Isolated recombinant oncolytic poxvirus regulated by microRNA and its application

By integrating specific microRNA target sequences and IL-21 genes in oncolytic poxviruses, a functionally defective recombinant virus was constructed, and the existing oncolytic poxvirus safety risks and insufficient tumor specificity were solved, and efficient and safe tumor treatment effects were achieved.

CN113583977BActive Publication Date: 2025-06-06HANGZHOU CONVERD CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202010363270.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-04-30
Publication Date
2025-06-06
Estimated Expiration
2040-04-30

AI Technical Summary

Technical Problem

Existing oncolytic poxviruses have safety risks in clinical applications and lack products with higher tumor specificity and safety.

Method used

By integrating the target sequence of specific microRNAs in the genome of oncolytic poxvirus, the low expression of microRNAs in tumor cells is used to regulate the replication of viruses, construct recombinant oncolytic poxviruses with functional defects in TK and/or VGF genes, and integrate exogenous IL-21 genes in the genome.

Benefits of technology

The efficient replication of viruses in tumor cells and tumor-specific killing is achieved, reducing the impact on normal cells, and improving the safety and effectiveness of treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0002475723270000291
    Figure BDA0002475723270000291
  • Figure BDA0002475723270000301
    Figure BDA0002475723270000301
  • Figure BDA0002475723270000351
    Figure BDA0002475723270000351
Patent Text Reader

Abstract

The present invention provides a separated recombinant oncolytic poxvirus that can be regulated by microRNA and its application. The separated recombinant oncolytic poxvirus can be regulated by microRNA, and the expression of the microRNA is lower in the tumor cells of mammals than in the normal cells of the same mammal, wherein the target sequence of the microRNA is integrated in the 3'UTR region of the E10R gene in the genome of the recombinant oncolytic poxvirus. The replication of the recombinant oncolytic poxvirus of the present invention in a variety of tumor cells is significantly higher than that in normal cells, thereby having better tumor specificity and safety, and can significantly inhibit the growth of tumor cells. In addition, the present invention provides a richer and more effective product line for cancer treatment, which can provide better effects, higher tumor specificity and safer products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular, relates to an isolated recombinant oncolytic poxvirus that can be regulated by microRNA, a pharmaceutical composition, and use thereof in a drug for treating tumors and / or cancers. Background Art

[0002] As early as the end of the 19th century, people discovered that a variety of viruses can alleviate the process of tumor development, suggesting the potential of viruses in the field of tumor treatment. Poxviruses are double-stranded DNA viruses. Based on the good safety, stability, strong immune response, strong oncolytic effect and effective diffusion in tumors, the virus has gained increasing attention in the field of tumor immunotherapy. Although poxviruses have natural tumor targeting, wild-type viruses that have not been genetically modified can still infect many normal cells, which may cause certain risks. Several strains of oncolytic poxviruses have been reported, including Western Reserve, Wyeth, Copenhagen, Lister, etc., and their respective mutants have been constructed. Among these mutants, the thymidine kinase (TK) gene of poxvirus is one of the most used mutation regions. The TK gene is one of the main genes involved in the virus replication program. The high expression of the TK gene in tumor tissues makes the replication ability of TK-deficient poxviruses limited in normal tissues. Secondly, the spread of poxviruses in host cells is closely related to the activation of the epidermal growth factor receptor (EGFR) signaling pathway. VGF secreted by poxviruses after infected cells binds to EGFR on the surface of infected or adjacent uninfected cells and activates the EGFR / Ras signaling pathway, providing a favorable environment for poxviruses to infect adjacent cells. Therefore, poxviruses lacking VGF cannot activate the EGFR / Ras channel in normal cells, limiting their infection of normal cells. The EGFR signaling pathway in tumor cells is in an activated state, so the infection of poxviruses lacking the VGF gene in tumor cells is not affected, which means that the specificity for tumors is relatively improved. However, in clinical practice, VGF and / or TK-deficient oncolytic poxviruses still have safety risks when administered to patients by systemic administration.

[0003] Although the China National Medical Products Administration approved the marketing of Shanghai Sanwei Biotechnology Co., Ltd.'s genetically modified oncolytic adenovirus H101 in 2005 for the treatment of head and neck tumors, and the US FDA and the EU EMA approved Amgen's genetically modified oncolytic herpes simplex virus T-Vec in 2015 for the treatment of advanced malignant melanoma, there are currently no oncolytic poxvirus products on the market.

[0004] Therefore, in oncolytic virus immunotherapy for tumors and / or cancers, there is still a need to develop products with better efficacy, higher tumor specificity, and greater safety. Summary of the invention

[0005] In order to solve the problems existing in the above-mentioned prior art, the present invention provides an isolated recombinant oncolytic poxvirus, a pharmaceutical composition and the use thereof in drugs for treating tumors and / or cancers.

[0006] Specifically, the present invention provides:

[0007] (1) An isolated recombinant oncolytic poxvirus, which can be regulated by microRNA, wherein the expression level of the microRNA in tumor cells of a mammal is lower than that in normal cells of the same mammal, wherein the target sequence of the microRNA is integrated into the 3'UTR region of the E10R gene in the genome of the recombinant oncolytic poxvirus.

[0008] (2) The recombinant oncolytic poxvirus according to (1), wherein the microRNA is selected from the group consisting of miR-9, miR-15a, miR-16, miR-26a, miR-27b, miR-29b, miR-30a, miR-32, miR-33, miR-34, miR-95, miR-101, miR-122, miR-124, miR-125a, miR-125b, miR-126, miR-127, miR-128, miR-133b, miR-134b, miR-135b, miR-136, miR-137, miR-138, miR-139b, miR-140, miR-141, miR-142, miR-143, miR-144, miR-145 iR-139,miR-140,miR-142,miR-143,miR-145,miR-181,miR-192,miR-195,miR-198,miR-199a,miR-199b,miR-2 00,miR-203,miR-204,miR-205,miR-218,miR-219,miR-220,miR-224,miR-345,miR-375;preferably,miR-199a and miR-199b.

[0009] (3) The recombinant oncolytic poxvirus according to (1), which is TK gene function-deficient and / or VGF gene function-deficient.

[0010] (4) The recombinant oncolytic poxvirus according to (1), wherein the target sequence of the microRNA is repeated, and the repeat comprises 2-8 repeats.

[0011] (5) The recombinant oncolytic poxvirus according to (3), wherein an exogenous IL-21 gene is integrated into the genome of the recombinant oncolytic poxvirus, and the IL-21 gene can be expressed in tumor cells.

[0012] (6) The recombinant oncolytic poxvirus according to (3), wherein the TK gene is rendered functionally defective by inserting a foreign nucleotide sequence.

[0013] (7) The recombinant oncolytic poxvirus according to (5), wherein the exogenous IL-21 gene is inserted into the TK gene, thereby rendering the TK gene functionally defective.

[0014] (8) The recombinant oncolytic poxvirus according to (3), wherein the VGF gene is rendered functionally defective by gene knockout or insertion of an exogenous nucleotide sequence.

[0015] (9) The recombinant oncolytic poxvirus according to (1), wherein the recombinant oncolytic poxvirus is a WR strain or a Wyeth strain.

[0016] (10) The recombinant oncolytic poxvirus according to (1), wherein an exogenous screening gene is also integrated into the genome of the recombinant oncolytic poxvirus, and the exogenous screening gene includes a gpt gene and / or a LacZ gene.

[0017] (11) The recombinant oncolytic poxvirus according to (5), wherein the exogenous IL-21 gene is from mouse or human.

[0018] (12) A pharmaceutical composition, wherein the pharmaceutical composition comprises as an active ingredient the recombinant oncolytic poxvirus according to any one of (1) to (11), and a pharmaceutically acceptable excipient.

[0019] (13) The pharmaceutical composition according to (12), wherein the pharmaceutical composition comprises 1×10 5 -5×10 9 pfu of the recombinant oncolytic poxvirus.

[0020] (14) The pharmaceutical composition according to (12), wherein the recombinant oncolytic poxvirus is administered by intratumoral injection or intravenous administration.

[0021] (15) A vector for preparing the recombinant oncolytic poxvirus according to any one of (1) to (11).

[0022] (16) The vector according to (15), wherein the vector comprises an exogenous IL-21 gene under the control of a promoter.

[0023] (17) A host cell containing the vector described in (15) or (16).

[0024] (18) Use of the recombinant oncolytic poxvirus according to any one of (1) to (11) in the preparation of a medicament for treating tumors and / or cancer.

[0025] (19) The use according to (18), wherein the tumor and / or cancer includes lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumor, colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0026] (20) A method for treating tumors and / or cancer, comprising administering the recombinant oncolytic poxvirus according to any one of (1) to (11) to a tumor and / or cancer patient.

[0027] (21) The method according to claim 20, wherein the administration dose of the recombinant oncolytic poxvirus is 1×10 5 -5×10 9 pfu, once a day for 1-6 consecutive days; or once every 2 days for 1-6 consecutive times.

[0028] (22) The method according to (20), wherein the oncolytic virus is administered by intratumoral injection or intravenous administration.

[0029] (23) The method according to (20), wherein the tumor and / or cancer includes lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumor, colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0030] Compared with the prior art, the present invention has the following advantages and positive effects:

[0031] After in-depth research and experiments, the present invention selects a specific essential gene E10R in the genome of the oncolytic poxvirus, and proposes to insert an exogenous nucleotide sequence in the 3'UTR region (3' untranslated region) of E10R, wherein the exogenous nucleotide sequence contains a target sequence of a specific microRNA, wherein the expression level of the microRNA is lower in tumor cells than in normal cells. In this way, in normal cells infected with the oncolytic poxvirus, the highly expressed microRNA can target the mRNA corresponding to the 3'UTR region of the oncolytic poxvirus E10R, and inhibit the expression of E10R by degrading the mRNA or hindering its translation, thereby inhibiting the replication of the oncolytic poxvirus. In tumor cells infected with the oncolytic poxvirus, the microRNA is lowly expressed or not expressed, so the expression of E10R is not inhibited, thereby maintaining the replication ability of the oncolytic poxvirus. Therefore, the present invention utilizes the characteristics of different expression levels of specific microRNAs in normal tissues and tumor tissues in vivo to provide a new recombinant oncolytic poxvirus with higher and more obvious selectivity for tumor cells. The inventors surprisingly found that the replication of the recombinant oncolytic poxvirus of the present invention in various tumor cells is significantly higher than that in normal cells, thereby having better tumor specificity and safety, and being able to significantly inhibit the growth of tumor cells.

[0032] In addition, the present invention further selected the types of microRNAs and found that multiple microRNAs (preferably miR-199) can effectively achieve the purpose of the present invention, and the resulting recombinant oncolytic poxvirus showed stronger tumor selectivity and safety.

[0033] The novel recombinant oncolytic poxvirus of the present invention may further include inactivation of the TK and / or VGF genes, thereby achieving stronger tumor cell selectivity. Compared with existing oncolytic poxviruses (such as TK and / or VGF-deficient poxviruses), its replication in normal cells and killing of normal cells are significantly reduced.

[0034] In addition, the present invention further enables the novel oncolytic poxvirus to carry the gene of the immune regulatory factor IL-21 at the same time, so that the obtained recombinant oncolytic poxvirus can selectively replicate in tumor cells and express the immune regulatory factor IL-21. In this way, the oncolytic virus can fully exert the effect of selectively replicating and killing tumor cells in tumor cells, and further causing subsequent immune responses of the body, while also fully exerting the anti-tumor immune effect of exogenous IL-21. The present invention finds that integrating the IL-21 gene into the oncolytic poxvirus can produce a synergistic effect of the oncolytic killing effect of the oncolytic virus and the anti-tumor immune stimulation of IL-21.

[0035] Therefore, the present invention provides a richer and more effective product line for cancer treatment, and can provide products with better effects, higher tumor specificity and greater safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The flowchart for constructing the plasmid pZB-E10R-miR199T in Preparation Example 1 is shown.

[0037] Figure 2 The identification result of the pZB-E10R-miR199T plasmid in Preparation Example 1 is shown; wherein lane M is DNA Marker III (DNA molecular weight marker III), and lane 1 is the pZB-E10R-miR199T band.

[0038] Figure 3 The results of the identification of the monoclonal recombinant oncolytic virus of the VSC20-mT / mCherry backbone virus constructed in Preparation Example 2 are shown; wherein lane M is a DNA molecular weight marker, lane 1 is a VSC20-mT / mCherry band, lane 2 is a VSC20 band, and lane 3 is a negative control (no DNA sample).

