress can induce mitochondrial dysfunction and concomitant insulin resistance - perhaps an adaptive response aimed at limiting further oxidative damage. Importantly, the elimination of oxidative stress can reverse insulin resistance.

[0314] Muscle performance

[0315] In other embodiments, the present invention provides methods for enhancing muscle performance by administering a therapeutically effective amount of an extract, formulation, or compound that enhances or activates mitochondria. For example, extracts containing ellagitannins or ellagic acid, or compositions containing ellagitannins, ellagic acid, or urolithins, act to activate mitochondria and can be used to improve physical endurance (e.g., the ability to perform physical tasks such as exercise, physical labor, sports activities, etc.), inhibit or delay physical fatigue, increase blood oxygen levels, increase energy in healthy individuals, enhance work capacity and endurance, reduce muscle fatigue, reduce stress, enhance heart and cardiovascular function, improve sexual ability, increase muscle ATP levels, and / or reduce lactic acid in the blood. In certain embodiments, the methods include administering an amount of a natural extract containing ellagitannins or ellagic acid, or a composition containing ellagitannins, ellagic acid, or urolithins, that increases mitochondrial activity, increases mitochondrial biogenesis, and / or increases mitochondrial mass.

[0316] Athletic ability refers to the performance ability of an athlete's muscles when participating in sports activities. Enhanced athletic ability, strength, speed, and endurance are measured by an increase in muscle contraction intensity, an increase in muscle contraction amplitude, or a shortening of the muscle reaction time between stimulation and contraction. An athlete is an individual who participates in sports at any level and who seeks to achieve improved levels of intensity, speed, or endurance in their performance, e.g., fitness enthusiasts, cyclists, long-distance runners, and short-distance runners. Enhanced athletic ability is manifested as the ability to overcome muscle fatigue and the ability to maintain activity over a longer period of time with more effective practice.

[0317] It is contemplated that the compositions and methods of the present invention are also effective in treating muscle-related pathological conditions, including: myopathies, neuromuscular diseases such as Duchenne muscular dystrophy, acute sarcopenia, e.g., muscle atrophy and / or cachexia associated with burns, bed rest, limb immobilization, or major thoracic, abdominal, and / or orthopedic surgeries.

[0318] Chronic stress

[0319] It has also been reported that chronic stress has a significant impact on cognitive performance, and more precisely on learning and memory processes (Sandi 2004; Sandi and Pinelo-Nava 2007). Several factors are determinants of the impact of chronic stress on cognitive function. The level of stress is important in determining whether stress enhances or is detrimental to cognitive function. It is thought that in response to a stressful situation, the body induces stress hormones, which have a U-shaped effect on learning, memory, and plasticity. Baldi et al. (2005) Nonlinearity Biol Toxicol Med. 3(1):9-21; Joels (2006) Trends Pharmacol Sci. 27(5):244-50. Thus, the level of stress has a major impact on cognitive function, with high levels of stress leading to high levels of stress hormones and decreased performance.

[0320] It has also been demonstrated that the duration of stress (chronic versus acute) plays an important role, having different effects on cognitive function, as well as on brain structure and function (Sandi and Loscertales 1999; Pinnock and Herbert 2001). Also, stress acts on the memory formation process, producing different outcomes, with acute stress promoting consolidation (memory storage) and inhibiting retrieval (memory recall) (Roozendaal 2003). Additionally, the predictability of stress also plays a role in the severity of the effects observed on cognitive performance (Maier and Watkins 2005).

[0321] Furthermore, the context in which chronic stress occurs, as well as individual differences in the inherent stress response and gender, play important roles in determining the ultimate cognitive impact of chronic stress (Bowman, Beck et al. 2003; Shors 2004; Joels, Pu et al. 2006). The biological basis of the effects of chronic stress is not yet clear. However, a frequently observed feature is the key role of glucocorticoids in mediating (both promoting and impairing) the effects of stress on different memory processes and stages. Although the mechanism of action of glucocorticoids remains to be elucidated, it has been demonstrated in vitro that they impair the neuronal growth halo induced by nerve growth factor (NGF). Unsicker et al. (1978) Proc Natl Acad Sci USA. 75:3498-502. In addition, the neuronal structure and neurite growth halo induced by factors such as NGF are strongly correlated with their neuroprotective activity, again suggesting that neuronal structure is important for cognition.

[0322] Stress and Structural Remodeling

[0323] Initially, the hippocampus was the brain region receiving intensive attention because many reports pointed out the detrimental effects of chronic stress on hippocampus-dependent memory tasks. However, focused work is now providing evidence for a more global impact of chronic stress throughout the brain, and significant changes in the prefrontal cortex and amygdala have also been reported. Changes in dendritic branching and synaptogenesis occurring in the amygdala are plausible candidate causes for stress-induced mood alterations. Also, changes occurring at the hippocampal and prefrontal cortex levels are thought to play a key role in stress-induced mood alterations.

[0324] Hippocampus. The important role of the hippocampus in the memory process is well-known. Hippocampus-dependent tasks are generally affected by acute and chronic stress manipulations. In humans, neuroimaging studies have reported stress-related hippocampal atrophy and glucocorticoid-related cognitive and neuropsychiatric alterations, including depression.

[0325] In rodents, the prominent and repeatedly reported effect is dendritic atrophy in the apical dendrites of CA3 pyramidal neurons. This reduced dendritic branching has been associated with: (i) a decrease in the synaptic density of excitatory glutamatergic synapses; (ii) shrinkage of the volume of complex dendritic spines called dendritic tumors, which are located on proximal apical dendrites and the cell bodies of CA3 pyramidal cells and serve as postsynaptic targets for mossy fiber synaptic inputs; and (iii) rearrangement of synaptic vesicles and mitochondria in the terminal of the input mossy fibers. In turn, evidence of synaptic remodeling (in the form of changes in synaptic characteristics) in the hippocampal CA1 region has also been reported.

[0326] Prefrontal cortex. The prefrontal cortex (PFC), and more specifically its medial part (mPFC), plays a key role in higher cognitive processes (including executive function, working memory, attention) and in the integration of cognitive and emotion-related information. It should be noted that the mPFC contains high levels of glucocorticoid receptors and is involved in the regulation of stress-induced hypothalamic–pituitary–adrenal (HPA) activity. As pointed out above, clinical evidence highlights the mPFC as a region that undergoes significant alterations in a variety of neuropsychiatric disorders, including depression.

[0327] Abundant evidence from rodent studies has shown stress-induced dendritic shrinkage in the PFC. Specifically, significant neuronal remodeling has been described as occurring in layer II / III of the mPFC as a consequence of repeated exposure to chronic stress or repeated glucocorticoid treatment. The significant changes described in this region are: (i) dendritic atrophy, including a decrease in the total length and number of apical dendrites from pyramidal neurons; and (ii) a decrease in apical dendritic spine density (loss of approximately 1 / 3 of all axo-spinous synapses on the apical dendrites of pyramidal neurons).

[0328] Antidepressant effects. Treatment with the atypical (modified tricyclic) antidepressant tianeptine has been shown to reverse the dendritic atrophy induced by chronic stress in CA3 pyramidal neurons of rats. In addition, antidepressants have been reported to promote axonal and dendritic sprouting. These findings suggest that antidepressants can have a significant impact on neuronal remodeling, thus providing a basis for the circuitry to be reconfigured during recovery from depression.

[0329] Early life stress

[0330] One aspect of the present invention is a method for treating the mood effects of early life stress. The method comprises the steps of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof to treat the effects of early life stress on mood, depression, anxiety, and risk-taking behavior.

[0331] It has been reported that early life stress has a significant detrimental effect on cognitive performance, including psychological parameters such as increased proportions or susceptibilities to depression, anxiety, and abnormal risk-taking behavior. Heim C, Nemeroff CB. (2001) Biol Psychiatry 49:1023 - 1039. High proportions of attention deficit / hyperactivity disorder (ADHD), post-traumatic stress disorder (PTSD), and major depression have been reported in individuals who have experienced early life stress. Famularo R et al. (1992) J Am Acad Child Adolesc Psychiatry 31:863 - 867; Pelcovitz D et al. (1994) J Am Acad Child Adolesc Psychiatry 33:305 - 312. Early life stress is thought to have an impact on the hypothalamic - pituitary - adrenal (HPA) axis. Ladd CO et al. (2000) Prog Brain Res 122:81 - 103. The key effector thought to control the responsiveness of the HPA axis to stress is central corticotropin-releasing factor (CRF).

[0332] CRF is a 41-amino acid peptide that is widely distributed throughout the CNS. This includes the cell bodies in the medial parvocellular part of the paraventricular nucleus (PVN) of the hypothalamus, which is an important component of the HPA axis. After stress, CRF is released from median eminence nerve endings into the hypothalamic - pituitary portal circulation and is transported to the anterior pituitary, where it binds to CRF receptors (CRF1 and CRF2). CRF binding to the CRF1 receptor produces effects manifested as stress, depression, and anxiety. CRF binding to the CRF2 receptor stimulates the production and release of adrenocorticotropic hormone (ACTH), which in turn stimulates the production of glucocorticoids involved in the stress response.

[0333] In an early life stress model caused by maternal separation, consistently elevated levels of CRF mRNA were observed over the long term. Plotsky PM et al. (2005) Neuropsychopharmacology 30:2192-2204. It has been demonstrated that such an increase in CRF plays a role in increasing the anxiety response at the amygdala level. It has been suggested that persistent sensitization of the CRF neural circuitry gives rise to the abnormally elevated anxiety, depressive disorders, and risk-taking behaviors observed in mice exposed to early life stress.

[0334] Current strategies for using antidepressants to improve psychological disorders caused by early life stress

[0335] Numerous studies have confirmed that antidepressants reduce CRF activity in the HPA axis in rodents and primates, including humans. Banki CM et al. (1992) J Affect Disord 25:39-45; Brady LS et al. (1992) Brain Res 572:117-125; Brady LS et al. (1991) J Clin Invest 87:831-837; DeBellis MD et al. (1993) Am J Psychiatry 150:656-657; Veith RC et al. (1993) Psychiatry Res 46:1-8. Several classes of antidepressant medications appear to cause a decrease in the activity of one or more CRF neural systems. These include selective 5-HT reuptake inhibitors (SSRI), which have been shown to be effective in treating several mental disorders that have been associated with early life stress (e.g., depression and PTSD). Hidalgo RB et al. (2000) J Psychopharmacol 14:70-76. Notably, in randomized placebo-controlled trials, subjects who have experienced early life stress and have PTSD respond to fluoxetine. van der Kolk BA et al. (1994) J Clin Psychiatry 55:517-522. In addition, SSRI (including fluoxetine and paroxetine) have shown significant efficacy compared to placebo in the treatment of early-onset depression in children and adolescents. Martin A et al. (2000) Child Adolesc Psychiatr Clin NAm 9:135-157. It has also been found that tricyclic antidepressants reverse the increased HPA axis reactivity to stress in adult primates exposed to maternal separation. Suomi SJ. (1991) Ciba Found Symp 156:171-183. Several available medications (including SSRI) appear to be potentially beneficial in the treatment of children and adults exposed to early life stress. Fisher PA et al. (2000) J Am Acad Child Adolesc Psychiatry 39:1356-1364.

[0336] Other Indications

[0337] The present invention can also be used to treat any one of a variety of other diseases and conditions in which: defective or reduced mitochondrial activity is involved in the pathophysiology of the disease or condition, or increased mitochondrial function would produce a desired beneficial effect. As an example, the present invention additionally includes methods and compounds that can be used to treat male infertility associated with reduced sperm motility. Nakada et al. (2006) Proc Natl Acad Sci USA. 103:15148-53. As another example, the present invention additionally includes methods and compounds that can be used to treat macular degeneration and certain other age-related and genetic eye diseases. Khandhadia et al. (2010) Expert Rev Mol Med. 12:e34; Jarrett et al. (2010) Ophthalmic Res. 44:179-90. Another example is a method of treating hearing loss, including but not limited to age-related hearing loss. In each of these and other indications, the method includes: administering to a subject in need of such treatment an effective amount of urolithin or its precursor as disclosed herein to treat the indication.

[0338] Formulations and clinical applications

[0339] As used herein, the term "subject" refers to a living vertebrate. In one embodiment, the subject is a mammal. In one embodiment, the subject is a human.

[0340] As used herein, the term "treatment" when used in connection with a disease, disorder or condition of a subject means that at least one clinical or objective manifestation of the disease, disorder or condition of the subject is reduced by a detectable amount. In one embodiment, the term "treatment" when used in connection with a disease, disorder or condition of a subject means curing the disease, disorder or condition of the subject.

[0341] Urolithin or its precursor can be administered to a subject (e.g., a mammal) alone or together with other agents in a variety of ways. For example, urolithin or its precursor can be administered orally or parenterally. Parenteral administration includes, but is not limited to, intravenous, intramuscular, intraperitoneal, subcutaneous, intra-articular, intrasynovial, intraocular, intrathecal, topical or by inhalation. Thus, the dosage form of urolithin or its precursor can be in a variety of forms, including natural foods, processed foods, natural fruit juices, concentrates and extracts, injectable solutions, microcapsules, nanocapsules, liposomes, plasters, inhalation forms, nasal sprays, nasal drops, eye drops, sublingual tablets and sustained release formulations.

[0342] The compounds of the present invention can be provided in isolated form. As used herein, the term "isolated" means substantially free of other compounds or components that might otherwise be found with the target compound (e.g., as found in nature). In one embodiment, a compound is isolated when substantially all other compounds or components that might otherwise be found with the target compound have been removed. In one embodiment, a compound is isolated when it is pure.

[0343] The compounds of the present invention can be incorporated into a variety of formulations for therapeutic administration. More specifically, the compounds of the present invention can be formulated into pharmaceutical compositions by combination with a suitable pharmaceutically acceptable carrier or diluent, and can be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres and aerosols. Thus, administration of the compounds can be effected in different ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal and intratracheal administration. The active agent can be systemic after administration, or can be localized by use of topical, intramural or use of implants which serve to retain the active dose at the site of implantation.

