5-halouracil-modified microRNA and its use in cancer treatment
By incorporating 5-halouracil groups into microRNA, the problems of high toxicity, poor stability and insufficient targeting of existing cancer therapies are solved, achieving a more efficient, stable and low-toxic anti-cancer effect.
Patent Information
- Application Number
- CN201980087509.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2018-10-31
- Filing Date
- 2019-10-30
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2039-10-30
AI Technical Summary
Existing cancer therapies have problems such as high toxicity, poor stability and insufficient targeting. In particular, 5-fluorouracil chemotherapy agents are prone to cause side effects during use and antagonize apoptosis pathways, and tumor cells are prone to develop resistance.
By incorporating 5-halouracil groups into the nucleotide sequence of microRNA, modified microRNA compositions are formed to improve their stability and targeting, reduce cancer cell proliferation and enhance the efficacy of chemotherapeutic agents.
The modified microRNA composition achieves improved stability, targeting and reduced toxicity in treating cancer, enhances the inhibitory effect on cancer cells, and maintains the function of natural microRNA.
Smart Images

Figure CN113573781B_ABST
Abstract
Description
[0001] Cross-reference to related applications
[0002] This application is a continuation-in-part of PCT / US2017 / 059011, filed on October 30, 2017, which claims the benefit of U.S. Provisional Application No. 62 / 464,491, filed on February 28, 2017, U.S. Provisional Application No. 62 / 422,298, filed on November 15, 2016, and U.S. Provisional Application No. 62 / 415,740, filed on November 1, 2016, the entire contents of each of which are incorporated herein by reference.
[0003] Government support
[0004] This invention was made with government support under Grant Nos. HL127522 and CA197098 awarded by the National Institutes of Health. The government has certain rights in this invention.
[0005] Sequence Listing Incorporated by Reference
[0006] The Sequence Listing in an ASCII text file is designated 050_8992_US_SequenceListing.txt and was submitted to the United States Patent and Trademark Office via EFS-Web, which is incorporated herein by reference. Technical Field
[0007] The present disclosure generally relates to nucleic acid compositions comprising 5-halouracils. More specifically, the present disclosure provides modified microRNA compositions containing one or more 5-halouracil compounds and methods of use thereof. In addition, the application provides pharmaceutical compositions comprising nucleic acid compositions of the present invention and methods of using the same to treat cancer. Background Art
[0008] MicroRNAs (miRNAs, miRs) are a class of highly conserved small noncoding RNA molecules that mediate translation in cells or organisms by negatively regulating the expression of their target genes, thereby causing translational arrest, messenger RNA (mRNA) cleavage, or a combination thereof. See Bartel DP. Cell By targeting multiple transcripts, miRNAs regulate a wide range of biological processes, including apoptosis, differentiation, and cell proliferation; thus, aberrant microRNA function can lead to cancer (see Ambros V. Nature (2004) 431 pp. 350-355) and thus, miRNAs have recently been identified as biomarkers, oncogenes, or tumor suppressor genes. See, e.g., Croce, CM. Nat Rev Genet . (2009) 10pp. 704-714.
[0009] According to the World Health Organization, cancer is the leading cause of death worldwide, causing 8.8 million deaths in 2015. The most common causes of cancer death were cancers of the lung (1.69 million deaths), liver (788,000 deaths), colorectum (774,000 deaths), stomach (i.e., gastric cancer, causing 774,000 deaths), and breast (754,000 deaths). See Surveillance, Epidemiology, and End Results Program. SEER Cancer Stat Facts. National Cancer Institute . Bethesda, MD (2018).
[0010] Lung cancer is the leading cause of cancer death in both men and women in the United States, and only 18.6% of patients diagnosed with lung cancer survive beyond 5 years. Surveillance, Epidemiology, and End Results Program. SEERCancer Stat Facts: Lung and Bronchus Cancer. National Cancer Institute. Bethesda, MD (2018). There are two main types of lung cancer: non-small cell lung cancer and small cell lung cancer. Non-small cell lung cancer is further described by the type of cancer cells present in the tissue. Therefore, non-small cell lung cancer is divided into the following lung cancer subtypes: squamous cell carcinoma (also known as epidermoid carcinoma), large cell carcinoma, adenocarcinoma (i.e., cancer that originates in the cells lining the alveoli), pleomorphic, carcinoid tumors, and salivary gland carcinoma. Meanwhile, there are two main types of small cell lung cancer: small cell carcinoma and combined small cell carcinoma. SEER Cancer Stat Facts: Lung and Bronchus Cancer. National Cancer Institute Bethesda, MD (2018). The most common treatments for non-small cell lung cancer are gemcitabine (2', 2'-difluoro-2'-deoxycytidine), paclitaxel (e.g., Taxol), cisplatin (a DNA cross-linking agent), and combinations thereof. However, many types of antibody-based therapies are also used to treat non-small cell lung cancer (e.g., gefitinib, pembrolizumab, alectinib). Small cell lung cancer is typically treated with chemotherapeutic agents based on methotrexate, doxorubicin hydrochloride, and topotecan.
[0011] Breast cancer is the second most common cancer in women, and the most common type of breast cancer is ductal carcinoma. Ductal carcinoma begins in the cells of the duct. In contrast, lobular carcinoma, usually found in both breasts, starts in the lobe or lobule. Many chemotherapeutic agents are used to treat breast cancer, including but not limited to cytotoxic drugs such as paclitaxel (Taxol, Docetaxel), doxorubicin hydrochloride, 5-FU, gemcitabine hydrochloride, methotrexate and tamoxifen citrate. In addition, many antibody-based therapeutic agents are given to treat various types of breast cancer, such as trastuzumab, olaparib and pertuzumab.
[0012] Colorectal cancer (CRC) is the third most common malignancy and the second most common cause of cancer-related death in the United States. See, Hegde SR, et al., Expert review of gastroenterology & hepatology . (2008) 2(1) pp. 135-49. There are many chemotherapeutic agents used to treat cancer; however, pyrimidine antagonists, such as fluoropyrimidine-based chemotherapeutic agents (e.g., 5-fluorouracil, S-1), are the gold standard for treating colorectal cancer. Pyrimidine antagonists block the synthesis of nucleotides containing pyrimidines (cytosine and thymine in DNA; cytosine and uracil in RNA). Because pyrimidine antagonists have similar structures when compared to endogenous nucleotides, they compete with natural pyrimidines to inhibit key enzyme activities involved in the replication process, resulting in the prevention of DNA and / or RNA synthesis and the inhibition of cell division.
[0013] Gastric cancer (i.e., cancer of the stomach or gastric adenocarcinoma) is the fourth most common cause of cancer-related death worldwide and remains incurable in Western countries, primarily because most patients present with advanced disease. In the United States, gastric malignancies are currently the 14th most common cancer. American Cancer Society: Cancer Facts and Figures 2018. American Cancer Society Atlanta, Georgia (2018). Gastric cancer typically presents as either well-differentiated intestinal adenocarcinoma or poorly differentiated diffuse adenocarcinoma and does not form glandular structures. Surgery remains the mainstay of treatment for gastric cancer due to the lack of effective noninvasive treatment options. However, a combination of 5-fluorouracil (5-FU) and folinic acid may also be given to patients with gastric cancer.
[0014] Pancreatic cancer is a deadly cancer that is very difficult to treat. See Siegel, RL et al. Cancer J. Clin . (2015) 65 pp. 5-29. Unique aspects of pancreatic cancer include a very low 5-year survival rate of less than 7% (supra), late presentation, early metastasis, and poor response to chemotherapy and radiation. See Maitra A and Hruban RH, Annu Rev. Pathol.(2008) 3 pp. 157-188. Currently, gemcitabine-based chemotherapy (2',2'-difluoro-2'-deoxycytidine) is the gold standard for the treatment of pancreatic cancer, however, the effectiveness of therapeutic intervention is limited due to drug resistance. Oettle, H et al. JAMA (2013) 310pp. 1473-1481.
[0015] Blood-borne cancers, i.e., leukemias, are common forms of cancer that are also very diverse, as evidenced by the number of different types of leukemia. In 2015, an estimated 405,815 people in the United States were living with leukemia. The main types of leukemia are: acute lymphoblastic leukemia (ACL), acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML). Noone AM et al. (eds). SEER Cancer Statistics Review, 1975-2015, National Cancer Institute Bethesda, MD (2018). Drugs approved for the treatment of leukemia include, for example, doxorubicin hydrochloride, 5-FU, gemcitabine hydrochloride, cytarabine, methotrexate and tamoxifen citrate, rituximab, ibrutinib, imatinib, and dasatinib.
[0016] 5-Fluorouracil (i.e., 5-FU, or more specifically, 5-fluoro-1H-pyrimidine-2,4-dione) is a well-known pyrimidine antagonist used in many adjuvant chemotherapy drugs such as Carac® cream, Efudex®, Fluoroplex®, and Adrucil®. It is well established that 5-FU targets the key enzyme thymidylate synthase (TYMS or TS), which catalyzes the methylation of deoxyuridine monophosphate (dUMP) to deoxythymidine monophosphate (dTMP), an essential step in DNA biosynthesis. Danenberg PV, Biochim . Biophys. Acta . (1977) 473(2):73-92. However, despite the steady improvement of 5-FU-based treatments, the patient response rate to 5-FU-based chemotherapy remains modest due to the development of drug resistance. Longley D. B, et al., Apoptosis, Cell Signaling, and Human Diseases , (2007) pp. 263-78.
[0017] However, existing cancer therapies are still in their early stages, and many obstacles are still to be improved or overcome. For example, it is well known that although 5-FU is quite effective in treating various cancers, 5-FU has substantial toxicity and can cause numerous harmful side effects. 5-FU, like many cytotoxic chemotherapeutics, is administered systemically by IV or injection, and all dividing cells (including cancer cells) in non-specifically targeted subjects. Therefore, new targeted anticancer therapies with less toxicity are sought as an alternative to existing cancer therapies.
[0018] With respect to miRNA, it is known that these compounds are susceptible to enzymatic degradation upon administration, which results in poor stability. In addition, it is known that tumor cells circumvent apoptotic pathways by developing resistance to common therapeutic agents such as 5-FU and gemcitabine. See Gottesman M. M. et al., Nature Reviews Cancer , (2002) 2(1):48-58. Therefore, more effective, stable, and less toxic drugs for the treatment of cancer would be of significant benefit. Summary of the Invention
[0019] Without being limited by any particular theory, the present disclosure is based on the following discovery: when compared with certain known chemotherapeutic agents and / or natural microRNA molecules alone, incorporating 5-halogenated uracil bases into the nucleotide sequence of a microRNA increases the efficacy of the microRNA as an anticancer therapeutic agent. The present disclosure has demonstrated that nucleic acid compositions (i.e., microRNAs) incorporating at least one 5-halogenated uracil base have outstanding efficacy as anticancer agents. In addition, the data presented herein show that contacting cells with the modified microRNA compositions of the present disclosure regulates cell cycle progression and reduces tumorigenesis by, for example, reducing cancer cell proliferation and increasing the efficacy of chemotherapeutic agents. In addition, it is shown that the modified microRNAs of the present disclosure maintain target specificity, can be delivered without the use of harmful and ineffective delivery vehicles (e.g., nanoparticles), and exhibit improved efficacy and stability without abolishing the natural functions of endogenous microRNAs. Therefore, the present disclosure provides novel modified microRNA compositions with improved stability and efficacy, target specificity, and low toxicity for treating many types of cancer.
[0020] Therefore, in one aspect of the present disclosure, a nucleic acid composition comprising a modified microRNA nucleotide sequence is described, wherein the microRNA nucleotide sequence of the modification has at least one uracil base (U, U base) substituted by 5-halogenated uracil, for example, 5-fluorouracil (5-FU). In certain embodiments, the microRNA of the modification has more than one or just one uracil substituted by 5-halogenated uracil. In some embodiments, the microRNA nucleotide sequence of the modification comprises 2, 3, 4, 5, 6, 7, 8 or more uracil bases substituted by 5-halogenated uracil. In a specific embodiment, all uracil nucleotide bases of natural microRNA have been replaced by 5-halogenated uracil.
[0021] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil.
[0022] In certain embodiments, the microRNA nucleotide sequence of modification comprises more than one 5-halogenated uracil, wherein the 5-halogenated uracils are each identical. In other embodiments, the microRNA nucleotide sequence of modification comprises more than one 5-halogenated uracil, wherein the 5-halogenated uracils are each different. In other embodiments, the microRNA nucleotide sequence of modification comprises more than two 5-halogenated uracils, wherein the microRNA nucleotide sequence of modification comprises a combination of different 5-halogenated uracils.
[0023] In an exemplary embodiment of the present disclosure, a nucleic acid composition is provided comprising a miR-129 nucleotide sequence that has been modified by replacing at least one uracil nucleotide base with a 5-halouracil. More specifically, the nucleic acid composition comprises at least the following native miR-129 nucleotide sequence: CUUUUUGCGGUCUGGGCUUGC [SEQ ID NO. 1], wherein at least one, two, three, four, five, six, seven, eight, or all of the uracil bases in or covalently attached to the nucleic acid sequence are replaced with a 5-halouracil.
[0024] In a specific embodiment of the present disclosure, the modified microRNA has a F U F U F U F U F GCGGU F CU F GGGCU F U F GC [SEQ ID NO. 4] consisting of a nucleic acid sequence, wherein U FIt is a halogenated uracil, specifically 5-fluorouracil.
[0025] In other embodiments, the seed portion GUUUUUGC of the natural miR-129 nucleotide sequence remains unmodified (i.e., does not contain 5-halouracil), while one or more (or all) of the remaining uracil nucleotide bases in the remainder of the modified miR-129 nucleotide sequence are substituted with an equal number of 5-halouracils. In specific embodiments, the modified miR-129 microRNA of the present disclosure has a sequence consisting of CUUUUUGCGGU F CU F GGGCU F U F GC [SEQ ID NO. 5] consisting of a nucleic acid sequence, wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0026] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil.
[0027] In another embodiment of the present disclosure, a nucleic acid composition is provided comprising a miR-15a nucleotide sequence that has been modified by replacing at least one uracil nucleotide base with a 5-halouracil, such as 5-fluorouracil (5-FU). Specifically, the nucleic acid composition comprises at least the following native miR-15a nucleotide sequence: UAGCAGCACAUAAUGGUUUGUG [SEQ ID NO. 2], wherein at least one, two, three, four, five, six, or all of the uracil nucleotide bases in or covalently attached to the sequence are 5-halouracils.
[0028] In a specific embodiment of the present disclosure, the modified miR-15a microRNA has a F AGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO. 6] consisting of a nucleic acid sequence, wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0029] In other embodiments, the seed portion UAGCAGCA of the native miR-15a nucleotide sequence is not modified with 5-halouracil, while one or more (or all) of the remaining uracil bases in the remainder (non-seed portion) of the miR-15a nucleotide sequence are substituted with 5-halouracil.
[0030] In a specific embodiment, the modified miR-15a microRNA has a residue consisting of UAGCAGCACAU F AAU F GGU F U F U F GU F G[SEQ ID NO. 7] composed of nucleic acid sequence, wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0031] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-140 nucleotide sequence. In some embodiments, the native miR-140 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil. More specifically, the nucleic acid composition comprises at least the following native miR-140 nucleotide sequence: CAGUGGUUUUACCCUAUGGUAG [SEQ ID NO. 8], wherein at least one, two, three, four, five, six, seven, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracils.
[0032] In one set of embodiments, exactly one U base in the native miR-140 nucleic acid sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the native miR-140 nucleotide sequence are substituted with 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-140 nucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the native miR-140 nucleotide sequence are 5-halouracil. In some embodiments, exactly or at least five U bases in the miR-140 nucleotide sequence are 5-halouracil. In yet other embodiments, exactly or at least six U bases in the miR-140 nucleotide sequence are 5-halouracil. In some embodiments, exactly or at least seven U bases in the miR-140 nucleotide sequence are 5-halouracil. In a specific embodiment, all U bases in the miR-140 nucleotide sequence, whether in the native portion and / or in the appended portion, are 5-halouracil.
[0033] In an exemplary embodiment, the modified microRNA nucleic acid composition of the present disclosure has the nucleotide sequence CAGU F GGUUUUACCCU F AUGGU F AG [SEQ ID NO. 9], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0034] In yet another embodiment, the modified microRNA nucleic acid composition of the present disclosure has the nucleotide sequence CAGU F GGU F U F U F U F ACCCU F AU F GGU F AG [SEQ ID NO. 16], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0035] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified native miR-192 or miR-215 nucleotide sequence that has been modified by replacing at least one uracil base with a 5-halouracil. In some embodiments, the modified miR-192 nucleotide sequence is modified by replacing at least one U base with a 5-fluorouracil. More specifically, the nucleic acid composition contains at least the following native miR-192 nucleotide sequence: CUGACCUAUGAAUUGACAGCC [SEQ ID NO. 10], wherein at least one, two, three, four, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracil.
[0036] In a specific embodiment, exactly one U base in the modified miR-192 nucleotide sequence is a 5-halouracil. In other embodiments, exactly or at least two U bases in the modified miR-192 nucleotide sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the modified miR-192 nucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the modified miR-192 or miR-215 nucleotide sequence are 5-halouracil. In a specific embodiment, all U bases in the modified miR-192 or miR-215 sequence, whether in the native portion of the nucleic acid and / or in the appended portion, are 5-halouracil.
[0037] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-192 or modified miR-215 nucleotide sequence CU F GACCU F AU F GAAU F U F GACAGCC [SEQ ID NO. 11], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0038] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified native miR-502 nucleotide sequence that has been modified by replacing uracil with a 5-halouracil. In some embodiments, the modified miR-502 nucleotide sequence has been modified by replacing at least one U base with a 5-fluorouracil. More specifically, the nucleic acid composition contains at least the following native miR-502 nucleotide sequence: AUCCUUGCUAUCUGGGUGCUA [SEQ ID NO. 12], wherein at least one, two, three, four, five, six, seven, or all of the uracil bases in the nucleic acid sequence are replaced with a 5-halouracil.
[0039] In another set of embodiments, exactly one U base in the miR-502 nucleotide sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-502 nucleotide sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-502 nucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-502 nucleotide sequence are 5-halouracil. In other embodiments, exactly or at least five U bases in the miR-502 nucleotide sequence are 5-halouracil. In other embodiments, exactly or at least six U bases in the modified miR-502 nucleotide sequence are 5-halouracil. In other embodiments, exactly or at least seven U bases in the miR-502 nucleotide sequence are 5-halouracil. In a specific embodiment, all U bases in the miR-502 nucleotide sequence, whether in the native portion and / or in the appended portion, are 5-halouracil.
[0040] In an exemplary embodiment, the modified miR-502 nucleic acid composition of the present disclosure has a modified nucleotide sequence AU F CCU F U F GCUAU F CU F GGGU F GCUF A [SEQ ID NO. 13], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0041] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-506 nucleotide sequence comprising a 5-halouracil. In some embodiments, the modified miR-506 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition may contain at least the following native miR-506 nucleotide sequence: UAUUCAGGAAGGUGUUACUUAA [SEQ ID NO. 14], wherein at least one, two, three, four, five, six, seven, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracils.
[0042] In another set of embodiments, exactly one U base in the native miR-506 nucleotide sequence is replaced with a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-506 nucleotide sequence are 5-halouracils. In another set of embodiments, exactly or at least three U bases in the modified miR-506 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least four U bases in the modified miR-506 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least five U bases in the modified miR-506 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least six U bases in the modified miR-506 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least seven U bases in the modified miR-506 nucleotide sequence are 5-halouracils. In a specific embodiment, all U bases in the modified miR-506 nucleotide sequence, whether in the native portion and / or in the appended portion, are 5-halouracil.