[0039] Figure 4 The structure of the VSC20-mT / mCherry oncolytic virus vector constructed in Preparation Example 2 is shown.

[0040] Figure 5 The results of identification of the monoclonal recombinant oncolytic virus of the MiTDvv-mCherry backbone virus constructed in Preparation Example 3 are shown; wherein lane M is a DNA molecular weight marker, lane 1 is a MiTDvv-mCherry band, lane 2 is a VSC20-mT / mCherry band, and lane 3 is a negative control (no DNA sample).

[0041] Figure 6 The structure of the MiTDvv-mCherry oncolytic virus vector constructed in Preparation Example 3 is shown.

[0042] Figure 7 The monoclonal recombinant oncolytic virus identification results of the MiTDvv-hIL21-mCherry oncolytic virus constructed in Preparation Example 4 are shown; wherein lane M is a DNA molecular weight marker, lane 1 is a MiTDvv-hIL21-mCherry band, lane 2 is a DDvv-hIL21 band, and lane 3 is a negative control (no DNA sample).

[0043] Figure 8 The structure of the MiTDvv-hIL21-mCherry oncolytic virus constructed in Preparation Example 4 is shown.

[0044] Fig. 9A shows that the PCR method was used in Preparation Example 5 to confirm that the MiTDvv backbone virus and the MiTDvv-hIL21 oncolytic virus contained the miR199T sequence and did not contain the mCherry sequence; wherein lane M is a DNA molecular weight marker, lane 1 is a MiTDvv band, lane 2 is a MiTDvv-mCherry band, lane 3 is a negative control (no DNA sample), lane 4 is a DDvv-hIL21 band, and lane 5 is a MiTDvv-hIL21-mCherry band. Fig. 9 B shows the PCR method used in Preparation Example 5 to confirm that the MiTDvv backbone virus lacks the TK gene; wherein lane M is a DNA molecular weight marker, lane 1 is a MiTDvv band, lane 2 is a VSC20 band, and lane 3 is a negative control (no DNA sample).

[0045] Fig.10 The structures of the MiTDvv backbone virus and MiTDvv-hIL21 oncolytic virus constructed in Preparation Example 5 are shown.

[0046] Fig.11 The comparison of the replication of MiTDvv backbone virus in normal cells and tumor cells in Example 1 is shown. As shown in the figure, the replication of MiTDvv backbone virus in normal human cells HUVEC is lower than that in human tumor cells Hela, showing obvious tumor selective replication function. Fig.11 A shows the viral content of HUVEC cells (left column) and Hela cells (right column) infected with MiTDvv backbone virus 24 hours later. Fig.11 B shows the virus content 48 hours after MiTDvv backbone virus infected HUVEC cells (left column) and Hela cells (right column); Fig.11 C shows the ratio of MiTDvv backbone virus replication in Hela cells to that in HUVEC cells. Fig.11 In A and B, the X axis represents different cells, and the Y axis represents the virus content per milliliter of culture medium; Fig.11 In C, the X-axis is the ratio of virus replication in Hela cells and HUVEC cells, and the Y-axis is the virus infection time.

[0047] Fig.12 The comparison of the in vitro killing of normal cell lines by MiTDvv skeleton virus and DDvv skeleton virus in Example 2 is shown. As shown in the figure, the killing effect of DDvv virus skeleton on normal cell MRC-5 is significantly stronger than that of MiTDvv oncolytic virus skeleton. The X-axis is the different virus infection doses (MOI) used to treat cells, the Y-axis is the percentage value of the corresponding killing rate, the gray column represents DDvv virus infection, and the black column represents MiTDvv virus infection.

[0048] Fig.13The comparison of the replication of MiTDvv backbone virus and DDvv backbone virus in normal cells in Example 3 is shown. As shown in the figure, the replication of DDvv oncolytic virus backbone in normal cell MRC-5 is significantly higher than that of MiTDvv oncolytic virus backbone. The X-axis is the different virus infection doses (MOI) used to treat cells, the Y-axis is the corresponding number of copies of viral genes per ml culture system, the gray column represents DDvv virus infection, and the black column represents MiTDvv virus infection.

[0049] Fig.14 The comparison of the killing of normal cells by MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses in Example 4 is shown. As shown in the figure, the killing effect of DDvv-hIL21 oncolytic virus on normal cell MRC-5 is significantly stronger than that of MiTDvv-hIL21 oncolytic virus. The X-axis is the different virus infection doses (MOI) used to treat cells, the Y-axis is the percentage value of the corresponding cell growth inhibition rate, the black column represents MiTDvv-hIL21 virus infection, and the gray column represents DDvv-hIL21 virus infection.

[0050] Fig.15 The comparison of the replication of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses in normal cells in Example 5 is shown. As shown in the figure, the replication of DDvv-hIL21 oncolytic virus in normal cells MRC-5 is significantly higher than that of MiTDvv-hIL21 oncolytic virus. Wherein the X-axis is the different viral infection doses (MOI) used to treat cells, the Y-axis is the number of copies of viral genes per milliliter of culture system, the gray column indicates DDvv-hIL21 oncolytic poxvirus infection, and the black column indicates MiTDvv-hIL21 oncolytic poxvirus infection.

[0051] Fig.16 The figure shows the comparison of the replication of MiTDvv-hIL21 oncolytic poxvirus in normal cells and tumor cells in Example 6. As shown in the figure, the replication of MiTDvv-hIL21 oncolytic virus in normal cells MRC-5 is lower than that in tumor cells A549. Fig.16 A shows the virus content after cells are infected with viruses of different titers, wherein the X-axis represents the different virus infection doses (MOI) used to treat cells, the Y-axis represents the number of copies of viral genes per milliliter of culture system, the gray columns represent normal cells infected with MiTDvv-hIL21 oncolytic poxvirus, and the black columns represent tumor cells infected with MiTDvv-hIL21 oncolytic poxvirus. Fig.16B shows the replication multiples of MiTDvv-hIL21 oncolytic virus in tumor cells A549 and in normal cells MRC-5, wherein the X-axis is the replication multiples of oncolytic virus in A549 cells and in MRC-5 cells, and the Y-axis is the different viral infection doses used to treat the cells.

[0052] Fig.17 The in vitro killing effect of MiTDvv-hIL21 oncolytic poxvirus in Example 7 on different tumor cell lines is shown. Fig.17 AG are the results of FaDu cells (A), A549 cells (B), LOVO cells (C), MNNG / HOS C1 cells (D), SK-HEP-1 cells (E), PANC-1 cells (F), and U251 cells (G), respectively. The X-axis is the log value (lg MOI) of the different viral infection MOIs used to treat the cells, the Y-axis is the percentage value of the corresponding inhibition rate, the solid points are the inhibition rate of MiTDvv-hIL21 oncolytic poxvirus, and the hollow squares are the inhibition rate of the positive control 10μM paclitaxel.

[0053] Fig.18 The expression levels of miR-199 in different cells in Example 8 are shown. The X-axis represents different tumor cell lines, and the Y-axis represents the relative expression of miR-199. Black columns represent high-expressing strains, gray columns represent medium-expressing cell lines, and white columns represent low-expressing cell lines.

[0054] Fig.19 The correlation between the killing effect of MiTDvv-hIL21 oncolytic virus on tumor cells and the expression of miR-199 in Example 8 is shown, wherein the X-axis represents different tumor cell lines, and the Y-axis represents the percentage value of cell survival rate.

[0055] Fig. 20 The validation of the stably transfected miR-199 fragment in HCT116 cells in Example 9 is shown. Fig. 20 A shows the results of GFP expression detected by cell flow cytometry, where the left figure is the result of the blank control group (HCT116 cell line), the middle figure is the result of the negative control cell line HCT116-miRNC, and the right figure is the result of the HCT116-miR199 cell line stably expressing miR-199; Fig. 20 B shows the results of quantitative PCR detection of miR-199 expression, wherein the X-axis represents different cell lines and the Y-axis represents the relative expression level of miR-199.

[0056] Fig.21The results of infecting tumor cells with high expression of miR-199 with MiTDvv-hIL21 oncolytic virus in Example 9 are shown. As shown in the figure, tumor cells with high expression of miR-199 significantly inhibit the cell killing effect of MiTDvv-hIL21 oncolytic virus. The X-axis is the different virus infection doses (MOI), the Y-axis is the percentage value of the corresponding cell growth inhibition rate, the white column represents the cell line infected with HCT116-miRNC, and the black column represents the cell line infected with HCT116-miR199.

[0057] Fig. 22 The anti-tumor effect of MiTDvv-hIL21 oncolytic virus on colorectal cancer in Example 10 is shown. Fig. 22 A shows the change of tumor volume over time after intratumoral injection of MiTDvv-hIL21 oncolytic poxvirus; as can be seen from the figure, MiTDvv-hIL21 oncolytic poxvirus can effectively inhibit tumor growth; wherein the X-axis is the time after administration, the Y-axis is the tumor volume, the solid squares represent intratumoral injection of MiTDvv-hIL21, and the hollow squares represent intratumoral injection of PBS. Fig. 22 B shows the change of relative tumor growth rate T / C (%) over time after intratumoral injection of MiTDvv-hIL21 oncolytic poxvirus; as can be seen from the 10th day after administration, the relative tumor growth rate of the MiTDvv-hIL21 administration group was less than 40%; wherein the X-axis is the time after administration, the Y-axis is T / C (%), and the solid squares represent intratumoral injection of MiTDvv-hIL21. Fig. 22 C shows the change in mouse weight over time after intratumoral injection of MiTDvv-hIL21 oncolytic poxvirus; as shown in the figure, there was no significant decrease in mouse weight during the entire experiment; the X-axis is the time after administration, the Y-axis is the mouse weight, the solid squares represent intratumoral injection of MiTDvv-hIL21, and the hollow squares represent intratumoral injection of PBS.

[0058] Fig.23 The anti-tumor effect of MiTDvv-hIL21 oncolytic virus in Example 11 on human osteosarcoma is shown. Fig.23 A shows the change of tumor volume over time after intratumoral injection of MiTDvv-hIL21 oncolytic poxvirus; as can be seen from the figure, MiTDvv-hIL21 oncolytic poxvirus can effectively inhibit tumor growth; wherein the X-axis is the time after administration, the Y-axis is the tumor volume, the solid squares represent intratumoral injection of MiTDvv-hIL21, and the hollow squares represent intratumoral injection of PBS. Fig.23B shows the change of relative tumor growth rate T / C (%) over time after intratumoral injection of MiTDvv-hIL21 oncolytic poxvirus; as can be seen from the 8th day after administration, the relative tumor growth rate of the drug administration group was less than 40%; wherein the X-axis is the time after administration, the Y-axis is T / C (%), and the solid squares represent intratumoral injection of MiTDvv-hIL21. Fig.23 C shows the change in mouse weight over time after intratumoral injection of MiTDvv-hIL21 oncolytic poxvirus; as shown in the figure, there was no significant decrease in mouse weight during the entire experiment; the X-axis is the time after administration, the Y-axis is the mouse weight, the solid squares represent intratumoral injection of MiTDvv-hIL21, and the hollow squares represent intratumoral injection of PBS.

[0059] Fig.24 The results show that the MiTDvv-hIL21 oncolytic virus in Example 12 has an inhibitory effect on human liver cancer. Fig.24 A shows the change of tumor volume over time after intratumoral injection of MiTDvv-hIL21 oncolytic poxvirus; as can be seen from the figure, MiTDvv-hIL21 oncolytic poxvirus can effectively inhibit tumor growth; wherein the X-axis is the time after administration, the Y-axis is the tumor volume, the solid squares represent intratumoral injection of MiTDvv-hIL21, and the hollow squares represent intratumoral injection of PBS. Fig.24 B shows the change in mouse weight over time after intratumoral injection of MiTDvv-hIL21 oncolytic poxvirus; as shown in the figure, there was no significant decrease in mouse weight during the entire experiment; the X-axis is the time after administration, the Y-axis is the mouse weight, the solid squares represent intratumoral injection of MiTDvv-hIL21, and the hollow squares represent intratumoral injection of PBS.

[0060] Fig.25 The killing effect of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses on tumor cells with different miR-199 expression levels evaluated in Example 13 is shown. The X-axis represents different types of tumor cells, the Y-axis represents cell growth inhibition rate, the black column represents MiTDvv-hIL21 oncolytic poxvirus, and the gray column represents DDvv-hIL21 oncolytic poxvirus.