[0344] In pharmaceutical dosage forms, the compounds can be administered in the form of their pharmaceutically acceptable salts. They can also be used in suitable combination with other pharmaceutically active compounds. The following methods and excipients are merely exemplary and in no way limiting.

[0345] For oral formulations, the compounds can be used alone or in combination with the following suitable additives to prepare tablets, powders, granules or capsules: for example, conventional additives such as lactose, mannitol, corn starch or potato starch; binders such as crystalline cellulose, cellulose derivatives, gum arabic, corn starch or gelatin; disintegrants such as corn starch, potato starch or sodium carboxymethyl cellulose; lubricants such as talc or magnesium stearate; and, if desired, diluents, buffers, wetting agents, preservatives and flavoring agents.

[0346] The compounds can be formulated into injection preparations as follows: dissolving, suspending or emulsifying them in an aqueous or non-aqueous solvent such as vegetable oil or other similar oils, synthetic fatty acid glycerides, esters of higher fatty acids or propylene glycol; and, if desired, using conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives.

[0347] The compounds can be used in aerosol preparations for administration by inhalation. The compounds of the present invention can be formulated into a pressurized acceptable propellant such as dichlorodifluoromethane, propane, nitrogen, etc.

[0348] In addition, the compound can be made into suppositories by mixing with various matrices such as emulsified matrices or water-soluble matrices. The compounds of the present invention can be administered rectally via suppositories. The suppositories can include a medium that melts at body temperature but solidifies at room temperature, such as cocoa butter, carbowax, and polyethylene glycol.

[0349] Unit dosage forms for oral or rectal administration can be provided, such as syrups, elixirs, and suspensions, where each dosage unit (e.g., a teaspoon, a tablespoon, a tablet, or a suppository) contains a predetermined amount of the composition, and the composition contains one or more compounds of the present invention. Similarly, unit dosage forms for injection or intravenous administration can contain the compounds of the present invention in the composition, which is a solution in sterile water, physiological saline, or other pharmaceutically acceptable carriers, where each dosage unit (e.g., mL or L) contains a predetermined amount of the composition, and the composition contains one or more compounds of the present invention.

[0350] Implants for sustained-release formulations are well known in the art. The implants are formulated as microspheres, plates, etc. using biodegradable or non-biodegradable polymers. For example, polymers of lactic acid and / or glycolic acid form erodible polymers that are well tolerated by the host. An implant containing an inhibitory compound can be placed near the target site so that the local concentration of the active agent is increased relative to other parts of the body.

[0351] As used herein, the term "unit dosage form" refers to physically discrete units suitable as unit doses for human and animal subjects, each unit containing a predetermined amount of the compound of the present invention, calculated to be an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier, or vehicle. The specification of the novel unit dosage forms of the present invention depends on the specific compound applied, the desired effect to be achieved, and the pharmacokinetics associated with each compound in the host.

[0352] Pharmaceutically acceptable excipients such as vehicles, adjuvants, carriers, or diluents are readily available to the public. In addition, pharmaceutically acceptable accessories such as pH regulators and buffers, tonicity regulators, stabilizers, wetting agents, etc. are readily available to the public.

[0353] For clinical applications, urolithin or urolithin precursors are administered in a therapeutically effective amount. As used herein, "effective amount" means an amount sufficient to achieve the desired biological effect. As used herein, "therapeutically effective amount" means an amount sufficient to achieve the desired therapeutic effect in a single dose or multiple doses. A person skilled in the art can determine the therapeutically effective amount based on in vitro studies, preclinical studies, or clinical studies, or any combination thereof.

[0354] The dosing is typically daily to weekly. In one embodiment, the dosing is at least once a week. For example, a subject may receive dosing once a week, twice a week, three times a week, or once every other day. In one embodiment, the dosing is at least once a day. For example, a subject may receive dosing once or multiple times a day.

[0355] For clinical use, urolithin is typically administered in an amount within the range of about 0.2–150 milligrams (mg) of urolithin per kilogram (kg) of subject body weight. In one embodiment, the urolithin or its precursor is administered at a dose equal to or equivalent to 2–120 mg of urolithin / kg of subject body weight. In one embodiment, the urolithin or its precursor is administered at a dose equal to or equivalent to 4–90 mg of urolithin / kg of subject body weight. In one embodiment, the urolithin or its precursor is administered at a dose equal to or equivalent to 8–30 mg of urolithin / kg of subject body weight. In cases where a urolithin precursor rather than urolithin is to be administered, it is administered in an amount equivalent to the above amounts of urolithin.

[0356] Any given dose can be administered as a single dose or as divided doses.

[0357] In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 0.001 micromolar (μM). In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 0.01 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 0.1 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 1 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 5 μM. In one embodiment, the urolithin or its precursor is administered at a dose sufficient to achieve a peak serum level of at least 10 μM.

[0358] In one embodiment, the urolithin or its precursor is administered in a dose sufficient to achieve a sustained serum level of at least 0.001 micromolar (μM). In one embodiment, the urolithin or its precursor is administered in a dose sufficient to achieve a sustained serum level of at least 0.01 μM. In one embodiment, the urolithin or its precursor is administered in a dose sufficient to achieve a sustained serum level of at least 0.1 μM. In one embodiment, the urolithin or its precursor is administered in a dose sufficient to achieve a sustained serum level of at least 1 μM. In one embodiment, the urolithin or its precursor is administered in a dose sufficient to achieve a sustained serum level of at least 5 μM. In one embodiment, the urolithin or its precursor is administered in a dose sufficient to achieve a sustained serum level of at least 10 μM. The sustained serum level can be measured using any suitable method, e.g., high-pressure liquid chromatography (HPLC) or HPLC-MS.

[0359] In one embodiment, the urolithin or its precursor is administered as pomegranate juice in an amount of 25 mL to 5 L, or an equivalent dose of ellagitannins, ellagic acid, urolithin, or any combination thereof. Table 4 shows the consumption of different levels of pomegranate juice for different pomegranate compounds. This range encompasses the differences in compound concentrations between different varieties of pomegranate. To calculate ellagic acid equivalents, it is assumed that the metabolism of each mole of punicalagin results in the release of 1 mole of ellagic acid and that this conversion occurs with 100% efficiency. The urolithin level is determined by assuming that all ellagic acid present (including ellagic acid derived from punicalagin) is converted to urolithin with 100% efficiency. Other sources of ellagic acid besides punicalagin and ellagic acid are not considered.

[0360] Table 4.

[0361]

[0362]

[0363] In one embodiment, the subject does not take the urolithin or its precursor for any purpose other than treating a disorder according to the methods of the present invention. In one embodiment, the subject does not take the urolithin or its precursor for treating atherosclerosis, thrombosis, cancer, unwanted angiogenesis, infection, or inflammation.

[0364] Examples

[0365] The present invention will now be generally described and will be more readily understood by reference to the following, which is provided solely for the purpose of illustrating certain aspects and embodiments of the present invention and is not intended to limit the present invention.

[0366] Example 1

[0367] Preparation of a functional extract from pomegranate compounds

[0368] In the standard polymer adsorption-based column, a polyphenol adsorption-based extraction operation was used to prepare the pomegranate extract containing specific molecules described in this application. To prepare extracts 31008 and 1108 from pomegranate juice, pomegranates were juiced using standard juicing and manufacturing processes and adsorbed as pure juice onto a high molecular chromatography resin. Resin Amberlite XAD-16 (Rohm & Haas) was packed into a semi-preparative column and the extracted juice was loaded. The column was washed with water to remove sugars until completion (Brix below 0.1%). Polyphenols were eluted with 100% ethanol. The remaining ethanol was evaporated under vacuum to prepare a concentrated extract containing 4.5 g of total polyphenols per liter, which was determined using the Folin assay for total polyphenol content. Extract 1011 was prepared in a similar manner to extracts 31008 and 1108, but the liquid extract was then spray-dried using a spray dryer to prepare the final powder extract. Compounds were identified using HPLC-MS, and extracts 31008, 1108, and 1011 were found to contain the molecules punicalagin, punicalin, neosyringin, and magnoflorine.

[0369] Preparation of extract 71109 derived from pomegranate husk: The husk was manually separated from the aril pulp of the pomegranate and then juiced using a manual fruit juicer. To extract the maximum amount of polyphenols, the cake / residue of the juiced pomegranate portion was successively immersed in water for several minutes (5 minutes) to increase the extraction efficiency. The extracted pomegranate solution was centrifuged to clarify and then adsorbed onto a polymeric chromatography Amberlite XAD-16 resin (Rohm & Haas) which was packed in a semi-preparative column and loaded with water extracted from the pomegranate husk. The column was washed with water to remove sugars until completion (Brix < 0.1%). The polyphenols were eluted with 100% ethanol. The remaining ethanol was evaporated under vacuum to prepare a concentrated extract containing 17.1 g of total polyphenols per liter, which was determined using the Folin assay for total polyphenol content. This technique is an improvement over known methods in the art, such as those described in several published methods for purifying polyphenols from various plants and berries. Tuck, K.L. and P.J. Hayball (2002) “Major phenolic compounds in olive oil: metabolism and health effects.” J Nutr Biochem 13(11):636-644; and Schieber, A., P. Hilt, et al. (2003) “A new process for the combined recovery of pectin and phenolic compounds from apple pomace.” Innovative Food Sci. Emerging Technol. 4:99-107.

[0370] To prepare extract 61109, the aqueous extract of pomegranate was fractionated using centrifugal partition chromatography. The separated fractions were lyophilized under reduced pressure to prepare extract 61109 highly enriched in punicalagin (>90%).

[0371] Purification of punicalagin

[0372] Preparation of extracts

[0373] The pomegranate extract was dissolved in a 16 mL organic / aqueous phase mixture (1:1) and filtered through a Teflon filter (0.45 μm).

[0374] Separation of punicalagin from the extract using centrifugal partition chromatography

[0375] Punicalagin was separated from the pomegranate extract using centrifugal partition chromatography CPC. The CPC instrument was provided by Kromaton Technologies (Angers, France) An instrument of 1000 is equipped with a rotor having a capacity of 1000 mL. Solvent is pumped in with a 4-channel binary high-pressure stepping pump. The sample is introduced into the CPC column via a high-pressure injection valve (Rheodyne) equipped with a 20 mL sample loop. The effluent is monitored with a diode array detection (DAD) detector equipped with a preparative flow cell. Fractions are collected by a fraction collector. The separation step is carried out at room temperature.

[0376] To complete the extraction, first the stationary phase is introduced into the column in a rising mode without rotation, and then the mobile phase is pumped through the stationary phase until the equilibrium stage is reached. Then, the rotation speed is increased from 0 to 1000 rpm, and the mobile phase is pumped into the column at a flow rate of 20 mL / min. After injecting 10 g of pomegranate extract, 20 mL fractions are collected every minute. The content of the effluent organic phase is monitored by on-line UV absorbance measurement at λ = 260 nm.

[0377] All compounds are recovered from the column using an elution-displacement operation: after a classical elution of 100 min, the mobile phase used as the fluid liquid is replaced with the stationary phase until all the contained volume (1000 mL) is displaced from the column. Fractions containing punicalagin (a mixture of A and B isomers) with a chromatographic purity of 94 - 97% are obtained between 51 - 63 minutes of elution, and a second fraction with a chromatographic purity of 85 - 88% is obtained between 64 - 79 min.

[0378] To determine the purification level, the purified sample is examined by HPLC-DAD at a detection wavelength of 260 nm. The sample is loaded onto a Prosontil C18, 5 μm, 250 x 4 mm column. The solvents used are H2O mQ + 9.1% TFA / acetonitrile + 0.1% TFA, and the flow rate is 1 mL / min.

[0379] Example 2

[0380] In vitro screening assay for compounds that promote enhanced mitochondrial gene expression in a prototype skeletal muscle cell line (C2C12 myotubes)

[0381] Skeletal muscle plays a key role in the regulation of metabolic homeostasis as it is involved in metabolic functions such as energy expenditure and maintenance of insulin sensitivity. These functions are closely related to mitochondrial activity, and impairment of mitochondrial function plays a causative role in the development of defective metabolic homeostasis and metabolic disorders such as type II diabetes, obesity, and dyslipidemia. The gene expression profile of genes related to mitochondrial activity in differentiated C2C12 cells (myotubes) is a model suitable for evaluating the effects of compounds on mitochondrial activity, where numerous pathways reflecting mitochondrial activity are evaluated, such as mitochondrial biogenesis, glycolysis, fatty acid β-oxidation, electron transport chain (ETC), mitochondrial dynamics.

[0382] To evaluate the effect of the compounds on mitochondrial gene expression, C2C12 myoblasts were differentiated into myotubes by serum deprivation for 4 days (Cantó et al. (2009) Nature. 458:1056 - 60). Myotubes were incubated for 48 h with ellagic acid or urolithin A (both dissolved in DMSO at a final concentration of 0.1%) at final concentrations of 1, 10 or 50 μM. DMSO was used as a control (final concentration 0.1%). At the end of the treatment, cells were washed with phosphate - buffered saline (PBS) and immediately mRNA was extracted by adding 1 mL of Trizol reagent according to the manufacturer's instructions (Trizol Reagent, Invitrogen). After extraction, cDNA was prepared by reverse transcription according to the manufacturer's instructions.