[0043] In an exemplary embodiment, the miR-506 nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence U F AU F U F CAGGAAGGU F GU F U F ACU F U F AA [SEQ ID NO. 15], where U F It is a halogenated uracil, specifically 5-fluorouracil.
[0044] In yet another embodiment, the present disclosure provides a nucleic acid composition comprising a modified miR-34 nucleotide sequence comprising a 5-halouracil. In some embodiments, the modified miR-34 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil, such as 5-fluorouracil. For example, a nucleic acid composition can contain at least the following native miR-34 nucleotide sequence: UGGCAGUGUCUUAGCUGGUUGU [SEQ ID NO. 17], wherein at least one, two, three, four, five, six, seven, eight, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracils.
[0045] In another set of embodiments, exactly one U base in the native miR-34 nucleotide sequence is replaced by a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-34 nucleotide sequence are 5-halouracils. In another set of embodiments, exactly or at least three U bases in the modified miR-34 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least four U bases in the modified miR-34 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least five U bases in the modified miR-34 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least six U bases in the modified miR-34 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least seven U bases in the modified miR-34 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least 8 U bases in the modified miR-34 nucleotide sequence are 5-halouracils. In specific embodiments, all U bases in the modified miR-34 nucleotide sequence, whether in the native portion and / or the appended portion, are 5-halouracils.
[0046] In an exemplary embodiment, the miR-34 nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence U F GGCAGU F GU F CU F U F AGCU F GGU F U F GU F [SEQ ID NO. 18], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0047] In yet another embodiment, the present disclosure provides a nucleic acid composition comprising a modified miR-200a nucleotide sequence comprising a 5-halouracil. In some embodiments, the modified miR-200a nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition can contain at least the following native miR-200a nucleotide sequence: UAACACUGUCUGGUAACGAUGU [SEQ ID NO. 19], wherein at least one, two, three, four, five, six, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracils.
[0048] In another set of embodiments, exactly one U base is replaced by 5-halouracil in the native miR-200a nucleotide sequence. In a second set of embodiments, exactly or at least two U bases are 5-halouracil in the modified miR-200a nucleotide sequence. In another set of embodiments, exactly or at least three U bases are 5-halouracil in the modified miR-200a nucleotide sequence. In other embodiments, exactly or at least four U bases are 5-halouracil in the modified miR-200a nucleotide sequence. In other embodiments, exactly or at least five U bases are 5-halouracil in the modified miR-200a nucleotide sequence. In other embodiments, exactly or at least six U bases are 5-halouracil in the modified miR-200a nucleotide sequence. In a specific embodiment, all U bases in the modified miR-200a nucleotide sequence, whether in the native portion and / or the appended portion, are 5-halouracil.
[0049] In an exemplary embodiment, the miR-200a nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence U F AACACU F GU F CU F GGU F AACGAU F GU F [SEQ ID NO. 20], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0050] In other embodiments, the present disclosure provides nucleic acid compositions comprising modified miR-200b nucleotide sequences comprising 5-halouracils. In some embodiments, the modified miR-200b nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil, such as 5-fluorouracil. For example, a nucleic acid composition can contain at least the following native miR-200b nucleotide sequence: UAAUACUGCCUGGUAAUGAUGA [SEQ ID NO. 21], wherein at least one, two, three, four, five, six, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracils.
[0051] In another set of embodiments, exactly one U base is replaced by 5-halouracil in the native miR-200b nucleotide sequence. In a second set of embodiments, exactly or at least two U bases are 5-halouracils in the modified miR-200b nucleotide sequence. In another set of embodiments, exactly or at least three U bases are 5-halouracils in the modified miR-200b nucleotide sequence. In other embodiments, exactly or at least four U bases are 5-halouracils in the modified miR-200b nucleotide sequence. In other embodiments, exactly or at least five U bases are 5-halouracils in the modified miR-200b nucleotide sequence. In other embodiments, exactly or at least six U bases are 5-halouracils in the modified miR-200b nucleotide sequence. In a specific embodiment, all U bases in the modified miR-200b nucleotide sequence, whether in the native portion and / or the appended portion, are 5-halouracil.
[0052] In an exemplary embodiment, the miR-200b nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence U F AAU F ACU F GCCU F GGU F AAU F GAU F GA [SEQ ID NO. 22], where U F It is a halogenated uracil, specifically 5-fluorouracil.
[0053] In yet another embodiment, the present disclosure provides a nucleic acid composition comprising a modified miR-200c nucleotide sequence comprising a 5-halouracil. In some embodiments, the modified miR-200c nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition may contain at least the following native miR-200c nucleotide sequence: UAAUACUGCCGGGUAAUGAUGGA [SEQ ID NO. 23], wherein at least one, two, three, four, five, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracils.
[0054] In another set of embodiments, exactly one U base in the native miR-200c nucleotide sequence is replaced by a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-200c nucleotide sequence are 5-halouracils. In another set of embodiments, exactly or at least three U bases in the modified miR-200c nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least four U bases in the modified miR-200c nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least five U bases in the modified miR-200c nucleotide sequence are 5-halouracils. In a specific embodiment, all U bases in the modified miR-200c nucleotide sequence, whether in the native portion and / or the additional portion, are 5-halouracils.
[0055] In an exemplary embodiment, the miR-200c nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence U F AAU F ACU F GCCGGGU F AAU F GAU F GGA [SEQ ID NO. 24], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0056] In some embodiments, the present disclosure provides nucleic acid compositions comprising a modified miR-145 nucleotide sequence comprising a 5-halouracil. In one example, the modified miR-145 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition can contain at least the following native miR-145 nucleotide sequence: GUCCAGUUUUCCCAGGAAUCCCU [SEQ ID NO. 25], wherein at least one, two, three, four, five, six, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracils.
[0057] In another set of embodiments, exactly one U base in the native miR-145 nucleotide sequence is replaced by a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-145 nucleotide sequence are 5-halouracils. In another set of embodiments, exactly or at least three U bases in the modified miR-145 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least four U bases in the modified miR-145 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least five U bases in the modified miR-145 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least six U bases in the modified miR-145 nucleotide sequence are 5-halouracils. In a specific embodiment, all U bases in the modified miR-145 nucleotide sequence, whether in the native portion and / or the appended portion, are 5-halouracil.
[0058] In an exemplary embodiment, the miR-145 nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence GU F CCAGU F U F U F U F CCCAGGAAU F CCCU F [SEQ ID NO. 26], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0059] In another exemplary embodiment, a nucleic acid composition is provided that includes a modified native miR-194 nucleotide sequence that has been modified by replacing at least one uracil base with a 5-halouracil. In some embodiments, the modified miR-194 nucleotide sequence has been modified by replacing at least one U base with a 5-fluorouracil. More specifically, the nucleic acid composition contains at least the following native miR-194 nucleotide sequence: UGUAACAGCAACUCCAUGUGGA [SEQ ID NO. 27], wherein at least one, two, three, four, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracil.
[0060] In a specific embodiment, exactly one U base in the modified miR-194 nucleotide sequence is a 5-halouracil. In another embodiment, exactly or at least two U bases in the modified miR-194 nucleotide sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the modified miR-194 nucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the modified miR-194 nucleotide sequence are 5-halouracil. In a specific embodiment, all U bases in the modified miR-194 sequence, whether in the native portion and / or the appended portion of the nucleic acid, are 5-halouracil.
[0061] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-194 nucleotide sequence U F GU F AACAGCAACU F CCAU F GU F GGA [SEQ ID NO. 28], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0062] In yet another embodiment, the present disclosure provides a nucleic acid composition comprising a modified miR-let-7 nucleotide sequence comprising a 5-halouracil. In some embodiments, the modified miR let-7 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition can contain at least the following native miR-let-7 nucleotide sequence: UGAGGUAGUAGGUUGUAUAGUU [SEQ ID NO. 29], wherein at least one, two, three, four, five, six, seven, eight, or all of the uracil bases in the nucleic acid sequence are replaced with 5-halouracil.
[0063] In another set of embodiments, exactly one U base in the native miR-let-7 nucleotide sequence is replaced with a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-let-7 nucleotide sequence are 5-halouracils. In another set of embodiments, exactly or at least three U bases in the modified miR-34 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least four U bases in the modified miR-let-7 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least five U bases in the modified miR-let-7 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least six U bases in the modified miR-let-7 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least seven U bases in the modified miR-let-7 nucleotide sequence are 5-halouracils. In other embodiments, exactly or at least 8 U bases in the modified miR-let-7 nucleotide sequence are 5-halouracils. In specific embodiments, all U bases in the modified miR-let-7 nucleotide sequence, whether in the native portion and / or the appended portion, are 5-halouracils.
[0064] In an exemplary embodiment, the miR-let-7 nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence U F GAGGU F AGU F AGGU F U F GU F AU F AGU F U F [SEQ ID NO. 30], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0065] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil, or a combination thereof. In certain instances, all U bases of the modified miR are substituted with 5-fluorouracil.
[0066] The present disclosure also relates to the preparation of the microRNA composition of modification described herein or the preparation comprising its combination (that is, the microRNA of at least two modifications).In certain embodiments, preparation can include the pharmaceutical preparation comprising the above-mentioned nucleic acid composition and other known pharmacological agents, such as one or more pharmaceutically acceptable carriers.
[0067] The present disclosure reveals that each of the modified microRNAs exhibits potent efficacy as an anti-cancer therapy. Significantly, each of the modified microRNA nucleic acid compositions tested reduced cancer cell proliferation, tumor growth, and development in a dose-dependent manner in all six cancer types examined by inducing cell cycle arrest.
[0068] Thus, another aspect of the present disclosure relates to a method for treating cancer comprising administering to a subject an effective amount of one or more nucleic acid compositions as described herein. In certain embodiments of the present method, the nucleic acid composition comprises a modified miR-129, miR-15a, miR-192 / miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194, miR-let-7 nucleotide sequence or a combination thereof, wherein at least one, two, three, four or more uracil nucleotide bases in each native (unmodified) nucleotide sequence are substituted with 5-halouracil.
[0069] In a specific embodiment, the method comprises administering a nucleic acid composition of the present disclosure to a subject having cancer or a predisposition to cancer, wherein the nucleic acid composition is a modified miR-129 or modified miR-15a nucleic acid. In a specific embodiment of the present disclosure, the modified microRNA administered has a nucleic acid sequence selected from the group consisting of: F U F U F U F U F GCGGU F CU F GGGCU F U F GC [SEQ ID NO. 4],CUUUUUGCGGU F CU F GGGCU F U F GC [SEQ ID NO. 5], U F AGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO.6] and UAGCAGCACAU F AAU F GGU F U F U F GU FG [SEQ ID NO. 7].
[0070] In other embodiments, the method comprises administering a nucleic acid composition of the present disclosure to a subject having cancer or a predisposition to cancer, wherein the nucleic acid composition is a modified miR-140 or modified miR-192 nucleic acid. In a specific embodiment of the present disclosure, the administered modified microRNA has a CAGU F GGUUUUACCCU F AUGGU F AG [SEQ ID NO.9], CAGU F GGU F U F U F U F ACCCU F AU F GGU F AG [SEQ ID NO. 16] and CU F GACCU F AU F GAAU F U F The nucleic acid sequence of GACAGCC [SEQ ID NO. 11].
[0071] In another embodiment, the method comprises administering a nucleic acid composition of the present disclosure to a subject having cancer or a predisposition to cancer, wherein the nucleic acid composition is a modified miR-502 or modified miR-506 nucleic acid. In a specific embodiment of the present disclosure, the administered modified microRNA has a moiety selected from the group consisting of AU F CCU F U F GCUAU F CU F GGGU F GCU F A [SEQ ID NO. 13] and U F AU F U F CAGGAAGGU F GU F U F ACU F U F The nucleic acid sequence of AA [SEQ ID NO. 15].
[0072] In another embodiment, the method comprises administering a nucleic acid composition of the present disclosure to a subject having cancer or a predisposition for cancer, wherein the nucleic acid composition comprises a modified miR-34, modified miR-145, modified miR-200a, modified miR-200b, modified miR-200c, modified miR-194, or modified miR-let-7 nucleic acid. In a specific embodiment of the present disclosure, the modified microRNA administered has a F GGCAGU F GU F CU F U F AGCU F GGU F U F GU F [SEQ ID NO.18], U F AACACU F GU F CU F GGU F AACGAU F GU F [SEQ ID NO. 20]、U F AAU F ACU F GCCU F GGU F AAU F GAU F GA [SEQ ID NO. 22], U F AAU F ACU F GCCGGGU F AAU F GAU F GGA [SEQ ID NO. 24], GU F CCAGU F U F U F U F CCCAGGAAU F CCCU F [SEQ ID NO. 26]、U F GU F AACAGCAACU F CCAU F GU F GGA [SEQ ID NO. 28], U F GAGGU F AGU F AGGU F UF GU F AU F AGU F U F [SEQ ID NO. 30] and nucleic acid sequences of combinations thereof.
[0073] In certain embodiments, the subject treated by the methods of the present invention is a mammal. In certain embodiments, the subject treated is a human, dog, horse, pig, mouse, or rat. In specific embodiments, the subject is a human diagnosed with cancer or identified as having a tendency to develop cancer. In some embodiments, the cancer treated can be, for example, colorectal cancer, gastric cancer, esophageal cancer, lung cancer, ovarian cancer, pancreatic cancer, or cervical cancer. In certain embodiments, the methods of the present disclosure treat one or more of the following types of cancer in a subject: colorectal cancer, gastric cancer, pancreatic cancer, lung cancer, blood cancer (e.g., leukemia), or breast cancer.
[0074] The data provided herein unexpectedly show increased potency of the modified microRNAs described herein compared to known anticancer agents, such as 5-FU alone, in several different cancer models, including colorectal cancer, pancreatic cancer, and lung cancer. For example, the present disclosure provides the unexpected discovery that the modified nucleic acid compositions described are significantly more effective in inhibiting cancer progression and tumorigenesis than 5-FU, miR-15a, miR-129, miR-140, miR-192, miR-215, miR-502, miR-506, miR-34, miR-145, miR-200a, miR-200b, miR-200c, miR-194, or miR-let-7 alone, or than a combination of 5-FU and the corresponding natural microRNA.
[0075] Thus, the present compositions and methods provide the additional benefit of allowing lower dosages, which results in lower toxicity and fewer side effects. A further significant advantage exhibited by the described nucleic acid compositions is that the compositions have significantly improved efficacy compared to native miR-15a, miR-129, miR-140, miR-192, miR-215, miR-502, miR-506, miR-34, miR-145, miR-200a, miR-200b, miR-200c, miR-194 or miR-let-7 nucleic acids that have not been modified with halouracils. Thus, at least in view of the advantages noted, the nucleic acid compositions disclosed herein represent a substantial advance in the treatment of all cancers. BRIEF DESCRIPTION OF THE DRAWINGS
[0076] The patent file contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
[0077] Figures 1A-1P Chemical representations of exemplary modified microRNA nucleotide sequences of the present disclosure. (A) Chemical representation of the miR-129 nucleotide sequence, in which all U bases are replaced by halogenated uracils (i.e., U F) substituted with halouracil, as shown in SEQ ID NO: 4. (B) Chemical representation of miR-129, wherein only the non-seed portion of miR-129 has U bases substituted with halouracils, as shown in SEQ ID NO: 5. (C) Chemical representation of the miR-15a nucleotide sequence, wherein all U bases are substituted with halouracils, as shown in SEQ ID NO: 6. (D) Chemical representation of miR-15a, wherein only the non-seed portion of miR-15a has U bases substituted with halouracils, as shown in SEQ ID NO: 7. (E) Chemical representation of the miR-140 nucleotide sequence, wherein certain (3) U bases are substituted with halouracils, as shown in SEQ ID NO: 9. (F) Chemical representation of a modified miR-140 nucleotide sequence, wherein certain all U bases are substituted with halouracils, as shown in SEQ ID NO: 16. (G) Chemical representation of the miR-192 nucleotide sequence, wherein certain (5) U bases are substituted with halogenated uracils, as shown in SEQ ID NO: 11. (H) Chemical representation of the miR-502 nucleotide sequence, wherein certain (7) U bases are substituted with halogenated uracils, as shown in SEQ ID NO: 13. (I) Chemical representation of the miR-506 nucleotide sequence, wherein all (i.e., 8) U bases are substituted with halogenated uracils, as shown in SEQ ID NO: 15. (J) Chemical representation of the modified miR-34 nucleotide sequence, wherein all (i.e., 9) U bases are substituted with halogenated uracils, as shown in SEQ ID NO: 18. (K) Chemical representation of the modified miR-200a nucleotide sequence, wherein all (i.e., 7) U bases are substituted with halogenated uracils, as shown in SEQ ID NO: 20. (L) A chemical representation of a modified miR-200b nucleotide sequence wherein all (i.e., 7) U bases are substituted with halogenated uracils, as set forth in SEQ ID NO: 22. (M) A chemical representation of a modified miR-200c nucleotide sequence wherein all (i.e., 6) U bases are substituted with halogenated uracils, as set forth in SEQ ID NO: 24. (N) A chemical representation of a modified miR-145 nucleotide sequence wherein all (i.e., 7) U bases are substituted with halogenated uracils, as set forth in SEQ ID NO: 26. (O) A chemical representation of a modified miR-194 nucleotide sequence wherein all (i.e., 5) U bases are substituted with halogenated uracils, as set forth in SEQ ID NO: 28. (P) A chemical representation of a modified miR-let-7 nucleotide sequence wherein all (i.e., 9) U bases are substituted with halogenated uracils, as set forth in SEQ ID NO: 30.The orientation of each exemplary modified microRNA described is provided by either a 5' to 3' or a 3' to 5' designation.
[0078] Figures 2A-2C Exemplary modified microRNA nucleic acids enter cancer cells and effectively reduce target protein expression. (A) Graph showing target (E2F3) specificity and potency of an exemplary modified miR-129 (all U bases replaced with 5-FU, 5-FU-miR-129) compared to a control miRNA and unmodified miR-129 nucleic acid. (B) Quantitative real-time PCR analysis showing that the modified miR-129 nucleic acid (mimetic) enters cancer cells. (C) The modified miR-129 nucleic acid (mimetic) enters cancer cells and degrades TS-FdUMP significantly better than 5-FU alone.
[0079] Figure 3 Figure showing that exemplary modified microRNAs (mimics) inhibit colon cancer cell proliferation in four different colon cancer cell lines (HCT116, RKO, SW480, and SW620). Exemplary modified miR-129 nucleic acids in which all U bases are replaced by 5-fluorouracil ( ), compared with nonspecific (negative control, ) control and exogenously expressed natural miR-129 ( )compared to.
[0080] Figure 4 Combination therapy with 5-FU and a modified microRNA composition of the present disclosure effectively inhibits cancer cell proliferation. Graphical comparison of colon cancer cell proliferation in cancer cells treated with a negative control (NC), exogenously expressed native miR-129 (miR-129), 5-FU, an exemplary modified miR-129 nucleic acid of the present disclosure (5-FU-miR-129), and a combination of 5-FU and an exemplary miR-129 nucleic acid of the present disclosure (5-FU-miR-129 + 5-FU).