[0061] Fig.26 The figure shows the comparison of the tumor inhibitory effects of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses in Example 14 on tumor-bearing mice with different miR-199 expression levels. Fig.26A shows the change in tumor volume over time after intratumoral injection of oncolytic poxvirus in tumor-bearing mice with human colorectal cancer HCT116 that lowly expresses miR-199; wherein the X-axis is the time after administration, the Y-axis is the tumor volume, the solid squares represent intratumoral injection of MiTDvv-hIL21, and the hollow squares represent intratumoral injection of DDvv-hIL21; as can be seen from the figure, the tumor inhibitory effect of MiTDvv-hIL21 is slightly stronger than that of DDvv-hIL21. Fig.26 B shows the change of tumor volume over time after intratumoral injection of oncolytic poxvirus in tumor-bearing mice with human osteosarcoma MNNG / HOS C1 that highly expresses miR-199; wherein the X-axis is the time after administration, the Y-axis is the tumor volume, the solid squares represent the intratumoral injection of MiTDvv-hIL21, and the hollow squares represent the intratumoral injection of DDvv-hIL21; as can be seen from the figure, the tumor inhibitory effect of MiTDvv-hIL21 is weaker than that of DDvv-hIL21.

[0062] Fig. 27 The tissue distribution of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses in mice in Example 15 is shown. Fig. 27 AF respectively show the distribution of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses in mouse ovaries, uterus, spleen, liver, lungs, and peripheral blood. The X-axis is the time after administration, the Y-axis is the virus content in the tissue, the black column represents the MiTDvv-hIL21 oncolytic poxvirus, and the gray column represents the DDvv-hIL21 oncolytic poxvirus.

[0063] Figure 12-15 , 22-25, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001 (compared with the corresponding control group, obtained by using the One-way ANOVA statistical analysis method). DETAILED DESCRIPTION

[0064] The present invention will be further illustrated below through the description of specific implementation methods and with reference to the accompanying drawings, but this is not a limitation of the present invention. Those skilled in the art can make various modifications or improvements based on the basic idea of ​​the present invention, but as long as they do not deviate from the basic idea of ​​the present invention, they are all within the scope of the present invention.

[0065] In the present invention, the terms "tumor", "cancer", "tumor cell" and "cancer cell" include the meanings generally recognized in the art.

[0066] As used herein, the term "oncolytic virus" or "oncolytic poxvirus" refers to a virus or poxvirus that is capable of selectively replicating in tumor cells and lysing tumor cells.

[0067] The term "therapeutically effective amount" as used herein refers to the amount of a functional pharmaceutical agent or pharmaceutical composition that can exhibit a detectable therapeutic effect or inhibitory effect, or an amount that exerts an anti-tumor effect. The effect can be detected by any test method known in the art.

[0068] As used herein, the term "administration" or "administering" refers to providing a compound, complex or composition (including viruses and cells) to a subject.

[0069] The term "patient" as used herein refers to a human or non-human organism. Therefore, the methods and compositions described herein are applicable to both human and veterinary diseases. In some embodiments, the patient suffers from a tumor. In some instances, the patient suffers from one or more types of cancer at the same time.

[0070] As used herein, the term "synergistic effect" refers to the effect of two or more agents working together, which is greater than the sum of the individual effects of each agent.

[0071] The term "pfu" or "plague forming unit" used herein means: the amount of virus that produces one plaque is called one plaque forming unit (pfu).

[0072] The term "MOI" or "multiplicity of infection" as used herein, i.e., the ratio of virus to cell number, refers to the number of virus particles that are used to initiate virus infection per cell. MOI = pfu / cell, i.e., number of cells x MOI = total PFU.

[0073] Strategies based on the use of endogenous microRNAs (miRNAs) to control viral replication have been widely used (see reference " et al., Generation of a conditionally replicating adenovirus based on targeted destruction of E1A mRNA by a cell type-specific MicroRNA. J Virol 82: 11009-11015. 2008”). miRNA is a 20-24 bp small nucleic acid molecule that plays an important biological role in the expression of the target gene or post-translational protein modification by binding to the non-coding region sequence of a specific target gene (see the literature "Ambros et al., The functions of animal microRNAs. Nature 431: 350-355 2004").In cancer research, it was found that the expression of a series of miRNA small molecules changed significantly during tumor development (see the literature "Negrini et al., MicroRNAs in human cancer: from research to therapy. J Cell Sci 120: 1833-1840. 2007"), showing multi-target regulation of cancer-related genes, such as mTOR, c-Met, HIF-1α and CD44 (see the literature "Fornari et al., miR-199a-3p regulates mTORand c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res 70: 5184-5193. 2010"; "Kim et al., MicroRNA miR-199a regulatesthe MET proto-oncogene and the downstream extracellular signal-regulatedkinase 2(ERK2). J Biol Chem 283: 18158-18166. 2008"; "Jia et al., Lentivirus-Mediated Overexpression of MicroRNA-199a Inhibits Cell Proliferation of HumanHepatocellular Carcinoma. Cell Biochem Biophys, 62:237–44.2011"; "Henry et al., miR-199a-3p targets CD44 and reduces proliferation of CD44 positivehepatocellular carcinoma cell lines. Biochem Biophys Res Commun 403:120-125.2010”).

[0074] In order to provide a new recombinant oncolytic poxvirus with obvious selectivity for tumor cells, the inventors of the present invention have selected a specific essential gene E10R in the genome of the oncolytic poxvirus after in-depth research and experimental exploration, and proposed to insert an exogenous nucleotide sequence in the 3'UTR region (3' untranslated region) of E10R, wherein the exogenous nucleotide sequence contains a target sequence of a specific microRNA, wherein the expression amount of the microRNA is lower in tumor cells than in normal cells. In this way, in normal cells infected with the oncolytic poxvirus, the highly expressed microRNA can target the mRNA corresponding to the 3'UTR region of the oncolytic poxvirus E10R, and inhibit the expression of E10R by degrading the mRNA or hindering its translation, thereby inhibiting the replication of the oncolytic poxvirus. In tumor cells infected with the oncolytic poxvirus, the microRNA is lowly expressed or not expressed, so the expression of E10R is not inhibited, thereby maintaining the replication ability of the oncolytic poxvirus. Therefore, the present invention utilizes the characteristics that the expression levels of specific microRNAs in normal tissues and tumor tissues in the body are different to provide a new recombinant oncolytic poxvirus with higher and more obvious selectivity for tumor cells. The inventors were surprised to find that the replication of the recombinant oncolytic poxvirus of the present invention in a variety of tumor cells is significantly higher than that in normal cells, thereby having better tumor specificity and safety, and can significantly inhibit the growth of tumor cells. Furthermore, since the new recombinant oncolytic poxvirus can only replicate in tumor cells that lack specific microRNAs, it can obtain stronger tumor cell selectivity and reduce the effect of the virus on normal tissues.

[0075] Based on the above concept, the present invention provides an isolated recombinant oncolytic poxvirus, which can be regulated by microRNA, and the expression level of the microRNA in tumor cells of mammals is lower than that in normal cells of the same mammal, wherein the target sequence of the microRNA is integrated in the 3'UTR region of the E10R gene in the genome of the recombinant oncolytic poxvirus.

[0076] The expression level of the microRNA in tumor cells of a mammal is lower than that in normal cells of the same mammal, which means that the expression level of the microRNA in at least one tumor cell of a mammal is lower than that in at least one normal cell of the same mammal. The mammal includes a human.

[0077] The present invention finds that the replication of the recombinant oncolytic poxvirus in tumor cells is significantly higher than that in normal cells, and can significantly inhibit the growth of tumor cells.

[0078] The microRNAs include those known in the art to be low in expression or not expressed in tumor cells, and also include those known to be low in expression or not expressed in tumor cells according to the techniques in the art. The microRNAs may be selected from: miR-9, miR-15a, miR-16, miR-26a, miR-27b, miR-29b, miR-30a, miR-32, miR-33, miR-34, miR-95, miR-101, miR-122, miR-124, miR-125a, miR-125b, miR-126, miR-127, miR-128, miR-133b, miR-139, miR -140, miR-142, miR-143, miR-145, miR-181, miR-192, miR-195, miR-198, miR-199a, miR-199b, miR-200, miR-203, miR-204, miR-205, miR-218, miR-219, miR-220, miR-224, miR-345, miR-375; preferably miR-199a, miR-199b. Among them, miR-199 (including miR-199a and miR-199b) can most effectively achieve the purpose of the present invention, and the resulting recombinant oncolytic poxvirus shows stronger tumor selectivity and safety. In the present invention, miRNA is a concept comprising any one of miRNA precursors and mature miRNAs, but unless otherwise specified, it refers to mature miRNA.

[0079] In the present description, the name numbers of the above-mentioned microRNAs are recognized and well-known in the art (for example, mature miRNA is abbreviated as miR, highly homologous miRNAs are followed by lowercase English letters, such as miR-199a and miR-199b), and they respectively have specific known nucleotide sequences, and the specific nucleotide sequences can be queried at the miRBase public database website (http: / / www.mirbase.org / ).

[0080] Mature miRNA (mature RNA) or miRNA mature body is produced by a series of nuclease shearing processing of a longer primary transcript. The length of the primary transcript (pri-miRNA) ranges from hundreds to thousands of bases, with a 5' end cap and a 3' poly A tail, as well as one or more hairpin stem-loop structures. The primary transcript is sheared to produce a miRNA precursor of about 70 bases, i.e., pre-miRNA. The miRNA precursor (pre-miRNA) is further sheared to form a single-stranded mature miRNA with a length of about 22 bases. In the cell, pri-miRNA and pre-miRNA as precursors, as well as mature miRNA, can usually be present. In this specification, miRNA is a concept that includes any one of miRNA precursors and mature miRNAs, but unless otherwise specified, it refers to mature miRNA.

[0081] Preferably, the target sequence of the microRNA is repeated, and the repetition preferably comprises 2-8 repetitions, more preferably comprises 3-4 repetitions. In some embodiments, the repeated target sequence of the microRNA is separated by a spacer region (e.g., gg, cc, ggcc) of 2 or more nucleotides. The target sequence of the repeated miRNA can be the reverse complement of the miRNA.

[0082] Preferably, the recombinant oncolytic poxvirus is TK gene function defective and / or VGF gene function defective. The oncolytic poxvirus constructed in this way achieves stronger tumor cell selectivity, and its replication in normal cells and killing of normal cells are significantly reduced compared with known oncolytic poxviruses (e.g., TK / VGF double defective poxviruses).

[0083] The term "functional defect" used in the present invention when referring to the gene of the oncolytic virus means that the oncolytic virus cannot perform the function of the gene, that is, loss of function, which can be achieved by (for example) inserting an exogenous fragment into the gene or knocking out the gene.

[0084] Therefore, an exogenous nucleotide sequence may be inserted into the TK gene to render it functionally defective. An exogenous nucleotide sequence may also be inserted into the VGF gene and / or the gene may be knocked out to render it functionally defective.

[0085] Preferably, an exogenous IL-21 gene is integrated into the genome of the recombinant oncolytic poxvirus, and the IL-21 gene can be expressed in tumor cells.

[0086] IL-21 (interleukin-21) is a multi-directional type I cytokine, mainly produced by T cells, regulating innate and acquired immune responses, and playing an important role in anti-tumor immune responses. There are literature reports on the effects of IL-21 on various immune cells and signal transduction (see the literature: "Leonard, WJ & Wan, C. IL-21 Signaling in Immunity. F1000 Research 5, 1–10 (2016)"). The various immune cells mainly include: 1) CD4 + T cells: promote proliferation and produce cytokines; T fh Cells: promote differentiation and improve development center function; T h17 1) Treg cells: promote differentiation and proliferation; 2) NKT cells: proliferate and enhance cytotoxicity; 3) CD8 + T cells: enhance cytotoxicity, proliferation and / or survival, anti-tumor effect; 4) NK cells: promote cell maturation, proliferation, enhance cytotoxicity, and enhance anti-tumor activity; 5) DC cells: inhibit antigen presentation function and induce apoptosis; 6) Macrophages: enhance phagocytosis; 7) B cells: promote proliferation and / or apoptosis, promote plasma cell differentiation and immunoglobulin production; 8) In addition, IL-21 can activate a variety of tumor-related signaling pathways, including JAK / STAT, MARK / PI3K and other signaling pathways, to regulate the development of tumors. In tumor immunotherapy, activation of NK cells and CD8 + T cell cytotoxicity is the key, and many studies have fully demonstrated that IL-21 plays an important role in this process. IL-21 promotes the maturation of NK cells to produce IFN-γ, granzyme B and perforin, induces NK cell-mediated anti-tumor cytotoxicity, and enhances the killing power of NK cells through antibody-dependent cell-mediated cytotoxicity (ADCC) (see the literature: "Spolski, R. & Leonard, WJ Interleukin-21: a double-edgedsword with therapeutic potential. Nat. Rev. Drug Discov. 13, 379–395 (2014)."). Secondly, IL-21 induces CD8 + T cell proliferation, induction of memory T cell generation, promotion of IFNγ / granzyme B secretion, etc., to enhance CD8 + T cells kill tumors and are conducive to the generation of memory immune responses to recurrent tumor cells. Importantly, unlike IL-2, IL-21 does not induce the expansion of Treg cells and further enhances CD8 +The immune response of T cells (see the literature: "Spolski, R. & Leonard, WJ Interleukin-21: a double-edged sword with therapeutic potential. Nat. Rev. Drug Discov. 13, 379–395 (2014)"). Based on the diverse effects of IL-21 on immune cells, it is shown that IL-21 can "reactivate" a variety of effector cells in the tumor microenvironment.