[0383] By real - time quantitative PCR (Watanabe et al. (2004) J Clin Invest. 113:1408 - 18), using the following primer sets (Fwd: forward primer; Rev: reverse primer), the expression levels of genes controlling mitochondrial function (PGC - 1α, Tfam, PFKFB3, CPT1b, MCAD, LCAD, Ndufa2, Cyt c and Mfn2) were evaluated:

[0384] PGC - 1α: (Fwd) AAGTGTGGAACTCTCTGGAACTG (SEQ ID NO:1)

[0385] (Rev) GGGTTATCTTGGTTGGCTTTATG (SEQ ID NO:2)

[0386] Tfam: (Fwd) AAGTGTTTTTCCAGCATGGG (SEQ ID NO:3)

[0387] (Rev) GGCTGCAATTTTCCTAACCA (SEQ ID NO:4)

[0388] PFKFB3: (Fwd) TCATGGAATAGAGCGCC (SEQ ID NO:5)

[0389] (Rev) GTGTGCTCACCGATTCTACA (SEQ ID NO:6)

[0390] CPT1b: (Fwd) CCCATGTGCTCCTACCAGAT (SEQ ID NO:7)

[0391] (Rev)CCTTGAAGAAGCGACCTTTG(SEQ ID NO:8)

[0392] MCAD:(Fwd)GATCGCAATGGGTGCTTTTGATAGAA(SEQ ID NO:9)

[0393] (Rev)AGCTGATTGGCAATGTCTCCAGCAAA(SEQ ID NO:10)

[0394] LCAD:(Fwd)GTAGCTTATGAATGTGTGCAACTC(SEQ ID NO:11)

[0395] (Rev)GTCTTGCGATCAGCTCTTTCATTA(SEQ ID NO:12)

[0396] Ndufa2:(Fwd)GCACACATTTCCCCACACTG(SEQ ID NO:13)

[0397] (Rev)CCCAACCTGCCCATTCTGAT(SEQ ID NO:14)

[0398] Cyt c:(Fwd)TCCATCAGGGTATCCTCTCC(SEQ ID NO:15)

[0399] (Rev)GGAGGCAAGCATAAGACTGG(SEQ ID NO:16)

[0400] Mfn2:(Fwd)ACGTCAAAGGGTACCTGTCCA(SEQ ID NO:17)

[0401] (Rev)CAATCCCAGATGGCAGAACTT(SEQ ID NO:18)

[0402] PGC-1α (PPARγ co-activator 1α) and Tfam (mitochondrial transcription factor A) are major regulators of mitochondrial function, namely mitochondrial biogenesis and mitochondrial oxidative phosphorylation (mOXPHOS). An increase in their expression levels reveals an overall enhancement of mitochondrial activity. Evaluation of other target genes involved in key mitochondrial functions allows identification of enhanced pathways. PFKFB3 (6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase 3) is a key enzyme in glycolysis, i.e., the use of glucose to generate energy. Under aerobic conditions, i.e., when oxygen supply is present, pyruvate generated from glucose via glycolysis is used by mitochondria to generate energy (ATP) through the Krebs cycle. CPT1b (carnitine O-palmitoyltransferase 1b), MCAD (medium-chain acyl-CoA dehydrogenase), and LCAD (long-chain acyl-CoA dehydrogenase) play key roles in mitochondrial fatty acid uptake and β-oxidation, two key steps in generating energy from fatty acids. Ndufa2 (NADH dehydrogenase [ubiquinone] 1α subcomplex subunit 2) and Cyt c (cytochrome c) are subunits of complex I and complex IV of the mitochondrial electron transport chain, respectively. These proteins have important roles in the mitochondrial respiratory chain and energy production (from the reducing equivalents generated by the Krebs cycle). Mfn2 (mitochondrial fusion protein 2) is involved in mitochondrial dynamics and fusion processes. Its expression increases in the context of increased mitochondrial remodeling and / or mitochondrial biogenesis (an increase in the number of mitochondria per cell).

[0403] Figure 3 The data presented clearly indicate that ellagic acid and urolithin A increase mitochondrial activity in a dose-dependent manner by regulating the expression of numerous genes involved in several mitochondrial metabolic pathways.

[0404] Example 3

[0405] In vitro screening assay for compounds that promote enhanced mitochondrial activity in a prototype skeletal muscle cell line (C2C12 myotubes)

[0406] Citrate synthase is the initial enzyme of the tricarboxylic acid (TCA) cycle and the rate-limiting step for entry into the TCA cycle. The TCA cycle generates NADH2 and FADH2, which are then used to power the electron transport chain that generates a proton (energy) gradient, which will be used to generate ATP. Thus, citrate synthase is the sole marker of mitochondrial number and mitochondrial activity. By measuring the effect of a compound or formulation on citrate synthase enzyme activity, it is possible to evaluate the ability of the compound to stimulate mitochondrial activity, i.e., OXPHOS and ATP production.

[0407] Citrate synthase catalyzes the reaction between acetyl coenzyme A (acetyl-CoA) and oxaloacetate to form citrate. Acetyl-CoA contributes 2 carbons to the 4 carbons of oxaloacetate to form citrate with 6 carbons. Hydrolysis of the thioester of acetyl-CoA results in the formation of CoA with a sulfhydryl group (CoA-SH). The activity of citrate synthase is measured by the reaction between the sulfhydryl group of CoA-SH and DTNB in the mixture (forming 5-thio-2-nitrobenzoic acid (TNB)). The yellow product (TNB) is observed by spectrophotometry by measuring the absorbance at 412 nm (Citrate Synthase Assay Kit, catalog number CS0720, Sigma Aldrich).

[0408] C2C12 myoblasts were differentiated into myotubes by serum deprivation for 4 days (Cantó et al. (2009) Nature. 458:1056-60). Myotubes were incubated for 48 h with punicalagin at a final concentration of 1 or 10 μM, or with ellagic acid or urolithin at final concentrations of 1, 10 or 50 μM (all dissolved in DMSO at a final concentration of 0.1%). DMSO was used as a control (final concentration 0.1%). At the end of the treatment, cells were washed 3 times with PBS and citrate synthase activity was measured according to the manufacturer's instructions (Citrate Synthase Assay Kit, catalog number CS0720, Sigma Aldrich).

[0409] As Figure 4 shown, punicalagin, ellagic acid and urolithin increased citrate synthase activity in a dose-dependent manner, thus confirming an overall increase in mitochondrial activity and / or mitochondrial density (number of mitochondria per cell). These results confirmed the results obtained by gene expression profiling of mitochondrial genes (Example 1), thus indicating enhanced mitochondrial activity and mitochondrial biogenesis in treated differentiated C2C12.

[0410] Statistics: One-way ANOVA, *p < 0.05.

[0411] Example 4

[0412] In vitro screening assay for compounds that promote AMP-activated protein kinase (AMPK) activity in a prototype skeletal muscle cell line (C2C12 myotubes)

[0413] AMPK acts as a metabolic master switch that regulates several intracellular systems, including the cell's glucose uptake, β-oxidation of fatty acids, and biogenesis and mitochondria of glucose transporter 4 (GLUT4). The energy-sensing ability of AMPK can facilitate its ability to detect and respond to fluctuations in the AMP:ATP ratio that occur during rest and exercise (muscle stimulation). As an example, during a workout, AMPK activity increases (phosphorylation of AMPK, P-AMPK), while myocytes undergo metabolic stress caused by the cell's extreme demand for ATP. After activation (AMPK phosphorylation, P-AMPK), AMPK increases cellular energy levels as follows: inhibiting energy-consuming anabolic pathways (fatty acid synthesis, protein synthesis, etc.), and stimulating energy-producing catabolic pathways (fatty acid oxidation, glucose transport, etc.). As a result, AMPK activation leads to enhanced mitochondrial function, including increased OXPHOS and mitochondrial biogenesis.

[0414] C2C12 myoblasts were differentiated into myotubes by serum deprivation for 4 days (Cantó et al. (2009) Nature. 458:1056 - 60). Myotubes were incubated for 1 hour with resveratrol (RSV) acting as a positive control, or with ellagic acid (EA) or urolithin A (UL) at a final concentration of 50 μM (both dissolved in DMSO, final concentration 0.1%). DMSO was used as a control (final concentration of DMSO: 0.1%). At the end of the treatment, cells were washed 3 times with PBS and AMP-activated protein kinase (AMPK) was evaluated by Western blotting. After compound treatment, C2C12 cells were lysed in buffer containing phosphatase inhibitors and the protein concentration was determined using the standard Bradford assay.

[0415] Equivalents of 25 μg of protein were used for separation on a 10% SDS-PAGE gel, followed by transfer by standard Western blotting procedures. Antibodies against AMPK (Cell Signaling) and phosphorylated AMPK (P-AMPK, Cell Signaling) were used for detection.

[0416] As Figure 5 shown, Western blot analysis of the phosphorylated and thus activated form of AMPK (i.e., P-AMPK) indicates that the level of phosphorylation of AMPK (P-AMPK) and thus the level of activation of AMP-activated protein kinase (AMPK) are indeed increased in cells treated with ellagic acid or urolithin compared to control-treated cells. This data indicates that both ellagic acid and urolithin A are AMPK activators. This further supports the observation that ellagic acid and urolithin induce an increase in mitochondrial function.

[0417] Example 5

[0418] Screening Assay for Compounds that Promote the Neurite Growth Halo in PC-12 Cells

[0419] It has been confirmed that the neurite growth halo in neuron cultures and the number of average protrusions per cell correlate with neuron function. It has been confirmed that chronic stress leads to a decrease in dendritic length and the number of branches, and this effect can be reversed after the removal of stress. In addition, it has been confirmed that this reversibility is inhibited with aging (Bloss, Janssen et al. 2010). There is also other evidence indicating that learning and novel sensory experiences are related to an increase in spine formation and the elimination of elongated protrusions. Therefore, synaptic structural plasticity plays an important role in learning and memory (Yang, Pan et al. 2009). In fact, the levels of the neurite growth halo and the number of protrusions induced by compounds such as nerve growth factor (NGF) are strongly correlated with their neuroprotective ability. With aging, this synaptic plasticity becomes impaired, and there is an increased loss of spines and a decreased synaptic density (Dumitriu, Hao et al. 2010). Neurodegenerative diseases also have an impact on the neurite growth halo. The A-β (Aβ) peptide, which plays an important role in Alzheimer's disease, inhibits the neurite growth halo in mouse neuroblastoma cells. Therefore, by measuring the effect on the neurite growth halo in vitro, compounds and preparations with neuroprotective effects on neurons under chronic stress, aging neurons, and neurons present in neurodegenerative diseases can be identified.

[0420] The effects of different ellagitannins and their metabolites punicalagin (PA), punicalin (PB), tellimagrandin (TL), ellagic acid (EA), and urolithin A (UA) on the neurite growth halo in vitro were tested on cells of the noradrenergic rat pheochromocytoma cell line (PC-12 cells), which have been confirmed to differentiate in response to nerve growth factor (NGF) (Greene and Tischler 1976). It has been confirmed that the neurite growth halo in these differentiated PC-12 cells is strongly promoted by dibutyryl cyclic AMP (dbcAMP) (Gunning, Landreth et al. 1981), and this compound was used as a positive control. The specific Janus N-terminal kinase (JNK) inhibitor SP600125 was used as a negative control, and the SP600125 has been confirmed to reduce different neurite growth halo parameters (Xiao, Pradhan et al. 2006). The ellagitannins and their metabolites tested in the assay were synthesized or purchased from suppliers including Funakoshi, Sigma, and Chemos. The stock solutions were aliquoted and stored at -20 °C.

[0421] PC-12 cells (ATCC CRL-1721) were cultured in a poly-L-lysine-coated culture flask at 37 °C, 5% CO2, in complete medium (RPMI 1640 + 10% heat-inactivated horse serum + 5% fetal bovine serum).

[0422] Twenty-four hours after plating, cell differentiation was carried out in the culture flask in complete medium supplemented with 100 ng / mL NGF (2.5S NGF, Invitrogen). The medium supplemented with NGF was changed every 3 days, and differentiation was induced over an 8-day period.

[0423] Immediately before starting the experiment, all test compounds were made into a 50 mM stock solution in dimethyl sulfoxide (DMSO). The final DMSO concentration in the medium of all experimental groups was 0.1%.

[0424] For neurite growth halo measurement, differentiated cells were washed with phosphate-buffered saline (PBS), collected after detachment, and replated at a density of 5,000 cells / well (biocoated imaging 96-well plate) in complete medium supplemented with 100 ng / mL NGF, containing or not containing 10 μM SP600125 (negative control), 1 mM dbcAMP (positive control), or 5x10 -7 M of the test compound. In the undifferentiated control group, NGF was not added after replating.

[0425] After 72 h of culture, PC-12 cells were washed with PBS and fixed in 1% paraformaldehyde solution for 20 minutes. After washing 3 times with PBS, immunofluorescent labeling was performed with a Texas Red Maleimide probe, which reacts with the sulfhydryl groups of cysteine residues of proteins, allowing visualization of the entire cell morphology (including neurites).

[0426] Immunofluorescence analysis was performed in automated confocal microscopy. Images were acquired with a BD Pathway 855 system under a 20X objective with an 8X8 field-of-view montage. Then, with the neurite module of the software, the neurite growth halo was measured from the acquired images. The total and average growth halo, the total and average number of processes per cell, and the total number and percentage of cells with a large growth halo (defined as a growth halo longer than 20 μm) were analyzed.

[0427] As Figure 6 shown, all compounds (except PA and PB) increased the number of PC-12 cells in the wells by >30%, indicating a trophic effect of these compounds at a concentration of 0.5 μM (for UA, EA, and TL, p < 0.001 relative to the differentiation control (ctrl)).

[0428] Promotion of neurite growth halo

[0429] As Figure 7 and Figure 8 shown, all test compounds (PA, PB, TL, EA, and UA) were able to induce robust neurite growth halos from differentiated PC-12 cells. Compared to the differentiation controls for all test compounds, the average growth halo ( Figure 7 ) showed an increase of >30%. The percentage of cells showing a significant growth halo ( Figure 8 ) was significantly greater than that observed for differentiated cells under all test compounds

[0430] (p < 0.05 (26% increase) for UA and PB, p < 0.01 (>26% increase) for PA, and p < 0.001 (>37% increase) for EA and TL).