[0081] Figures 5A-5B Exemplary modified microRNAs induce apoptosis and lead to cell cycle arrest in colon cancer cells. (A) Cell death was quantified by a FITC-Annexin V apoptosis assay, showing that the modified miR-129 nucleic acid compositions of the present disclosure induce cancer cell apoptosis at significantly higher levels than a negative control or exogenously expressed native miR-129 in several different colorectal cancer cell lines. (B) Flow cytometry was performed, showing that the modified miR-129 nucleic acid compositions of the present disclosure (Mic-1) increase G1 cell cycle arrest at significantly higher levels than a negative control or exogenously expressed native miR-129.
[0082] Figure 6 The modified microRNA nucleic acid compositions of the present disclosure eliminate chemotherapy-resistant cancer stem cells. HCT116-derived colon cancer stem cells were treated with increasing concentrations of an exemplary modified miR-129 nucleic acid of the present disclosure ( ) or 5-FU ( The results showed that the modified miR-129 nucleic acid killed 5-FU-resistant cancer stem cells in a dose-dependent manner.
[0083] Figure 7 . In vivo systemic treatment with an exemplary modified microRNA nucleic acid composition inhibits colon cancer metastasis without toxic side effects. A colon cancer metastasis mouse model was established by tail vein injection of metastatic human colon cancer cells. Two weeks after the establishment of metastasis, 40 μg of the modified miR-129 nucleic acid composition as shown in SEQ ID NO: 4 was delivered by intravenous injection at a treatment frequency of once every other day for two weeks. The exemplary modified miR-129 nucleic acid (mimetic) was able to inhibit colon cancer metastasis (right figure), while the negative control miRNA (left figure) had no effect. Mice treated with the modified miR-129 nucleic acid did not show any toxicity.
[0084] Figures 8A-8B Second exemplary anti-cancer activity of modified microRNAs of the present disclosure. (A) Representative Western blot comparing the ability of exogenously expressed unmodified miR-15a (miR-15a) and a modified miR-15a nucleic acid composition (mimetic-1) to regulate protein expression in colon cancer cells. Modified miR-15a (mimetic-1), as shown in SEQ ID NO: 6, retains the ability to regulate miR-15a targets (YAP1, BMI-1, DCLK1, and BCL2) and degrades TS-FdUMP in colorectal cancer cells. (B) Modified miR-15a (mimetic-1) exhibits enhanced ability to inhibit colon cancer cell proliferation in three different colorectal cancer cell lines (HCT116, RKO, SW620) compared to exogenously expressed unmodified miR-15a (miR-15a).
[0085] Figures 9A-9BModified microRNA nucleic acids induce cell cycle arrest at the G1 / S phase in leukemia and colorectal cancer cells. (A) Graph showing cell cycle control of a control (negative), unmodified miR-15a (miR-15a), and an exemplary modified miR-15a nucleic acid composition (Mic-1) as set forth in SEQ ID NO: 6. Administration of modified miR-15a nucleic acids induced cell cycle arrest compared to unmodified miR-15a, as demonstrated by an increased G1 / S ratio in colorectal cancer cells expressing modified miR-15a when compared to cells exogenously expressing native miR-15a and a negative control. (B) Additional exemplary modified microRNA nucleic acids (5-FU-miR-145 and 5-FU-miR-let-7) also induced cell cycle arrest at the G1 / S phase in hematological cancer cells (i.e., REH leukemia cells) compared to a negative control when the modified microRNA was provided at a concentration of 50 nM.
[0086] Figure 10 Expression of modified miR-15a reduces the ability of cancer stem cells to induce cancer cell colony formation. In colon cancer stem cells, expression of unmodified miR-15a (miR-15a) inhibited cancer cell colony formation when compared to cancer stem cells provided with a nonspecific control microRNA (negative). Treatment with an exemplary modified miR-15a of the present disclosure (5-FU-miR-15a) completely blocked cancer cell colony formation.
[0087] Figure 11 Other exemplary modified microRNAs have shown efficacy as in vivo anticancer agents. A colon cancer metastasis mouse model was established by tail vein injection of metastatic human colon cancer cells. Two weeks after the metastasis was established, 40 μg of a modified miR-15a nucleic acid composition as shown in SEQ ID NO: 6 was delivered by intravenous injection at a treatment frequency of once every other day for two weeks. The exemplary modified miR-15a nucleic acid (mimetic) was able to inhibit colon cancer metastasis, while the negative control miRNA (negative) had no effect. Mice treated with the modified miR-15a nucleic acid did not show any toxicity.
[0088] Figures 12A-12D. Exemplary modified miR-15a and miR-129 mimics of the present disclosure show enhanced ability to inhibit proliferation of human breast cancer (A549; C, D) and pancreatic cancer (Panc-1 (A); AsPC-1 (B)) cells compared to unmodified miR-15a (miR-15a) or unmodified miR-129 (miR-129) or cells treated with a negative control.
[0089] Figures 13A-13B. Exemplary modified microRNAs of the present disclosure exhibit increased ability to inhibit the proliferation of human colorectal cancer cells. Additional exemplary modified microRNAs were tested for their ability to inhibit the proliferation of colorectal cancer cells in HCT116 human colorectal cancer cells. (A) An exemplary modified miR-140 mimic, as shown in SEQ ID NO: 9, was administered to human colorectal cancer cells and exhibited increased ability to inhibit the proliferation of colorectal cancer cells when compared to a negative control microRNA. (B) An exemplary modified miR-192 mimic, as shown in SEQ ID NO: 11, was administered to human colorectal cancer cells and exhibited increased ability to inhibit the proliferation of colorectal cancer cells when compared to a negative control microRNA.
[0090] Figures 14A-14E. All exemplary modified microRNAs of the present disclosure exhibited improved ability to inhibit several types of cancer. For each cancer type tested, cancer cell proliferation was inhibited by exogenous expression of each of the following 5-FU-modified microRNA nucleic acids: miR-15a [SEQ ID NO: 6], miR-129 [SEQ ID NO: 4], miR-506 [SEQ ID NO: 15], miR-502 [SEQ ID NO: 13], miR-34 [SEQ ID NO: 18], miR-200a [SEQ ID NO: 20], miR-200b [SEQ ID NO: 22], miR-200c [SEQ ID NO: 24], miR-145 [SEQ ID NO: 26], miR-194 [SEQ ID NO: 28], miR-let-7 [SEQ ID NO: 30], miR-215 [SEQ ID NO: 11], and miR-140 [SEQ ID NO: 16], when compared to the negative control (negative). (A) Human pancreatic cancer cell proliferation was inhibited by expression of each modified microRNA tested in Hs766T pancreatic cancer cells. (B) Gastric cancer cell proliferation was inhibited by expression of each modified microRNA tested in AGS gastric cancer cells. (C) Human breast cancer cell proliferation was inhibited by expression of each modified microRNA tested in SKBR3 breast cancer cells. (D) Lung cancer cell proliferation was inhibited by expression of each modified microRNA tested in A549 lung cancer cells. (E) Leukemia cancer cell proliferation was inhibited by expression of each modified microRNA tested in acute lymphoblastic leukemia cell line (REH). In summary, the data reveal that the modified microRNA compositions of the present disclosure show an increased ability to inhibit the proliferation of all types of cancer cells compared to the negative control.
[0091] Figures 15A-15C. All exemplary modified microRNAs of the present disclosure showed the ability to inhibit cancer cell growth in a dose-dependent manner. For each cancer type tested, cancer cell proliferation was inhibited by exogenous expression of each of the following 5-FU-modified microRNA nucleic acids compared to a negative control (negative): miR-15a [SEQ ID NO: 6], miR-129 [SEQ ID NO: 4], miR-506 [SEQ ID NO: 15], miR-502 [SEQ ID NO: 13], miR-34 [SEQ ID NO: 18], miR-200a [SEQ ID NO: 20], miR-200b [SEQ ID NO: 22], miR-200c [SEQ ID NO: 24], miR-145 [SEQ ID NO: 26], miR-194 [SEQ ID NO: 28], miR-let-7 [SEQ ID NO: 30], miR-215 [SEQ ID NO: 11], and miR-140 [SEQ ID NO: 16]. (A, B) In two different human pancreatic cancer cell lines (A, APSC-1; B, PANC-1), human pancreatic cancer cell proliferation was inhibited in a dose-dependent manner by each modified microRNA tested. (C) In an acute lymphoblastic leukemia cell line (REH), leukemia cancer cell proliferation was inhibited in a dose-dependent manner by each modified microRNA tested. In summary, the data reveal that the modified microRNA compositions of the present disclosure exhibit the ability to inhibit the growth and proliferation of multiple types of cancer cells in a dose-dependent manner.
[0092] Figures 16A-16C. Another exemplary modified microRNA nucleic acid enters cancer cells and effectively reduces target protein expression and inhibits tumorigenesis and progression by inducing cell cycle arrest. (A) Graphs showing target (ZEB-1 and fibronectin) specificity and the potency of an exemplary modified miR-200b (all U bases replaced with 5-FU, 5-FU-miR-200b) compared to a control miRNA and unmodified miR-200b nucleic acid. (B) The modified miR-200b nucleic acid (5-FU-miR-200b) enters breast cancer cells (MDA-MB-231 cell line) with triple-negative breast cancer and disrupts TS-FdUMP, demonstrating anti-cancer activity. (C) Compared with exogenous natural miR-200b and negative control (miR-NC), expression of modified miR-200b (5-FU-miR-200b) significantly increased the G1 / S ratio (upper panel) and G1 subpopulation (lower panel) of cells, indicating that modified miR-200b inhibits breast cancer cell cycle progression.
[0093] Figures 17A-17B Modified microRNA molecules can be delivered to cancer cells without an exogenous delivery vehicle. (A) MDA-MB-231 cells were transfected with a nonspecific microRNA control nucleic acid (miR-NC), natural miR-200b, or modified miR-200b (5-FU-miR-200b) in the presence of oligofectamine, or (B) exposed to NC (negative control), natural miR-200b, or modified miR-200b (5-FU-miR-200b) in the absence of a delivery vehicle (i.e., without oligofectamine). Compared to the negative control and natural miR-200b, modified miR-200b effectively reduced cell proliferation in breast cancer cells with or without a delivery vehicle. In contrast, exogenous miR-200b did not inhibit cell growth in the absence of a delivery vehicle. DETAILED DESCRIPTION
[0094] The present disclosure provides nucleic acid compositions incorporating one or more halogenated uracil molecules. Without being limited by any specific theory, surprisingly, the present disclosure discloses that replacing the uracil nucleotides in the microRNA oligonucleotide sequence with 5-halogenated uracil increases the ability of microRNA to suppress cancer development, progression and tumorigenesis. In addition, the data herein show that contacting many types of cancer cells with the modified microRNA compositions of the present disclosure regulates cell cycle progression and reduces tumorigenesis by, for example, reducing cancer cell proliferation and increasing the efficacy of chemotherapeutic agents. In addition, it is shown that the modified microRNA of the present disclosure retains target specificity and can be delivered without using harmful and ineffective delivery vehicles (e.g., nanoparticles), and shows improved efficacy and stability without abolishing the natural function of endogenous microRNA. Therefore, the present disclosure provides various nucleic acid (e.g., microRNA) compositions incorporating 5-halogenated uracil molecules into its nucleic acid sequence and methods for treating cancer using the same. The present disclosure further provides preparations, such as pharmaceutical compositions comprising modified nucleic acid compositions, and methods for treating cancer, comprising administering the preparation to a subject in need.
[0095] Nucleic acid composition
[0096] The terms "microRNA" or "miRNA" or "miR" are used interchangeably and refer to small non-coding ribonucleic acid (RNA) molecules that can regulate gene expression by interacting with messenger RNA molecules (mRNA), DNA or proteins. Typically, microRNA consists of a nucleic acid sequence of about 19-25 nucleotides (bases) and is present in mammalian cells. Mature microRNA molecules are single-stranded RNA molecules processed from double-stranded precursor transcripts that form a local hairpin structure. The hairpin structure is typically cleaved by the Dicer enzyme to form a double-stranded microRNA duplex. See, for example, Bartel, Cell , (2004) 116 pp. 281-297. As used herein, the term microRNA encompasses both duplexes (i.e., double-stranded miRs) and single-stranded miRs (i.e., mature miRs) in the 5' to 3' direction, as well as the complementary strand in the 3' to 5' direction. In specific embodiments, the modified miRs of the present disclosure consist of single-stranded mature miRs.
[0097] Typically, one of the two strands of a microRNA duplex is packaged in a microRNA ribonucleoprotein complex (microRNP). In humans, for example, microRNPs also include the protein eIF2C2 / Argonaute (Ago2), the helicases Gemin3 and Gemin 4. Other members of the Argonaute protein family, such as Ago1, 3, and 4, also associate with microRNAs and form microRNPs.
[0098] The terms "modified microRNA," "modified miRNA," "modified miR," or "mimetic" are used interchangeably herein to refer to microRNAs that are different from natural or endogenous microRNA (unmodified microRNA) polynucleotides. More specifically, the microRNA modified in the present disclosure differs from an unchanged or unmodified microRNA nucleic acid sequence by one or more bases. In some embodiments of the present disclosure, the modified microRNA of the present disclosure comprises at least one uracil (U) nucleotide base substituted with 5-halouracil. In other embodiments, the modified microRNA comprises additional nucleotides (i.e., adenine (A), cytosine (C), uracil (U), and guanine (G)) and at least one uracil base substituted with 5-halouracil.
[0099] In one aspect of the present disclosure, nucleic acid compositions comprising modified microRNA nucleotide sequences having at least one uracil base (U,U base) substituted with a 5-halouracil, such as 5-fluorouracil (5-FU), are described. As further discussed herein, the nucleic acid compositions of the present disclosure can be used to treat at least all cancers. In particular, exemplary modified microRNAs of the present disclosure have been shown herein to be effective in treating colorectal cancer, pancreatic cancer, lung cancer, gastric cancer, blood cancers (e.g., leukemia), and breast cancer.
[0100] In some embodiments, nucleic acid composition comprises the nucleotide sequence that at least one uracil core base modification is derived at 5-position by using the group that provides similar effect to halogen atom.In some embodiments, the group that provides similar effect has the size similar to halogen atom on weight or spatial dimension, for example, at most or less than the molecular weight of 20,30,40,50,60,70,80,90 or 80 g / mol.In certain embodiments, the group that provides the effect similar to halogen atom can be for example methyl, trihalomethyl (for example, trifluoromethyl), pseudohalide (for example, trifluoromethanesulfonate root, cyano group or cyanate root) or deuterium (D) atom.The group that provides the effect similar to halogen atom can exist in microRNA nucleotide sequence when there is no 5-halogenated uracil base or except 5-halogenated uracil base.
[0101] In addition, in other embodiments, groups that provide effects similar to halogen atoms may be located in the natural (or seed) portion and / or the additional portion of the microRNA nucleotide sequence, which will be readily determined by one of ordinary skill in the art. In some embodiments, one or more (or all) of the above types of groups that provide effects similar to halogen atoms are excluded from the modified miRNA nucleotide sequence. When all of these alternative groups are excluded, only one or more halogen atoms exist as substituents to the 5-position of one or more uracil groups in the microRNA nucleotide sequence.
[0102] In certain embodiments, the modified microRNA has more than one, or exactly one, uracil substituted with a 5-halouracil.
[0103] In some embodiments, the modified microRNA nucleotide sequence comprises 3, 4, 5, 6, 7, 8, or more uracil bases substituted with 5-halouracil.
[0104] In one embodiment, all uracil nucleotide bases of the modified mRNA are substituted with 5-halouracil.
[0105] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil.
[0106] As used herein, the term "miR-129" is intended to be synonymous with the term "microRNA-129" or "miRNA-129," and refers to an oligonucleotide having the following nucleotide sequence: CUUUUUGCGGUCUGGGCUUGC [SEQ ID NO. 1], wherein it is understood that C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is referred to herein as the unmodified miR-129 (i.e., "native") sequence, unless otherwise indicated. In other embodiments, miR-129 may also be referred to in the art as hsa-miR-129, having accession number MI0000252 for the double-stranded microRNA containing a stem-loop; hsa-miR-129-5p, for the 5' to 3' strand of the mature miR, as set forth in accession number MIMAT0000242; and hsa-miR-129-3p, for the 3' to 5' complementary strand of the duplex miR-129 molecule, as set forth in accession number MIMAT0004548. MiR-129 is well known and has been studied in detail. See, for example, J. Wu et al., Cell Cycle , (2010) 9:9, 1809-1818. As is also well known in the art, miR-129 sequences can be modified to produce "miR-129 mimics," which have sequences modified from the native sequence but retain the known function or activity of native miR-129. Unless otherwise indicated, all such modified miR-129 compositions are considered herein to be within the scope of the term "miR-129 mimics," as used herein.
[0107] A specific modified miR-129 nucleic acid sequence (mimic) of interest comprises two U bases (i.e., two U-containing nucleotides) covalently attached to the termini of the miR-129 native sequence, for example, in CUUUUUGCGGUCUGGGCUUGC-UU [SEQ ID NO. 3]. In the aforementioned sequence, the two terminal U bases continue or extend the miR-129 native sequence from 21 nucleotide bases to 23 nucleotide bases. Generally, the miR-129 mimic comprises no more than 1, 2, 3, 4, or 5 additional bases (i.e., as additional nucleotides) covalently attached to the miR-129 native sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-129 is used in single-stranded form, but double-stranded versions are also contemplated herein.
[0108] In one embodiment, the present disclosure relates to a nucleic acid composition comprising a miR-129 nucleotide sequence that has been modified by replacing at least one uracil nucleobase (i.e., a U base) with a 5-halouracil, i.e., wherein at least one U base in the miR-129 sequence, whether in the native portion and / or in the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0109] In a first group of embodiments, exactly one U base in the miR-129 sequence is a 5-halouracil. In a second group of embodiments, exactly or at least two U bases in the miR-129 sequence are 5-halouracil. In a third group of embodiments, exactly or at least three U bases in the miR-129 sequence are 5-halouracil. In a fourth group of embodiments, exactly or at least four U bases in the miR-129 sequence are 5-halouracil. In a fifth group of embodiments, exactly or at least five U bases in the miR-129 sequence are 5-halouracil. In a sixth group of embodiments, all U bases in the miR-129 sequence, whether in the native portion and / or in the additional portion, are 5-halouracil.
[0110] In a specific embodiment, the nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence CU as shown in SEQ ID NO. 4 F U F U F U F U F GCGGU F CU F GGGCU F U F GC, where U FIt is a halogenated uracil, specifically 5-fluorouracil.
[0111] The U bases substituted with 5-halouracils in the miR-129 sequence can be located in the unmodified portion of the miR-129 sequence (as provided above), or in the case of a miR-129 mimic, can be located at one or more U bases covalently attached to native miR-129 (also as provided above). In other embodiments, the seed portion GUUUUUGC of the native miR-129 nucleotide sequence remains unmodified with 5-halouracils, while one or more (or all) of the remaining U bases in the remainder of the miR-129 nucleotide sequence are substituted with an equal number of 5-halouracils.
[0112] For example, in a specific embodiment, the nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence CUUUUUGCGGU as shown in SEQ ID NO. 5 F CU F GGGCU F U F GC, where U F It is a halogenated uracil, specifically 5-fluorouracil.