[0087] The present invention further strengthens the anti-tumor effect of oncolytic viruses by inserting the IL-21 gene that can regulate immunity into the genome of the new oncolytic poxvirus. In this way, not only can the oncolytic virus selectively replicate and kill tumor cells in tumor cells, and further induce the subsequent immune response of the body, but also the anti-tumor immune effect of exogenous IL-21 can be fully utilized. The present invention finds that integrating the IL-21 gene in the oncolytic poxvirus can produce a synergistic effect between the oncolytic killing effect of the oncolytic virus and the anti-tumor immune stimulation of IL-21.

[0088] Preferably, the exogenous IL-21 gene is inserted into the TK gene, so that the TK gene can be functionally defective and the IL-21 gene can be expressed after infecting tumor cells.

[0089] In the present invention, poxviruses that can be used include Wyeth strains or WR strains. An example of WR strain is VSC20.

[0090] In a preferred embodiment, the recombinant oncolytic poxvirus is obtained by genetically modifying the VSC20 poxvirus. The VSC20 poxvirus is a poxvirus with a VGF gene deletion, wherein the LacZ gene is inserted at the C11R site. The preparation method can be found in the scientific literature: "McCart, JA, et al. Systemic cancer therapy with a tumor-selective vaccinia virus mutant lacking thymidine kinase and vaccinia growthfactor genes. Cancer Res (2001) 61: 8751-8757.". The genetic modification includes inserting a repeated specific microRNA target sequence in the 3'UTR region of the E10R gene of the VSC20 poxvirus, such as a target sequence of miR-199 (miR-199a-3p or miR-199b-3p).

[0091] In some embodiments, the present invention uses genetic engineering to construct a shuttle plasmid containing the left and right homologous arms of the E10R gene and a repeated specific microRNA target sequence, and then introduces the shuttle plasmid into the VSC20 poxvirus to obtain a recombinant virus in which the repeated specific microRNA target sequence is inserted into the 3'UTR region of the E10R gene through a recombination mechanism. The process of a specific embodiment of constructing the shuttle plasmid is as follows: Figure 1 shown.

[0092] The genetic modification may also include inserting an exogenous sequence (e.g., an IL-21 gene) into the TK gene of the VSC20 poxvirus, thereby rendering the TK gene functionally defective, the specific method being as described in Preparation Example 3 or 4, or as described in Chinese Patent Publication CN109554353A, the entire text of which is incorporated herein by reference.

[0093] The genome of the recombinant oncolytic poxvirus may also be integrated with exogenous screening genes, including gpt (guanine phosphoribosyl transferase) gene, LacZ gene, fluorescent protein gene (eg, red fluorescent protein gene). Preferably, the fluorescent protein gene is not included to avoid the potential safety hazards caused by the expression of fluorescent protein in the patient.

[0094] The genome of the recombinant oncolytic poxvirus may not have an exogenous selection gene integrated therein.

[0095] In some embodiments, the present invention uses the poxvirus promoter p7.5 to control the gpt gene and the artificially synthesized poxvirus early / late promoter pSEL to control the exogenous IL-21 gene, and uses in vitro intracellular recombination technology to insert the gpt and IL-21 genes into the TK gene region of the poxvirus VSC20 strain to construct an oncolytic virus. The two promoters respectively start the expression of their respective regulatory genes in a back-to-back manner.

[0096] Preferably, the exogenous IL-21 gene is from mouse or human.

[0097] The recombinant oncolytic poxvirus of the present invention can be obtained by related known methods in the field of bioengineering.

[0098] Based on the recombinant oncolytic poxvirus developed by the present invention, the present invention also provides a pharmaceutical composition, wherein the pharmaceutical composition comprises the recombinant oncolytic poxvirus according to the present invention as an active ingredient, and pharmaceutically acceptable excipients.

[0099] Preferably, the pharmaceutical composition comprises a therapeutically effective amount of the recombinant oncolytic poxvirus. In certain embodiments, the active ingredient of the pharmaceutical composition comprises 1×10 5 Up to 5×10 9pfu / day dose of the recombinant oncolytic poxvirus according to the present invention (e.g., 1×10 5 Up to 3×10 9 pfu / day dose of the recombinant oncolytic poxvirus according to the present invention, 1×10 5 Up to 1×10 8 pfu / day dose of the recombinant oncolytic poxvirus according to the present invention, etc.).

[0100] The oncolytic virus can be administered by a method commonly used in the art, such as intratumoral injection or intravenous administration.

[0101] The pharmaceutical composition of the present invention may also contain other active ingredients known in the art, such as interleukin-2 (IL-2), IL-15, IL-17, IL-18, granulocyte-macrophage colony stimulating factor (GM-CSF), interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), etc., and the dosage and mode of administration may be carried out in accordance with their respective conventional methods. If other active ingredients are included, the recombinant oncolytic poxvirus should be independently present in the pharmaceutical composition without mixing with other active ingredients. For example, the recombinant oncolytic poxvirus is independently contained in a separate container.

[0102] Those skilled in the art will appreciate that the pharmaceutical composition of the present invention may further comprise suitable pharmaceutically acceptable excipients.

[0103] In some embodiments, the pharmaceutical composition of the present invention comprises one or more pharmaceutically acceptable carriers. Pharmaceutical preparations can be prepared by methods known in the art. For example, active ingredients such as compounds can be prepared with common excipients, diluents (such as phosphate buffer or saline), tissue culture medium, and carriers (such as autologous plasma or human serum albumin), and used as suspending agents. Other carriers can include liposomes, micelles, nanocapsules, polymeric nanoparticles, solid lipid particles (for example, see the document "E. Koren and V. Torchilin, Life, 63: 586-595, 2011"). The specific preparation method of the pharmaceutical composition of the present invention can be found in the description in scientific literature and patent literature, for example, see the latest edition of Remington's Pharmaceutical Science, Maack Publishing Company, Easton PA ("Remington's").

[0104] Another aspect of the present invention provides a vector for preparing the recombinant oncolytic poxvirus of the present invention.

[0105] The vector can transform the E10R gene in the poxvirus through a recombination mechanism. For example, in a specific embodiment, Figure 4As shown, the recombinant vector comprises the left and right homologous arms of the E10R gene, repeated target sequences of miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p), and an expression frame for activating the exogenous screening gene mCherry / Zeocin. Preferably, the vector can also cause the TK gene in the poxvirus to become functionally defective through a recombination mechanism. In another specific embodiment, as Figure 6 As shown, the recombinant vector comprises the left and right homology arms of the E10R gene, the target sequence of repeated miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p), the expression frame for activating the exogenous screening gene mCherry / Zeocin, and the TK homology fragments TK-L and TK-R. When the poxvirus is the WR strain, the sequence of the TK gene is the sequence shown in 80724-81257 bp in the poxvirus gene numbered NC_006998 in GenBank of NCBI (i.e., the National Center for Biotechnology Information, website: https: / / www.ncbi.nlm.nih.gov), then the sequence of TK-L can be, for example, the sequence fragment shown in 80724-80961 bp, and the sequence of TK-R can be, for example, the sequence fragment shown in 81033-81257 bp. The target sequence insertion site of the repeated miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p) can be, for example, at 56974 bp of the left homology arm of the E10R gene. Figure 8 As shown, the recombinant vector comprises the left and right homologous arms of the E10R gene, the repeated target sequence of miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p), the expression frame for activating the exogenous screening gene mCherry / Zeocin, the TK homologous fragments TK-L and TK-R, and the expression frames for activating the IL-21 gene and the exogenous screening gene gpt. The vector can insert the IL-21 gene expression frame and the gpt gene expression frame into the TK gene region of the poxvirus through the intracellular recombination mechanism (for example, the sequence fragment shown in 80962-81032 bp in the poxvirus gene numbered NC_006998 in GenBank is deleted), thereby causing the recombinant poxvirus to lose the TK gene function. The target sequence insertion site of the repeated miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p) can be, for example, at 56974 bp on the left homology arm of the E10R gene.

[0106] Another aspect of the present invention provides a host cell containing the vector of the present invention.

[0107] Another aspect of the present invention also provides use of the recombinant oncolytic poxvirus of the present invention in the preparation of a medicament for treating tumors and / or cancer.

[0108] The tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., gliomas), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0109] Another aspect of the present invention provides a method for treating tumors and / or cancers, comprising administering the recombinant oncolytic poxvirus according to the present invention to a tumor and / or cancer patient.

[0110] The tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., gliomas), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0111] In a preferred embodiment of the present invention, the administration dose of the recombinant oncolytic poxvirus is a therapeutically effective dose, once a day for 1-6 consecutive days; or once every 2 days for 1-6 consecutive times. The therapeutically effective dose is preferably 1×10 5 Up to 5×10 9 pfu / day dose (e.g., 1×10 5 Up to 3×10 9 pfu / day dose, 1×10 5 Up to 1×10 8 pfu / day dose, etc.).

[0112] If necessary, the recombinant oncolytic poxvirus of the present invention can also be used in combination with other drugs, such as interleukin-2 (IL-2), IL-15, IL-17, IL-18, granulocyte-macrophage colony stimulating factor (GM-CSF), interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), etc., and the dosage and administration method can be carried out in accordance with their respective conventional methods.

[0113] The method for treating tumors and / or cancers of the present invention may be performed once or multiple times on the patient according to actual conditions and needs.

[0114] The oncolytic virus can be administered by a method commonly used in the art, such as intratumoral injection or intravenous administration.

[0115] The present invention also provides a therapeutic agent, comprising:

[0116] (a) a first pharmaceutical composition, wherein the first pharmaceutical composition comprises the recombinant oncolytic poxvirus of the present invention in a first pharmaceutically acceptable carrier; and

[0117] (b) A second pharmaceutical composition, wherein the second pharmaceutical composition comprises NK cells in a second pharmaceutically acceptable carrier.

[0118] In some embodiments, the first pharmaceutically acceptable carrier and the second pharmaceutically acceptable carrier are the same. In other embodiments, the first pharmaceutically acceptable carrier and the second pharmaceutically acceptable carrier are different.

[0119] In some cases, the therapeutic agent may also be understood as a combination of drugs.

[0120] The mechanisms by which all oncolytic viruses kill tumor cells are generally similar. In different embodiments, the oncolytic virus contacts tumor cells by intratumoral injection or intravenous administration, and infects and enters the tumor cells. Due to the characteristics of oncolytic viruses, they mainly replicate and proliferate in tumor cells, but replicate at low levels or not in normal cells. Therefore, a large number of oncolytic viruses will appear in the infected tumor cells, causing the lysis and death of tumor cells. The lysis of tumor cells will release a large amount of tumor antigens and proliferated oncolytic viruses. The antigens will further activate the body's immune system, stimulating NK cells and T cells in the body to continue to attack tumor cells that have not yet died, and new oncolytic viruses will continue to infect tumor cells that have not yet been infected.

[0121] NK cells are immune cells that can kill tumor cells with a broad spectrum. NK cells can distinguish between tumor cells and normal cells. NK cells contact tumor cells, identify them as abnormal cells, and then kill tumor cells through multiple synergistic means such as receptor recognition, antibody targeted recognition (ADCC), granzyme secretion, perforin secretion, and secretion of interferon indirect killing. In vitro experiments show that a healthy NK cell can kill 27 tumor cells continuously during its life span.