[0431] Promotion of neurite formation and branching

[0432] Compounds PA, PB, UA, EA, and TL all induced an increase in the number of neurites when administered to differentiated PC-12 cells. The compounds (UA, p < 0.05 (15.7% increase); PA, p < 0.01 (26.3% increase); EA and TL, p < 0.001 (>31% increase)) promoted neurite formation ( Figure 9 ) as effectively or more effectively than dbcAMP (positive control).

[0433] Compared to the results observed in differentiated controls, neurite branching was significantly higher, with most compounds inducing a two-fold increase in branching.

[0434] Example 6

[0435] Screening assay for compounds that promote neurite growth halo in primary dopaminergic TH-positive neurons

[0436] Primary neurons, due to their untransformed state, serve as a good in vitro model for the effects of compounds on neuronal plasticity and differentiation, such as neuronal growth halos and the formation of dendrites and neurites. The effects of different ellagitannin metabolites, punicalagin (PA), urolithin (UA), ellagic acid (EA), and tellimagrandin (TL), on this process were examined. The compounds tested in the assay were purchased from suppliers including Funakoshi and Sigma or chemically synthesized. Stock solutions were aliquoted and stored at -20 °C.

[0437] Primary midbrain cultures were prepared from E14 rat embryos. The ventral midbrain was carefully minced and dissociated. Cells were then plated in DMEM F12 medium containing 10% heat-inactivated horse serum at a density of 100,000 cells / well (96-well plate), with the medium containing or not containing the JNK-specific inhibitor SP600125 (10 μM) (which served as a negative control) or dbcAMP (1 mM) (which served as a positive control) or the test compound at a dose of 0.1 μM each.

[0438] Seventy-two hours after plating, images were acquired by automated confocal microscopy (X4 objective, tiled 4X4) covering the entire well surface, and the effect on the neurite growth halo of dopaminergic tyrosine hydroxylase (TH)-positive neurons was measured and quantified using the neurite growth halo module of the software. Several representative parameters of the neurite growth halo were obtained: the analyzed total and average growth halos, the total and average number of processes per cell, and the total number and percentage of cells with a large growth halo (defined as a growth halo longer than 20 μm). All experiments were performed in quadruplicate.

[0439] Promotion of the neurite growth halo

[0440] As Figures 10 - 16 shown, the compounds selected in the above PC-12 screening assay were also able to induce a neurite growth halo in primary midbrain neurons at a concentration of 0.1 μM. As measured by the average growth halo per cell as Figure 10 shown, most compounds promoted the growth halo per cell as effectively as dbcAMP (>25% increase in growth halo) (UA, GA, EA, TL vs. control, p < 0.001). All test compounds performed as well as or better than dbcAMP ( Figure 11 ).

[0441] Increase in neurite processes and branches

[0442] All test compounds showed a significant increase in the average number of processes per cell (>10%) ( Figure 12 ), as well as a significant increase in the maximum process length (>10%) ( Figure 13 ).

[0443] In the presence of a positive control (dbcAMP), primary cells showed an increase in branching. However, the JNK inhibitor SP600125 did not inhibit primary cell branching (as in PC12 cells), but was able to promote branching, although not to the same level as dbcAMP (60% increase compared to 86% increase observed with dbcAMP). Compounds UA, EA, and TL were able to promote branching to the same level as dbcAMP (>111% increase in branching, Figure 14 ).

[0444] Increase in the number of dendrites and dendrite length per cell

[0445] UA, EA, and TL significantly increased the number of dendrites to levels higher than dbcAMP, with all compounds showing >18% increase ( Figure 15 ).

[0446] Ellagic acid, urolithin A, and neosophoridin all resulted in >26% increase in dendrite length, higher than the observations with dbcAMP ( Figure 16 ).

[0447] Example 7

[0448] Pomegranate extract, punicalagin, ellagic acid, and urolithin A reduce weight gain and fat mass in mice fed a high-fat diet

[0449] Male C57BL6 / J mice at 7 weeks of age were purchased from Charles River Laboratory (L’Arbresle, France) and acclimated to the animal facility for 2 weeks before the start of the experiment. Mice were housed in groups of 5 under standard housing conditions, using a 12-hour light-dark cycle, and had free access to food and water. Starting at 9 weeks of age, mice were fed a high-fat diet (HFD) (60% kcal from fat; D12492; Research Diets Inc., New Brunswick, NJ, USA) for 14 weeks. Body weight was monitored weekly.

[0450] Mice in different treatment groups were administered: (i) urolithin A mixed with food (food mixture) to achieve a dosing of 55 mg / kg body weight per day (mkd); (ii) ellagic acid mixed with food (food mixture) to achieve a dosing of 75 mkd; (iii) punicalagin (by gavage) to achieve a dosing of 90 mkd; or (iv) pomegranate extract (PE) (by gavage) to achieve a dosing of 140 mkd total polyphenols. A typical pomegranate extract used in these experiments had the following composition: polyphenols, 140 mkd; punicalagin, 13.1 mkd; and ellagic acid, 13.2 mkd. For animals treated by gavage, gavage was performed between 8:00 and 10:00 am daily (7 days / week); the compound was mixed with saline solution (0.9% NaCl) and provided at a final volume of 5 mL / kg body weight. Mice in the high-fat control group were fed the same diet as the experimental animals. Mice in the corresponding different control groups were administered either a high-fat diet alone or a high-fat diet + daily gavage of vehicle (saline). Another control group of mice was fed a standard chow diet alone.

[0451] Body composition was monitored by EchoMRI (Echo Medical Systems, Houston, TX, USA) 5 weeks after the start of treatment (for mice fed a high-fat diet) and 2 weeks after the start of treatment (for mice fed a chow diet). Animals were individually placed in plastic cylinders and then introduced into the EchoMRI system for body composition scanning (lean mass and fat mass) for approximately 2 min.

[0452] The results are shown in Figures 17 and 18.

[0453] Compared to control mice fed a standard chow diet (CD), mice fed a high-fat diet (HFD) developed severe obesity ( Figure 17A ). The weight gain of untreated high-fat-fed mice was associated with an increase in the percentage of fat mass measured by EchoMRI 5 weeks after treatment ( Figure 17B ) and a decrease in the percentage of muscle mass (lean body mass) ( Figure 17C ). In mice fed a high-fat diet, treatment with urolithin A (administered via food mixture) or punicalagin or pomegranate extract (PE) (both administered by gavage) prevented the development of obesity, and there was a significant decrease in weight gain in treated HFD-fed mice compared to control HFD-fed mice ( Figure 17A ). In addition, compared to untreated HFD-fed mice, there was a significant decrease in fat mass in HFD-fed mice treated with urolithin A, punicalagin, or PE ( Figure 17B ).

[0454] Mice fed a standard chow diet and treated with ellagic acid or urolithin A also showed a decrease in fat mass and an accompanying increase in muscle (lean body mass), indicating that these treatments are beneficial for weight control and a lean or muscular physique( Figure 18 B).

[0455] Example 8

[0456] Pomegranate extract, punicalagin, ellagic acid, and urolithin A increase muscle mass in normal and obese mice

[0457] As described in Example 7, male C57BL6 / J mice were grouped and treated.

[0458] In mice fed a standard chow diet and in mice fed an HFD, treatment with PE, punicalagin, ellagic acid, or urolithin A resulted in a statistically significant increase in the percentage of lean body mass. Mice fed a high-fat diet and treated with urolithin A, punicalagin, or PE showed a decrease in fat mass and an accompanying increase in muscle (lean body mass)( Figure 17B and 17C ). Mice fed a chow diet and treated with ellagic acid or urolithin A also showed a decrease in fat mass and an accompanying increase in muscle (lean body mass), thus indicating that these treatments are beneficial for weight control and a lean or muscular physique( Figure 18 A and 18B). Since lean body mass is primarily represented by muscle mass, these results explain how treatment with PE, punicalagin, ellagic acid, or urolithin A leads to an increase in the proportion of muscle mass relative to total mass in normal and obese mice. This effect was observed as early as 2 weeks of treatment.

[0459] Example 9

[0460] Pomegranate extract, punicalagin, ellagic acid, and urolithin A increase energy expenditure in normal and obese mice

[0461] As described in Example 7, male C57BL6 / J mice were grouped and treated. Additionally, however, at 8 weeks after the start of treatment (for HFD-fed mice) and 2 weeks after the start of treatment (for standard chow-fed mice), the basal energy expenditure of the mice was measured by indirect calorimetry (oxygen consumption, carbon dioxide production, and respiratory exchange ratio) using a Comprehensive Laboratory Animal Monitoring System (CLAMS; Columbus Instruments, Columbus, OH, USA). First, between 11 am and 12 pm, the animals were allowed to acclimate to the CLAMS cages (room temperature 22 °C ± 1 °C) for 22 h. Then, measurements were made for at least 20 h under the same conditions. The measurements included the entire dark cycle. The parameters measured in the CLAMS were as follows: (i) oxygen consumption (VO2, mL / kg / h): VO2 is directly related to energy expenditure; (ii) carbon dioxide production (VCO2, mL / kg / h); and (iii) respiratory exchange ratio (RER): VCO2 / VO2: RER is an indicator of energy substrate utilization. At steady state, RER is equal to the respiratory quotient (RQ). Utilization of pure carbohydrate produces RER = 1, while combustion of pure fat produces RER = 0.7. A mixed diet produces RER = 0.85.

[0462] Results are shown in Figure 19 and 20 .

[0463] Oxygen consumption is a physiological marker of mitochondrial activity and energy expenditure. Treatment with PE, punicalagin, ellagic acid, or urolithin A significantly increased oxygen consumption in the mice. Ellagic acid and urolithin A increased energy expenditure in the standard chow-fed mice ( Figure 19 A and 19B). This effect was observed as early as 2 weeks after treatment. Treatment with pomegranate extract (PE), punicalagin, and urolithin A increased energy expenditure in the HFD-fed mice ( Figure 20 A and 20B).

[0464] Example 10

[0465] Pomegranate extract, punicalagin, ellagic acid, and urolithin A increased the utilization of fatty acids as an energy substrate in normal and obese mice

[0466] As described in Example 9, male C57BL6 / J mice were grouped and treated.

[0467] As described above, in addition to oxygen consumption, indirect calorimetry also monitors carbon dioxide production. The ratio of carbon dioxide production (VCO2) to oxygen consumption (VO2) is called the respiratory exchange ratio (RER). RER is an excellent indicator of energy substrate utilization. At steady state, RER is equal to the respiratory quotient (RQ). Preferential utilization of carbohydrates as an energy substrate results in an RER close to 1, while utilization of fat as an energy substrate (fat burning) results in a lower RER, approaching 0.7 when fatty acids are preferentially utilized.

[0468] As Figure 21 and Figure 22 shown, treatment with PE, punicalagin, ellagic acid, and urolithin A significantly decreased RER in both chow diet- and HFD-fed mice. This effect was prominent in chow diet-fed mice treated with ellagic acid and urolithin A ( Figure 21 ). These results support the changes in body composition observed after consumption of PE, punicalagin, ellagic acid, or urolithin A, which are beneficial for a stronger (leaner) physique with a reduced fat composition.

[0469] Example 11

[0470] Pomegranate extract, punicalagin, and urolithin A decrease plasma levels of triglycerides and free fatty acids in obese mice

[0471] As described in Example 7, male C57BL6 / J mice were grouped and treated. Additionally, plasma biochemistry was performed 14 weeks after the start of treatment using a standard automated clinical chemistry analyzer (Dimension Xpand, SIEMENS). Before blood collection, animals were fasted for 12 h (from 8 PM to 8 AM). Approximately 500 μL of blood was collected from the vena cava of anesthetized animals under isoflurane anesthesia. The blood was collected into heparinized tubes and immediately placed on wet ice. Plasma was prepared by centrifugation (1500 x g, 15 min, 4 °C). Then the plasma samples were transferred into clean 1.5 mL microtubes and stored at -80 °C until biochemical measurements were performed using the appropriate kits on a standard automated clinical chemistry analyzer (Dimension Xpand, SIEMENS).

[0472] Circulating levels of triglycerides and free fatty acids in the blood of control and treated HFD-fed mice were measured by standard biochemistry ( Figure 23 ). Treatment with PE, punicalagin, and urolithin A led to a statistically significant improvement in plasma levels of triglycerides and free fatty acids. These results indicate that PE, punicalagin, and urolithin A can effectively treat dyslipidemia in obese mice and thus can play a role in improving cardiovascular function and preventing cardiovascular diseases.

[0473] Example 12

[0474] Punicalagin, ellagic acid, and urolithin A improve glucose tolerance in obese mice

[0475] As described in Example 7, male C57BL6 / J mice were grouped and treated. Additionally, glucose tolerance tests (GTT) were performed on HFD-fed mice that developed glucose intolerance. Glucose tolerance was monitored for 10 weeks after the start of treatment by oral glucose tolerance test (oGTT). Before the oGTT, the animals were fasted for 12 h (from 8 p.m. to 8 a.m.). On the day of the oGTT, a small drop of blood (<2 μL) was collected from the lateral tail vein and blood glucose was monitored using a blood glucose meter (AccuCheck Aviva, Roche Diagnosis). Then, each animal received an oral dose of D-glucose at a dose of 2 g / kg body weight at time 0. Blood glucose was then monitored at 15, 30, 45, 60, 90, 120, and 150 min after the oral glucose load.

[0476] As in humans, feeding mice a high-fat diet leads to obesity and the onset of type II diabetes characterized by severe glucose intolerance, as assessed by immediately following blood glucose after exposure to glucose (2 g / kg body weight) (glucose tolerance test) Figure 24 )。As Figure 24 shown, treatment with punicalagin, ellagic acid, and urolithin A improves glucose tolerance in HFD-fed mice. As a result, these treatments may also be effective treatment regimens for treating type II diabetes.