[0113] In an alternative embodiment, the nucleic acid composition comprises a miR-129 nucleotide sequence modified by deriving at least one uracil (U) nucleobase at the 5-position with a group providing an effect similar to that of a halogen atom. In some embodiments, the group providing a similar effect has a size similar to that of a halogen atom in weight or spatial dimensions, for example, a molecular weight of at most or less than 20, 30, 40, 50, 60, 70, 80, 90, or 80 g / mol. The group providing an effect similar to that of a halogen atom can be, for example, a methyl group, a trihalomethyl group (e.g., a trifluoromethyl group), a pseudohalide (e.g., a trifluoromethanesulfonate group, a cyano group, or a cyanate group) or a deuterium (D) atom. The group providing an effect similar to that of a halogen atom can be present in the miR-129 nucleotide sequence in the absence of a 5-halogenated uracil base or in addition to a 5-halogenated uracil base. In addition, the group providing an effect similar to that of a halogen atom can be located in the natural (or seed) portion and / or the additional portion of the miR-129 nucleotide sequence. In some embodiments, one or more (or all) of the above types of groups that provide an effect similar to that of halogen atoms are excluded from the miR-129 nucleotide sequence. When all of these alternative groups are excluded, only one or more halogen atoms are present as substituents at the 5-position of one or more uracil groups in the miR-129 nucleotide sequence.
[0114] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-15a nucleotide sequence. In some embodiments, the miR-15a nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0115] As used herein, the term "miR-15a" is intended to be synonymous with the term "microRNA-15a" or "miRNA-15a," and refers to an oligonucleotide having the following nucleotide sequence: UAGCAGCACAUAAUGGUUUGUG [SEQ ID NO. 2], wherein it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is referred to herein as the miR-15a unmodified (i.e., "native") sequence, unless otherwise indicated. In other embodiments, miR-15a may also be referred to in the art as hsa-miR-15a, having accession number MI0000069 for the double-stranded microRNA containing the stem-loop; and hsa-miR-15a-5p, having accession number MI0000068 for the mature miR 5' to 3'; and hsa-miR-15a-3p, having accession number MIMAT0004488 for the 3' to 5' complementary strand of the duplex miR-15a molecule. miR-15a is well known and has been studied in detail, for example, by Xie T et al. Clin Transl Oncol . (2015) 17(7):504-10; and Acunzo M and Croce CM, Clin. Chem (2016) 62(4):655-6. As described above for miR-129 mimics, methods for creating miR-15a mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-15a forms are considered herein to be within the scope of the term "miR-15a mimics" as used herein.
[0116] Typically, the modified miR-15a (i.e., miR-15a mimic) comprises no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native sequence of miR-15a, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-15a is used in single-stranded form, but double-stranded versions are also contemplated herein.
[0117] In some embodiments, at least one U base in the miR-15a sequence, whether in the native portion and / or in the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0118] In one set of embodiments, exactly one U base in the miR-15a sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-15a sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-15a oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-15a sequence are 5-halouracil. In some embodiments, exactly or at least five U bases in the miR-15a sequence are 5-halouracil. In yet other embodiments, exactly or at least six U bases in the miR-15a sequence are 5-halouracil. In specific embodiments, all U bases in the miR-15a sequence, whether in the native portion and / or in the attached portion, are 5-halouracil.
[0119] In one embodiment, the nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence U F AGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO. 6], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0120] The U base that is replaced by 5-halouracil in the miR-15a sequence can be located in the unmodified portion of the miR-15a sequence (as provided above), or, in the case of a miR-15a mimic, can be located in one or more uracil bases appended to native miR-15a (also as provided above).
[0121] In other embodiments, the seed portion UAGCAGCA of the native miR-15a nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-15a nucleotide sequence are substituted with 5-halouracil.
[0122] In a specific embodiment, the nucleic acid composition of the present disclosure has a modified miR-15a nucleotide sequence UAGCAGCACAU F AAU F GGU F U F U F GU F G[SEQ ID NO. 7], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0123] In certain embodiments, the nucleic acid composition comprises a miR-15a nucleotide sequence modified by derivatizing at least one uracil (U) nucleobase at the 5-position with a group that provides an effect similar to that of a halogen atom. In some embodiments, the group that provides a similar effect has a size similar to that of a halogen atom in terms of weight or spatial dimensions, for example, a molecular weight of at most or less than 20, 30, 40, 50, 60, 70, 80, 90, or 80 g / mol. The group that provides an effect similar to that of a halogen atom can be, for example, a methyl group, a trihalomethyl group (e.g., a trifluoromethyl group), a pseudohalide (e.g., a trifluoromethanesulfonate group, a cyano group, or a cyanate group), or a deuterium (D) atom. The group that provides an effect similar to that of a halogen atom can be present in the miR-15a nucleotide sequence in the absence of a 5-halogenated uracil base or in addition to a 5-halogenated uracil base. In addition, the group that provides an effect similar to that of a halogen atom can be located in the natural (or seed) portion and / or the additional portion of the miR-15a nucleotide sequence.
[0124] In some embodiments, one or more (or all) of the above types of groups that provide an effect similar to that of halogen atoms are excluded from the miR-15a nucleotide sequence. When all of these alternative groups are excluded, only one or more halogen atoms are present as substituents at the 5-position of one or more uracil groups in the miR-15a nucleotide sequence.
[0125] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-140 nucleotide sequence. In some embodiments, the miR-140 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0126] As used herein, the term "miR-140" is intended to be synonymous with the term "microRNA-140" or "miRNA-140," and refers to an oligonucleotide having the following nucleotide sequence: CAGUGGUUUUACCCUAUGGUAG [SEQ ID NO. 8], wherein it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is referred to herein as the miR-140 unmodified (i.e., "native") sequence, unless otherwise indicated. In other embodiments, miR-140 may also be referred to as hsa-miR-140, having accession number MI0000456 for the double-stranded microRNA containing a stem-loop; hsa-miR-140-5p for the 5' to 3' strand of the mature miR, as set forth in accession number MIMAT0000431 or NT_010498; and hsa-miR-140-3p for the 3' to 5' complementary strand of the duplex miR-140 molecule, as set forth in accession number MIMAT0004597. MiR-140 is well known and has been studied in detail, for example, by Zhai, H. et al., Oncotarget (2015) 6: 19735-46. As described above for the exemplary mimics miR-129 and miR-15a, methods for creating miR-140 mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified forms of miR-140 are considered herein to be within the scope of the term "miR-140 mimics" as used herein.
[0127] Typically, a modified miR-140 nucleic acid (i.e., a miR-140 mimetic) comprises no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-140 sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-140 mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0128] In some embodiments, at least one U base in the miR-140 sequence, whether in the native portion and / or in the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0129] In one set of embodiments, exactly one U base in the miR-140 mimic sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-140 sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-140 oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-140 sequence are 5-halouracil. In some embodiments, exactly or at least five U bases in the miR-140 mimic sequence are 5-halouracil. In yet other embodiments, exactly or at least six U bases in the miR-140 mimic sequence are 5-halouracil. In specific embodiments, all U bases in the miR-140 sequence, whether in the native portion and / or in the attached portion, are 5-halouracil.
[0130] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-140 nucleotide sequence CAGU F GGUUUUACCCU F AUGGU F AG [SEQ ID NO. 9], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0131] In another embodiment, the nucleic acid composition of the present disclosure has a modified miR-140 nucleotide sequence UAGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO. 16], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0132] The U base substituted with 5-halouracil in the miR-140 mimetic sequence can be located in the unmodified portion of the miR-140 sequence (as provided above), or can be located in one or more uracil bases appended to the native miR-140 sequence (as provided above).
[0133] In other embodiments, the seed portion of the native miR-140 nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-140 nucleotide sequence are substituted with 5-halouracil.
[0134] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-192 nucleotide sequence. In some embodiments, the miR-192 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0135] As used herein, the term "miR-192" is intended to be synonymous with the terms "microRNA-192," "miRNA-192," "microRNA-215," "miR-215," or "miRNA-215," and refers to an oligonucleotide having the following nucleotide sequence: CUGACCUAUGAAUUGACAGCC [SEQ ID NO. 10], wherein it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is referred to herein as the miR-192 unmodified (i.e., "native") sequence, unless otherwise indicated. In some embodiments, miR-192 may be referred to in the art as hsa-miR-192 or hsa-miR-215, having accession numbers MI0000234 or MI0000291 for the double-stranded microRNA containing a stem-loop; hsa-miR-192-5p or hsa-miR-215-5p, for the 5' to 3' strands of the mature miR, as set forth in accession numbers MIMAT0000222 and MIMAT0000272, respectively; and hsa-miR-192-3p or hsa-miR-215-3p, for the 3' to 5' complementary strands of the duplex molecule, as set forth in accession numbers MIMAT0004543 and MIMAT0026476, respectively. MiR-192 is well known and has been studied in detail, for example, by Song, B. et al., Clin. Cancer Res . (2008), 14: 8080-8086, and Song, B. et al., Mol. Cancer . (2010), 9:96 pp. 1476-4598. As described above for exemplary mimics miR-129, miR-140, and miR-15a, methods for creating miR-192 mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-192 nucleic acid forms are considered herein to be within the scope of the term "miR-192 mimics" as used herein.
[0136] Typically, the modified miR-192 (i.e., miR-192 mimic) comprises no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native sequence of miR-192, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-192 mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0137] In some embodiments, at least one U base in the miR-192 or miR-215 sequence, whether in the native portion and / or in the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0138] In another set of embodiments, exactly one U base in the miR-192 mimic sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-192 sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-192 oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-192 sequence are 5-halouracil. In a specific embodiment, all U bases in the miR-192 sequence, whether in the native portion and / or in the appended portion, are 5-halouracil.
[0139] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-192 nucleotide sequence CU F GACCU F AU F GAAU F U F GACAGCC [SEQ ID NO. 11], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0140] The U base substituted with 5-halouracil in the miR-192 mimetic sequence can be located in the unmodified portion of the miR-192 sequence (as provided above), or can be located in one or more uracil bases appended to the native miR-192 sequence (as provided above).
[0141] In other embodiments, the seed portion of the native miR-192 nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-192 nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0142] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-502 nucleotide sequence. In some embodiments, the miR-502 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0143] As used herein, the term "miR-502" is intended to be synonymous with the term "microRNA-502" or "miRNA-502," and refers to an oligonucleotide having the following nucleotide sequence: AUCCUUGCUAUCUGGGUGCUA [SEQ ID NO. 12], wherein it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is referred to herein as the miR-502 unmodified (i.e., "native") sequence, unless otherwise indicated. In other embodiments, miR-502 may also be referred to herein as hsa-miR-502, having accession numbers MI0003186 for the double-stranded microRNA containing a stem-loop; hsa-miR-502-5p for the mature miR 5' to 3' strand, as set forth in accession number MIMAT0002873; and hsa-miR-502-3p for the 3' to 5' complementary strand of the duplex miR-502 molecule, as set forth in accession number MIMAT0004775. MiR-502 is well known and has been studied in detail, e.g., by Zhai, H et al., Oncogene (2013), 32:12 pp. 1570-1579. As described above for exemplary mimics miR-129, miR-140, miR-192, and miR-15a, methods for creating miR-502 mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-502 nucleic acid forms are considered herein to be within the scope of the term "miR-502 mimics," as used herein.
[0144] Typically, the modified miR-502 (i.e., miR-502 mimic) comprises no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-502 sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-502 mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0145] In some embodiments, at least one U base in the miR-502 sequence, whether in the native portion and / or in the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0146] In another set of embodiments, exactly one U base in the miR-502 mimic sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-502 sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-502 oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-502 sequence are 5-halouracil. In other embodiments, exactly or at least five U bases in the miR-502 sequence are 5-halouracil. In other embodiments, exactly or at least six U bases in the miR-502 sequence are 5-halouracil. In other embodiments, exactly or at least seven U bases in the miR-502 sequence are 5-halouracil. In a specific embodiment, all U bases in the miR-502 sequence, whether in the native portion and / or in the appended portion, are 5-halouracil.
[0147] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-502 nucleotide sequence AU F CCU F U F GCUAU F CU F GGGU F GCU F A [SEQ ID NO. 13], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0148] The U base substituted with 5-halouracil in the miR-502 mimic sequence can be located in the unmodified portion of the miR-502 sequence (as provided above), or can be located in one or more uracil bases appended to the native miR-502 sequence (as provided above).
[0149] In other embodiments, the seed portion of the native miR-502 nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-502 nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0150] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-506 nucleotide sequence. In some embodiments, the miR-506 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0151] As used herein, the term "miR-506" is intended to be synonymous with the term "microRNA-506" or "miRNA-506," and refers to an oligonucleotide having the following nucleotide sequence: UAUUCAGGAAGGUGUUACUUAA [SEQ ID NO. 14], wherein it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is referred to herein as the miR-506 unmodified (i.e., "native") sequence, unless otherwise indicated. In other embodiments, miR-506 may also be referred to herein as hsa-miR-506, having accession numbers MI0003193 for the double-stranded microRNA containing a stem-loop; hsa-miR-506-5p for the mature miR 5' to 3' strand, as set forth in accession number MIMAT0022701; and hsa-miR-506-3p for the 3' to 5' complementary strand of the duplex miR-506 molecule, as set forth in accession number MIMAT0002878. MiR-506 is well known and has been studied in detail, e.g., by Li, J et al., Oncotarget . (2016), 7:38 pp. 62778-62788 and Li, J. et al., Oncogene. (2016) 35 pp. 5501-5514. As described above for exemplary mimics miR-129, miR-140, miR-502, miR-192, and miR-15a, methods for creating miR-506 mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-506 nucleic acid forms are considered herein to be within the scope of the term "miR-506 mimics" as used herein.
[0152] Typically, the modified miR-506 (i.e., miR-506 mimic) comprises no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native sequence of miR-506, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-506 mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0153] In some embodiments, at least one U base in the miR-506 sequence, whether in the native portion and / or in the appended portion, is a 5-halouracil, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0154] In another set of embodiments, exactly one U base in the miR-506 mimic sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-506 sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-506 oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-506 sequence are 5-halouracil. In other embodiments, exactly or at least five U bases in the miR-506 sequence are 5-halouracil. In other embodiments, exactly or at least six U bases in the miR-506 sequence are 5-halouracil. In other embodiments, exactly or at least seven U bases in the miR-506 sequence are 5-halouracil. In a specific embodiment, all U bases in the miR-506 sequence, whether in the native portion and / or in the appended portion, are 5-halouracil.
[0155] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-506 nucleotide sequence U F AU F U F CAGGAAGGU F GU F U F ACU F U F AA [SEQ ID NO. 15], where U F It is a halogenated uracil, specifically 5-fluorouracil.
[0156] The U base substituted with 5-halouracil in the miR-506 mimic sequence can be located in the unmodified portion of the miR-506 sequence (as provided above), or can be located in one or more uracil bases appended to the native miR-506 sequence (as provided above).
[0157] In other embodiments, the seed portion of the native miR-506 nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-506 nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0158] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-34 nucleotide sequence. In some embodiments, the miR-34 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0159] As used herein, the term "miR-34" is intended to be synonymous with the term "microRNA-34," "miR-34a," or "miRNA-34," and refers to an oligonucleotide having the following nucleotide sequence: UGGCAGUGUCUUAGCUGGUUGU [SEQ ID NO. 17]. The foregoing nucleotide sequence is referred to herein as the miR-34 unmodified (i.e., "native") sequence, unless otherwise indicated. In other embodiments, miR-34 may also be referred to herein as hsa-miR-34, having accession numbers MI0000268 for the double-stranded microRNA containing a stem-loop; hsa-miR-34a-5p, for the 5' to 3' strand of the mature miR, as set forth in accession number MIMAT0000255; and hsa-miR-34a-3p, for the 3' to 5' complementary strand of the duplex miR-129 molecule, as set forth in accession number MIMAT0004557. MiR-34 is well known and has been studied in detail. See, e.g., Lui, WO et al., Cancer Res. 67 pp. 6031-6043 (2007). As described above for exemplary mimics miR-129, miR-140, miR-502, miR-506, miR-192, and miR-15a, methods for creating modified miR-34 polynucleotides are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-34 nucleic acid forms are considered herein to be within the scope of the terms "miR-34 mimics" or "modified miR-34" as used herein.
[0160] Typically, the modified miR-34 (i.e., miR-34 mimic) contains no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-34 sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-34 mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0161] In some embodiments, at least one U base in the miR-34 sequence, whether in the native portion and / or the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0162] In other embodiments, exactly one U base in the miR-34 mimic sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-34 sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-34 oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-34 sequence are 5-halouracil. In other embodiments, exactly or at least five U bases in the miR-34 sequence are 5-halouracil. In other embodiments, exactly or at least six U bases in the miR-34 sequence are 5-halouracil. In other embodiments, exactly or at least seven U bases in the miR-34 sequence are 5-halouracil. In yet another embodiment, exactly or at least eight U bases in the miR-34 sequence are 5-halouracil. In a specific embodiment, all U bases in the miR-34 sequence, whether in the native portion and / or the appended portion, are 5-halouracil.
[0163] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-34 nucleotide sequence U F GGCAGU F GU F CU F U F AGCU F GGU F U F GU F [SEQ ID NO. 18], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0164] The U base substituted with 5-halouracil in the modified miR-34 sequence can be located in the unmodified portion of the miR-34 sequence, as provided above, or can be located in one or more uracil bases appended to the native miR-34 sequence, as provided above.
[0165] In other embodiments, the seed portion of the native miR-34 nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-34 nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0166] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-200a nucleotide sequence. In some embodiments, the miR-200a nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0167] As used herein, the term "miR-200a" is intended to be synonymous with the term "microRNA-200a" or "miRNA-200a" and refers to an oligonucleotide having the following nucleotide sequence: UAACACUGUCUGGUAACGAUGU [SEQ ID NO. 19]. The foregoing nucleotide sequence is referred to herein as the unmodified (i.e., "native") sequence of miR-200a, unless otherwise indicated. In other embodiments, miR-200a may also be referred to herein as hsa-miR-200a, having accession number MI0000737 for a double-stranded microRNA containing a stem-loop; hsa-miR-200a-5p, for the 5' to 3' strand of the mature miR, as set forth in accession number MIMAT0001620; and hsa-miR-200a-3p, for the 3' to 5' complementary strand of the duplex miR-200a molecule, as set forth in accession number MIMAT000682. MiR-200a is well known and has been studied in detail. See, for example, Lagos-Quintana M et al., RNA 9: pp. 175-179 (2003). As described above, methods for creating modified miR-200a polynucleotides are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-200a nucleic acid forms are considered herein to be within the scope of the terms "miR-200a mimics" or "modified miR-200a" as used herein.
[0168] Typically, the modified miR-200a (i.e., miR-200a mimic) contains no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-200a sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-200a mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0169] In some embodiments, at least one U base in the miR-200a sequence, whether in the native portion and / or the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0170] In other embodiments, exactly one U base in the miR-200a mimic sequence is a 5-halouracil. In a second group of embodiments, exactly or at least two U bases in the miR-200a sequence are 5-halouracils. In another group of embodiments, exactly or at least three U bases in the miR-200a oligonucleotide sequence are 5-halouracils. In other embodiments, exactly or at least four U bases in the miR-200a sequence are 5-halouracils. In other embodiments, exactly or at least five U bases in the miR-200a sequence are 5-halouracils. In other embodiments, exactly or at least six U bases in the miR-200a sequence are 5-halouracils. In specific embodiments, all U bases in the miR-200a sequence, whether in the native portion and / or the additional portion, are 5-halouracils.
[0171] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-200a nucleotide sequence U F AACACU F GU F CU F GGU F AACGAU F GU F [SEQ ID NO. 20], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0172] The U base substituted with 5-halouracil in the modified miR-200a sequence can be located in the unmodified portion of the miR-200a sequence, as provided above, or can be located in one or more uracil bases appended to the native miR-200a sequence, as provided above.