[0122] NK cells also have antiviral functions. When normal cells are infected with viruses, as the virus replicates in large quantities, the cells show signs of aging and pathology, which is reflected in the changes in the composition of protein clusters on the cell membrane. In this process, NK cells can keenly and efficiently identify infected cells and kill infected cells through methods similar to those used to kill tumor cells, thereby inhibiting viral replication and proliferation. Subsequently, under the action of antigen stimulation and factors such as interferon, other immune cells will continue to work to resist the virus.

[0123] The present invention takes into account the respective characteristics of oncolytic viruses and NK cells, and cleverly combines them. When combined, the antiviral mechanism of NK cells is also applicable to tumor cells infected by oncolytic viruses, and is complementary to its anti-tumor mechanism. In addition, the combination also makes tumor cells containing oncolytic viruses become specific targets of NK cells, thereby enhancing the tumor killing effect of NK cells. Oncolytic viruses selectively proliferate in cancer cells, act intracellularly to kill cancer cells, and can cause changes in protein receptor clusters on cancer cell membranes, enhance NK cell recognition of cancer cells, and NK cells attack outside cancer cells. The two are combined to synergistically kill cancer cells, with better therapeutic effects. Further, the recombinant oncolytic poxvirus of the present invention also preferably expresses exogenous IL-21 at the same time, and the expressed exogenous IL-21 can enhance the lethality of NK cells and further enhance the killing effect of NK cells, so that the combination of the recombinant oncolytic poxvirus of the present invention and NK cells can produce surprising effects on the killing effect of tumors.

[0124] Preferably, the active ingredient of the first pharmaceutical composition is the recombinant oncolytic poxvirus described in the present invention, and the active ingredient of the second pharmaceutical composition is the NK cell.

[0125] Preferably, the first pharmaceutical composition and the second pharmaceutical composition are each independently present in the therapeutic agent without mixing with each other.

[0126] In the present invention, the NK cells can be selected from autologous NK cells and allogeneic NK cells; preferably, the NK cells are autologous NK cells obtained by in vitro amplification or allogeneic NK cells obtained by in vitro amplification. The large-scale in vitro amplification and culture technology of NK cells is known and has been basically mature (see (for example) the following scientific and technological literature: "Somanchi SS, Lee DA. Ex Vivo Expansion of Human NK Cells Using K562 Engineered to Express Membrane Bound IL21. Methods Mol Biol. 2016; 1441: 175-93. " or "Phan MT, Lee SH, Kim SK, Cho D. Expansion of NK Cells Using Genetically Engineered K562 Feeder Cells. Methods Mol Biol. 2016; 1441: 167-74. "). Clinical data confirm that autologous NK cells, half-matched allogeneic NK cells (allogeneic NK cells), and NK cells prepared from umbilical cord blood have no toxic side effects and long-term dependence after being transfused back into the human body, and are safe and effective.

[0127] The purity range of NK cells that can be used for treatment can be: the purity of autologous NK cells can be greater than or equal to 85%, and the purity of allogeneic NK cells can be greater than or equal to 90%; the impurity cells therein can be NK-T and / or γδT cells. Preferably, the activity (survival rate) of NK cells is greater than or equal to 90%, and the killing activity of NK cells is greater than or equal to 80%.

[0128] In the combined treatment regimen of the present invention, the present invention further explores and optimizes the respective administration doses of oncolytic virus and NK cells, which is crucial. Preferably, the first pharmaceutical composition comprises 1×10 5 -5×10 9 pfu / day dose of the recombinant oncolytic poxvirus (e.g., 1×10 5 -3×10 9 pfu / day dose of the recombinant oncolytic poxvirus, 1×10 5 -1×10 8 pfu / day dose of the recombinant oncolytic poxvirus, etc.), and the second pharmaceutical composition comprises 1×10 7 -1×10 10 The NK cells (preferably, the second pharmaceutical composition comprises 1×10 8 Up to 5×10 9 cells / day dose of the NK cells; preferably, the second pharmaceutical composition comprises 1×10 9 Up to 4×10 9 cells / day dose of the NK cells; more preferably, the second pharmaceutical composition comprises 1×10 9 Up to 3×10 9 Preferably, the active ingredient of the therapeutic agent consists of 1×10 5 Up to 5×10 9 pfu / day dose of the recombinant oncolytic poxvirus (e.g., 1×10 5 Up to 3×10 9 pfu / day dose of the recombinant oncolytic poxvirus, 1×10 5 Up to 1×10 8 pfu / day dose of the recombinant oncolytic poxvirus, etc.) and 1×10 7 Up to 1×10 10 The NK cells are dosed at 1×10 cells / day (e.g., 1×10 8 Up to 5×10 9 The NK cells at a dose of 1×10 9 Up to 4×10 9 The NK cells at a dose of 1×10 9 Up to 3×10 9The NK cells are composed of a dose of 1 cell / day, etc.

[0129] The recombinant oncolytic poxvirus can be administered by a commonly used administration method in the art, such as intratumoral injection or intravenous administration.

[0130] NK cells can be administered using a commonly used administration method in the art, such as intravenous administration.

[0131] Those skilled in the art will appreciate that the therapeutic agent of the present invention may further comprise suitable pharmaceutically acceptable excipients.

[0132] The therapeutic agent of the present invention may also contain other active ingredients known in the art, such as interleukin-2 (IL-2), IL-15, IL-17, IL-18, granulocyte-macrophage colony stimulating factor (GM-CSF), interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), etc.

[0133] In some embodiments, the therapeutic agent of the present invention comprises one or more pharmaceutically acceptable carriers. Pharmaceutical preparations can be prepared by methods known in the art. For example, active ingredients such as compounds can be prepared with common excipients, diluents (such as phosphate buffer or normal saline), tissue culture medium, and carriers (such as autologous plasma or human serum albumin), and used as suspending agents. Other carriers can include liposomes, micelles, nanocapsules, polymeric nanoparticles, solid lipid particles (for example, see the document "E. Koren and V. Torchilin, Life, 63: 586-595, 2011"). The specific preparation method of the therapeutic agent of the present invention can be found in the description in scientific literature and patent literature, for example, see the latest edition of Remington's Pharmaceutical Sciences, Maack Publishing Company, Easton PA ("Remington's").

[0134] The therapeutic agents of the present invention can treat a variety of tumors and / or cancers, including but not limited to: lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (such as gliomas), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0135] The method for administering the therapeutic agent of the present invention is to first administer the recombinant oncolytic poxvirus to a tumor and / or cancer patient, and then administer the NK cells to the tumor and / or cancer patient 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.) after the administration of the recombinant oncolytic poxvirus. “Administering the NK cells to the tumor and / or cancer patient 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.) after administering the recombinant oncolytic poxvirus” means that the time interval between the first administration of NK cells and the first administration of the recombinant oncolytic poxvirus is 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.), or the time interval between the first administration of NK cells and the most adjacent administration of the recombinant oncolytic poxvirus is 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.). Preferably, the time interval between the first administration of NK cells and the most adjacent administration of the recombinant oncolytic poxvirus is 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.). Also preferably, the time interval between the first NK cell administration and the most recent previous administration of the recombinant oncolytic poxvirus is 24-48 hours.

[0136] In a preferred embodiment of the present invention, the administration dose of the recombinant oncolytic poxvirus is a therapeutically effective amount, once a day, for 1-6 consecutive days; and the administration dose of the NK cells is 1×10 7 Up to 1×10 10 Cells / day dose (e.g., 1×10 8 Up to 5×10 9 Cells / day dose, 1×10 9 Up to 4×10 9 Cells / day dose, 1×10 9 Up to 3×10 9 In another preferred embodiment of the present invention, the dosage of the recombinant oncolytic poxvirus is a therapeutically effective amount, once every 2 days, for 2-6 consecutive days; and the dosage of the NK cells is 1×10 7 Up to 1×10 10 Cells / day dose (e.g., 1×10 8 Up to 5×10 9 Cells / day dose, 1×10 9 Up to 4×10 9 Cells / day dose, 1×10 9Up to 3×10 9 Cells / day dose), once every 2 days, for 2-6 consecutive days. Regardless of which of the above embodiments or other embodiments are adopted in the present invention, as long as the conditions for administering NK cells to the tumor and / or cancer patient are met from 18 hours to 72 hours after the administration of the recombinant oncolytic poxvirus, it is sufficient. The administration of the recombinant oncolytic poxvirus and the administration of NK cells can be an interval administration method (for example, the recombinant oncolytic poxvirus is administered on the 1st day, the NK cells are administered on the 2nd day, the recombinant oncolytic poxvirus is administered on the 3rd day, and the NK cells are administered on the 4th day... and so on); or a sequential administration method (for example, the recombinant oncolytic poxvirus is administered on the 1st day, the recombinant oncolytic poxvirus and NK cells are administered sequentially on the 2nd day, the recombinant oncolytic poxvirus and NK cells are administered sequentially on the 3rd day, and the recombinant oncolytic poxvirus and NK cells are administered sequentially on the 4th day... and so on); or other administration methods (for example, the recombinant oncolytic poxvirus is first administered once a day for 1-6 consecutive days, and then NK cells are administered again after an interval of 18-72 hours, once a day for 1-6 consecutive days). Preferably, the recombinant oncolytic poxvirus is administered first, and NK cells are administered 18-72 hours after the recombinant oncolytic poxvirus is fully administered. In a preferred embodiment of the present invention, the recombinant oncolytic poxvirus is first administered to a tumor and / or cancer patient, and the administration dose of the recombinant oncolytic poxvirus is a therapeutically effective amount, and is administered once; and the NK cells are administered to the tumor and / or cancer patient 18 to 72 hours after the administration of the recombinant oncolytic poxvirus, and the administration dose of the NK cells is 1×10 7 Up to 1×10 10 Cells / day dose (e.g., 1×10 8 Up to 5×10 9 Cells / day dose, 1×10 9 Up to 4×10 9 Cells / day dose, 1×10 9 Up to 3×10 9 The therapeutically effective amount of the recombinant oncolytic poxvirus is preferably 1×10 5 Up to 5×10 9 pfu / day dose (e.g., 1×10 5 Up to 3×10 9 pfu / day dose, 1×10 5 Up to 1×10 8 pfu / day dose, etc.).

[0137] The present invention also provides the use of the therapeutic agent of the present invention in preparing a medicine for treating tumors and / or cancers.

[0138] The tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., gliomas), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0139] On the other hand, the present invention also provides a medicine kit for treating tumors and / or cancers with a synergistic combination drug, comprising a first container containing the recombinant oncolytic poxvirus of the present invention and a second container containing the NK cells of the present invention, wherein the first container and the second container are independent; and instructions for specifying the timing and mode of administration. Preferably, the medicine kit consists of independent containers containing the recombinant oncolytic poxvirus of the present invention and the NK cells of the present invention, respectively, and instructions for specifying the timing and mode of administration.

[0140] The tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., gliomas), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0141] Preferably, the first container containing the recombinant oncolytic poxvirus of the present invention contains a therapeutically effective amount of the recombinant oncolytic poxvirus, and the second container containing NK cells contains enough to provide 1×10 7 -1×10 10 The NK cells are dosed at 1×10 cells / day (e.g., 1×10 8 Up to 5×10 9 The NK cells at a dose of 1×10 9 Up to 4×10 9 The NK cells at a dose of 1×10 9 Up to 3×10 9 The therapeutically effective amount of the recombinant oncolytic poxvirus is preferably 1×10 5 Up to 5×10 9 pfu / day dose (e.g., 1×10 5 Up to 3×10 9 pfu / day dose, 1×10 5 Up to 1×10 8 pfu / day dose, etc.).

[0142] Preferably, the first container containing the recombinant oncolytic poxvirus contains 1×10 5 -1×10 8pfu / day dose of the recombinant oncolytic poxvirus, and the second container containing NK cells contains 1×10 9 Up to 3×10 9 The NK cells are dosed at 1 cell / day.

[0143] In the present invention, the NK cells can be selected from autologous NK cells and allogeneic NK cells; preferably, the NK cells are autologous NK cells obtained by in vitro amplification or allogeneic NK cells obtained by in vitro amplification.

[0144] The recombinant oncolytic poxvirus can be administered by a respective administration method commonly used in the art, such as intratumoral injection or intravenous administration.

[0145] NK cells can be administered using a commonly used administration method in the art, such as intravenous administration.

[0146] The tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., gliomas), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0147] Another aspect of the present invention provides a method for treating tumors and / or cancers, comprising the following steps performed in sequence:

[0148] 1) administering the recombinant oncolytic poxvirus according to the present invention to a tumor and / or cancer patient;

[0149] 2) Administering the NK cells of the present invention to the tumor and / or cancer patient 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.) after administering the recombinant oncolytic poxvirus.

