Lysis reagents and kits suitable for direct amplification of DNA or RNA viruses and their application in viral PCR detection.
By using a lysis agent composed of Tris-HCl, ionizing salt, surfactant, and RNase inhibitor, viral nucleic acid is directly released, solving the problems of cumbersome nucleic acid extraction steps and cross-contamination in existing technologies, and realizing rapid viral PCR detection.
Patent Information
- Application Number
- CN202110553162.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-05-20
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2041-05-20
AI Technical Summary
Existing nucleic acid extraction methods are cumbersome, time-consuming, or pose a risk of cross-contamination, and the cost of nucleic acid extraction is high, which affects the efficiency of virus detection.
A lysis reagent consisting of Tris-HCl, ionizing salt, surfactant, reducing agent, and RNase inhibitor is used to directly release viral nucleic acid, simplifying viral PCR detection to room temperature conditions.
It rapidly releases viral nucleic acid at room temperature, shortening the detection time to 1.5 hours, eliminating the need for nucleic acid extraction, and improving detection efficiency.
Smart Images

Figure CN113444771B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a lysis reagent suitable for direct amplification of DNA or RNA viruses and its application in viral PCR detection, as well as a corresponding DNA or RNA virus PCR detection kit, belonging to the field of biotechnology. Background Technology
[0002] Nucleic acid testing is characterized by high sensitivity, strong specificity, short testing time, and the ability to monitor viral activity, and has been widely used in clinical testing. However, clinical samples contain a large number of nucleic acid amplification interfering substances, so nucleic acid extraction and purification must be performed on the samples before nucleic acid amplification.
[0003] Currently, the main nucleic acid extraction methods include silica gel membrane adsorption column extraction and magnetic bead extraction. Column extraction can obtain high-purity nucleic acids, but the extraction steps are cumbersome, requiring multiple centrifugations, and the entire process is time-consuming. Magnetic bead extraction, combined with automated extraction instruments, can significantly shorten the extraction time compared to column extraction, but there is a risk of cross-contamination when operating multiple samples simultaneously, and the cost of extraction instruments and reagents is also relatively high.
[0004] Viral lysis reagents are inexpensive and can rapidly and effectively release viral nucleic acids from samples at room temperature. The lysate can be used directly for qPCR amplification without the need for nucleic acid extraction, which greatly improves detection efficiency and reduces the overall time from 3 hours to 1.5 hours. Summary of the Invention
[0005] The purpose of this invention is to provide a lysis reagent suitable for direct amplification of DNA or RNA viruses, and the lysate can be directly used for qPCR amplification without the need for nucleic acid extraction.
[0006] The technical solution adopted in this invention is as follows:
[0007] A lysis agent suitable for the direct amplification of DNA or RNA viruses includes: Tris-HCl, ionizing salt, surfactant, reducing agent, EDTA, and RNase inhibitor Rnasin.
[0008] Preferably, the ionizing salt is one of guanidine hydrochloride, guanidine isothiocyanate, or guanidine thiocyanate, with a concentration of 50-200 mM.
[0009] Preferably, the liquid salt is guanidine hydrochloride with a concentration of 100 mM.
[0010] Preferably, the surfactant is Triton X-100, NP40 or Tween20, with a concentration of 0.5-2% by volume, that is, 0.5-2 ml of surfactant is contained in every 100 ml of pyrolysis agent.
[0011] Preferably, the surfactant is Tween20, with a concentration of 0.5% by volume.
[0012] Preferably, the reducing agent is DTT or acetylcysteine at a concentration of 0.5-2% by mass / volume, i.e., 0.5-2 mg of reducing agent per 100 ml of lysis agent; or mercaptoethanol at a concentration of 0.5-2% by volume, i.e., 0.5-2 ml of reducing agent per 100 ml of lysis agent.
[0013] Preferably, the reducing agent is acetylcysteine at a concentration of 0.5% by mass / volume.
[0014] Preferably, the pH of the Tris-HCl is 7.0-8.5 and the concentration is 10-100 mM.
[0015] Preferably, the Tris-HCl has a pH of 8.0 and a concentration of 20 mM.
[0016] Preferably, the concentration of EDTA is 1-10 mM.
[0017] Preferably, the concentration of EDTA is 2.5 mM.
[0018] Preferably, the concentration of Rnasin is 100-2000 U / ml.