[0173] In other embodiments, the seed portion of the native miR-200a nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-200a nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0174] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-200b nucleotide sequence. In some embodiments, the miR-200b nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0175] As used herein, the term "miR-200b" is intended to be synonymous with the term "microRNA-200b" or "miRNA-200b" and refers to an oligonucleotide having the following nucleotide sequence: UAAUACUGCCUGGUAAUGAUGA [SEQ ID NO. 21]. The foregoing nucleotide sequence is referred to herein as the unmodified (i.e., "native") sequence of miR-200b, unless otherwise indicated. In other embodiments, miR-200b may also be referred to herein as hsa-miR-200b, having accession number MI0000342 for a double-stranded microRNA containing a stem-loop; hsa-miR-200b-5p, for the 5' to 3' strand of the mature miR, as set forth in accession number MIMAT00004571; and hsa-miR-200b-3p, for the 3' to 5' complementary strand of the duplex miR-200b molecule, as set forth in accession number MIMAT0000318. MiR-200b is well known and has been studied in detail. See, for example, Altuvia Y et al. , Nucleic Acids Res . 33 pp. 2697-2706 (2005). As described above, methods for creating modified miR-200b polynucleotides are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-200b nucleic acid forms are considered herein to be within the scope of the terms "miR-200b mimics" or "modified miR-200b" as used herein.
[0176] Typically, the modified miR-200b (i.e., miR-200b mimic) contains no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-200b sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-200b mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0177] In some embodiments, at least one U base in the miR-200b sequence, whether in the native portion and / or the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0178] In other embodiments, exactly one U base in the miR-200b mimic sequence is a 5-halouracil. In a second group of embodiments, exactly or at least two U bases in the miR-200b sequence are 5-halouracils. In another group of embodiments, exactly or at least three U bases in the miR-200b oligonucleotide sequence are 5-halouracils. In other embodiments, exactly or at least four U bases in the miR-200b sequence are 5-halouracils. In other embodiments, exactly or at least five U bases in the miR-200b sequence are 5-halouracils. In other embodiments, exactly or at least six U bases in the miR-200b sequence are 5-halouracils. In specific embodiments, all U bases in the miR-200b sequence, whether in the native portion and / or the additional portion, are 5-halouracils.
[0179] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-200b nucleotide sequence U F AAU F ACU F GCCU F GGU F AAU F GAU F GA [SEQ ID NO. 22], where U F It is a halogenated uracil, specifically 5-fluorouracil.
[0180] The U base substituted with 5-halouracil in the modified miR-200b sequence can be located in the unmodified portion of the miR-200b sequence, as provided above, or can be located in one or more uracil bases appended to the native miR-200b sequence, as provided above.
[0181] In other embodiments, the seed portion of the native miR-200b nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-200b nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0182] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-200c nucleotide sequence. In some embodiments, the miR-200c nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0183] As used herein, the term "miR-200c" is intended to be synonymous with the term "microRNA-200c" or "miRNA-200c" and refers to an oligonucleotide having the following nucleotide sequence: UAAUACUGCCGGGUAAUGAUGGA [SEQ ID NO. 23]. The foregoing nucleotide sequence is referred to herein as the unmodified (i.e., "native") sequence of miR-200c, unless otherwise indicated. In other embodiments, miR-200c may also be referred to herein as hsa-miR-200c, having accession number MI0000650 for a double-stranded microRNA containing a stem-loop; hsa-miR-200c-5p, for the 5' to 3' strand of the mature miR, as set forth in accession number MIMAT00004657; and hsa-miR-200c-3p, for the 3' to 5' complementary strand of the duplex miR-200c molecule, as set forth in accession number MIMAT0000617. MiR-200c is well known and has been studied in detail. See, for example, Landgraf P et al., Cell . 129 pp. 1401-1414 (2007). As described above, methods for creating modified miR-200c polynucleotides are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-200c nucleic acid forms are considered herein to be within the scope of the terms "miR-200c mimics" or "modified miR-200c" as used herein.
[0184] Typically, the modified miR-200c (i.e., miR-200c mimic) contains no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-200c sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-200c mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0185] In some embodiments, at least one U base in the miR-200c sequence, whether in the native portion and / or the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0186] In other embodiments, exactly one U base in the miR-200c mimic sequence is a 5-halouracil. In a second group of embodiments, exactly or at least two U bases in the miR-200c sequence are 5-halouracils. In another group of embodiments, exactly or at least three U bases in the miR-200c oligonucleotide sequence are 5-halouracils. In other embodiments, exactly or at least four U bases in the miR-200c sequence are 5-halouracils. In other embodiments, exactly or at least five U bases in the miR-200c sequence are 5-halouracils. In specific embodiments, all U bases in the miR-200c sequence, whether in the native portion and / or the additional portion, are 5-halouracils.
[0187] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-200c nucleotide sequence U F AAU F ACU F GCCGGGU F AAU F GAU F GGA [SEQ ID NO. 24], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0188] The U base substituted with 5-halouracil in the modified miR-200c sequence can be located in the unmodified portion of the miR-200c sequence, as provided above, or can be located in one or more uracil bases appended to the native miR-200c sequence, as provided above.
[0189] In other embodiments, the seed portion of the native miR-200c nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-200c nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0190] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-145 nucleotide sequence. In some embodiments, the miR-145 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0191] As used herein, the term "miR-145" is intended to be synonymous with the term "microRNA-145" or "miRNA-145," and refers to an oligonucleotide having the following nucleotide sequence: GUCCAGUUUUCCCAGGAAUCCCU [SEQ ID NO. 25], wherein it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is referred to herein as the miR-145 unmodified (i.e., "native") sequence, unless otherwise indicated. In some embodiments, miR-145 may be referred to as hsa-miR-145, having accession number MI0000461 for the double-stranded microRNA containing a stem-loop; hsa-miR-145-5p, for the mature miR 5' to 3' strand, as set forth in accession number MIMAT0000437; and hsa-miR-145-3p, for the 3' to 5' complementary strand of the duplex miR-145 molecule, as set forth in accession number MIMAT0004601. MiR-145 is well known and has been studied in detail. See, for example, Landgraf P et al., Cell . 129 pp. 1401-1414 (2007). As described above for exemplary mimics miR-129, miR-140, miR-192, 200a, 200b, 200c, miR-34, and miR-15a, methods for creating miR-145 mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-145 nucleic acid forms are considered herein to be within the scope of the term "miR-145 mimics" as used herein.
[0192] Typically, the modified miR-145 (i.e., miR-145 mimic) contains no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-145 sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-145 mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0193] In some embodiments, at least one U base in the miR-145 sequence, whether in the native portion and / or the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0194] In another set of embodiments, exactly one U base in the miR-145 mimic sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-145 sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-145 oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-145 sequence are 5-halouracil. In other embodiments, exactly or at least five U bases in the miR-145 sequence are 5-halouracil. In other embodiments, exactly or at least six U bases in the miR-145 sequence are 5-halouracil. In specific embodiments, all U bases in the miR-145 sequence, whether in the native portion and / or the additional portion, are 5-halouracil.
[0195] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-145 nucleotide sequence GU F CCAGU F U F U F U F CCCAGGAAU F CCCU F [SEQ ID NO. 26], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0196] The U base substituted with 5-halouracil in the miR-145 mimetic sequence can be located in the unmodified portion of the miR-145 sequence, as provided above, or can be located in one or more uracil bases appended to the native miR-145 sequence, as provided above.
[0197] In other embodiments, the seed portion of the native miR-145 nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-145 nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0198] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-194 nucleotide sequence. In some embodiments, the miR-194 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0199] As used herein, the term "miR-194" is intended to be synonymous with the term "microRNA-194" or "miRNA-194" and refers to an oligonucleotide having the following nucleotide sequence: UGUAACAGCAACUCCAUGUGGA [SEQ ID NO. 27]. The foregoing nucleotide sequence is referred to herein as the unmodified (i.e., "native") sequence of miR-194, unless otherwise indicated. In some embodiments, miR-194 may be referred to in the art as hsa-miR-194, with accession numbers MI0000488 or MI0000732 for double-stranded microRNA containing a stem-loop; hsa-miR-94-5p, for the mature miR 5' to 3' strand, as shown in accession number MIMAT0000460; and hsa-miR-194-3p, for the 3' to 5' complementary strand of the duplex molecule, as shown in accession number MIMAT0004671. MiR-194 is well known and has been studied in detail. See, e.g., Lagos-Quintana M et al. RNA 9: pp. 175-179 (2003). As with the modified microRNAs described above, methods for creating miR-194 mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-194 nucleic acid forms are considered herein to be within the scope of the term "miR-194 mimics," as used herein.
[0200] Typically, the modified miR-194 (i.e., miR-194 mimic) contains no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-194 sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-194 mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0201] In some embodiments, at least one U base in the miR-194 sequence, whether in the native portion and / or the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0202] In another set of embodiments, exactly one U base in the miR-194 mimic sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-194 sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-194 oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-194 sequence are 5-halouracil. In a specific embodiment, all U bases in the miR-194 sequence, whether in the native portion and / or the appended portion, are 5-halouracil.
[0203] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-194 nucleotide sequence U F GU F AACAGCAACU F CCAU F GU F GGA [SEQ ID NO. 28], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0204] The U base substituted with 5-halouracil in the miR-194 mimic sequence can be located in the unmodified portion of the miR-194 sequence, as provided above, or can be located in one or more uracil bases appended to the native miR-194 sequence, as provided above.
[0205] In other embodiments, the seed portion of the native miR-194 nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-194 nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0206] In another exemplary embodiment, the present disclosure relates to a nucleic acid composition comprising a modified miR-let-7 nucleotide sequence. In some embodiments, the miR-let-7 nucleotide sequence has been modified by replacing at least one U base with a 5-halouracil.
[0207] As used herein, the term "miR-let-7" is intended to be synonymous with the term "microRNA-let-7" or "miRNA-let-7" and refers to an oligonucleotide having the following nucleotide sequence: UGAGGUAGUAGGUUGUAUAGUU [SEQ ID NO. 29]. The foregoing nucleotide sequence is referred to herein as the miR-let-7 unmodified (i.e., "native") sequence, unless otherwise indicated. In other embodiments, miR-let-7 may also be referred to herein as hsa-miR-let-7a-1, having accession number MI0000060 for a double-stranded microRNA containing a stem-loop; hsa-miR-let-7a-5p, for the 5' to 3' strand of the mature miR, as set forth in accession number MIMAT0000062; and hsa-miR-let-7a-3p, for the 3' to 5' complementary strand of the duplex miR-129 molecule, as set forth in accession number MIMAT0004481. MiR-let-7 is well known and has been studied in detail, for example, Kasashima K et al. Biochem Biophys Res Commun. 322 pp. 403-410 (2004). As described above for the exemplary modified microRNAs described herein, methods for creating miR-let-7 mimics are known to those of ordinary skill in the art. Unless otherwise indicated, all such modified miR-let-7 nucleic acid forms are considered herein to be within the scope of the term "miR-let-7 mimics" as used herein.
[0208] Typically, the modified miR-let-7 (i.e., miR-let-7 mimic) contains no more than 1, 2, 3, 4, or 5 additional nucleotides covalently appended to the native miR-let-7 sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, miR-let-7 mimics are used in single-stranded form, but double-stranded versions are also contemplated herein.
[0209] In some embodiments, at least one U base in the miR-let-7 sequence, whether in the native portion and / or the appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0210] In another set of embodiments, exactly one U base in the miR-let-7 mimic sequence is a 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the miR-let-7 sequence are 5-halouracil. In another set of embodiments, exactly or at least three U bases in the miR-let-7 oligonucleotide sequence are 5-halouracil. In other embodiments, exactly or at least four U bases in the miR-let-7 sequence are 5-halouracil. In other embodiments, exactly or at least five U bases in the miR-let-7 sequence are 5-halouracil. In other embodiments, exactly or at least six U bases in the miR-let-7 sequence are 5-halouracil. In other embodiments, exactly or at least seven U bases in the miR-let-7 sequence are 5-halouracil. In a specific embodiment, all U bases in the miR-let-7 sequence, whether in the native portion and / or the appended portion, are 5-halouracil.
[0211] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-let-7 nucleotide sequence U F GAGGU F AGU F AGGU F U F GU F AU F AGU F U F [SEQ ID NO. 30], wherein U F It is a halogenated uracil, specifically 5-fluorouracil.
[0212] The U base replaced by 5-halouracil in the miR-let-7 mimic sequence can be located in the unmodified portion of the miR-let-7 sequence, as provided above, or can be located in one or more uracil bases appended to the native miR-let-7 sequence, as provided above.
[0213] In other embodiments, the seed portion of the native miR-let-7 nucleotide sequence remains unmodified with 5-halouracil, while one or more (or all) of the remaining U bases in the remainder (non-seed portion) of the miR-let-7 nucleotide sequence are substituted with 5-halouracil or a combination thereof.
[0214] The microRNA nucleic acid compositions of modification as described herein can be synthesized using any well-known method for synthesizing nucleic acid.In a specific embodiment, nucleic acid compositions is synthesized by automated oligonucleotides, and for example, any well-known process of using phosphoramidite chemistry produces.In order to introduce one or more 5-halogenated uracil bases in the miR sequence (for example, miR-15a sequence, miR-140 sequence, miR-192 sequence, miR-502 sequence, miR-506 sequence, miR-34 sequence, miR-200a sequence, miR-200b sequence, miR-200c sequence, miR-145 sequence, miR-194 sequence or miR-let-7 sequence) of modification, 5-halogenated uracil nucleoside phosphoramidites can be included together with the phosphoramidite derivatives of the nucleoside comprising the natural base to be included in the nucleotide sequence (for example, A, U, G and C).
[0215] In some embodiments, the nucleic acid compositions of the present disclosure can be produced biosynthetically, for example, by using in vitro RNA transcription from plasmids, PCR fragments, or synthetic DNA templates, or by using recombinant (in vivo) RNA expression methods. See, for example, CM Dunham et al., Nature Method , (2007) 4(7), pp. 547-548. The modified microRNA sequences of the present disclosure (e.g., miR-15a sequence, miR-140 sequence, miR-192 sequence, miR-502 sequence, miR-506 sequence, miR-34 sequence, miR-200a sequence, miR-200b sequence, miR-200c sequence, miR-145 sequence, miR-194 sequence, or miR-let-7 nucleotide sequence) can be further chemically modified, for example, by functionalization with polyethylene glycol (PEG) or hydrocarbons or targeting agents, particularly cancer cell targeting agents such as folic acid, using techniques well known in the art. To include such groups, the oligonucleotide sequence can first include reactive groups (e.g., amino, aldehyde, sulfhydryl, or carboxylate groups) that can be used to attach the desired functional groups. While such reactive or functional groups can be incorporated into the nucleic acid sequences thus produced, reactive or functional groups can be more readily included through the use of automated oligonucleotide synthesis in which non-nucleoside phosphoramidites are included that contain the reactive group or reactive precursor group.
[0216] Modified nucleic acid preparations
[0217] The present disclosure reveals that each of the modified microRNAs exhibits potent efficacy as anticancer therapies. Significantly, each modified microRNA nucleic acid composition tested reduced cancer cell proliferation, tumor growth, and development in a dose-dependent manner across all six cancer types examined by inducing cell cycle arrest.
[0218] Therefore, the present disclosure also relates to the preparation of the modified microRNA nucleic acid composition described herein. For example, the present nucleic acid composition can be formulated for medical use. In certain embodiments, the preparation is a pharmaceutical composition comprising the nucleic acid composition described herein and a pharmaceutically acceptable carrier. In other embodiments, the preparation of the present disclosure comprises modified miR-129 nucleic acid, modified miR-15a nucleic acid, modified miR-140 nucleic acid, modified miR-192 nucleic acid, modified miR-502, modified miR-506 nucleic acid, modified miR-34 nucleic acid, modified miR-200a nucleic acid, modified miR-200b, modified miR-200c nucleic acid, modified miR-194 nucleic acid, modified miR-let-7 nucleic acid or a combination thereof and a pharmaceutically acceptable carrier.
[0219] More specifically, one or more modified microRNA nucleic acids shown in the following nucleotide sequences can be formulated for pharmaceutical applications and uses: F U F U F U F U F GCGGU F CU F GGGCU F U F GC [SEQ ID NO. 4],CUUUUUGCGGU F CU F GGGCU F U F GC [SEQ ID NO. 5], U F AGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO.6], UAGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO. 7], CAGU F GGUUUUACCCU F AUGGU F AG [SEQ ID NO. 9], CU F GACCU F AU F GAAU F UF GACAGCC [SEQ ID NO. 11]、AU F CCU F U F GCUAU F CU F GGGU F GCU F A[SEQ ID NO. 13]、U F AU F U F LAST F GU F U F ACU F U F AA [SEQ ID NO. 15]、CHANGE F GGU F U F U F U F ACCCU F AU F GGU F AG [SEQ ID NO. 16]、UFGGGQUEQUEQUE[SEQ ID NO. 18]、U F ACACU F GU F CU F GGU F AACGAU F GU F [SEQ ID NO. 20]、U F AAU F ACU F GCCU F GGU F AAU F GAU F GA [SEQ ID NO. 22]、U F AAU F ACU F GCCGGGU F AAU F GAU F GGA [SEQID NO. 24]、GU F CCAGU F U F U F U F CCCAGGAAU F CCCU F[SEQ ID NO. 26]、U F GU F AACAGCAACU F CCAU F GU F GGA [SEQ ID NO. 28], U F GAGGU F AGU F AGGU F U F GU F AU F AGU F U F [SEQID NO. 30].
[0220] The term "pharmaceutically acceptable carrier" is used synonymously herein with a pharmaceutically acceptable diluent, solvent, or excipient. Depending on the type of pharmaceutical composition and the intended mode of administration, the nucleic acid composition may be dissolved or suspended (e.g., as an emulsion) in a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier may be any liquid or solid compound, material, composition, and / or dosage form that is suitable, within the scope of sound medical judgment, for use in contact with the tissues of a subject. A carrier should be "acceptable" in the sense that it is not harmful to the subject to which it is being provided and is compatible with the other ingredients of the formulation (i.e., does not alter its biological or chemical function).
[0221] Some non-limiting examples of materials that can be used as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; gelatin; talc; waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as ethylene glycol and propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl dodecanoate; agar; buffers; water; isotonic saline; pH buffered solutions, and other non-toxic compatible substances used in pharmaceutical formulations. Pharmaceutically acceptable carriers may also include manufacturing aids (e.g., lubricants, talc, magnesium stearate, calcium stearate, zinc stearate, or stearic acid), solvents, or encapsulating materials. If desired, certain sweeteners and / or flavorings and / or coloring agents may also be added. Other suitable excipients can be found in standard pharmaceutical texts, such as "Remington's Pharmaceutical Sciences", The Science and Practice of Pharmacy, 19th ed. Mack Publishing Company, Easton, Pa., (1995).
[0222] In some embodiments, the pharmaceutically acceptable carrier may include a diluent, which increases the bulk of the solid pharmaceutical composition and makes the dosage form easier for the patient and caregiver to handle. Diluents for solid compositions include, for example, microcrystalline cellulose (e.g., Avicel ® ), microcellulose, lactose, starch, pregelatinized cellulose, calcium carbonate, calcium sulfate, sugar, dextrates, dextrin, dextrose, dibasic calcium phosphate dihydrate, tribasic calcium phosphate, kaolin, magnesium carbonate, magnesium oxide, maltodextrin, mannitol, polymethacrylates (e.g., Eudragit ® ), potassium chloride, powdered cellulose, sodium chloride, sorbitol, and talc.