[0477] Example 13

[0478] Urolithin A increases mitochondrial function in aged Caenorhabditis elegans

[0479] Caenorhabditis elegans strains were cultured at 20 °C on nematode growth medium (NGM) agar plates seeded with the Escherichia coli strain OP50. The strain used was the wild-type Bristol N2 provided by the Caenorhabditis Genetics Center (University of Minnesota, Minnesota). Urolithin A was dissolved in DMSO. Animals were exposed to the compound and were derived from eggs on plates seeded with live OP50 bacteria. Control plates were prepared with DMSO at the corresponding concentration (0.1%).

[0480] Measurement of oxygen consumption is a direct indicator of mitochondrial activity. The effects of urolithin A on mitochondrial activity in aged Caenorhabditis elegans (10-day-old) were evaluated as follows: Adult Caenorhabditis elegans at 10 days were treated with urolithin A, at which time oxygen consumption was measured using a Seahorse XF24 instrument (Seahorse Bioscience Inc., North Billerica, MA). 250 10-day-old Caenorhabditis elegans were used for each condition. Caenorhabditis elegans were recovered from NGM plates containing M9 medium, washed three times in 2 mL of M9 to eliminate residual bacteria, and resuspended in 500 μL of M9 medium. The worms were transferred into a 24-well standard Seahorse plate (#100777-004) (50 worms / well), and oxygen consumption was measured. First, the basal oxygen consumption of the worms was measured over 30 minutes at 5-minute intervals (0 min, 5 min, 15 min, 20 min, 25 min, and 30 min), with 5 replicates per interval. The respiration rate was normalized to the exact number of worms per well measured using a stereomicroscope at the end of the experiment. After determining the basal oxygen consumption, the uncoupled oxygen consumption was measured as follows: At the 30-minute time point, carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP) was added to the medium to evaluate the maximum oxygen consumption capacity and the maximum mitochondrial capacity. At 5-minute intervals (35 min, 40 min, 45 min, 50 min, 55 min, and 60 min), the uncoupled oxygen consumption was measured to allow measurement of mitochondrial function over time. FCCP is a chemical uncoupler that abolishes the obligatory connection between the respiratory chain and the phosphorylation system observed with intact mitochondria. This effect is due to the amphiphilic nature of the molecule, which dissolves in the mitochondrial phospholipid bilayer. This dramatically increases the ionic permeability of the mitochondrial membrane and causes significant proton leakage, resulting in an increase in oxygen consumption (due to quenching of oxygen with electrons pumped into the respiratory chain in parallel with proton leakage). Because this oxygen consumption is dissociated (uncoupled) from ATP production (oxidative phosphorylation), FCCP increases oxygen consumption while decreasing the energy (ATP) production of mitochondria. Completely uncoupled mitochondria (such as achieved with FCCP) will indicate the maximum capacity of their mitochondrial respiratory chain (maximum oxygen consumption) without "slowing down" oxidative phosphorylation and energy production.

[0481] At Figure 25The results depicted in indicate that urolithin A increases the maximal mitochondrial capacity in aged Caenorhabditis elegans, as shown by the extended effect of increased uncoupled respiration in worms treated with urolithin A compared to worms treated with the control (DMSO). Untreated control worms showed a transient increase in uncoupled respiration, which rapidly returned to basal oxygen consumption levels. Worms treated with urolithin A showed a more extended elevation of oxygen consumption. The degree of increased mitochondrial activity was shown by comparing the area under the curve (AUC) in the uncoupled phase and the mean coupled respiration used as a baseline. It was observed that urolithin A significantly increased uncoupled respiration in aged worms during the 30-minute period evaluated compared to untreated control worms.

[0482] Example 14

[0483] Urolithin A increases mitochondrial activity in Caenorhabditis elegans

[0484] Caenorhabditis elegans strains were cultured at 20 °C on nematode growth medium agar plates inoculated with HT115 bacteria and containing 50 μM urolithin A or the corresponding concentration of DMSO as a control. The worms were treated for 24 hours. The strain used was SJ4103 (zcIs14[myo-3:GFP(mit)]), which is a stable transgenic line expressing a green fluorescent protein (GFP) localized to mitochondria, with a cleavable mitochondrial import signal peptide under the control of the muscle-specific myo-3 promoter. GFP expression and quantification were performed according to a previously described protocol (Durieux et al., 2011). Worms obtained from eggs were treated with 50 μM urolithin A and GFP was monitored after 1 day of adulthood. Fluorescence measurements were performed using a Victor X4 multi-label plate reader (Perkin-Elmer Life Science). Eighty worms were randomly selected (20 worms per well of a black-wall 96-well plate), and each well was read 4 times and the mean value was taken.

[0485] Figure 26 The results in indicate that treating worms with urolithin A induces the expression of a mitochondrial GFP-reporter driven by the muscle-specific myo-3 promoter in Caenorhabditis elegans. This significant increase in GFP expression provides clear evidence of the increased mitochondrial capacity caused by urolithin A. For this observed increase in the GFP signal, the mitochondria in the muscles of these worms must be larger or more numerous.

[0486] Example 15

[0487] Effects of pomegranate-derived compounds on mood and cognition induced by chronic stress

[0488] 7-week-old C57BL / 6J wild-type male mice were exposed to a 4-week period of chronic unpredictable stress. Several behavioral experiments were conducted before, during, and after the chronic stress period to determine the effects on mood and cognition. As previously reported, chronic stress negatively affects mood and cognition. Natural compounds derived from pomegranate were administered to these mice to determine what effect these compounds have in ameliorating this negative impact on mood and cognition.

[0489] Before starting the experiments, the mice were acclimated to our animal facility for 9 days. All mice were housed in standard plastic cages in groups of three, maintained on a 12 h light / dark cycle (7:00 a.m.–7:00 p.m.), with free access to food and water. All procedures were conducted in accordance with the Swiss National Institutional Guidelines on Animal Experimentation and were approved by the Swiss Cantonal Veterinary Office Committee for Animal Experimentation.

[0490] Characterization of animals

[0491] After acclimation to the animal facility, all mice were characterized in terms of body weight, anxiety-like behavior in the elevated zero maze (EZM), and locomotion and exploration in the open field and novel object tests. The purpose of these experiments was to match the animals according to their anxiety and exploration ratios in order to establish equivalent experimental and control groups based on these characteristics.

[0492] Elevated zero maze

[0493] Anxiety was measured in the elevated zero maze (EZM). Mice were observed for 5 min in the EZM (a 5.5-cm-wide circular runway, 46 cm in diameter, 46 cm above the ground) under dim and diffuse light conditions. Two opposite 90° sectors were protected by inner and outer walls 13.5 cm high. Thus, three zones were defined as follows: a middle zone including four 30° segments at the ends of the protective walls, separated by two 50°-wide enclosed / protected zones and two 70°-wide open / unprotected exploration zones. Due to these boundaries, entry was detected only when all four paws of the animal entered the open sector. The trajectory of each mouse was automatically recorded by video tracking (Ethovision 3.0, Noldus, Wageningen, the Netherlands). The total number of entries into all sectors served as an index of spontaneous locomotor activity, while the difference in the number of entries and the time spent in the open sectors were used as anxiety indices. Between experiments, the maze was cleaned with 4% ethanol / water.

[0494] Open field and novel object

[0495] Under dim and diffuse light conditions, locomotion towards the open field (OF) and reactivity were evaluated in a white square box (50 x 50 x 37 cm). Mice were placed in the center of the arena and allowed to move freely for 10 min. The total distance moved, frequency of entry into the center, time and percentage of time in the center of the OF were analyzed. Avoidance of the inner or "unprotected" area of the arena was interpreted as anxiety-like behavior. The measurement of the total distance was used as an index of activity. The novel object (NO) test was used to evaluate exploratory behavior. The NO test was performed immediately after the OF test. A small metal object (3 x 1.5 x 5 cm) was placed in the center of the open field while the mouse was inside. Then the mouse was given 5 min to freely explore the novel object. The time spent and the number of entries into the center, latency period, and the total distance moved in the center and throughout the compartment were analyzed. The time and distance percentage that the mouse spent exploring the novel object in the center were regarded as indices of "focused" exploratory activity.

[0496] Treatment with pomegranate-derived extract

[0497] Three weeks before starting the chronic stress protocol, the mice were divided into four different groups. One group received a standard mouse chow diet (control), while the remaining three groups received different doses of extract 1011, an extract derived from pomegranate juice. The low dose corresponded to an extract dose of 21 mg / kg / d of gallic acid equivalent polyphenols (GAE PPE), the middle dose corresponded to an extract dose of 43 mg / kg / d of GAE PPE, and the high dose corresponded to an extract dose of 86 mg / kg / d of GAE PPE (see Table 5).

[0498] Table 5. Pomegranate powder extract 1011.

[0499]

[0500] Three weeks before starting the chronic stress protocol, dietary treatment was initiated and continued until the end of the experiment.

[0501] Treatment with urolithin A (pomegranate-derived metabolite)

[0502] Three weeks before starting the chronic stress protocol, mice were divided into 2 groups. One group received a standard mouse chow diet (control), while the other groups received a diet containing urolithin A, delivered at a dose of 25 mg / kg / d.

[0503] Chronic unpredictable stress

[0504] The unpredictable chronic stress protocol consisted of: exposing the animals to stress situations at unpredictable times each day for 4 weeks (between 8:00 am and 4:00 pm and randomly distributed over 28 days). The stress stimuli used were any of the following: 6 min tail suspension; 3 x 0.4 mA inescapable foot shock; 4 h exposure to damp sawdust mixed with soil; 2 h exposure to a elevated platform; 1 h restraint in a plastic tube; 30 min exposure to 16 °C; 2 days of reversed light / dark cycle; 10 min exposure to aged aggressive conspecifics; bright light exposure (600 lux); 2 h crowding the cage (6 mice) and 8 h of 40° cage tilt. All animals were weighed and the state of their fur was evaluated regularly (every 3–5 days). In this experiment, one group of mice was exposed to chronic stress and the other groups of animals were kept intact and used as controls.

[0505] Behavioral assays

[0506] Tail suspension test

[0507] The tail suspension test (TST) was used as a model for evaluating the antidepressant-like activity in mice. This test is based on the fact that animals subjected to short-term (6 min.) inescapable stress of being suspended by their tails will assume an immobile posture. The mice were suspended from a metal rod with adhesive tape 20 mm from the tip of their tails. The distance between the floor and the rod was approximately 25 cm. Immobility was defined as the absence of active movement and included passive swaying. The study time (which included immobility, struggling, and climbing) was scored from a videotape.

[0508] As Figure 27As shown, chronic stress causes an increase in immobility in the TST, which is an indicator of enhanced depressive and helpless feelings. However, mice treated with increasing doses of pomegranate extract showed a reversal of this pattern, and motility and struggling returned to levels observed in non-stressed mice. Thus, pomegranate extract prevents the depressive response observed in untreated mice with chronic stress.

[0509] Context recognition

[0510] Context fear training is a measurement of an animal's ability to remember a specific context. In this assay, mice are placed in a box and then receive two mild electric shocks that are 1 minute apart. In response to the shocks, the mice become immobile. The ability of the mice to recognize the context in which they received the shocks is tested by placing them back in the box at a later time point. If they recognize the context, the mice become immobile in anticipation of receiving an electric shock.

[0511] In normal mice, the ability to recognize the context in the absence of any electric shock is a measurement of context memory. Mice with better context memory recognize the initial context better and thus have a higher level of immobility.

[0512] This assay can also be used to measure the anxiety of stressed mice. In stressed mice, increased anxiety and a longer period of disappearance of context memory can be observed in the increased immobility response time caused by the initial electric shock. The disappearance of context memory is measured as follows: Mice are placed in the same context once a day for several days in the absence of the initial adverse stimulus. The mice forget the association between the context and the adverse stimulus over time, which is confirmed by a gradual decrease in immobility. In anxious stressed mice, this disappearance of the adverse memory takes longer.

[0513] Use contextual fear training to test the effect of pomegranate extract on anxiety induction (i.e., learned anxiety) in mice caused by contextual recognition. The training and testing were carried out in a rodent training chamber (20×20×28 cm), which was placed in a plexiglass box and illuminated by a 20-W light bulb. The side walls of the training chamber were made of white methacrylate, and the door and top cover were made of plexiglass. The floor consisted of 20 steel bars through which irregular electric shocks could be delivered from an electric shock generator. A ventilator provided a background noise of 68 dB (the whole system: Panlab, S.L., Barcelona, Spain). In the 3rd week of the chronic stress protocol for the stress group, contextual fear training was carried out. On the day of fear training, the mice were transported from the group housing room to the adjacent behavioral laboratory and placed in the training chamber. The training included: exposing the mice to the training context for 3 min, followed by delivering a foot shock (2 s, 0.4 mA) three times at 1-min intervals. After the last foot shock, the animals were kept in the chamber for 30 s. The fear training chamber was thoroughly cleaned with 0.5% acetic acid, and then each mouse was placed in a box. To determine the effects of chronic stress and different doses of pomegranate extract on the anxiety level induced by this contextual memory, the level of anxiety-induced behavior caused by this context was measured. The following behavioral responses (known to be sensitive to the anxiety level) were examined: the percentage of immobility, the percentage of rearing on the hind legs, and the percentage of grooming behavior. These behavioral measurements were carried out 48 h after the mice were re-exposed to the training context for 8 min. After the training and testing, the animals were immediately returned to their home cages. The behavior of the animals was recorded and later scored by observers who were unaware of the animal handling using self-made behavioral observation software.

[0514] The immobility (defined as no movement other than heart beat and breathing) was scored and used as an index of anxiety. The immobility time was converted into a percentage of the immobility level. The pomegranate extract showed a dose-dependent response, with a significant decrease in the percentage of immobility at the highest dose ( Figure 28 ), indicating protection against anxiety. Regarding rearing on the hind legs, a similar reduction in anxiety behavior was observed, with a significant and dose-dependent protection against the rearing on the hind legs behavior after the administration of the pomegranate extract ( Figure 29 ). Concluding these observations was a strong inhibition of the anxiety-induced grooming behavior by the highest dose of the pomegranate extract ( Figure 30 ). These results confirm that pomegranate extract and compounds reduce experience-induced anxiety in mice.