[0019] Preferably, the concentration of Rnasin is 500 U / ml.
[0020] The present invention also discloses the application of the above-mentioned lysis reagent suitable for direct amplification of DNA or RNA viruses in viral PCR detection.
[0021] The present invention also discloses a DNA or RNA virus PCR detection kit, comprising the above-mentioned lysis agent.
[0022] The beneficial effects of this invention are:
[0023] Using the lysing agent of this invention to process samples such as serum, plasma, nasal swabs, pharyngeal swabs, sputum, and bronchoalveolar lavage fluid can rapidly and effectively release viral nucleic acid at room temperature. The lysate can be directly used for qPCR amplification without the need for nucleic acid extraction, which greatly improves detection efficiency and shortens the entire time from 3 hours to 1.5 hours. Attached Figure Description
[0024] Figure 1 This is a fluorescence quantitative PCR amplification curve of serum simulated samples with gradient concentrations of HBV virus using the lysis reagent of this invention.
[0025] Figure 2 This is a standard curve for detecting HBV virus gradient concentrations in simulated serum samples using the lysis reagent of this invention.
[0026] Figure 3 This is a comparison image of a simulated throat swab sample for detecting Coxsackievirus A16 using the lysis reagent of this invention and amplification using the Qiagen RNeasy Mini kit.
[0027] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings. Detailed Implementation
[0028] The features and advantages of the present invention can be further understood through the following detailed description in conjunction with the accompanying drawings. The provided embodiments are merely illustrative of the method of the present invention and do not limit the rest of the content disclosed herein in any way.
[0029] Example 1:
[0030] The lysis agent in this embodiment consists of 20 mM Tris-HCl pH 8.0, 150 mM guanidine hydrochloride, 0.5% Tween 20, 0.5% acetylcysteine, 2.5 mM EDTA, and 500 U / ml RNasin.
[0031] High-concentration fresh HBV virus cultures (quantified using Roche's COBAS AmpliPrep / COBAS TaqManHBV Test, version 2.0 kit) were serially diluted with commercially available negative and clear serum to obtain 10 6 10 5 10 4 10 3 For samples with a concentration of IU / ml, the lysis reagent and diluted sample were mixed 1:1, incubated at room temperature for 5 min, and then 5 μl was used for subsequent qPCR amplification.
[0032] HBV primers and probes:
[0033] HBV-F: 5'-GTGTCTGCGGCGTTTTATCA- 3'
[0034] HBV-R: 5'-GACAAACGGGCAACATACCTT- 3'
[0035] HBV-P: 5'- CCTCTTCATCCTGCTGCTATGCCTCATC - 3' (Marked: 5'FAM, 3'BHQ1)
[0036] Components Volume (μl) / reaction 5X PCR buffer 5 dNTPs (10mM) 0.5 Taq DNA enzyme (5 U / μl) 0.6 Primer HBV-F (10 μM) 1 Primer HBV-R (10μM) 1 Probe HBV-P (10μM) 0.5 ddH2O 11.4 DNA template 5
[0037] Amplification procedure:
[0038]
[0039] The fluorescence quantitative PCR amplification curve is as follows: Figure 1 As shown, according to Figure 1 The standard curve is as follows Figure 2 As shown in the figure, the standard curve for treating HBV gradient concentration serum samples with this lysis reagent showed an amplification efficiency of 99.5%. The consistency coefficient reached 0.999, indicating that the nucleic acid release agent treatment of the samples can be directly used for qPCR amplification without affecting the amplification efficiency.
[0040] Example 2:
[0041] The cleavage agent in this embodiment consists of 20 mM Tris-HCl pH 8.0, 100 mM guanidine isothiocyanate, 0.5% Tween 20, 0.5% acetylcysteine, 2.5 mM EDTA, and 500 U / ml RNasin.
[0042] Coxsackievirus A16 (one of the main pathogens of hand-foot-mouth disease) was diluted to 10⁻⁶ using a negative throat swab sample. 5 10 3 Copies / ml, treated with lysis solvent and extracted with Qiagen RNeasyMini Kit, 10 5 Copies / ml set 3 replicates, 10 3 The Copies / ml setting was configured to 20 replicates, with 5 μl used as template for subsequent RT-qPCR detection.