[0223] The nucleic acid compositions of the present disclosure can be formulated into compositions and dosage forms according to methods known in the art. In certain embodiments, the formulated compositions can be specifically formulated for administration in solid or liquid forms, including those suitable for: (1) oral administration, e.g., tablets, capsules, powders, granules, pastes for application to the tongue, aqueous or non-aqueous solutions or suspensions, infusions, or syrups; (2) parenteral administration, e.g., as a sterile solution or suspension by subcutaneous, intramuscular, or intravenous injection; (3) topical administration, e.g., as a cream, ointment, or spray applied to the skin, lungs, or mucous membranes; or (4) intravaginally or intrarectally, e.g., as a pessary, cream, or foam; (5) sublingually or buccally; (6) ocularly; (7) transdermally; or (8) nasally.
[0224] In some embodiments, the formulations of the present disclosure include solid pharmaceutical dosage forms compacted into dosage forms such as tablets, which may include excipients whose functions include helping the active ingredient and other excipients to bind together after compression. Binders for solid pharmaceutical compositions include gum arabic, alginic acid, carbomers (e.g., carbopol), sodium carboxymethylcellulose, dextrin, ethylcellulose, gelatin, guar gum, hydrogenated vegetable oils, hydroxyethylcellulose, hydroxypropylcellulose (e.g., Klucel ® ), hydroxypropyl methylcellulose (such as Methocel ® ), liquid glucose, magnesium aluminum silicate, maltodextrin, methylcellulose, polymethacrylate, povidone (e.g., Kollidon ® 、Plasdone ® ), pregelatinized starch, sodium alginate and starch.
[0225] The dissolution rate of a compacted solid pharmaceutical composition in the stomach of a subject can be increased by adding a disintegrant to the composition. Disintegrants include alginic acid, carboxymethylcellulose calcium, carboxymethylcellulose sodium (e.g., Ac-Di-Sol ® ,Primellose® ), colloidal silicon dioxide, croscarmellose sodium, crospovidone (e.g. Kollidon ® 、Polyplasdone ® ), guar gum, magnesium aluminum silicate, methylcellulose, microcrystalline cellulose, polacrilin potassium, powdered cellulose, pregelatinized starch, sodium alginate, sodium starch glycolate (e.g., Explotab ® ) and starch.
[0226] Therefore, in certain embodiments, a glidant may be added to the formulation to improve the flowability of the non-compacted solid dosage form and to improve the accuracy of the dosage. Excipients that may function as glidants include colloidal silicon dioxide, magnesium trisilicate, powdered cellulose, starch, talc, and trivalent calcium phosphate.
[0227] When making dosage forms such as tablets by compacting powdered compositions, compositions are subjected to pressure from punches and dyes. Some excipients and active ingredients have a tendency to adhere to punches and dye surfaces, which can cause the product to have pitting and other surface irregularities. Lubricants can be added to the compositions to reduce adhesion and make the product easy to discharge from the dye. Lubricants include magnesium stearate, calcium stearate, glyceryl monostearate, palmitoyl stearate, hydrogenated castor oil, hydrogenated vegetable oil, mineral oil, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, sodium stearyl fumarate, stearic acid, talc and zinc stearate.
[0228] Pharmaceutical compositions formulated for tableting or capsule filling can be prepared by wet granulation. In wet granulation, some or all of the active ingredients and excipients in powder form are mixed and then further mixed in the presence of a liquid, usually water, that causes the powders to agglomerate into granules. The granules are screened and / or milled, dried, and then screened and / or milled to the desired particle size. The granules can then be tableted, or other excipients, such as glidants and / or lubricants, can be added before tableting. Tabletted compositions can be prepared by dry mixing. For example, the mixed active substance and excipient composition can be compacted into small pieces or flakes and then pulverized into compacted granules. The compacted granules can then be compressed into tablets.
[0229] In other embodiments, as an alternative to dry granulation, the mixed composition can be compressed directly into a compacted dosage form using direct compression technology. Direct compression produces a more uniform tablet without particles. Excipients that are particularly well suited for direct compression tableting include microcrystalline cellulose, spray-dried lactose, dibasic calcium phosphate dihydrate, and colloidal silicon dioxide. The appropriate use of these and other excipients in direct compression tableting is known in the art to those who have experience and skill in the special formulation challenges of direct compression tableting. Capsule filling can include any of the aforementioned blends and granules described for tableting; however, it does not undergo the final tableting step.
[0230] In the liquid pharmaceutical composition of the present disclosure, reagent and any other solid excipient are dissolved or suspended in liquid carrier for example water, water for injection, vegetable oil, alcohol, polyethylene glycol, propylene glycol or glycerol.Liquid pharmaceutical composition can comprise emulsifying agent to disperse active component or other excipient that is insoluble in liquid carrier equably in whole composition.Liquid preparation can be used as the preparation of injectable, enteric or softener type and use.The emulsifying agent that can be used in liquid composition of the present invention comprises for example gelatin, egg yolk, casein, cholesterol, gum arabic, tragacanth, carrageenan, pectin, methylcellulose, carbomer, cetostearyl alcohol mixture and cetyl alcohol.
[0231] In some embodiments, the liquid pharmaceutical composition of the present disclosure may also include a viscosity increasing agent to improve the mouthfeel of the product and / or coat the lining of the gastrointestinal tract. Such reagent includes gum arabic, alginic acid, bentonite, carbomer, carboxymethylcellulose calcium or sodium, cetostearyl alcohol mixture, methylcellulose, ethylcellulose, gelatin, guar gum, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, maltodextrin, polyvinyl alcohol, polyvidone, propylene carbonate, propylene glycol alginate, sodium alginate, sodium starch glycolate, starch, tragacanth and xanthan gum. In other embodiments, the liquid composition of the present disclosure may also include a buffer, for example gluconic acid, lactic acid, citric acid or acetic acid, sodium gluconate, sodium lactate, sodium citrate or sodium acetate.
[0232] Sweeteners such as sorbitol, saccharin, saccharin sodium, sucrose, aspartame, fructose, sorbitol, and invert sugar may be added to certain formulations of the present disclosure to improve taste. Flavoring agents and flavor enhancers may make the dosage form more palatable to the patient. Common flavoring agents and flavor enhancers for pharmaceuticals that may be included in the compositions of the present disclosure include maltol, vanillin, ethyl vanillin, menthol, citric acid, fumaric acid, ethyl maltol, and tartaric acid.
[0233] Preservatives and chelating agents, such as alcohol, sodium benzoate, butylated hydroxytoluene, butylated hydroxyanisole, and ethylenediaminetetraacetic acid, may be added at levels safe for ingestion to improve storage stability. Solid and liquid compositions may also be dyed using any pharmaceutically acceptable colorant to improve their appearance and / or facilitate patient identification of the product and unit dosage level.
[0234] The dosage formulation of the present disclosure can be a capsule containing a composition, such as a powdered or granular solid composition of the present disclosure, in a hard or soft shell. The shell can be made of gelatin, optionally containing a plasticizer such as glycerol and sorbitol, and an opacifier or colorant.
[0235] Methods for treating cancer
[0236] As described above, compared to the exogenous expression of the corresponding unmodified natural microRNA and / or known cancer therapies (chemotherapy) such as 5-FU, the modified microRNA nucleic acid compositions of the present disclosure and their preparations show unexpected and outstanding anti-cancer activity. Therefore, another aspect of the present disclosure provides a method for treating cancer in mammals by administering an effective amount of one or more modified microRNA nucleic acid compositions of the present disclosure or their preparations to a mammal.
[0237] like Figure 2A and 8A As shown in , exemplary modified microRNA nucleic acids of the present disclosure, namely modified miR-15a and modified miR-129, inhibit BCL2 expression and activity in cancer cells of a subject, which results in an increased amount of available pro-apoptotic proteins, which ultimately leads to increased cancer cell death. For example, miR-129 regulates apoptosis by directly targeting BCL2 as well as by affecting other key cell death-related proteins. Further, Figure 2A miR-129 was shown to reduce the expression and therefore activity of E2F3, a transcription factor protein that regulates cell cycle progression and reduces the expression or activity of thymidylate synthase (TS) protein levels, which leads to increased cell proliferation and increased efficacy of chemotherapeutic agents.
[0238] In addition, and as shown in Figures 12A-12D, 13A-13B and 14A-14, all exemplary modified microRNAs regulate cancer cell proliferation and induce cancer cell apoptosis. More specifically, modified miR-15a has been shown to reduce cancer cell proliferation in the following experimental models: pancreatic cancer cells ( Figures 12A-12B and 14A), lung cancer (Figures 12D and 14D), colorectal cancer ( Figure 8B ), gastric cancer (Figure 14B), breast cancer (Figure 14C), and blood cancers, namely leukemia ( Figure 14E ). In addition, modified miR-129 has been shown to reduce cancer cell proliferation in the following experimental models: pancreatic cancer cells (Figure 14A), lung cancer (Figures 12C and 14D), colorectal cancer ( Figure 3 ), gastric cancer (Figure 14B), breast cancer (Figure 14C), and blood cancers, namely leukemia ( Figure 14E Modified miR-192 and modified miR-140 have also demonstrated the ability to reduce cancer cell proliferation in experimental models of pancreatic cancer ( FIG. 14A ), lung cancer ( FIG. 14D ), colorectal cancer ( FIG. 13A-13B ), gastric cancer ( FIG. 14B ), breast cancer ( FIG. 14C ), and hematologic cancers, namely leukemia ( Figure 14E). In addition, each modified microRNA of the present disclosure (i.e., modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194, and miR-let-7) inhibited cancer cell proliferation in all of the following experimental cancer models: pancreatic cancer ( FIG. 14A ), gastric cancer ( FIG. 14B ), breast cancer ( FIG. 14C ), lung cancer ( FIG. 14D ), and hematological cancer ( FIG. 14E ). Figure 14E ).
[0239] Furthermore, the modified miR compositions of the present invention were tested and found to be therapeutically effective in vivo. For example, Figure 7 and 11 Intravenous treatment with two exemplary modified microRNAs of the present disclosure (e.g., modified miR-129 and modified miR-15a) was shown to effectively treat cancer (e.g., colorectal cancer) by inhibiting tumor growth and development in vivo.
[0240] Thus, disclosed methods for treating cancer include administering one or more modified nucleic acid compositions of the present disclosure (e.g., modified microRNAs, such as modified miR-129 nucleic acids, modified miR-15a nucleic acids, modified miR-140 nucleic acids, modified miR-192 nucleic acids, modified miR-502, modified miR-506 nucleic acids, modified miR-34 nucleic acids, modified miR200a nucleic acids, modified miR-200b nucleic acids, modified miR-200c nucleic acids, modified miR-145 nucleic acids, modified miR-194 nucleic acids, modified miR-let-7 nucleic acids, or combinations thereof) to a subject. In certain embodiments, the nucleic acid composition can be administered as a formulation comprising the nucleic acid composition and one or more pharmaceutically acceptable carriers.
[0241] In specific embodiments, the nucleic acid compositions of the present disclosure can be administered without a delivery vehicle or pharmaceutical carrier (ie, naked). See, e.g., Figures 17A-17B .
[0242] As used herein, the term "subject" refers to any mammal. The mammal can be any mammal, although the methods herein more typically involve humans. As used herein, the phrase "subject in need thereof" is included within the term subject and refers to any mammalian subject in need of treatment, particularly cancer or a medically determined increased risk of a cancerous or precancerous condition. In specific embodiments, the subject includes a human cancer patient.
[0243] In some embodiments, the human subject has colorectal cancer or has a medically determined increased risk of developing colorectal cancer.
[0244] In other embodiments, the subject has pancreatic cancer, or has a medically determined increased risk of developing pancreatic cancer, eg, diagnosed with chronic pancreatitis.
[0245] In certain embodiments, the subject of the present disclosure has breast cancer, or has a medically determined increased risk of developing breast cancer. In specific embodiments, the breast cancer is triple-negative breast cancer, ductal carcinoma, or lobular carcinoma.
[0246] In some embodiments, the subject has a blood cancer or has a medically determined increased risk of developing a blood cancer. In specific embodiments, the blood cancer is a leukemia. In one embodiment, the leukemia is acute lymphoblastic leukemia.
[0247] In other embodiments, the subject has gastric cancer, or has a medically determined increased risk of developing gastric cancer.In one embodiment, the gastric cancer treated is a cancer of the stomach.
[0248] The terms "treatment," "treat," and "treating" are synonymous with the term "administering an effective amount." These terms shall mean the medical management of a subject with the intent to cure, ameliorate, stabilize, reduce one or more symptoms of, or prevent a disease, pathological condition, or disorder, such as cancer. These terms are used interchangeably and include active treatment, i.e., treatment specifically directed toward improving a disease, pathological condition, or disorder, as well as causal treatment, i.e., treatment directed toward removing the cause of the relevant disease, pathological condition, or disorder. Additionally, treatment includes palliative care, i.e., treatment designed to relieve symptoms rather than cure a disease, pathological condition, or disorder; prophylactic treatment, i.e., treatment directed toward minimizing or partially or completely inhibiting the development of the relevant disease, pathological condition, or disorder; and supportive care, i.e., treatment that supplements another specific therapy directed toward improving the relevant disease, pathological condition, or disorder. It should be understood that while treatment is intended to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder, it is not necessary that the treatment actually results in a cure, amelioration, stabilization, or prevention. The effect of treatment can be measured or assessed as described herein and as known in the art, as appropriate for the disease, pathological condition or disorder involved. Such measurement and assessment can be performed in qualitative and / or quantitative terms. Thus, for example, a characteristic or feature of a disease, pathological condition or disorder and / or a symptom of a disease, pathological condition or disorder can be reduced to any effect or to any quantity. In specific embodiments, treatment of a disease, such as cancer, comprises inhibiting the proliferation of cancer cells. In some embodiments, treatment of cancer can be determined by detecting a decrease in the amount of proliferating cancer cells, a decrease in tumor growth or a decrease in tumor size in a subject.
[0249] In certain embodiments, the nucleic acid compositions of the present disclosure are used to treat cancer.
[0250] As used herein, the term "cancer" includes any disease caused by the uncontrolled division and growth of abnormal cells, including, for example, malignant and metastatic growth of tumors. The term "cancer" also includes precancerous conditions or conditions characterized by an increased risk of cancer or precancerous conditions. Cancer or precancerous conditions (tumor conditions) can be located in any part of the body, including internal organs and skin. As is well known, cancer spreads through the blood by invading the normal non-cancerous tissues surrounding the tumor, through lymph nodes and blood vessels, and after the tumor invades the veins, capillaries, and arteries of the subject. When cancer cells leave ("metastasis") from the primary tumor, secondary tumors are generated throughout the affected subject, forming metastases.
[0251] Some non-limiting examples of cancer cells that may be suitable for treatment using the methods of the present invention include colon, rectum (including anus), stomach, esophagus, kidney, prostate, skin, lung, breast, pancreas, brain, blood, and liver. Cancer or tumors may also include the presence of one or more carcinomas, sarcomas, lymphomas, blastomas, or teratomas (germ cell tumors). In some embodiments, cancer may also be in the form of leukemia.
[0252] In specific embodiments, the nucleic acid compositions described herein are used to treat any stage of colorectal (ie, colon or rectal) cancer, pancreatic cancer, breast cancer, gastric cancer, lung cancer, or hematological cancer, as further described below.
[0253] For example, there are four stages of colorectal cancer, which are generally characterized by the degree of metastasis. In stage 0, or carcinoma in situ, abnormal, potentially cancerous cells are present in the mucosa (innermost layer) of the colon wall. In stage I, cancerous cells form in the mucosa of the colon wall and have spread to the submucosa (the layer of tissue beneath the mucosa) and may have spread to the muscle layer of the colon wall. Stage II consists of three subclasses: stage IIA, in which cancerous tissue has spread through the muscle layer of the colon wall to the serosa (outermost layer) of the colon wall; stage IIB, in which the tumor has spread through the serosa of the colon wall but has not yet spread to nearby organs; and stage IIC, in which the cancer has spread through the serosa of the colon wall and invaded nearby organs. Stage III is also divided into three subcategories: Stage IIIA, in which the cancer may have spread through the mucosa of the colon wall to the submucosa and muscle layer and has spread to 1-3 nearby lymph nodes or tissue near the lymph nodes; or the cancer has spread through the mucosa to the submucosa and 4-6 nearby lymph nodes; Stage IIIB, in which the tumor has spread through the muscle layer of the colon wall to the serosa or has spread through the serosa but not to nearby organs and the cancer has spread to 1-3 nearby lymph nodes or tissue near the lymph nodes; or has spread to the muscle layer or to the serosa, and to 4-6 nearby lymph nodes; or has spread through the mucosa to the submucosa and may have spread to the muscle layer and has spread to 7 or more nearby lymph nodes. In stage IIIC colorectal cancer, the tumor has spread through the serosa of the colon wall but not to nearby organs and the cancer has spread to 4-6 nearby lymph nodes; or the cancer has spread through the muscle layer to the serosa or has spread through the serosa but not to nearby organs and the cancer has spread to 7 or more nearby lymph nodes; or the cancer has spread through the serosa to nearby organs and to one or more nearby lymph nodes or to tissue near the lymph nodes. Finally, stage IV colon cancer is divided into two subcategories: stage IVA, in which the cancer has spread through the colon wall and into nearby organs and one organ not near the colon or to distant lymph nodes; and stage IVB, in which the cancer has spread through the colon wall and into nearby organs and more than one organ not near the colon or into the lining of the abdominal wall.
[0254] Yet another example of tumor staging includes the Dukes classification system for colorectal cancer. Here, the stages are identified as Stage A, in which the tumor is confined to the intestinal wall; Stage B, in which the tumor shows invasion through the intestine but has not yet invaded the lymph nodes; Stage C, in which cancerous cells or tissue are found in the subject's lymph nodes; and Stage D, in which the tumor shows widespread metastasis into several organs of the subject.
[0255] Alternatively, the Astler Coller classification system may be used. Here, stage A colorectal cancer is identified as cancer present only in the mucosa of the intestine; stage B1, in which the tumor extends into the muscularis propria but has not penetrated the muscularis propria and the tumor has not metastasized into the lymph nodes, stage B2 colorectal cancer is denoted as a tumor that has penetrated the muscularis propria and the tumor has not metastasized into the lymph nodes; stage C1 is characterized by a tumor that extends into the muscularis propria but has not penetrated the muscularis propria and the tumor has metastasized into the lymph nodes; stage C2 colorectal cancer is classified as a tumor that has penetrated the muscularis propria, where the tumor has metastasized into the lymph nodes; and stage D describes a tumor that has metastasized throughout the organism or subject.
[0256] In some embodiments, the therapeutic methods of the present disclosure are more specifically directed to cancer subjects that exhibit reduced levels of miR-129 expression, miR-15a expression, miR-506 expression, miR-502, miR-140, or a combination thereof. In this regard, miR-15a is known to be downregulated in cancer. See, e.g., RI Aqeilan, et al., Cell Death and Differentiation (2010) 17, pp. 215–220. Furthermore, cancerous cells with reduced miR-129 expression are known to be resistant to 5-fluorouracil, as described, for example, in U.S. Application Publication No. 2016 / 0090636, the contents of which are incorporated by reference in their entirety. Additionally, pancreatic cancer cells are known to exhibit reduced levels of miR-506. See, for example, Li, J, et al. Oncogene. 35, pp. 5501–5514.