[0515] This reduction in experience-induced anxiety in chronically stressed mice by urolithin A (a metabolite of punicalagin) was also observed. In this study, the level of anxiety was measured by the disappearance of the memory of the aversive context provided in the above-mentioned contextual fear assay. In this study, mice that had been trained using the contextual fear paradigm were exposed to the context once a day for 4 days, but in the absence of any aversive stimuli. The ability to recognize the context was measured by freezing during a 3-minute observation period. It has been confirmed that increased levels of anxiety lead to a longer period of disappearance of the aversive context memory. As Figure 31 shown, mice that had experienced chronic stress showed a slower disappearance period than normal mice. However, after treatment with urolithin A at a dose of 25 mg / kg / d, mice that had experienced chronic stress showed a significant improvement in the disappearance of the aversive memory, thus confirming that urolithin A, like punicalagin, is able to reduce anxiety in mice that have experienced chronic stress.

[0516] Morris water maze

[0517] Spatial memory and learning are affected by chronic stress. The Morris water maze apparatus consists of a large white circular pool (140 cm in diameter) filled with opaque colored water (25 °C ± 1 °C) and a platform (10 x 10 cm 2 ) submerged 1 cm below the water surface. The water maze is surrounded by a gray curtain (25 cm from the perimeter of the pool) containing several prominent visual cues. Before the trials, the mice were trained to learn the location of the platform. Using the prominent visual cues, the mice learned to locate the platform. The learning phase began with a habituation phase, in which the mice were introduced to the room, the apparatus, and the water and allowed to perform a 2-min free-swimming trial without the platform present. Data were collected using a camera fixed to the inner ceiling, which was connected to a video tracking system (Ethovision 3.0, Noldus, Wageningen, the Netherlands).

[0518] After the habituation phase (day 0), the mice were subjected to different protocols to sequentially evaluate their spatial learning ability (days 1–3). The spatial learning phase was carried out for 3 consecutive days (days 1–3), with 4 trials per day and a 6-min inter-trial interval (ITI) between each trial.

[0519] Each trial began with the mouse being introduced into the maze, facing the pool wall, by means of a cup at one of four possible locations (which were randomly balanced between trials and days). The distance between the mouse and the platform was measured at each sampling time, with 25 sampling times collected per second. The sum of these distances was then calculated over a 60 - second period to obtain the measurement of the distance (cm) to the platform for each trial. If the mouse did not find the platform within 60 seconds, it was gently guided to the platform. Each mouse had to stay on the platform for 20 seconds and was then returned to its waiting cage.

[0520] The results of this example confirmed that chronic stress has a significant negative impact on learning and spatial memory. During the training period, the distance traveled to reach the platform was significantly increased compared to non - stressed controls, indicating that chronic stress impairs the normal memory formed during learning ( Figure 32 ). Treating the mice with pomegranate extract protected against these negative effects of chronic stress on learning and associated memory. A dose - dependent effect was observed in the mice receiving pomegranate extract, and the chronically stressed mice treated were able to perform at the same level as non - stressed controls ( Figure 33 ).

[0521] As Figure 34 shown, a similar effect was observed for the mice treated with urolithin A. As confirmed by the high variability between sequential trials, mice that had undergone the chronic stress protocol showed unstable learning. Chronic stress mice treated with urolithin A at a dose of 25 mg / kg / d showed stabilization of this variability. This confirmed the fact that urolithin A (a downstream metabolite of punicalagin) can also protect against these negative effects of chronic stress on cognition (including learning and memory).

[0522] In summary, these results together confirmed that pomegranate extract and derived compounds such as urolithin A can act to reduce the negative effects of chronic stress on cognition (including memory and learning). Additionally, pomegranate extract and derived compounds have antidepressant activity (as seen in the tail suspension test) and reduce anxiety caused by chronic stress. The results also confirmed that pomegranate extract prevents the decline in memory and learning performance and spatial recognition that are commonly observed after chronic stress.

[0523] Example 16

[0524] Effects on Memory and Cognition in an Aged Rat Model

[0525] During the aging process, there are several effects on cognition and memory, which can be replicated in an aging rat model. For a review, see Gallagher and Rapp (1977) Annu Rev Psychol. 48:339-70. The aged rat model has been widely used to characterize the effects of aging on memory and cognition. In the experiments presented here, improved performance was observed in the presence of pomegranate extract.

[0526] Aged Sprague-Dawley rats (starting at 19 months of age) received pomegranate extract (1108) in their drinking water at a concentration of 0.34 mg / mL polyphenol (PPE). The polyphenol content was measured using the Folin-Ciocalteu spectrophotometric method, and the phenolic content was expressed as gallic acid equivalents. The control treatment consisted of 1.36% sucrose, 0.12% D-glucose, and 0.12% D-fructose dissolved in water. The rats consumed an average of 30 mL / day of the control and 1108 treatment agents (see Table 6), with an average weight of 660 g / rat. For animals receiving the 1108 extract, this resulted in a dose of 15 mg PPE / kg / d or 1.1 mg punicalagin / kg / d.

[0527] Table 6. Pomegranate liquid extract.

[0528] Extract 1108 Delivered polyphenol dose 15 mg / kg / d Delivered punicalagin dose 1.11 mg / kg / d

[0529] After 2.5 months of treatment, short-term working memory was evaluated using the social recognition task (a standard test that includes social cognition). Thor and Halloway (1981) Animal Learning Behavior. 9:561-5. In this task, each aged rat was placed in its home cage with a young male Sprague-Dawley rat (<5 weeks old) for 5 minutes. Thirty minutes later, the exact same procedure was repeated with the same young rat to determine the extent of the second interaction between the two animals. A decrease in contact was anticipated during the second interaction because the two animals had had a previous interaction. This decrease in contact between the animals is a measure of cognitive performance and memory retention. Thirty minutes later, a new young rat was placed with the aged rat for 5 minutes to determine whether the aged rat could distinguish between two different young individuals. During each contact phase between the two animals, the total contact time was measured to assess the intensity of the social interaction.

[0530] The results are shown in Figure 35In contrast, aged animals in the control treatment did not show a preference for familiar objects and spent equal time exploring the two objects. This effect has been previously demonstrated in aged rats and is thought to reflect a decline in temporal order memory during the aging process. Hauser et al. (2009) Behav Neurosci. 123:1339-45. However, rats treated with extract 1108 showed a decrease in the time spent on the same juvenile rat during the second exposure period and an increase in the interaction time with the new juvenile rat. This observed difference explains the protective benefit of extract 1108 on memory development and retention.

[0531] Example 17

[0532] Effect on Spatial Memory in an Aged Rat Model

[0533] It has also been reported that spatial memory is affected by aging, which leads to a decline in performance. Bergado et al. (published electronically on October 29, 2010) Spatial and emotional memory in aged rats: a behavioral analysis. Neuroscience. To examine the effect of pomegranate extract on the decline of spatial memory during the aging process, aged Sprague-Dawley rats (starting at 19 months of age) were treated with pomegranate extract 1108 or a control in their drinking water, as described for Example 16.

[0534] Aged rats were treated with extract 1108 or an isocaloric control for 3 months. Thereafter, their learning and memory performance was evaluated using the Morris water maze task, as described in Example 15.

[0535] The learning ability of each animal was evaluated by their performance in the reversal task (3 trials). In this task, the animal was first taught the location of the platform in the quadrant (WEST) through 3 training trials. Then the position of the platform was changed and it was placed in the opposite quadrant (EAST). The animal received 3 new training periods to learn the new position of the platform. The effort to determine the new position of the platform was measured, which was measured by the distance moved before determining the platform position. The results are shown in Figure 36 In. Animals treated with the extract were significantly more effective in localizing the platform in the reversal test (one-way ANOVA, P < 0.02; control N = 11; PJ: N = 13; extract: N = 14), thus confirming the therapeutic benefit of the administered extract for this aspect of spatial memory.

[0536] Example 18

[0537] Effect of pomegranate-derived compounds on spatial and working memory in Alzheimer's disease

[0538] It has been confirmed that Alzheimer's disease (AD) has a harmful effect on spatial memory, which has also been observed in AD mouse models of the disease. To determine the effect of pomegranate-derived compounds on improving spatial and working memory in AD, different pomegranate extracts and punicalagin were tested in two spatial memory performance assays (Y-maze and Morris water maze).

[0539] Y-maze

[0540] In this study, the 5XFAD mouse model of AD was used. The 5XFAD mouse model of Alzheimer's disease is based on genetic modifications (introduction of mutant human APP and PS1 genes) that lead to the production of amyloid-beta peptide (Aβ) in brain tissue. These mice were found to have a significant decline in cognitive performance in the Y-maze as early as 7 months of age.

[0541] To determine the effect of pomegranate-derived compounds, pomegranate extract (PE) from whole pomegranates was delivered by gavage at a dose of 60 mg / kg / d of polyphenols, which includes approximately 5.6 mg / kg / d of punicalagin. Starting at 3 months of age, the mice were gavaged three times a week until the end of the treatment. After 7 months of age, the mice were tested for the effect of PE on working memory on the Y-maze. The mice were placed in the Y-maze for 15 minutes and allowed to explore two arms, with the third arm blocked. Four hours later, the animal was placed in the maze again for 5 minutes, and this time the third arm was opened, allowing the mouse the possibility of freely exploring all three arms. Exploration activity in the new arm evaluates the animal's ability to recognize, based on spatial cues, that a particular area has not been explored. The mice were scored as making a correct change in exploration if they explored each of the three arms and not just the first two that were present.

[0542] As Figure 37 shown, a significant improvement in working memory performance (measured by the number of correct changes) was observed in 5XFAD mice treated with PE.

[0543] Morris water maze

[0544] In a second transgenic animal model of Alzheimer's disease, pomegranate extracts 31008, 61109, and 71109 were tested. This model expresses the amyloid mutant London mutation and the presenilin-1 human mutation. Animals in this model form plaques before 4 months and develop memory deficits before 6 months. Dense plaque deposits can be seen after 7 months.

[0545] In one set of experiments, 4-month-old APP-PS1 transgenic mice were fed a fixed dose of approximately 97 mg total polyphenols / kg / day via their drinking water, which included extract 31008 of approximately 15 mg / kg / d of punicalagin, said extract being derived from whole pomegranates. In one set of experiments, 4-month-old APP-PS1 transgenic mice were fed a fixed dose of a total of approximately 468 mg / kg / day of extract 61109 via their drinking water, which was highly enriched in punicalagin (>91%). In one set of experiments, 4-month-old APP-PS1 transgenic mice were fed a fixed dose of extract 71109 of approximately 180 mg total polyphenols / kg / day via their drinking water, said extract being derived from pomegranate rinds. After 3 months of feeding, the mice (7 months old at this time) were tested in the Morris water maze spatial test.

[0546] The Morris water maze was conducted during days 84 - 87 of treatment. The pool (a white circular container, 1 m in diameter) contained water at 20 °C, which contained titanium dioxide as an odorless and non-toxic additive to hide the escape platform (1 cm below the water surface). The swimming of each mouse was recorded on videotape and analyzed (Ethovision, Noldus information Technology, Wageningen, the Netherlands). Before training, each mouse was placed on top of the platform for 15 seconds. For the place navigation test, the mice were trained for 3 consecutive days to locate the hidden platform in five modules of three trials. Each trial consisted of a forced swim trial of up to 120 seconds and a subsequent 60-second rest. In five consecutive training modules, the time required for each mouse to locate the platform was measured to determine the learning curve of each mouse.

[0547] Twenty-four hours after the last training, each animal underwent a probe test with the platform removed. The mice were allowed to search for the disappeared platform for 60 seconds, and the search time spent in each quadrant of the pool, as well as the number of times crossing the original platform location, were measured. As Figure 38 shown, the mice fed extract 31008 showed improved performance in the probe test, as confirmed by an increase in the frequency of crossing the area where the platform was originally located. The mice fed extract 61109 and 71109 had even better performance.

[0548] The composition of extract 61109 used in this experiment is shown in Table 7.

[0549] Table 7.

[0550] Extract 61109 Punicalagin 91.3% (w / w) Delivered punicalagin dose 295 mg / kg / d

[0551] Example 19

[0552] Effect of pomegranate-derived compounds on depression, anxiety, and cognition induced by early-life stress

[0553] The ability of pomegranate-derived compounds to improve brain function (including cognition, depression, and anxiety) was evaluated in a model of early-life stress associated with maternal separation.

[0554] Early-life stress has a significant impact on cognitive performance in later adult life, including: (i) increased abnormal decision-making and excessive risk-taking; (ii) susceptibility to increased rates of depression and anxiety; and (iii) impaired learning and memory.

[0555] All procedures were conducted in accordance with the Swiss National Institutional Guidelines on Animal Experimentation and were approved by the Swiss Cantonal Veterinary Office Committee for Animal Experimentation.

[0556] Early-life stress induced by maternal separation

[0557] On the first day after birth, pups were selected, six pups per mother. From the first day to the 14th day after birth, unforeseen maternal separation (MS) was performed for 3 hours per day. Maternal separation was carried out at random times (from 8 am to 2 pm) to avoid maternal habituation to the procedure. The protocol consisted of moving the pups from their mother to another cage for a 3-hour period at room temperature, after which the pups were returned to their original nest. These groups are represented in the figure as early-life stress. The control group of dams / pups remained intact and is represented in the figure as normal.

[0558] Treatment with punicalagin isolated from pomegranate

[0559] One week after maternal separation, the mice were divided into 2 groups. One control group received a standard mouse food diet (untreated), while the other group received ellagitannin punicalagin incorporated into the food and was designed to be delivered to the mice at a dose of 90 mg / kg / day. Diet treatment was initiated 1 week after the termination of the maternal separation treatment.