[0150] “Administering the NK cells of the present invention to the tumor and / or cancer patient 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.) after administering the recombinant oncolytic poxvirus” means that the time interval between the first administration of NK cells and the first administration of the recombinant oncolytic poxvirus is 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.), or the time interval between the first administration of NK cells and the most adjacent administration of the recombinant oncolytic poxvirus is 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.). Preferably, the time interval between the first administration of NK cells and the most adjacent administration of the recombinant oncolytic poxvirus is 18-72 hours (e.g., 20-70 hours, 22-48 hours, 24-48 hours, 30-48 hours, etc.). Also preferably, the time interval between the first NK cell administration and the most recent previous administration of the recombinant oncolytic poxvirus is 24-48 hours.

[0151] The tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., gliomas), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0152] Oncolytic viruses can selectively replicate in tumor or cancer cells and reach a peak after a certain period of time. The inventors of the present invention have found that after a period of replication, the oncolytic viruses in tumor cells promote the killing of tumor cells by NK cells. Therefore, the administration order and interval of the recombinant oncolytic poxvirus and NK cells proposed in the present invention achieve a double peak overlap of the peaks of the two actions.

[0153] The present invention further explores and optimizes the respective administration dosages of the recombinant oncolytic poxvirus and NK cells, which are crucial in combination with the above-mentioned administration order and administration interval, and determine the anti-tumor efficacy of the recombinant oncolytic poxvirus, the anti-tumor efficacy of NK cells, and the optimal synergistic killing of tumor cells by the two.

[0154] In a preferred embodiment of the present invention, the administration dose of the recombinant oncolytic poxvirus is a therapeutically effective amount, once a day, for 1-6 consecutive days; and the administration dose of the NK cells is 1×10 7 Up to 1×10 10 Cells / day dose (e.g., 1×10 8 Up to 5×10 9 Cells / day dose, 1×10 9 Up to 4×109 Cells / day dose, 1×10 9 Up to 3×10 9 In another preferred embodiment of the present invention, the dosage of the recombinant oncolytic poxvirus is a therapeutically effective amount, once every 2 days, for 2-6 consecutive days; and the dosage of the NK cells is 1×10 7 Up to 1×10 10 Cells / day dose (e.g., 1×10 8 Up to 5×10 9 Cells / day dose, 1×10 9 Up to 4×10 9 Cells / day dose, 1×10 9 Up to 3×10 9 Cells / day dose), once every 2 days, for 2-6 consecutive days. Regardless of which of the above embodiments or other embodiments are adopted in the present invention, as long as the conditions for administering NK cells to the tumor and / or cancer patient are met from 18 hours to 72 hours after the administration of the recombinant oncolytic poxvirus, it is sufficient. The administration of the recombinant oncolytic poxvirus and the administration of NK cells can be an interval administration method (for example, the recombinant oncolytic poxvirus is administered on the 1st day, the NK cells are administered on the 2nd day, the recombinant oncolytic poxvirus is administered on the 3rd day, and the NK cells are administered on the 4th day... and so on); or a sequential administration method (for example, the recombinant oncolytic poxvirus is administered on the 1st day, the recombinant oncolytic poxvirus and NK cells are administered sequentially on the 2nd day, the recombinant oncolytic poxvirus and NK cells are administered sequentially on the 3rd day, and the recombinant oncolytic poxvirus and NK cells are administered sequentially on the 4th day... and so on); or other administration methods (for example, first administering the recombinant oncolytic poxvirus once a day for 1-6 consecutive days, and then administering NK cells again after an interval of 18-72 hours, once a day for 1-6 consecutive days). Preferably, the recombinant oncolytic poxvirus is administered first, and the NK cells are administered 18-72 hours after the recombinant oncolytic poxvirus is fully administered. In a preferred embodiment of the present invention, the recombinant oncolytic poxvirus is first administered to the tumor and / or cancer patient, and the oncolytic virus is administered in a therapeutically effective dose, administered once; and the NK cells are administered to the tumor and / or cancer patient 18 to 72 hours after the oncolytic virus is administered, and the NK cells are administered in a dose of 1×10 7 Up to 1×10 10 Cells / day dose (e.g., 1×10 8 Up to 5×10 9 Cells / day dose, 1×10 9 Up to 4×10 9 Cells / day dose, 1×10 9 Up to 3×10 9The therapeutically effective amount of the recombinant oncolytic poxvirus is preferably 1×10 5 Up to 5×10 9 pfu / day dose (e.g., 1×10 5 Up to 3×10 9 pfu / day dose, 1×10 5 Up to 1×10 8 pfu / day dose, etc.).

[0155] The method for treating tumors and / or cancers of the present invention may be performed once or multiple times on the patient according to actual conditions and needs.

[0156] In the present invention, the NK cells can be selected from autologous NK cells and allogeneic NK cells; preferably, the NK cells are autologous NK cells obtained by in vitro amplification or allogeneic NK cells obtained by in vitro amplification.

[0157] The tumors and / or cancers include: lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., gliomas), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0158] The recombinant oncolytic poxvirus can be administered by a commonly used administration method in the art, such as intratumoral injection or intravenous administration.

[0159] NK cells can be administered using a commonly used administration method in the art, such as intravenous administration.

[0160] The following further explains or illustrates the content of the present invention by way of examples, but these examples should not be construed as limiting the scope of protection of the present invention.

[0161] example

[0162] Unless otherwise specified, the experimental methods used in the following examples were performed using conventional experimental procedures, operations, materials, and conditions in the field of bioengineering.

[0163] Unless otherwise specified, the percentage concentration (%) of each reagent refers to the volume percentage concentration (% (v / v)) of the reagent.

[0164] The biological materials used in the following examples are as follows:

[0165] 1.CV1 African green monkey kidney cells (culture medium: 10% FBS+MEM+1% P / S) were from ATCC, MRC-5 human normal embryonic lung fibroblasts (culture medium: 10% FBS+DMEM+1% P / S) were from the Shanghai Cell Bank of the Chinese Academy of Sciences, HEK-293 and HEK-293T human embryonic kidney cells (culture medium: 10% FBS+DMEM+1% P / S) were from Agilent Technologies and the Shanghai Cell Bank of the Chinese Academy of Sciences, respectively, and HUVEC human normal umbilical vein endothelial cells (10% FBS+H-004B+1% P / S) were from Shanghai Ausails Co., Ltd.

[0166] 2. Tumor cells: Tumor cell sources and cell culture medium are shown in Table A below

[0167] Table A

[0168]

[0169]

[0170] McCoy's 5A, F12K, IMDM, DMEM, RPMI1640 and MEM were purchased from GIBCO, fetal bovine serum (FBS) was purchased from SIGMA, and penicillin-streptomycin (P / S) solution (100X) was purchased from Bio-Tech.

[0171] 3. Virus: The backbone vector VSC20 poxvirus is a poxvirus lacking the VGF gene. The preparation method can be found in the scientific literature: "McCart, JA, et al. Systemic cancer therapy with a tumor-selective vacciniavirus mutant lacking thymidine kinase and vaccinia growth factor genes. Cancer Res (2001) 61: 8751-8757.". It is genetically modified, including using the artificially synthesized poxvirus early / late promoter pSEL to regulate the exogenous human IL21 gene, and using intracellular recombination technology to insert the human IL21 gene into the TK gene region of the poxvirus VSC20 strain, thereby constructing the oncolytic poxvirus DDvv-hIL21 (see Chinese patent application publication CN109554353A).

[0172] The oncolytic poxvirus DDVV-RFP used as a control virus is known and belongs to the oncolytic poxvirus WR strain (see, for example, the scientific literature: "X Song, et al. T-cell Engager-armed Oncolytic Vaccinia Virus Significantly Enhances Antitumor Therapy Molecular Therapy. (2014); 22 1, 102-111"). The TK gene and VGF gene of the virus are both functionally defective and carry an exogenous red fluorescent protein (RFP) gene. Since the RFP gene only plays a screening / reporting role, the anti-tumor function of the oncolytic poxvirus DDVV-RFP is basically equivalent to that of oncolytic poxviruses with functional defects in the TK gene and VGF gene. The oncolytic poxvirus DDvv-RFP can also be obtained by genetically modifying the VSC20 poxvirus using conventional techniques in the art. VSC20 poxvirus is a poxvirus lacking the VGF gene. The preparation method can be found in the scientific literature: "McCart, JA, et al. Systemic cancer therapy with a tumor-selective vaccinia virus mutant lacking thymidine kinase and vaccinia growth factor genes. Cancer Res (2001) 61: 8751-8757.". The genetic modification includes using an artificially synthesized poxvirus early / late promoter pSEL to regulate the exogenous RFP gene, and using in vitro intracellular recombination technology to insert the RFP gene into the TK gene region of the poxvirus VSC20 strain, thereby constructing the oncolytic poxvirus DDVV-RFP.

[0173] 4. C57BL / 6 mice and BalBc-Nude mice were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. Severe immunodeficient NCG mice were obtained from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.

[0174] 5. Culture plate: 6-well cell culture plate, 24-well cell culture plate and 96-well cell culture plate were all obtained from Corning.

[0175] 6. GPT drug preparation: Use 0.1N NaOH to prepare 10mg / ml mycophenolic acid (400×), 10mg / ml 40× xanthine (40×), and 10mg / ml hypoxanthine (670×), respectively, and store at -20°C away from light. Prepare 1× working solution when using: add 100μl of 400× mycophenolic acid, 40μl of 40× xanthine, and 60μl of 670× hypoxanthine to 40ml DMEM, mix well, filter with a 0.22μm filter membrane, and set aside.

[0176] 7. PBS formula: 8mM Na 2 HPO 4 , 136 mM NaCl, 2 mM KH 2 PO 4 , 2.6 mM KCl, pH 7.2-7.4.

[0177] 8. Virus purification solution formula: 60% (w / v), 50% (w / v), 40% (w / v), 30% (w / v) sucrose solution

[0178] The cell counting method used in the following examples is as follows:

[0179] MTT method: add 10 μl MTT solution (5 mg / ml) to each well of cells, culture in a 37°C incubator for 4 to 6 hours, discard the culture medium, add 150 μl DMSO to each well, place on a shaker and shake at low speed for 10 minutes to fully dissolve the crystals, and use a microplate reader to detect its absorbance at 490 nm (OD490). Inhibition rate calculation formula: Cell proliferation inhibition percentage (IR%) = 1-(OD490 test sample-OD490 blank) / (OD490 negative control-OD490 blank) × 100%.

[0180] The abbreviations used in the following examples are explained below:

[0181] miR199T: target sequence of miR199 (hsa-miR-199a-3p or hsa-miR-199b-3p)

[0182] FBS: Fetal bovine serum

[0183] P / S: Penicillin-Streptomycin

[0184] mCherry / Zeocin: Red fluorescent protein / zeocin

[0185] DMSO: dimethyl sulfoxide

[0186] Preparation Example 1: Construction of pZB-E10R-miR199T plasmid

[0187] To construct the shuttle plasmid pZB-E10R-miR199T carrying four repeated miR199T sequences, 4×miR199T repeated fragments were first synthesized by gene synthesis, each fragment was connected using GG, and inserted into the 3'UTR region of the poxvirus gene E10R (the insertion site was the 56974 bp of the left homology arm of the E10R gene). Then, the mCherry / Zeocin gene driven by the mH5 promoter was inserted, and its 5' and 3' ends each contained a LoxP sequence in the same direction. The DNA sequence of miR199T (SEQ ID NO.1) is as follows: 5'-acagtagtctgcacattggtta-3' (the miRBase database accession number of the corresponding miRNA mature body is MIMAT0000232 (hsa-miR-199a-3p) or MIMAT0004563 (hsa-miR-199b-3p)).

[0188] In summary, the construction process was to use pcDNA3.1(+)-E10R-mCherry / Zeocin containing the left and right homologous arms of the poxvirus gene E10R and the mCherry / Zeocin gene, the plasmid pUC-57-miR199T containing four repeats of miR199T (synthesized and constructed by Beijing Qingke Xinye Biotechnology Co., Ltd.), and the pCB plasmid (source can be found in the literature "Fang Yourong et al., Construction of recombinant vaccinia virus vector with Zeocin and GFP double selection markers. "International Journal of Epidemiology and Infectious Diseases", 2012.39(3):148-152.") to obtain pZB-E10R-miR199T (such as Figure 1 ).