[0257] In yet another example, the microRNA mimics of the present disclosure are used to treat pancreatic cancer. As shown in Figures 14A and 15A-15B, modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194 and miR-let-7 can each be used to treat pancreatic cancer. Pancreatic cancer originates from a precursor lesion called pancreatic intraepithelial neoplasia or PanIN. These lesions are typically located in the ducts of the exocrine pancreas and can be divided into low-grade dysplasia, moderate dysplasia or high-grade dysplasia lesions according to the degree of cellular atypia. Such lesions typically show the presence of KRSAActivating mutations in genes, together with some inactivating mutations in CDKN2A, TP53 and SMAD4. These gene mutations together lead to the formation of invasive cancer. Pancreatic cancer is staged based on the size of the primary tumor and whether it has grown to the outside of the pancreas and entered the surrounding organs, whether the tumor has spread to the lymph nodes in the vicinity and whether it has metastasized to other organs of the body (for example, liver, lung, abdomen). This information is then combined and used to provide specific stages, i.e. 0, 1A, 1B, 2A, 2B, 3 and 4. For stage zero (0), pancreatic tumors are confined to the top layer of pancreatic duct cells and have not yet invaded deeper tissues. The primary tumor has not yet spread to the outside of the pancreas, such as in pancreatic cancer in situ or pancreatic intraepithelial neoplasia III. Stage 1A pancreatic tumors are generally confined to the pancreas and 2 cm wide or less. Further, stage 1A pancreatic tumors have not yet spread to lymph nodes in the vicinity or distal sites. Stage 1B pancreatic tumors are confined to the pancreas and are greater than 2 cm wide. Stage 1B pancreatic tumors have not spread to nearby lymph nodes or distant sites. Stage 2A pancreatic tumors show tumors that have grown outside the pancreas but have not entered major blood vessels or nerves, but the cancer has not spread to nearby lymph nodes or distant sites. Subjects displaying Stage 2B pancreatic cancer present with tumors that are confined to the pancreas or that have grown outside the pancreas but have not entered major blood vessels or nerves but have spread to nearby lymph nodes. Subjects displaying Stage 3 pancreatic cancer present with tumors that have grown outside the pancreas and entered major blood vessels or nerves but have spread to distant sites. Stage 4 pancreatic cancer has metastasized to distant sites, lymph nodes, and organs.
[0258] In another example, the microRNA nucleic acid composition of the modification of the present disclosure is used to treat lung cancer. For example, as shown in Figure 14 D, the miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194 and miR-let-7 of modification can be used to treat lung cancer separately. Therefore, this method includes treating non-small cell lung cancer, such as squamous cell carcinoma, adenocarcinoma and large cell carcinoma. Lung cancer usually originates from the malignant tumor in the bronchus of the lung and spreads to other parts of health, such as lymph nodes. For example, in the case of small cell lung cancer, cancerous lesions are common in a lung and then spread to the fluid (pleura) or the organ near the second lung, the lung periphery. Lung cancer is classified into stages based on the size of the primary tumor and whether it has grown outside the lungs into lymph nodes and whether it has metastasized to other organs of the body (e.g., bones, liver, breast, brain). This information is then combined and used to provide a specific stage, 0, 1, 2, 3, and 4. For stage zero (0), carcinoma in situ, the cancer is small and has not yet spread into the deeper lung tissue or outside the lungs. Stage 1 lung cancer shows that cancer cells are present in the underlying lung tissue, but the lymph nodes are not affected. Stage 2 lung cancer shows that the cancer has spread to nearby lymph nodes or into the chest wall. Stage 3 lung cancer is classified by continued spread from the lungs to lymph nodes or nearby structures and organs such as the heart, trachea, and esophagus. Stage 4 lung cancer shows that the cancer has metastasized throughout the body, which can affect the liver, bones, and brain.
[0259] In another example, the microRNA mimics of the present disclosure are used to treat breast cancer. As shown in Figures 14C and 16C, modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194 and miR-let-7 can each be used to treat breast cancer. There are several major forms of breast cancer. For example, ductal carcinoma begins in the cells of the duct. In contrast, lobular carcinoma, usually found in both breasts, begins in the lobe or lobule. Therefore, this method includes the treatment of ductal and lobular breast cancer. More specifically, breast cancer can occur due to the presence of one or more genetic mutations, such as HER2 or BRACA. As shown in Figures 16A-16C, this method can be used to treat such breast cancer. Therefore, in a specific embodiment, this method can be used to treat triple-negative breast cancer.
[0260] In another example, the microRNA mimics of the present disclosure are used to treat gastric cancer. As shown in Figure 14B, modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194, and miR-let-7 can each be used to treat gastric cancer. Gastric cancer typically exists in two forms: well-differentiated intestinal adenocarcinoma or poorly differentiated diffuse adenocarcinoma, and does not form glandular structures. Therefore, this method includes the treatment of both gastric cancer and gastric adenocarcinoma.
[0261] In yet another example, the microRNA mimics of the present disclosure are used to treat blood cancers. Figure 14E and 15C As shown, modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194 and miR-let-7 can each be used to treat blood cancers. There are several types of leukemia, including but not limited to acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute lymphocytic leukemia (ACL), chronic lymphocytic leukemia (CLL) and chronic myeloid leukemia (CML). As Figure 14E and 15C As shown, the present method can be used to treat leukemia. Thus, the present method includes the treatment of ALL, ACL, AML, CLL and CML. In a specific embodiment, the present method can be used to treat acute lymphoblastic leukemia (ACL).
[0262] According to the present disclosure, methods of treating cancer include administering one or more nucleic acid compositions of the present invention by any route generally known in the art. This includes, for example, (1) oral administration; (2) parenteral administration, for example, by subcutaneous, intramuscular, or intravenous injection; (3) topical administration; or (4) vaginal or rectal administration; (5) sublingual or buccal administration; (6) ocular administration; (7) transdermal administration; (8) nasal administration; or (9) direct administration to an organ or cell in need thereof.
[0263] In a specific embodiment, the modified microRNA composition of the present disclosure is administered to a subject by injection. In one embodiment, a therapeutically effective amount of the modified microRNA composition is injected intravenously. In another embodiment, a therapeutically effective amount of the modified microRNA composition is injected intraperitoneally.
[0264] The amount (dosage) of the nucleic acid composition of the disclosure administered depends on several factors, including the type and stage of the cancer, the presence or absence of adjuvant or co-adjuvant drugs, and the subject's weight, age, health, and tolerance to the agent. Depending on these various factors, the dosage can be, for example, about 2 mg / kg body weight, about 5 mg / kg body weight, about 10 mg / kg body weight, about 15 mg / kg body weight, about 20 mg / kg body weight, about 25 mg / kg body weight, about 30 mg / kg body weight, about 40 mg / kg body weight, about 50 mg / kg body weight, about 60 mg / kg body weight, about 70 mg / kg body weight, about 80 mg / kg body weight, about 90 mg / kg body weight, about 100 mg / kg body weight, about 125 mg / kg body weight, about 150 mg / kg body weight, about 175 mg / kg body weight, about 200 mg / kg body weight, about 250 mg / kg body weight, about 300 mg / kg body weight, about 350 mg / kg body weight, about 400 mg / kg body weight, about 500 mg / kg body weight, about 600 mg / kg body weight, about 700 mg / kg body weight, about 800 mg / kg body weight, about 900 mg / kg body weight, about 100 mg / kg body weight, about 125 mg / kg body weight, about 150 mg / kg body weight, about 175 mg / kg body weight, about 200 mg / kg body weight, about 250 mg / kg body weight, about 300 mg / kg body weight, about 350 mg / kg body weight, about 400 mg / kg body weight, about 500 mg / kg body weight, about 600 mg / kg body weight, about 700 mg / kg body weight, about 800 mg / kg body weight, about 900 mg / kg body weight or about 1000 mg / kg body weight, wherein the term "about" is generally understood to be within ± 10%, 5%, 2% or 1% of the indicated value. The dosage may also be within the range defined by any two of the aforementioned values. Routine experimentation can be used to determine an appropriate dosage regimen for each patient by monitoring the effect of the compound on cancerous or precancerous conditions or on the expression level or activity of a microRNA (e.g., miR-15a, miR-200a, miR-200b, miR-200c, miR-145, miR-194, miR-34, miR-let-7, miR-129, miR-140, miR-192, miR-502, miR-506) or its target, such as BCL2 level or activity or on TS level or activity or on E2F3 level or disease pathology (all of which can be routinely and easily monitored according to methods known in the art). Any of the above exemplary nucleic acid dosages can be administered once, twice, or more times per day, depending on the various factors discussed above.
[0265] The ability of the nucleic acid compositions described herein, and optionally any additional chemotherapeutic agents, to be used with the current methods can be determined using pharmacological models well known in the art, such as cytotoxicity assays, apoptosis staining assays, xenograft assays, and binding assays.
[0266] The nucleic acid compositions described herein may also be co-administered with or without one or more chemotherapeutic agents, which may be different auxiliary drugs or adjuvants than the nucleic acid compositions described herein.
[0267] As used herein, "chemotherapy" or the phrase "chemotherapeutic agent" is an agent that can be used to treat cancer. Chemotherapeutic agents that can be used in combination with the methods described herein include, for example, any agent that directly or indirectly modulates BCL2, E2F3, or TS. Examples of chemotherapeutic agents include: antimetabolites such as methotrexate and fluoropyrimidine-based pyrimidine antagonists, 5-fluorouracil (5-FU) (Carac® cream, Efudex®, Fluoroplex®, Adrucil®) and S-1; antifolates, including polyglutamatable antifolates; raltitrexed (Tomudex®), GW1843, and pemetrexed (Alimta®), and non-polymeric glutamatergic agents.
[0014] The present invention also includes a nonpolyglutamatable antifolate compound; nolatrexed (Thymitaq®), pletrexed, BGC945; folic acid analogs such as dimethylfolate, methotrexate, pteropterin, trimetrexate; and purine analogs such as fludarabine, 6-mercaptopurine, thiopurine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine. In a specific embodiment of the present disclosure, the chemotherapeutic agent is a compound capable of inhibiting the expression or activity of a gene or gene product involved in a signal transduction pathway involved in abnormal cell proliferation or apoptosis, such as YAP1, BMI1, DCLK1, BCL2, thymidylate synthase or E2F3, and any pharmaceutically acceptable salt, acid or derivative thereof.
[0268] In other embodiments, the chemotherapy can be any of the following cancer drugs, such as one or more of the following: methotrexate, doxorubicin, cyclophosphamide, cisplatin, oxaliplatin, bleomycin, vinblastine, gemcitabine, vincristine, epirubicin, folinic acid, paclitaxel, and docetaxel. The chemotherapy agent can be administered before, during, or after initiation of treatment with the nucleic acid composition.
[0269] In some embodiments, the chemotherapeutic agent is an anticancer drug or a tissue sensitizer or other enhancer of an anticancer drug.In some embodiments, the combination drug can be another nucleic acid or another miRNA, such as a microRNA mimic of the present disclosure, gemcitabine, or free 5-FU.
[0270] In specific embodiments, the additional nucleic acid is a short hairpin RNA (shRNA), siRNA, or a nucleic acid complementary to a portion of the BCL2 3'UTR.
[0271] In some embodiments, the chemotherapeutic agent is a combination drug.
[0272] E2F transcription factor 3, or E2F3 (RefSeq NG_029591.1, NM_001243076.2, NP_001230005.1), is a transcription factor that binds DNA and interacts with effector proteins (including but not limited to retinoblastoma protein) to regulate the expression of genes involved in cell cycle regulation. Therefore, any drug that inhibits E2F3 expression is contemplated as a combination drug herein.
[0273] B-cell lymphoma 2 (BCL2) (RefSeq NG_009361.1, NM_000633, NP_000624), including its isoforms α (NM_000633.2, NP_000624.2) and β (NM_000657.2, NP_000648.2), encoded by the Bcl-2 gene, is a member of the BCL2 family of regulator proteins that regulate mitochondrial-mediated cell death through the intrinsic apoptotic pathway. BCL2 is an integral mitochondrial outer membrane protein that blocks apoptotic cell death by binding to BAD and BAK proteins. Non-limiting examples of BCL2 inhibitors include antisense oligonucleotides, such as Oblimersen (Genasense; Genta Inc.,), BH3 mimetic small molecule inhibitors, including ABT-737 (Abbott Laboratories, Inc.), ABT-199 (Abbott Laboratories, Inc.), and Obatoclax (Cephalon Inc.) Any drug that inhibits BCL2 expression is considered a combination drug herein.
[0274] Thymidylate synthase (RefSeq: NG_028255.1, NM_001071.2, NP_001062.1) is a ubiquitous enzyme that catalyzes the methylation of essential dUMP to produce dTMP, one of the four bases that make up DNA. This reaction requires CH4-folate as a cofactor, which acts both as a methyl donor and, uniquely, as a reducing agent. The constant demand for CH4-folate means that thymidylate synthase activity is strongly associated with two enzymes responsible for replenishing the cellular folate pool: dihydrofolate reductase and serine transhydroxymethylase. Thymidylate synthase is a homodimer of 30-35 kDa subunits. The active site simultaneously binds both the folate cofactor and the dUMP substrate, and dUMP is covalently bound to the enzyme via a nucleophilic cysteine residue (see, Carreras et al., Annu. Rev. Biochem., (1995) 64:721-762). The thymidylate synthase reaction is a key part of the pyrimidine biosynthetic pathway, which produces dCTP and dTTP for incorporation into DNA. This reaction is required for DNA replication and cell growth. Therefore, all rapidly dividing cells, such as cancer cells, require thymidylate synthase activity. Due to its association with DNA synthesis and therefore cell replication, thymidylate synthase has become a target of anticancer drugs for many years. Non-limiting examples of thymidylate synthase inhibitors include folic acid and dUMP analogs, such as 5-fluorouracil (5-FU). Any drug that inhibits thymidylate synthase expression can be considered herein as a combined drug.
[0275] If desired, administration of the nucleic acid compositions described herein can be combined with one or more non-drug therapies, such as radiotherapy and / or surgery. As is well known in the art, radiotherapy and / or administration of chemotherapeutic agents (in this case, nucleic acid compositions described herein and optionally any additional chemotherapeutic agents) can be administered prior to surgery to, for example, shrink a tumor or stop cancer from spreading prior to surgery. Also as is well known in the art, radiotherapy and / or administration of chemotherapeutic agents can be administered after surgery to destroy any remaining cancer.
[0276] The following examples are provided for illustration purposes and to describe certain specific embodiments of the present invention. However, the scope of the present invention is not limited in any way by the examples set forth herein. Example
[0277] Example 1. Materials and Methods
[0278] Modified microRNA: 5-FU modified miR is synthesized by an automated oligonucleotide synthesis process and purified by HPLC. The two strands are annealed to produce the mature modified 5-FU-miR of the present disclosure. More specifically, a process called "2'-ACE RNA synthesis" is used. 2'-ACE RNA synthesis is based on a protecting group scheme in which the 5'-hydroxyl group is protected using a silyl ether in combination with an acid-sensitive orthoester protecting group (2'-ACE) on the 2'-hydroxyl group. This combination of protecting groups is then used with standard phosphoramidite solid phase synthesis techniques. See, for example, SA Scaringe, FE Wincott, and MH Caruthers, J. Am. Chem. Soc. , 120 (45), 11820-11821 (1998); International PCT Application WO / 1996 / 041809; MD Matteucci, MH Caruthers, J. Am. Chem. Soc. , 103, 3185-3191 (1981); SL Beaucage, MH Caruthers, Tetrahedron Lett . 22, 1859-1862(1981), the entire contents of each of which are expressly incorporated herein.
[0279] Exemplary modified miR-15a nucleic acids, modified miR-140 nucleic acids, modified miR-192 nucleic acids, modified miR-502, modified miR-506 nucleic acids, modified miR-34 nucleic acids, modified miR-194 nucleic acids, modified miR-200a, modified miR-200b, modified miR-200c nucleic acids, modified miR-145 nucleic acids, modified miR-let-7 nucleic acids, or any other modified microRNA in which uracil is replaced with 5-halouracil can be synthesized in the same manner as described herein.
[0280] Some exemplary structures of currently used protected and functionalized ribonucleoside phosphoramidites are shown below:
[0281]
[0282] Cell cultureHuman colon cancer cell lines HCT116, RKO, SW480, SW620 and normal colon cell line CCD 841 CoN, pancreatic cancer cell lines ASPC-1, HS766T, Panc-1, AGS gastric cancer cell line, SKBR3 and MDA-MB-231 breast cancer cells, REH acute lymphoblastic cell line and lung cancer cell line A549 were obtained from the American Type Culture Collection (ATCC) and maintained in various types of culture media. For example, McCoy's 5A medium (SKBR3, HCT-116), DMEM (RKO, HS766T, SW480, SW620) and MEM (CCD 841 CoN), RPMI-1640 (REH and APSC-1) and F-12K medium (AGS, A549). The culture medium was supplemented with 10% fetal bovine serum (Thermo Fischer).
[0283] For transfection, 1 × 10 5 Cells were plated in six-well plates and transfected 24 hours later with 100 nM control nonspecific miRNA (Thermo Fischer), modified microRNA, or exogenous natural microRNA using Oligofectamine (Thermo Fischer) according to the manufacturer's protocol. For reagent-free transfection, cells were plated at 1×10 5 Each cell / well was plated in a six-well plate. After 24 hours, 100 pmol miRNA (control, miR-15a, analogs-1) was diluted in Optimem (ThermoFischer) and added to the plate. After 24 hours, the culture medium was changed. The culture medium was supplemented with 10% fetal bovine serum (ThermoFischer). In brief, cells were cultured in ultra-low attachment flasks in growth medium (DMEM / F12 (Life Technologies) supplemented with B27, 10 ng / mL bFGF and 20 ng / mL EGF) for 6 days. Spheroid cells were collected by gentle centrifugation, separated into single cells and maintained by re-plating.
[0284] Western immunoblot analysis:48 hours after transfection, equal amounts of protein (15 µg) extracted from cells lysed in RIPA buffer with protease inhibitors (Sigma) were separated on 10%-12% sodium dodecyl sulfate-polyacrylamide gels using standard procedures. The primary antibodies used for analysis were rabbit anti-YAP1 monoclonal antibody (1:10,000) (Cell Signaling Technologies), anti-DLCK1 (1:500) (Abcam), anti-BCL2 (1:500) (NeoMarkers), anti-BMI-1 (1:10,000) (Cell Signaling Technologies), mouse anti-human TS antibody (1:500), anti-α-tubulin (1:50,000) (Santa Cruz Biotech Inc.), anti-GAPDH (1:100,000) (Santa Cruz Biotech Inc.), and anti-E2F3 (1:500) (Santa Cruz Biotech Inc.). Horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies (1:5000, Santa Cruz Biotech Inc.) were used as secondary antibodies. Protein bands were visualized on autoradiography membranes using SuperSignal West Pico chemiluminescent substrate (Thermo Fischer). Western blot density was quantified using Image J software.
[0285] Cell proliferation assay: 24 hours after transfection, cells were seeded at a density of 2000 cells / well in 96-well plates. Cell proliferation assays were performed on days 1-5 by incubating 10 μl of WST-1 (Roche Applied Science, Mannheim, Germany) in culture medium for 1 hour and reading the absorbance at 450 nm and 630 nm. The cell proliferation rate was calculated by subtracting the absorbance at 450 nm from the absorbance at 630 nm. Cell proliferation assays were performed at least three times. OD was calculated by subtracting the absorbance at 630 nm from the absorbance at 450 nm. Proliferation experiments were performed three times.