[0560] Behavioral assays

[0561] The following behavioral assays were used to examine the effects of early-life stress on depression, anxiety, and cognition, which were performed 166 days after the end of the maternal separation protocol. Mice raised normally were compared with mice separated from their mothers (early-life stress) and mice separated from their mothers and treated with punicalagin.

[0562] Dark / Light Box Test

[0563] In this assay, mice were placed in a PVC box (Ligna, Paris, France) that was divided into two compartments: a dark compartment (15 x 20 x 25 cm, black PVC, covered on top) and a light compartment (30 x 20 x 25 cm, white PVC, under 200 lux illumination), which were connected by an interconnecting door (5 x 5 cm). The experiment was started by placing the animal in the dark compartment, after which the amount of time the mouse spent in the illuminated area, the number of migrations from the dark area to the illuminated area, and the latency period of escape from the dark area to the illuminated area were recorded with a video camera over a 5-minute period.

[0564] Under normal conditions, mice avoid the illuminated area in the box. As a consequence of early life stress, maternally separated mice spend an abnormally long time in the illuminated compartment compared to their non-maternally separated littermates ( Figure 39 ). This increase in the time spent exploring the illuminated area reflects impaired decision-making behavior characterized by abnormal and excessive risk-taking.

[0565] Treatment of maternally separated mice with punicalagin reverses and normalizes the observed excessive risk-taking behavior and restores the decision-making process to normal ( Figure 39 ).

[0566] Elevated O-Maze (EOM)

[0567] Another behavioral assay for measuring abnormal risk-taking is the Elevated O-Maze (EOM). In this assay, an apparatus consisting of a ring with a diameter of 41.5 / 46.5 cm (inner diameter / outer diameter) was divided into four equal parts. Two opposite parts of the ring were surrounded by 5-cm high walls. The remaining two parts of the ring had no walls. The maze was 1 m above the ground. The natural tendency of mice is to avoid open surfaces and spend more time in the enclosed area of the ring with 5-cm walls compared to the open area of the ring.

[0568] To examine the effects of early life stress, mice were placed at the entrance of one of the areas of the maze with 5-cm walls, with their nose facing the closed arm, and allowed to explore the EOM for 5 min. During this period, the animal behavior was videotaped. The time spent in each arm (closed versus open) was calculated, and an arm was considered to have been entered only when all four paws of the animal had entered the arm.

[0569] Under normal conditions, mice placed in the elevated O-maze avoid the open area of the ring and spend a limited amount of time exploring this area. Compared to their non-stressed littermates, mice stressed by maternal separation spend an abnormally long time in the open part of the O-maze (Figure 40 )。 Also as observed in the dark / light box test, this reflects the impaired decision-making behavior characterized by abnormal and excessive risk-taking in mice subjected to early-life stress.

[0570] Treatment of maternally separated mice with punicalagin reverses and normalizes their abnormal excessive risk-taking behavior caused by early-life stress ( Figure 40 ).

[0571] Forced swim test

[0572] The Porsolt or forced swim test is commonly used to test antidepressant treatment (Porsolt et al., 1977a; Porsolt et al., 1977b). For this behavioral test, mice are placed in a 5L cylinder (11 cm in diameter and 25 cm in height) filled two-thirds full with water at 23 °C. If there is significant body displacement, the animal is considered to be engaged in swimming and activity. Animals floating with minimal movement during the analysis phase are considered immobile. Using a video recorder and a mirror behind the cylinder, the animal behavior is recorded during a 6-minute test period. The swimming activity of the mice is analyzed separately during the first 2 minutes and the last 4 minutes of swimming. Increased levels of depression are associated with increased immobility of the mice, especially during the last 4 minutes. Animals that have experienced early-life stress show significantly increased immobility compared to their non-stressed littermates, indicating elevated levels of depression ( Figure 41 ). Treatment of mice subjected to early-life stress with punicalagin reverses this abnormal behavior (increased immobility) and increases swimming activity to the level observed in non-stressed mice. This behavioral effect of punicalagin confirms its activity as an antidepressant ( Figure 41 ).

[0573] Context fear training

[0574] Context fear training is used to determine the effect of ellagitannin punicalagin on the anxiety susceptibility of adult animals subjected to early-life stress. Animals are trained in a context fear conditioning chamber (Context A, W×L×H: 30 cm×24 cm×26 cm) (PanLab) with a grid floor containing stainless steel rods and connected to an electric shock generator developed by Panlab. During training, animals are placed in the chamber one at a time. After 4 minutes of exploration in the chamber, one foot shock (2 seconds and 0.4 mA) is applied, and a second foot shock (2 seconds and 0.4 mA) is applied 1 minute later. Thirty seconds after the second foot shock, the mouse is returned to its home cage. During the duration of the experiment, the animal behavior is monitored every 2 seconds. The periods during which the mouse remains immobile in the chamber are considered "freezing", and these periods are scored. The time the mouse remains immobile after the first shock during a 60-second period is recorded and expressed as a percentage.

[0575] The behavior of mice to remain immobile and "rigid" in response to foot shock is a measure of their anxiety level. In this behavioral test, the longer the duration of "rigidity", the higher the anxiety level of the animal.

[0576] After the first shock, differences in rigidity were observed between the experimental groups (normal non-stressed, early-life stressed, and early-life stressed + punicalagin) ( Figure 42 ). Early-life stress causes an increase in anxiety in mice, as evidenced by the increased rigidity time compared to their non-stressed littermates after foot shock ( Figure 42 ). Punicalagin treatment reduces and normalizes these elevated anxiety levels resulting from early-life stress, as evidenced by the decreased rigidity time after foot shock ( Figure 42 ). These observations in the early stress model confirm the anxiolytic effect of punicalagin.

[0577] Increased anxiety was also observed in animals exposed to early-life stress in terms of the elimination (i.e., disappearance) of context memory (i.e., the memory that associates the environmental context with the shock) induced by this assay. To examine the intensity of the anxiety formed during context fear training (as described above), animals were placed in the same chamber and context for 3 min each day for 12 days after the initial trial (at the same time of day, but without shock this time). During each of these daily 3-minute periods, the rigidity behavior induced by the animals' simple recognition of the chamber (where they received the initial shock) was measured.

[0578] The animal groups (normal non-stressed, early-life stressed, and early-life stressed + punicalagin) showed differences in their reduced recall of the shock context over the subsequent 12 days ( Figure 43 ). In this figure, the duration of rigidity is expressed as a percentage of the time held at different times on Day 1 (e.g., if a mouse remained immobile for 60 seconds on Day 1 and 30 seconds on Day 8, then the percentage of immobility on Day 1 was 100% and on Day 8 was 50%).

[0579] Normal non-stressed mice showed a predictable decline in context recall over the 12-day period ( Figure 43 ). Mice with early-life stress had enhanced context recall, as demonstrated by higher levels of rigidity compared to their non-stressed littermates ( Figure 43)。This shows elevated anxiety levels that are prolonged in these maternally separated mice. Treatment of mice with early-life stress with punicalagin has a significant effect on reducing anxiety, as observed by the disappearance of context recall. Mice treated for early-life stress showed a faster disappearance compared to untreated mice with early-life stress, characterized by a reduced immobility period between Day 8 and Day 12 ( Figure 43 )。

[0580] Rotarod

[0581] To measure the effect of pomegranate-derived compounds on the negative cognitive effects of maternal separation, the rotarod behavioral assay was used to test the effect on motor learning. The rotarod apparatus consists of a rod with a 2 cm diameter. Mice were placed on the rotarod, which was initiated at an initial speed of 5 rpm. The rod speed was gradually accelerated at a rate of 8 rpm / min until a speed of 45 rpm was reached. The latency to fall was measured with a cut-off time of 300 seconds. As Figure 44 shown, mice that had experienced early-life stress suffered impaired motor learning. Maternally separated mice fell off the rotarod faster than normal non-stressed mice. Treatment with punicalagin restored the motor learning skills of animals with early-life stress to the behavioral levels observed in normal non-stressed littermates.

[0582] Morris water maze

[0583] The Morris water maze behavioral assay was used to evaluate the cognitive effects of maternal separation. In this assay, cognitive learning was measured by the ability of the mice to locate a hidden platform in a pool of opaque water. The apparatus consisted of a pool (140 cm in diameter) filled with water at 22 °C. Mice escaped from the water by swimming to a hidden circular platform (15 cm in diameter) placed 1 cm below the water surface. By using visible cues located outside the maze, the mice were able to locate the platform and recall its position in subsequent trials. During the training period, the mice were placed at 2 (alternating) starting positions per hour. The Morris water maze task was performed as follows: 8 trials at T1, 6 trials at T2, and 4 trials at T3 (on Days 1, 2, and 3). The mice had a maximum of 60 seconds to reach the platform. The escape latency to reach the platform was measured by a video tracking system. As observed in Figure 45 , early-life stress had a significant effect on cognitive learning, with mice taking longer periods to learn the location of the hidden platform, as confirmed by an increased escape latency compared to normal non-stressed mice. Treatment of these maternally separated mice with punicalagin reversed this negative effect of early-life stress, thus reducing the time to remember the location of the hidden platform to the levels observed in normal non-stressed mice. These results confirm the ability of punicalagin to reverse the long-term negative cognitive effects of early-life stress on learning and memory formation.

[0584] Pomegranate-derived compounds

[0585] Together, the above data confirm that compounds derived from ellagitannins can reverse the long-term negative effects of early-life isolation on depression, anxiety, and cognition.

[0586] Example 20

[0587] Effect of pomegranate-derived compounds on memory and cognition in normal mice

[0588] Treatment with pomegranate-derived compounds

[0589] Starting at 3 months of age, mice were fed: (i) a standard control diet such as AIN-93G; (ii) a diet containing punicalagin at a concentration of 0.87 mg / kg, delivering an approximate dose of 90 mg / kg / day (for 3 months); or (iii) a diet containing urolithin A at a concentration of 0.57 mg / kg, delivering an approximate dose of 55 mg / kg / day (for 2.5 months). The actual dose varied slightly with the food consumption of each individual mouse and the mouse weight. After this phase, behavioral assessments of cognition were measured.

[0590] Behavioral assays for measuring the effect of pomegranate-derived compounds on cognition

[0591] To examine the effect of pomegranate-derived compounds on memory and cognition, the improvement of context memory in mice was examined using the context fear training assay. As described in Example 19, mice were trained in the fear training chamber.

[0592] During training, animals were placed in the chamber one at a time. After 4 minutes of exploration in the chamber, a single foot shock (2 seconds and 0.4 mA) was applied, and a second foot shock (2 seconds and 0.4 mA) was applied 1 minute later. Thirty seconds after the second foot shock, the mice were returned to their home cages.

[0593] One day later, the trained animals were returned to the chamber for a 3-minute period. During this time, the movement of the mice was monitored. The amount of time spent immobile or "frozen" was scored as a percentage of the total observation time (3 minutes). The time spent immobile is a measure of the strength of the mice's memory of the context in which they were trained. Treatment with the pomegranate-derived ellagitannin punicalagin and the ellagic acid metabolite urolithin A resulted in a significant improvement in context memory compared to untreated control mice, as determined by their context memory 24 hours after the training period ( Figure 46 ).

[0594] To determine the effects of these pomegranate-derived compounds on memory retention, normal mice fed (i) a control diet, (ii) punicalagin (for 3 months), or (iii) urolithin A (for 2.5 months) were studied for their memory recall on days 1, 2, 3, 4, and 5 after initial contextual fear training.

[0595] During the 5 days following the initial trial, the animals were placed in the same chamber and context for 3 min each day (at the same time of day, but without an electric shock this time). During each of these daily 3-min sessions, the freezing behavior induced by the simple recognition of the chamber (where they had received the initial electric shock) by the animals was measured. The ability to recognize the environment in the absence of a stimulus is a measure of contextual memory.

[0596] As the days passed, control untreated mice began to lose their memory of the contextual stimulus, as evidenced by a decrease in the degree of freezing ( Figure 47 ). Mice treated with punicalagin or urolithin A showed improved memory retention compared to control untreated mice. This was explained by the ability to remember the initial context for a longer time, as evidenced by a significantly longer period of time before the contextual memory disappeared ( Figure 47 ).

[0597] These results confirm that treatment with punicalagin or urolithin A leads to improved cognition, as evidenced by a significant increase in contextual recognition and an improvement in memory retention.

[0598] Example 21

[0599] Effects of pomegranate-derived compounds on improving muscle performance in normal mice

[0600] The ellagitannin-derived compounds punicalagin and urolithin A were evaluated for their ability to improve muscle performance. To examine the benefits of punicalagin and urolithin A on improving muscle performance, their effects were examined using two behavioral assays: (i) the rotarod assay, which measures muscle performance and motor skills, including coordination, and (ii) the treadmill endurance test, which measures muscle performance and endurance.

[0601] Behavioral assays for measuring the effects of pomegranate-derived compounds on muscle performance

[0602] Rotarod assay

[0603] Starting at 3 months of age, mice were fed a standard control diet such as AIN-93G or a diet containing punicalagin (at a dose to deliver 90 mg / kg / day) for 3 months.

[0604] To examine the effects of pomegranate-derived compounds on muscle performance and motor skills, mice were tested in the rotarod behavioral assay. The rotarod apparatus consisted of a rod with a diameter of 2 cm, which had 5 compartments that were 5 cm wide. The mice were placed on the rotarod that was started at an initial speed of 5 rpm. The rod speed was gradually accelerated at a rate of 8 rpm / min. With a cut-off time of 300 seconds, the latency to fall was measured. The mice were subjected to 4 trials. The latency to fall is a measure of the muscle performance and motor skills of the mice, and a longer latency to fall reflects better performance. Control untreated and punicalagin-treated mice were tested. Compared to the untreated mice, ellagitannin punicalagin was able to significantly improve muscle performance and motor skills. During the sequential trial period, compared to the untreated mice, the punicalagin-treated mice were able to stay on the rotarod at a higher speed and for a longer time ( Figure 48 ).