[0189] The specific operations are as follows:

[0190] The following PCR program can be carried out under temperature and cycle conditions within the conventional range and appropriately adjusted according to actual conditions. It is a conventional technique in the art and will not be described in detail.

[0191] 1) Construction of pcDNA3.1(+)-E10R-mCherry / Zeocin plasmid: Using the poxvirus Dvv-VSC20 genome as template (the virus source can be found in the literature “McCart, JA, et al. Systemic cancer therapy with a tumor-selectivevaccinia virus mutant lacking thymidine kinase and vaccinia growth factor genes. Cancer Res (2001) 61:8751–8757.”), PCR was performed (primer sequences are as follows: L-armE10: AGTCCTCGAGCTAATATTGAGAAATTCATC (SEQ ID NO. 2); E10R1:

[0192] The E10R gene and the left homology arm F1 fragment were obtained by PCR (primer sequences are as follows: L-arm E10: AGTCCTCGAGCTAATATTGAGAAATTCATC (SEQ ID NO.2); E10R2:

[0193] The E10R left homology arm fragment F2 was obtained by PCR using the pCBmCZ-tTFNGR plasmid (source can be found in the literature "Fang Yourong et al., Construction of Zeocin and GFP double selection marker recombinant vaccinia virus vector. International Journal of Epidemiology and Infectious Diseases, 2012.39(3):148-152.") as a template (primer sequences are as follows: 199H5:

[0194] ATGTGCAGACTACTGTCCTAACCAATGTGCAGACTACTGTCCAAAAATTGAAAATAAATAC (SEQ ID NO.5); Zeo-rev, GATCAAGATCTTTAGTCCTGCTCCTCGGCCAC (SEQ ID NO.6)) to obtain the mH5 promoter and mCherry / Zeocin fragment F3. The poxvirus Dvv-VSC20 genome was used as a template by PCR (primer sequences are as follows: E11UP:

[0195] GATCAAGATCTTTATAAACTTAACCCATTATAAAAC (SEQ ID NO.7); R-arm, AGTCGGATCCTTGACAGTCTTGAACAATTATAC (SEQ ID NO.8)) to obtain the right homology arm F4 containing poxvirus E10R. The F2 and F3 fragments were phosphorylated and connected by T4 DNA ligase (Thermo Company, E10011), and the connected fragments were used as templates for PCR (primer sequences are as follows: L-armE10, AGTCCTCGAGCTAATATTGAGAAATTCATC (SEQ ID NO.2);

[0196] Zeo-rev, GATCAAGATCTTTAGTCCTGCTCCTCGGCCAC (SEQ ID NO.6)) to obtain the fusion fragment F5 containing the left homology arm of E10R and the mCherry / Zeocin sequence. After the fragments F4 and F5 were digested with restriction endonuclease BglⅡ (Thermo Company, ER0082), they were connected by T4 DNA ligase to obtain the E10R-mCherry / Zeocin fragment containing the left and right homology arms of E10R and the mCherry / Zeocin sequence. The E10R-mCherry / Zeocin fragment and plasmid pCDNA3.1(+) (Invitrogen) were cut with restriction endonucleases BamHⅠ (Thermo Company, FD0054) and XhoⅠ (Thermo Company, FD0694), respectively, and then connected with T4 DNA ligase. Escherichia coli DH5α (TIANGEN Company, CB101) was transformed, and a single clone was picked to obtain the pcDNA3.1(+)-E10R-mCherry / Zeocin plasmid, which was confirmed to be correct by sequencing.

[0197] 2) Construction of pZB-1 plasmid: The linearized L-pCB fragment was obtained by PCR with pCB plasmid as template (the primer sequences used were: zP12-F: CCGCTCGAGGCTGGCGTTTTTCCATAGG (SEQ ID NO.33); zP12-R: CGCggatccCGGTCTGGTTATAGGTACATTGAG (SEQ ID NO.34)). pcDNA3.1(+)-E10R-mCherry / Zeocin and L-pCB were double-digested with restriction endonucleases BamHⅠ and XhoⅠ to obtain L-E10R-E11L / D and L-pCB / D fragments, which were then connected by T4 DNA ligase and finally transformed with Escherichia coli DH5α. A single clone was picked to obtain the pZB-1 plasmid, and the correctness was confirmed by sequencing.

[0198] 3) Construction of pZB-2 plasmid: Using pZB-1 plasmid template, PCR method (primer sequences are as follows: zP13-F: CCCAAGCTTTTAGTCCTGCTCCTCGGCC (SEQ ID NO.9); zP11m-R:

[0199] ATAACTTCGTATAGCATACATTATACGAAGTTATCTTTATAAACTTAACCCATTATAAAAC (SEQ ID NO.10)) was inserted into the 3' of mCherry / Zeocin by LoxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO.11)) to obtain L-pZB-1 fragment (4815 bp), which was self-ligated using T4 DNA ligase and transformed into Escherichia coli DH5α. A single clone was picked to obtain pZB-2 plasmid, which was confirmed to be correct by sequencing.

[0200] 4) Construction of pZB-E10R-miR199T plasmid: Using pZB-2 plasmid as template, PCR method (primer sequences are as follows: zP11-F: CCGTATTTGGGATCAGATG (SEQ ID NO.12); zP11-R: CAAAGGTTCTTGAGGGTTGTG (SEQ ID NO.13)) was used to obtain a fragment (4689 bp) containing L-E10R-E11L-LoxP. pUC-57-miR199T was double-digested with restriction endonucleases KpnⅠ (Thermo Company, FD0524) and SacⅠ (Thermo Company, FD1133) to obtain the L-miR199T fragment: CAATTTAACACAACCCTCAAGAACCTTTGTATTTATTTTCAATTTTTATAACTTCGTATAATGTATGCTATACGAAGTTATGGACAGTAGTCTGCACATTGGTTAGGACAGTAGTCTGCACATTGGTTAGGACAGTAGTCTGCACATTGGTTAGGACAGTAGTCTGCACATTGGTTATTAAGAAGCATAGTCTGGAACATCATATGGATATAAAGGGTTAACCTTTGTCACATCGATCGCGTATTTGGGATCAGATGGTAC (SEQ ID NO.35). The pZB-E10R-miR199T plasmid was obtained by one-step cloning (TreliefTMsosoo cloning kit ver.2, Beijing Qingke Xinye Biotechnology Co., Ltd., TSV-S2) and ligated with the fragment containing L-E10R-E11L-LoxP (4689 bp), transformed with E. coli DH5α, and single clones were selected. BamHI and SmaⅠ (Thermo Company, FD0663) were used for restriction enzyme digestion verification ( Figure 2 ) and sequenced using primers Z10, Z11, Z14 and Z15 (Beijing Qingke Xinye Biotechnology Co., Ltd.) to confirm that the sequence was correct (sequencing primer sequences are shown in Table 1).

[0201] Table 1

[0202]

[0203] Preparation Example 2: Packaging and identification of VSC20-mT / mCherry virus

[0204] 1) Recombination of oncolytic poxvirus: a) CV1 cells were plated in 6-well plates, 4×10 510 cells / well, so that the cell density reaches 80%-90% the next day. Discard the MEM in the 6-well plate and add 1 ml of serum-free and antibiotic-free MEM medium to each well, containing 8×10 3 pfu of Dvv-VSC20 virus to an infection concentration of 0.02 MOI, culture at 37°C for 2 hours, discard the culture medium, replace it with 2% FBS + 1% P / S MEM medium, add 300 μl plasmid / Lipo3000 (Lipofectamine OR 3000 transfection reagent, Invitrogen TM , L3000-015) mixture (Solution A: 2 μg pZB-E10R-miR199T plasmid and 4 μl P3000 reagent (Invitrogen TM Solution A: 10 μl of Lipo3000 was added to 300 μl of Opti-MEM I and mixed, and incubated at room temperature for 5 minutes; Solution B: 10 μl of Lipo3000 was added to 300 μl of Opti-MEM I and mixed, and incubated at room temperature for 5 minutes; Solution A and Solution B were mixed and incubated at room temperature for 15 minutes) and placed in an incubator (37°C, 5% CO 2 ) and continue to culture. b) After 24-48 hours, when the cells are completely diseased under the microscope, collect the supernatant and cells, freeze and thaw three times, centrifuge at 300g for 5 minutes, collect the virus released in the supernatant, and mark it as P0 virus. c) Take out 200μl of the virus, use the TIANamp Virus DNA / RNA kit (TIANGEN, DP315) to extract the viral genome, and use the PCR method using zP19 / zP20 primers to identify the successful recombination of VSC20-mT / mCherry.

[0205] 2) Screening of monoclonal recombinant oncolytic poxvirus: a) CV1 cells were plated in 5 100 mm culture dishes so that the cell density reached 80%-90% the next day. The MEM medium was discarded and 3 ml of serum-free culture medium with gradient dilutions of P0 virus (gradient dilutions were 10 -1 -10 -5 ) and placed in an incubator at 37°C, 5% CO 2 Incubate for 2 hours, cross-mix every 30 minutes, and continue incubating for another 2 hours. Then discard the culture medium and add 10 ml of 2% (w / v) agarose gel (MEM culture medium containing 2% FBS). After solidification, place in an incubator at 37°C and 5% CO. 2Continue to culture. b) After about 48 hours, pick a single plaque with red fluorescence and put it into 200μl sterile PBS. Repeat freezing and thawing three times to release the virus. Take 100μl of virus solution from each plaque and use CV1 cells (cells reach 80% full) in a 24-well plate for small-scale amplification. After about 48 hours when the cells are completely diseased, collect the viruses and mark them as P1-X (X is the number 1, 2, 3, 4..., representing different virus clones). Take 200μl of virus solution from each plaque and use the TIANamp Virus DNA / RNA kit to extract the genome. Use PCR to identify it, and store the remaining virus solution at -80℃. Repeat the above screening steps 4 times to obtain the P5 generation virus. PCR uses primers zP19 and zP20 (primer sequences are shown in Table 1) to obtain a 2310bp band, confirming the VSC20-mT / mCherry monoclonal recombinant virus ( Figure 3 ). Z11, Z15, zP19 and zP20 sequencing (primer sequences are shown in Table 1) were used to confirm the sequence was correct. The VSC20-mT / mCherry viral vector lacks the VGF gene function and inserts 4 repeats of the miR199T sequence and the mCherry red marker gene in the 3'UTR region of the E10R gene for screening ( Figure 4 ).

[0206] Preparation Example 3: Packaging and Identification of MiTDvv-mCherry Backbone Virus

[0207] 1) Recombination of oncolytic poxvirus: CV1 cells were plated in 6-well plates, 4×10 5 cells / well, so that the cell density reaches 80%-90% the next day; discard the MEM medium in the 6-well plate, add 1 ml of serum-free and antibiotic-free MEM medium to each of the two wells, containing 8×10 3 pfu of VSC20-mT / mCherry to an infection concentration of 0.02 MOI, culture at 37°C for 2 hours, discard the culture medium and replace it with 2% FBS + 1% P / S MEM medium, add 300 μl of pCB plasmid / Lipo3000 mixed solution (prepared as in Preparation Example 2), observe under a microscope after 24-48 hours to see that the cells are completely diseased, collect the supernatant and cells, freeze and thaw repeatedly 3 times, centrifuge at 300g for 5 minutes, collect the virus released from the supernatant, mark it as P0 generation virus, use TIANamp Virus DNA / RNA kit (TIANGEN, DP315) to extract the viral genome, and use PCR method using P5 / P18 primers to confirm the successful recombination of MiTDvv-mCherry virus.

[0208] 2) GPT drug screening: CV1 cells were cultured in a 60 mm culture dish. When the dish reached 80% full, 1 ml of virus diluent diluted with MEM, containing 150 μl of P0 virus, was added. After 2 hours of infection, 4 ml of 0.5× GPT screening drug was added for screening. Cell lesions were observed and viruses were collected and labeled as P1 virus. The above steps were repeated twice to obtain P3 virus.

[0209] 3) Screening of monoclonal recombinant oncolytic poxvirus: The specific operation is the same as that in Preparation Example 2. After CV1 cells were infected with gradient diluted P3 virus for 4 hours, 10 ml of 2% (w / v) agarose gel was added to fix the virus and cultured for about 48 hours. A single plaque with red fluorescence was picked for PCR identification. According to the PCR results, positive clones were screened repeatedly for P4-P5 generations to obtain MiTDvv-mCherry monoclonal virus. PCR identification contained a 1840 bp band (primers P5 and P18 sequences are shown in Table 1) and did not contain a 622 bp band (primers P1 and P2 sequences are shown in Table 1) ( Figure 5 ). Primers P5 and P18 sequencing were used to confirm (Beijing Qingke Xinye Biotechnology Co., Ltd.), and the MiTDvv-mCherry backbone virus was a double deletion of the VGF functional gene and the TK functional gene, with 4 repeated fragments of the miR199T sequence and the mCherry red marker gene inserted in the 3'UTR region of the E10R gene, and the gpt screening gene was carried in the TK gene region ( Figure 6 ).