[0043] Coxsackievirus A16 primers and probes:
[0044] Cox A16-F: 5'-GAACCATCACTCCACACAGGAG- 3'
[0045] Cox A16-R: 5'-GTACCTGGTGGTGGGCATTG- 3'
[0046] Cox A16-P: 5'-CAGCCATTGGGAATTTCTTTAGCCGTG-3' (Markings: 5'FAM, 3'BHQ1)
[0047] Components Volume (μl) / reaction 5X PCR buffer 5 dNTPs (10mM) 0.5 Taq DNA enzyme (5 U / μl) 0.6 MMLV enzyme (200 U / μl) 0.1 Rnasin (200 U / μl) 0.1 Primer H1N1-F (10 μM) 1 Primer H1N1-R (10 μM) 1 Probe H1N1-P (10 μM) 0.5 Rnase-free H2O 11.2 RNA template 5
[0048] Amplification procedure:
[0049]
[0050] The results are as follows Figure 3 As shown. 10 treated with pyrolysis agent 5Copies / ml of Coxsackievirus A16 pharyngeal swab samples were directly subjected to RT-qPCR amplification. The Ct values were basically consistent with those extracted by Qiagen, with a difference within 0.5 Ct. The results indicate that the lysis reagent of this invention has a strong ability to release RNA viral nucleic acid and can effectively remove the influence of inhibitors in the pharyngeal swab on amplification. 3 Pharyngeal swab sample extraction with copies / ml: Qiagen detected all 20 replicates, while lysis agent treatment detected 19 replicates. The detection rates of the two methods were basically the same.
[0051] Example 3:
[0052] The lysis agent in this embodiment consists of 20 mM Tris-HCl pH 8.0, 100 mM guanidine hydrochloride, 0.5% Tween 20, 0.5% acetylcysteine, 2.5 mM EDTA, and 500 U / ml RNasin.
[0053] Fifteen positive pharyngeal swab samples of influenza A (H1N1) virus were prepared and treated with lysis reagent and extracted with Qiagen RNeasy Mini Kit in parallel. The lysis reagent and sample were mixed at a ratio of 1:1. After shaking and mixing for 1 min, the samples were incubated at room temperature for 5 min. Subsequently, 5 μl of the samples were used as templates for RT-qPCR detection.
[0054] H1N1 influenza virus primers and probes:
[0055] H1N1-F:5'-GGACTGCAGCGTAGACGCTT- 3'
[0056] H1N1-R:5'-CATCCTGTTGTATATGAGGCCCAT- 3'
[0057] H1N1-P:5'-CTCAGTTATTCTGCTGGTGCACTTGCCA-3' (Marked: 5'FAM, 3'BHQ1)
[0058] The RT-qPCR reaction system and procedure are the same as in Example 2.
[0059] The test results are shown in the table below:
[0060]
[0061] The test results showed that both methods detected 100% of the 15 positive samples of influenza A H1N1 pharyngeal swabs. The Ct value indicated that the detection ability of the lysing agent of this invention in treating influenza A H1N1 pharyngeal swab samples was comparable to that of Qiagen extraction.
[0062] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.
Claims
1. A lysis agent suitable for direct amplification of DNA or RNA viruses, comprising: 20 mM Tris-HCl, 100-150 mM guanidine hydrochloride or guanidine isothiocyanate, 0.5% Tween20 (v / v), 0.5% acetylcysteine (w / v), 2.5 mM EDTA, and 500 U / ml RNase inhibitor Rnasin.
2. The lysing agent suitable for direct amplification of DNA or RNA viruses according to claim 1, characterized in that: The pH of the Tris-HCl is 8.
0.
3. The application of the lysis reagent suitable for direct amplification of DNA or RNA viruses according to any one of claims 1-2 in viral PCR detection, characterized in that, The application described is not for disease diagnosis or treatment purposes.
4. A DNA or RNA virus PCR detection kit, characterized in that: Includes the pyrolysis agent according to any one of claims 1-2.
Citation Information
Patent Citations
RNA one-step-lysis and one-tube RT-PCR detection method
CN103333955A
Pretreatment method, pretreatment solution and kit for virus nucleic acid detection, and application of pretreatment solution
CN110982876A
Virus preserving fluid and application thereof
CN111925941A
Kit and method for extracting RNA
CN112410327A
Virus sample direct amplification type preservation solution and application method
CN112680545A