[0605] Endurance test

[0606] Before starting the study, normal 8-week-old mice were allowed to acclimatize for 2 weeks. The mice were fed a standard rodent diet (food diet) or a diet containing urolithin A mixed with the food to achieve a dosing of 55 mg / kg / day delivered to the mice. After 6 weeks of treatment, the muscle performance of the mice was tested by means of an endurance test.

[0607] The endurance test was performed using a variable speed treadmill (Panlab, Barcelona, Spain) enclosed in a plexiglass chamber, which had a stimulation device consisting of an electric shock grid that was connected to the rear of the belt. The mice were made to run at 10 cm / sec and 0° incline for 5 min. Then the speed was increased by 2 cm / sec every 5 min until the mice were exhausted. The distance run in 5-min intervals and the number of electric shocks received were recorded. When the mice received approximately 20 electric shocks within a 1-min period, it was considered that they had become exhausted and they were removed from the experiment. Control untreated and urolithin A-treated mice were tested and their performance was compared.

[0608] The ability to run at a higher speed on the treadmill reflects improved muscle performance and endurance. The mice would seek to avoid the electric shock and would run despite the increasing speed. At a certain point, the mice could not keep up with the treadmill speed and were shocked. After reaching the threshold level of electric shock, the mice were removed from the treadmill. Mice with better muscle performance and improved endurance were able to keep up with the increasing treadmill speed and would experience fewer electric shocks at a particular speed. In this behavioral assay, the urolithin A-treated mice ran at a higher speed than the untreated control group mice, indicating that urolithin A improves muscle performance and endurance in this context ( Figure 49 ).

[0609] These results confirm that ellagitannin punicalagin and its metabolite urolithin A can improve the muscle performance and motor skills of mammals.

[0610] Equivalent scheme

[0611] The present invention has been described generally and generically herein. Those of ordinary skill in the art will readily envision numerous other devices and / or structures for achieving these functions and / or obtaining these results and / or one or more of the advantages described herein, and each such variation and / or modification is considered to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and the actual parameters, dimensions, materials, and / or configurations will depend upon the specific applications or those applications using the teachings of the present invention. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments of the invention described herein. Accordingly, it should be understood that the foregoing embodiments are presented by way of example only, and that within the scope of the appended claims and their equivalents, the invention may be practiced otherwise than as specifically described and claimed. The present invention pertains to each and every individual feature, system, article, material, kit, and / or method described herein. Moreover, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the scope of the present invention. Additionally, each narrower genus and subgroup falling within the general disclosure also forms part of the present invention. This includes the case where the general description of the invention has the proviso or negative limitation of excluding any subject matter from the genus, whether or not the excluded material is specifically recited herein.

[0612] Incorporation by reference

[0613] The contents of articles, patents, and patent applications, and all other documents mentioned or cited herein, and information that can be obtained electronically, are hereby incorporated by reference in their entirety to the same extent as if each individual publication were specifically and separately indicated to be incorporated by reference. The applicant reserves the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other tangible and electronic documents.

[0614] References cited

[0615] Bai, N., K. He, et al. (2008). "Active compounds from Lagerstroemia speciosa, insulin-like glucose uptake-stimulatory / inhibitory and adipocyte differentiation-inhibitory activities in 3T3-L1 cells." J Agric Food Chem 56(24):11668-74.

[0616] Bishop, N. A., T. Lu, et al. (2010). "Neural mechanisms of ageing and cognitive decline." Nature 464(7288):529-35.

[0617] Bloss, E. B., W. G. Janssen, et al. (2010). "Interactive effects of stress and aging on structural plasticity in the prefrontal cortex." J Neurosci 30(19):6726-31.

[0618] Bowman, R. E., K. D. Beck, et al. (2003). "Chronic stress effects on memory: sex differences in performance and monoaminergic activity." Horm Behav 43(1):48-59.

[0619] Cerda, B., J. C. Espin, et al. (2004). "The potent in vitro antioxidant ellagitannins from pomegranate juice are metabolised into bioavailable but poor antioxidant hydroxy-6H-dibenzopyran-6-one derivatives by the colonic microflora of healthy humans." Eur J Nutr 43(4):205-20.

[0620] Cerda, B., P. Periago, et al. (2005). "Identification of urolithin a as a metabolite produced by human colon microflora from ellagic acid and related compounds." J Agric Food Chem 53(14):5571 - 6.

[0621] De Souza Schmidt Goncalves, A. E., F. M. Lajolo, et al. "Chemical composition and antioxidant / antidiabetic potential of Brazilian native fruits and commercial frozen pulps." J Agric Food Chem 58(8):4666 - 74.

[0622] Del Pozo - Insfran, D., C. H. Brenes, et al. (2004). "Phytochemical composition and pigment stability of Acai (Euterpe oleracea Mart.)." J Agric Food Chem 52(6):1539 - 45.

[0623] Dumitriu, D., J. Hao, et al. (2010). "Selective changes in thin spine density and morphology in monkey prefrontal cortex correlate with aging - related cognitive impairment." J Neurosci 30(22):7507 - 15.

[0624] Gasperotti, M., D. Masuero, et al. "Profiling and accurate quantification of Rubus ellagitannins and ellagic acid conjugates using direct UPLC-Q-TOF HDMS and HPLC-DAD analysis." J Agric Food Chem 58(8):4602-16.

[0625] Gil, M. I., F. A. Tomas-Barberan, et al. (2000). "Antioxidant activity of pomegranate juice and its relationship with phenolic composition and processing." J Agric Food Chem 48(10):4581-9.

[0626] Greene, L. A. and A. S. Tischler (1976). "Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor." Proc Natl Acad Sci USA 73(7):2424-8.

[0627] Gunning, P. W., G. E. Landreth, et al. (1981). "Differential and synergistic actions of nerve growth factor and cyclic AMP in PC12 cells." J Cell Biol 89(2):240-5.

[0628] Harper, M. E., K. Green, et al. (2008). "The efficiency of cellular energy transduction and its implications for obesity." Annu Rev Nutr 28:13-33.

[0629] Hebert, L.E., P.A. Scherr, et al. (2003). "Alzheimer disease in the US population: prevalence estimates using the 2000 census." Arch Neurol 60(8):1119 - 22.

[0630] Joels, M., Z. Pu, et al. (2006). "Learning under stress: how does it work?" Trends Cogn Sci 10(4):152 - 8.

[0631] Joseph, J.A., B. Shukitt - Hale, et al. (2005). "Reversing the deleterious effects of aging on neuronal communication and behavior: beneficial properties of fruit polyphenolic compounds." Am J Clin Nutr 81(1 Suppl):313S - 316S.

[0632] Kujoth, G.C., A. Hiona, et al. (2005). "Mitochondrial DNA mutations, oxidative stress, and apoptosis in mammalian aging." Science 309(5733):481 - 4.

[0633] Lee, J.H., J.V. Johnson, et al. (2005). "Identification of ellagic acid conjugates and other polyphenolics in muscadine grapes by HPLC - ESI - MS." J Agric Food Chem 53(15):6003 - 10.

[0634] Maier, S.F. and L.R. Watkins (2005). "Stressor controllability and learned helplessness: the roles of the dorsal raphe nucleus, serotonin, and corticotropin-releasing factor." Neurosci Biobehav Rev 29(4-5):829-41.

[0635] Puech, J.L., C. Mertz, et al. (1999). "Evolution of castalagin and vescalaginin ethanol solutions. Identification of new derivatives." J Agric Food Chem 47(5):2060-6.

[0636] Pinnock, S.B. and J. Herbert (2001). "Corticosterone differentially modulates expression of corticotropin releasing factor and arginine vasopressin mRNA in the hypothalamic paraventricular nucleus following either acute or repeated restraint stress." Eur J Neurosci 13(3):576-84.

[0637] Rea, S.L., N. Ventura, et al. (2007). "Relationship between mitochondrial electron transport chain dysfunction, development, and life extension in Caenorhabditis elegans." PLoS Biol 5(10):e259.

[0638] Roozendaal, B. (2003). "Systems mediating acute glucocorticoid effects on memory consolidation and retrieval." Prog Neuropsychopharmacol Biol Psychiatry 27(8):1213-23.

[0639] Rozovsky, I., M. Wei, et al. (2005). "Reversible age impairments in neurite outgrowth by manipulations of astrocytic GFAP." Neurobiol Aging 26(5):705-15.

[0640] Sandi, C. (2004). "Stress, cognitive impairment and cell adhesion molecules." Nat Rev Neurosci 5(12):917-30.

[0641] Sandi, C. and M. Loscertales (1999). "Opposite effects on NCAM expression in the rat frontal cortex induced by acute vs. chronic corticosterone treatments." Brain Res 828(1-2):127-34.

[0642] Sandi, C. and M. T. Pinelo-Nava (2007). "Stress and memory: behavioral effects and neurobiological mechanisms." Neural Plast 2007:78970.

[0643] Satomi, H., K. Umemura, et al. (1993). "Carbonic anhydrase inhibitors from the pericarps of Punica granatum L." Biol Pharm Bull 16(8):787-90.

[0644] Schriner, S.E., N.J. Linford, et al. (2005). "Extension of murine life span by overexpression of catalase targeted to mitochondria." Science 308(5730):1909-11.

[0645] Shors, T.J. (2004). "Learning during stressful times." Learn Mem 11(2):137-44.

[0646] Tanaka, K., G. Nonaka, et al. (1986). "Tannins and Related Compounds. XLI. 1) Isolation and Charactherization of Novel Ellagitannins, Punicacorteins A, B, C, and Punigluconin from the brak of Punica granatum L." Chem. Pharm. Bull 34(2):656-663.

[0647] Tanaka, K., G. Nonaka, et al. (1986). "Tannins and Related Compounds. XLI. 1) Isolation and Charactherization of Novel Ellagitannins, Punicacorteins A, B, C, and Punigluconin from the brak of Punica granatum L." Chem. Pharm. Bull 34(2):656-663.

[0648] Tanaka, K., G. Nonaka, et al. (1986). "Tannins and Related Compounds. XLI. 1). Revision of the Structures of Punicalin and Punicalagin, and Isolation and Charactherization of 2 - O - Galloylpunicalin from the Bark of Punica granatum L." Chem. Pharm. Bull 34(2): 650 - 655.

[0649] Trifunovic, A., A. Wredenberg, et al. (2004). "Premature ageing in mice expressing defective mitochondrial DNA polymerase." Nature 429(6990): 417 - 23.

[0650] Vrhovsek, U., A. Palchetti, et al. (2006). "Concentration and mean degree of polymerization of Rubus ellagitannins evaluated by optimized acid methanolysis." J Agric Food Chem 54(12): 4469 - 75. Wang, C. H., C. C. Wang, et al. (2010). "Mitochondrial dysfunction in insulin insensitivity: implication of mitochondrial role in type 2 diabetes." Ann N Y Acad Sci 1201: 157 - 65.

[0651] Xiao, J., A. Pradhan, et al. (2006). "Functional role of JNK in neuritogenesis of PC12 - N1 cells." Neurosci Lett 392(3): 231 - 4.

[0652] Yang, G., F. Pan, et al. (2009). "Stably maintained dendritic spines are associated with lifelong memories." Nature 462(7275): 920 - 4.

Claims

1. Use of urolithin A as the only active ingredient in the manufacture of a food product or dietary supplement for improving, maintaining, enhancing, increasing or promoting muscle performance related to mitochondrial function, wherein the muscle performance related to mitochondrial function is selected from muscle strength, muscle speed, muscle endurance and muscle mass.

2. The use according to claim 1, wherein the improvement, maintenance, enhancement, increase or promotion of muscle performance related to mitochondrial function is partially achieved by increasing mitochondrial activity, mitochondrial biogenesis and / or increasing muscle mitochondrial mass.

3. The use according to claim 1, wherein the muscle performance related to mitochondrial function is muscle strength.

4. The use according to claim 1, wherein the muscle performance related to mitochondrial function is muscle speed.

5. The use according to claim 1, wherein the muscle performance related to mitochondrial function is muscle endurance.

6. The use according to claim 1, wherein the muscle performance related to mitochondrial function is muscle mass.

7. Use of urolithin A as the only active ingredient in the manufacture of a food product or dietary supplement for improving, maintaining, enhancing, increasing or promoting mitochondrial function.

8. The use according to claim 7, wherein the improvement, maintenance, enhancement, increase or promotion of mitochondrial function includes increasing mitochondrial activity, mitochondrial source or increasing muscle mitochondrial mass.

9. The use according to claim 7, wherein mitochondrial function is improved.

10. The use according to claim 7, wherein mitochondrial function is maintained.

11. The use according to claim 7, wherein mitochondrial function is enhanced.

12. The use according to claim 7, wherein mitochondrial function is increased.

13. The use according to claim 7, wherein mitochondrial function is promoted.

14. The use according to claim 7, wherein enhancing mitochondrial function is for improving physical endurance, inhibiting or delaying physical fatigue, enhancing the energy of healthy individuals, enhancing work endurance, reducing muscle fatigue or increasing muscle ATP levels.

15. The use according to claim 14, wherein enhancing mitochondrial function is for enhancing the energy of healthy individuals.

16. The use according to claim 14, wherein enhancing mitochondrial function is for reducing muscle fatigue.

17. Use of urolithin A in the manufacture of a food product or dietary supplement for improving intellectual performance related to mitochondrial function.

18. The use according to any one of claims 1-17, wherein the food product is a functional food.

19. The use according to any one of claims 1-17, wherein the food product is a food additive.

20. The use according to any one of claims 1-17, wherein the food product is a food ingredient.

21. The use according to any one of claims 1-17, wherein the food product or dietary supplement is a nutritional product.

22. The use according to any one of claims 1-17, wherein the food product or dietary supplement is a dietary additive.

23. Use according to any one of claims 1 - 17, wherein the food product or nutritional supplement is an oral preparation.

24. Use according to any one of claims 1 - 17, wherein the food product or nutritional supplement is for oral administration.

Images