[0286] The anchorage-independent proliferation was studied to determine the colony-forming ability of cancer cells. Cancer cells were trypsinized and counted, with a total of 1×10 5Cells / well were transfected with 25 nM modified microRNA, natural miR, or negative control miRNA using oligofectamine in 6-well plates. Six hours after transfection, cells were recounted. A total of 20,000 cells in 0.35% agar (Bacto Agar; Becton Dickinson) were plated on top of a 1 mL layer of solidified 0.6% agar in a 35-mm dish. Both layers contained growth medium supplemented with B27, 10 ng / mL bFGF, and 20 ng / mL EGF. After two weeks of incubation, colonies exceeding 50 mm in diameter were counted.
[0287] Cell cycle analysis: 24 hours after transfection, cells were harvested and cultured at 0.5-1 x 10 6 Cells were resuspended at 100 cells / mL in modified Krishan buffer supplemented with 0.02 mg / mL RNase H and 0.05 mg / mL propidium iodide. Stained cells were analyzed by flow cytometry using Modfit LT™ software. Cell cycle analysis experiments were performed at least three times.
[0288] Apoptosis assay: To distinguish early and late apoptosis, fluorescein isothiocyanate (FITC)-annexin assay (Becton Dickinson) was performed. HCT116, RKO, SW480, and SW620 cells were plated at 1×10 5 Cells were plated per well in 6-well plates. 24 hours later, cells were transfected with 25 nM modified miRNA using Oligofectamine. 48 hours after transfection, cells were harvested and stained with propidium iodide and anti-Annexin V antibody (Annexin V-FITC Apoptosis Detection Kit, Invitrogen, CA, USA) according to the manufacturer's protocol. Stained cells were analyzed by flow cytometry.
[0289] 5-FU treatment and cytotoxicity assay: 24 hours after transfection, cancer cells were plated at 2 x 10 3 100 cells / well were plated in triplicate in 96-well plates in 100 μL of culture medium. After 24 hours, fresh culture medium containing 2 μM 5-FU alone, 50 nM native microRNA, 50 nM modified microRNA (e.g., modified miR-129), or a combination of 2 mM 5-FU and 50 nM modified microRNA of the present disclosure, such as modified miR-129, was added and cells were cultured for an additional 72 hours. Cell viability was measured using the WST-1 assay.
[0290] Lentivirus production: In short, 1.5 x 10 6293T cells were plated in 10-cm dishes with 10 mL of DMEM + 10% FBS. Two days later, pEZX-MR03, a lentiviral plasmid expressing miR-129 or hsa-miR-15a, was transfected using the Lenti-Pac HIV Expression Packaging Kit according to the manufacturer's protocol. After 48 hours, the virus was harvested and concentrated using Lenti-Pac Lentivirus Concentrator Solution. The virus titer (approximately 1011 viral particles / mL) was then determined using the Lenti-Pac™ HIV qRT-PCR Titering Kit. Separately, 5 x 10 cells were transduced using serially diluted virus (0.1 µL, 0.5 µL, 2 µL, 10 µL, 50 µL). 4 HCT116 CSCs were transduced to determine transduction efficiency. For in vivo mouse treatment, the lowest concentration (2 µL) that achieved 100% positive expression was used to infect cells.
[0291] Real-time qRT-PCR analysis of nucleic acid expression: Quantify microRNA expression levels in cancer cells. Briefly, primers specific for the target microRNA and the internal control RNU44 gene were purchased from Ambion. cDNA synthesis was performed using a high-capacity cDNA synthesis kit (Applied Biosystems) with miRNA-specific primers. Real-time qRT-PCR was performed using TaqMan Gene Expression Assays (Applied Biosystems) on an Applied Biosystems 7500 Real-Time PCR machine with miRNA-specific primers. Expression levels of exemplary miRs of the present disclosure were calculated using the ΔΔCT method based on the internal control RNU44, normalized to the control group, and plotted as relative quantification.
[0292] Human Cancer Stem Cell Profiler RNA was extracted from cancer cells transfected with exemplary microRNAs of the present disclosure or negative miRNAs using TRIzol reagent (Thermo Fischer) according to the manufacturer's protocol. RNA was transcribed into first-strand cDNA using the RT2 First Strand Kit (Qiagen). Next, the cDNA was mixed with RT2 SYBR Green Mastermix (Qiagen), and the mixture was aliquoted into wells of a Human Cancer Stem Cell RT2 Profiler PCR Array (Qiagen). An Applied Biosystems 7500 Real-Time PCR machine was used for qRT-PCR (Applied Biosystems), and relative expression values were determined using the ΔΔCT method.
[0293] Mouse subcutaneous tumor implantation model: Two days before injection, HCT116 cancer stem cells were cultured at a concentration of 5 x 10 5 The cells were plated / well in 6-well ultra-low attachment plates. 20 μL of virus or 100 pmol of exemplary modified miR-129 or modified miR-15a were used for transduction or transfection. After 48 hours, the cells were harvested and plated at 10 6 The cells were resuspended in DMEM / F12 knockout medium with 30% Matrigel at 400 μL / ml. 10-12 week-old NOD / SCID mice (Jackson Laboratories, Bar Harbor, MA, USA) were used for tumor implantation. Mice were anesthetized by inhaled isoflurane. 100 μL of the cell suspension was injected subcutaneously into both sides of the lower back region. Tumor size was measured using calipers, and tumor volume was calculated using the formula V = length x width. 2 / 2 calculation.
[0294] For in vivo miRNA delivery experiments, colon cancer cells expressing the lenti-luc reporter gene were created by infecting parental HCT116 cells with recombinant lentivirus. HCT116 cells expressing luciferase (2.0×10 6 Cells (100 cells / mouse) were suspended in 0.1 mL of PBS and injected through the tail vein of each mouse. Two weeks after colon cancer cell injection, mice were treated with 40 µg of negative control or modified miR packaged with in vivojetPEI (Polyplus Transfection) via the tail vein. Mice were treated every other day for 2 weeks (8 treatments). After treatment, mice were screened using the IVIS Spectrum In Vivo Imaging System (IVIS) (PerkinElmer).
[0295] RNA isolation: For mouse xenografts, the tissue sections were deparaffinized, hydrated, and digested with proteinase K. Subsequently, TRIzol ® Total RNA was isolated using TRIzol-based ® isolated from clinical samples.
[0296] Statistical analysis: All experiments were repeated at least three times. All statistical analyses were performed using SigmaPlot software. Statistical significance between two groups was compared using Student's t -Test (paired for clinical samples t -test, unpaired for all other samples t-test). For comparisons of more than two groups, one-way ANOVA followed by the Bonferroni-Dunn test was used. Data are presented as mean ± standard error of the mean (SEM). Statistical significance is described in the figure legend or indicated with an asterisk (*). * = P < 0.05; ** = P < 0.01; *** = P < 0.001.
[0297] Example 2: The modified microRNA of the present disclosure has anti-cancer activity
[0298] like Figure 3 、 8B , 12A-D, 13A-B, 14A-E and 15A-C, when compared to one or a control (i.e., nonspecific microRNA, unmodified miRNA precursor or vehicle only), modified miRNA (modified miR: 129, 15a, 192 (215), 140, 502, 34, 194, 200a, 200b, 200c, 145, let-7 and 506) effectively inhibited the proliferation of colon cancer, blood cancer, breast cancer, gastric cancer, pancreatic cancer and lung cancer cells. In addition, the modified miRNA can be delivered to cancer cells in the absence of a transfection reagent (e.g., Figures 17A-17B Significantly, the results showed that cancer cell proliferation was significantly inhibited in several different colorectal cancer cell lines, pancreatic cancer cell lines, breast cancer cell lines, lung cancer cell lines, gastric cancer cell lines, and leukemia cell lines when compared to cancer cells treated with a control microRNA or vehicle alone.
[0299] Example 3: Modified miR-129 nucleic acid has anti-cancer activity
[0300] In the following experiments, 5-FU was incorporated into miR-129. In one experiment, all U bases in miR-129 were replaced with 5-FU, as shown in Figure 1A The structure shown in the provided F " represents 5-fluorouracil or other 5-halogenated uracil. In another experiment, except for the seed region of miR-129, all U bases were replaced with 5-FU, such as Figure 1B shown in the provided structure.
[0301] Target specificity analysis: The results of Western blotting experiments in colon cancer HCT-116 cells demonstrated that the exemplary modified miR-129 polynucleotides of the present disclosure were able to retain their target specificity for TS, BCL2, and E2F3. Figure 2A and 2B, which shows the results for a modified miR-129 nucleic acid having all U bases replaced with 5-FU, as obtained by two separate operators as shown in SEQ ID. NO: 4. More significantly, the exemplary miR-129 mimic was found to be more effective than unmodified (control) miR-129 in reducing the expression levels of TS, BCL2, and E2F3.
[0302] Functional enhancement of the modified microRNA of the present disclosure: The effects of the modified miR-129 on colon cancer cell proliferation were compared with those of the native miR-129. The results showed that at a concentration of 50 nM, 5-FU-miR-129 could completely inhibit the growth of HCT-116 tumor cells. Figure 3 As shown in the results in , 5-FU-miR-129 is far more potent than native miR-129, thus providing a significantly higher inhibitory effect. Such inhibition is specific, as a scrambled control miR has no effect on cell proliferation.
[0303] Next, HCT-16 colon cancer cells were used to compare the effects of modified miR-129 and 5-FU on cell proliferation. Figure 4 As shown in the results presented, 50 nM (1 / 40 of 5-FU) of modified miR-129 unexpectedly inhibited tumor cell proliferation much more effectively than 2 μM 5-FU.
[0304] Exemplary modified microRNAs of the present disclosure induce apoptosis in colon cancer cells: Given that BCL2 As an important target of miR-129, the effects of the modified miRs of the present disclosure on apoptosis were investigated. Specifically, apoptosis was measured to quantify cell death in HCT116, RKO, SW480 and SW620 colon cancer cells transfected with negative control miRNA, natural miR-129 or an exemplary miR-129 mimic of SEQ ID NO: 4. The results showed that miR-129 mimics were able to induce apoptosis (2-30 times) of natural miR-129 and negative control miRNA in all four colon cancer cell lines by FITC-annexin assay based on fluorescence activated cell sorting (FACS). Figure 5A ).
[0305] miR-129 mimics trigger G1 / S cell cycle checkpoint control: Cell cycle analysis was performed using flow cytometry in HCT-116 cells treated with a scrambled control, miR-129 precursor, and exemplary miR-129 mimics. Figure 5B As shown in , cell cycle analysis showed that miR-129 mimics affected colon cancer cell growth by inducing G1 arrest, and this effect was much stronger (more than 2-fold) than native miR-129.
[0306] miR-129 mimics eliminate chemotherapy-resistant colon cancer stem cells To determine the effects of certain exemplary modified microRNAs of the present disclosure (ie, miR-129 mimics) on 5-FU-resistant colon cancer stem cells, HCT116-derived colon cancer stem cells were treated with various concentrations of mimic-1 or 5-FU. Figure 6 The data presented in show that exemplary microRNA mimics of the present disclosure were able to eliminate over 80% of 5-FU-resistant colon cancer stem cells at a concentration of 100 nM, whereas 5-FU had minimal effect on cancer stem cell viability at a lethal dose of 100 μM.
[0307] In summary, these results show that the exemplary modified microRNA polynucleotides of the present disclosure are able to inhibit the proliferation of HCT116 colon cancer stem cells ( Figure 6 This inhibitory effect of modified miR-129 was much more potent than that of native miR-129, as proliferation was almost completely blocked by 25 nM miR-129 on day 6 ( Figure 6 We also demonstrated the effect of treatment of cells with modified miR-129 on anchorage-independent cell growth using a soft agar assay. Colon cancer stem cells treated with modified miR-129 did not form visible spheres compared to cells treated with native miR-129 or control miRNA (compared to the Figure 10 similar to those seen in ).
[0308] miR-129 mimics inhibit colon cancer metastasis in vivo: The therapeutic impact of modified miR-129 nucleic acids was evaluated using a colon cancer metastasis model. Two weeks after the establishment of metastases, 40 μg of miR-129 nucleic acid of SEQ ID NO: 4 was delivered via intravenous injection at a treatment frequency of once every other day for 2 weeks.
[0309] Figure 7 The results shown in Figure 3 show that modified microRNA-129 inhibits colon cancer metastasis, while negative control miRNA has no effect, and also shows no toxic side effects.
[0310] Example 4: Exemplary modified miRs and their anti-cancer activities
[0311] Exemplary modified miR-15a compositions have anti-cancer activity: like Figure 1C and Figure 1D As shown in , exemplary modified miR-15a mimics were synthesized as described above, wherein all uracil bases ( Figure 1C ) or only uracil bases in non-seed regions ( Figure 1D ) is substituted with 5-halouracil (i.e., 5-fluorouracil).
[0312] like Figure 1C After 3 days of transfection of the exemplary modified miR-15a shown in FIG into HCT-116 colon cancer stem cells, proteins were collected and subjected to Western blotting to confirm that the modified miR-15a nucleic acid compositions of the present disclosure maintained the ability to regulate key miR-15a targets. Figure 8A As shown in , the miR-15a targets YAP1, BMI1, DCLK1, and BCL2 showed reduced protein levels when transfected with unmodified miR-15a (native-miR15a) or modified miR-15a compositions, indicating that 5-halouracil modification does not inhibit the ability of miR-15a to regulate its targets within cells.
[0313] Modified miR-15a has increased therapeutic efficacy in vitro: To determine whether the modified miR-15a compositions of the present disclosure exhibit increased potency compared to unmodified miR-15a in colon cancer cell lines, negative control (nonspecific oligonucleotide), unmodified miR-15a, or Figure 1C HCT-116 colon cancer cells were transfected with the exemplary modified miR-15a composition shown in FIG.
[0314] Cancer cell proliferation was assessed using the WST-1 assay. Figure 8B As shown in the study, six days after transfection, unmodified miR-15a reduced cell proliferation by 53% compared to the control. In the case of modified miR-15a, cell proliferation was reduced by 84%. Overall, the experimental results show that modified miR-15a is more effective in reducing cancer cell proliferation than unmodified miR-15a.
[0315] The ability of modified miR-15a nucleic acids to inhibit cell cycle progression in cancer cells was also analyzed. Figure 9A Unmodified miR-15a was shown to induce cell cycle arrest, resulting in an approximately 3-fold increase in the G1 / S ratio. Figure 9A The exemplary modified miR-15a compositions of the present disclosure were also shown to be more effective in arresting cell cycle progression when compared to their native counterparts. For example, cells expressing the exemplary modified miR-15a nucleic acids of the present disclosure showed a 7-fold increase in the G1 / S ratio compared to controls. Thus, modified miR-15a was more effective than unmodified miR-15a in inducing cell cycle arrest in colon cancer cells.
[0316] Similarly, modified miR-let-7 and modified miR-145 were more effective in arresting cell cycle progression than negative controls. Figure 9B For example, cells expressing exemplary modified miR-let-7 and modified miR-145 nucleic acids of the disclosure exhibited significant fold increases in the G1 / S ratio when compared to controls.
[0317] As yet another example, modified miR-200b (5-FU-miR-200b) significantly increased the sub-G1 and G1 / S ratios of breast cancer cells in a population when compared to controls (i.e., native exogenous miR-200b or vehicle only, NC). Figure 16C This suggests that exemplary miR-200b may also treat cancer by inhibiting cell cycle progression.
[0318] The effects of exemplary modified miR-15a compositions on colony formation of colon cancer stem cells in Matrigel matrix were also examined. Figure 10 As shown in , although many colonies were generated from cells transfected with control miRNA ( Figure 10 , negative), very few colonies were generated from cells transfected with unmodified miR-15a ( Figure 10 , miR-15a). In contrast, in the case of cells transfected with modified miR-15a, no colonies were observed ( Figure 10 , 5-FU-miR-15a). These results indicate that exemplary modified miR-15a compositions of the present disclosure are indeed more effective inhibitors of tumorigenesis and colorectal cancer progression.
[0319] Modified miR-15a inhibits cancer development and progression in vivo: To further our understanding of miR-15a in colon CSCs, we established mouse xenograft models containing colorectal cancer cells that had been pre-transfected with modified miR-15a or a negative control miRNA. Eight weeks after injection, tumors were measured and harvested. Tumors established from CSCs expressing the modified miR-15a mimic showed a substantial reduction in tumor size (>25x) (n=8), as shown in Figure 2. Figure 11 As shown in .
[0320] The data presented herein support the feasibility of a novel modification in which halouracils (eg, 5-FU) are incorporated into miRNA nucleic acid sequences to enhance the chemotherapeutic function of native microRNA molecules (with or without the concomitant use of other chemotherapeutic agents).
[0321] Modified microRNAs can inhibit cancer development in a concentration-dependent manner and without the need for delivery vehicles. born .like Figure 6 As shown in Figures 15A-15C, the exemplary modified microRNAs tested were able to inhibit the proliferation of colorectal cancer, gastric cancer, breast cancer, and lung cancer cells in a concentration-dependent manner (i.e., at various concentrations, 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.125 nM). This provides further evidence that the modified microRNAs of the present disclosure can be used as anti-cancer therapies to treat a variety of cancers.
[0322] In addition, to test whether the modified microRNA of the present disclosure can be directly delivered to cells and taken up by cancer cells without the use of a transfer agent or vehicle (i.e., oligofectamine), MDA-MB-231 triple-negative breast cancer cells were transfected with miR-NC (negative control), exogenous unmodified miR-200b, or 5-FU-miR-200b using oligofectamine or without a delivery vehicle. Figures 17A-17B Figure 17A shows that the expression of the exemplary modified miR of test is monitored 6 days after transfection or incubation by MTT assay on the impact of breast cancer cell proliferation.In the presence of oligofectamine, compared with control microRNA (miR-NC), natural miR-200b reduces the cell proliferation rate of MDA-MB-231 cells.Meanwhile, modified miR-200b (5-FU-miR-200b) significantly reduces cell growth from the 3rd day.Referring to Figure 17 A.Unexpectedly, in the absence of oligofectamine processing (without delivery vehicle), modified miR can block MDA-MB-231 cell proliferation, while control microRNA and exogenous natural microRNA (that is, natural miR-200b) do not have an impact on proliferation in the absence of oligofectamine, as shown in Figure 17 B.
[0323] In addition, regarding the use of modified miR-200b to treat breast cancer, when compared to both exogenous natural miR-200b and a negative control, after administration of modified miR-200b, fibronectin (miR-200b target gene) expression and interaction with TS were observed to be reduced, as shown in Figures 16A and 16B. The results demonstrate that modified microRNAs, such as modified miR-200b, are delivered to cancer cells with or without a delivery agent and inhibit cell proliferation by regulating target genes.
Claims
1. A nucleic acid composition comprising a modified microRNA nucleotide sequence, wherein the modified microRNA nucleotide sequence is F AAU F ACU F GCCU F GGU F AAU F GAU F GA, where U F It is 5-fluorouracil.
2. A pharmaceutical composition comprising the nucleic acid composition of claim 1.
3. Use of the nucleic acid composition of claim 1 in the preparation of a medicament for treating cancer in a subject, wherein the subject has cancer or has been diagnosed with a predisposition to develop cancer, wherein the progression of the cancer is inhibited, and wherein the cancer is breast cancer.
4. The method of claim 3, wherein the subject is a human.
5. The use of claim 3, wherein the nucleic acid composition is administered to the subject by injection.
6. The method of claim 5, wherein the nucleic acid composition is injected intravenously or intraperitoneally.
Citation Information
Patent Citations
Flush tank siphon mechanism
CA197098A
MicroRNA-129 AS A BIOMARKER FOR COLORECTAL CANCER
US20160090636A1
Electrical railway-signal
US405815A
Novel protecting groups and use thereof in an improved process for oligonucleotide synthesis
WO1996041809A1
Synthetic mimics of MIR-34
CN103476931A