[0210] Preparation Example 4: Packaging and identification of MiTDvv-hIL21-mCherry oncolytic virus

[0211] 1) Recombination of oncolytic poxvirus: CV1 cells were plated in 6-well plates, 4×10 5 cells / well, so that the cell density reaches 80%-90% the next day; discard the MEM medium in the 6-well plate, add 1 ml of serum-free and antibiotic-free MEM medium to each of the two wells, containing 8×10 3pfu of DDvv-hIL21 virus (preparation method as described in Chinese patent publication CN109554353A, the entire contents of which are incorporated herein by reference), to an infection concentration of 0.02 MOI. Culture at 37°C for 2 hours, discard the culture medium and replace it with 2% FBS + 1% P / S MEM medium, add 300 μl pZB-E10R-miR199T plasmid / Lipo3000 mixed solution (prepared as in Preparation Example 2), observe the cells under a microscope after 24-48 hours to see complete lesions, collect the supernatant and cells, freeze and thaw repeatedly 3 times, centrifuge at 300g for 5 minutes, collect the virus released in the supernatant, and mark it as P0 generation virus. The viral genome was extracted using the TIANamp VirusDNA / RNA kit (TIANGEN, DP315), and the PCR method was used to confirm the successful recombination of the MiTDvv-hIL21-mCherry oncolytic virus using zP19 / zP20 primers.

[0212] 2) Screening of monoclonal recombinant oncolytic poxvirus: The specific operation is the same as that in Preparation Example 2). CV1 cells were infected with gradient diluted P0 virus for 4 hours, and then 10 ml of 2% (w / v) agarose gel was added to fix the virus and cultured for about 48 hours. Single plaques with red fluorescence were picked for PCR identification. Based on the PCR results, positive clones were screened repeatedly for P2-P5 generations to obtain monoclonal virus. PCR identification (primers zP19 and zP20 sequences are shown in Table 1) contained 2310 bp ( Figure 7 ), and the sequence was confirmed by sequencing with Z11, Z15, zP19 and zP20 (primer sequences are shown in Table 1) (Beijing Qingke Xinye Biotechnology Co., Ltd.). MiTDvv-hIL21-mCherry oncolytic virus double-deleted VGF functional gene and TK functional gene, inserted 4 repeats of miR199T sequence and mCherry red marker gene in the 3'UTR region of E10R gene, and carried IL-21 functional gene in the TK gene region ( Figure 8 ).

[0213] Preparation Example 5: Preparation of MiTDvv backbone virus and MiTDvv-hIL21 oncolytic virus by Cre-LoxP cleavage system

[0214] Obtaining MiTDvv backbone virus (MiTDvv-mCherry virus with mCherry / Zeocin sequence removed) and MiTDvv-hIL21 oncolytic virus (MiTDvv-hIL21-mCherry virus with mCherry / Zeocin sequence removed):

[0215] 1) CV1 cells were plated in 6-well plates, 4×10 5Cells / well were added to make the cell density reach about 70% the next day. After replacing the MEM medium with 5% FBS + 1% P / S, 300 μl of pBS185 CMV-Cre plasmid (the plasmid is driven by CMV promoter and can express Cre enzyme in mammalian cells, purchased from Addgene, catalog number #11916) / Lipo3000 mixed solution (prepared as in Preparation Example 2) was added to each well. The mixture was incubated at 37°C and 5% CO 2 After 24 h of culture, 8 × 10 5 pfu of MiTDvv-mCherry and MiTDvv-hIL21-mCherry viruses, and set up control wells with only virus added and only plasmid transferred. Cross-mix and continue to culture for 24 hours and observe under a microscope. After the cells are completely diseased, collect the viruses, freeze-thaw repeatedly for 3 times, centrifuge at 300g for 5 minutes, collect the supernatant, and mark it as P0 virus.

[0216] 2) CV1 cells were plated in 5 100 mm culture dishes so that the cell density reached 80%-90% the next day. The P0 virus was diluted 10-fold to 10 -1 -10 -5 , discard the MEM medium in the culture dish, add 3 ml of MEM medium to each culture dish to make gradient dilutions of the virus solution, and place it in an incubator at 37°C and 5% CO 2 Incubate for 2 hours, cross-mix every 30 minutes, and continue incubating for 2 hours, then discard the culture medium, add 10 ml of 2% (w / v) agarose gel, and continue culturing in an incubator after solidification. After about 48 hours, pick a single plaque without red fluorescence and put it into 200 μl of sterile PBS, freeze and thaw repeatedly three times to release the virus, take 100 μl of virus solution from each plaque and use 80% full wells of CV1 cells for small amplification in a 24-well plate, about 48 hours after the cells are completely diseased, collect the virus and mark it as P1-X (X is the number 1, 2, 3, 4..., representing different virus clones), take 200 μl of virus solution from each plaque to extract the genome, and use PCR method to identify (primers zP19 and zP20, sequence see Table 1).

[0217] 3) Repeat step 2) once to obtain P2 generation monoclonal viruses MiTDvv and MiTDvv-hIL21, identify them by PCR (primers zP19 and zP20, sequences are shown in Table 1), and sequence them using zP19 and zP20 (primer sequences are shown in Table 1) to confirm the sequence is correct (Beijing Qingke Xinye Biotechnology Co., Ltd.), and then store them at -80°C.

[0218] PCR and sequencing results showed that the four-repeat miR199T sequence in the MiTDvv backbone virus had been integrated into the 3'UTR region of the E10R of the Dvv-VSC20 poxvirus, and did not contain the mCherry / Zeocin sequence. The gpt gene was integrated into the TK region to inactivate the TK function. The four-repeat miR199T sequence in the MiTDvv-hIL21 oncolytic virus had been integrated into the 3'UTR region of the E10R of the DDvv-hIL21 poxvirus, and did not contain the mCherry / Zeocin sequence. That is, the two virus strains were successfully recombined ( Fig. 9 ), virus structure such as Fig.10 .

[0219] Preparation Example 6: Production and purification of oncolytic virus

[0220] 1) HeLa cells were plated in 150 mm culture dishes to reach about 80% on the second day, with a total of 50 dishes, and infected with 0.2 MOI P2 generation 1 monoclonal MiTDvv backbone virus and P2 generation 1 monoclonal MiTDvv-hIL21 oncolytic virus, respectively. After about 2-3 days, the cells were observed to have lesions and round beads under a microscope, and the culture medium and cells were collected using a cell scraper;

[0221] 2) Centrifuge at 25924×g for 30 minutes at 4℃, discard the supernatant, add 20ml of MEM containing 10% FBS to the precipitate, resuspend, freeze and thaw repeatedly three times with liquid nitrogen / autoclaved water, centrifuge at 25924×g for 30 minutes at 4℃, wash the precipitate with 20ml PBS, centrifuge at 25924×g for 30 minutes at 4℃, resuspend the precipitate in 10mL of 10mM Tris pH9.0. Ultrasonicate at 60W at 4℃ for 30 seconds, interval of 30 seconds, for a total of 3 minutes, centrifuge at 300×g for 5 minutes, collect the supernatant for later use. Take another 13.2ml ultracentrifuge tube, add 6ml of 36% (w / v) sucrose, slowly add 5ml of virus supernatant from top to bottom, centrifuge at 32900×g for 80 minutes at 4℃, resuspend the precipitate in 5ml 1mM Tris pH9.0, ultrasonicate for 30 seconds, interval of 30 seconds, for a total of 3 minutes;

[0222] 3) Preparation and sample loading of sucrose gradient purification tubes: Use a 13.2 ml ultracentrifuge tube to slowly add 2.2 ml of 40% (w / v), 36% (w / v), 32% (w / v), 28% (w / v), and 24% (w / v) sucrose solutions to prepare sucrose gradient purification tubes. Then, slowly add 2 ml of the virus suspension obtained in step 2) on the liquid surface along the wall of the centrifuge tube. After centrifugation at 26000×g and 4°C for 50 minutes, a milky white virus band can be seen in the middle of the ultracentrifuge tube with the naked eye. Use an 18G-5 ml syringe needle to pierce the ultracentrifuge tube to absorb the virus band and place it in a new centrifuge tube (record the volume of the absorbed virus band as V1);

[0223] 4) Add 2 times the volume of V1 of 1mM Tris pH9.0 buffer to wash the virus to remove residual sucrose, centrifuge at 32900g for 1 hour at 4°C, discard the supernatant, resuspend the precipitate in 5ml of 1mM Tris pH9.0, sonicate at 4°C for 30 seconds, 30 seconds at intervals, for a total of 3 minutes, dispense 50μl / tube into sterile EP tubes, store at -80°C, and use conventional plaque assay to detect virus titer. The titer of MiTDvv-hIL21 was 6.4×10 9 pfu / ml, and the titer of MiTDvv was 1.92×10 9 pfu / ml.

[0224] Example 1: Selective replication of MiTDvv backbone virus in tumor cells

[0225] Human normal umbilical vein endothelial cells (HUVEC) and human cervical cancer cells (Hela) were cultured at 3×10 5 Cells / well were plated into 6-well plates and incubated at 37°C with 5% CO 2 Culture overnight to reach 70% on the second day. Add 0.1 MOI of MiTDvv virus prepared by the above method respectively, and change to respective culture medium containing 5% FBS after 2 hours of infection. After culturing for 24 hours and 48 hours, collect cell culture fluid and cells, freeze-thaw repeatedly 3 times to complete cell lysis, and detect virus content in lysate using conventional plaque method.

[0226] The results are as follows Fig.11 As shown, under 0.1 MOI infection conditions, the replication of MiTDvv virus in normal HUVEC cells was lower than that in Hela tumor cells. Fig.11 A shows the virus content of HUVEC cells and Hela cells 24 hours after the MiTDvv backbone virus was infected, Fig.11 B shows the virus content of HUVEC cells and Hela cells 48 hours after the MiTDvv backbone virus infected them respectively; Fig.11 C shows the ratio of the replication of the MiTDvv backbone virus in Hela cells to that in HUVEC cells, wherein 24 hours and 48 hours after the virus infected the cells, the virus replication amount in Hela cells was 50.46 times and 60.56 times that in HUVEC cells, respectively.

[0227] Example 2: Comparison of in vitro killing effects of MiTDvv backbone virus and DDvv-RFP backbone virus on normal cell lines

[0228] Human normal embryonic lung fibroblasts MRC-5 were cultured at 1×10 4 Cells / well were plated into 96-well plates and incubated at 37°C with 5% CO2 Culture overnight to reach 80% on the second day. Add 0.03MOI and 0.1MOI of DDvv-RFP and MiTDvv viruses prepared by the above method, respectively. After 2 hours of infection, change to DMEM medium containing 5% FBS. Use xCELLigence real-time label-free cell analyzer (RTCA) SP (ACEA, xCELLigenc RTCA SP) to detect cell growth, and the detection time is 24 hours (n=6, 2-3 repeated experiments). In the experiment, a group of wells with only cells and no virus (no virus infection) was retained as the negative control group. The control group was subjected to the corresponding fluid replacement operation at the same time, and each group had 6 replicates. The cell killing rate is the percentage value of the experimental group and the negative control group.

[0229] The results are as follows Fig.12 As shown, under different MOI values, the killing effect of MiTDvv virus on MRC-5 normal cells was significantly lower than that of DDvv virus (p<0.001).

[0230] Example 3: Comparison of replication of MiTDvv backbone virus and DDvv-RFP backbone virus in normal cells

[0231] Human normal embryonic lung fibroblasts MRC-5 were cultured at 1×10 5 The cells were plated into 24-well plates and cultured in DMEM medium with 2% FBS at 37°C and 5% CO. 2 Culture overnight to reach 80% on the second day. Add 0.1MOI and 0.3MOI of DDvv-RFP virus and MiTDvv virus prepared by the above method respectively. After 2 hours of infection, change to medium containing 5% FBS. In the experiment, keep a group of wells with only cells but no virus as negative control group. The control group is changed at the same time. 37℃, 5% CO 2 After 24 hours of culture, the culture medium and cells were collected, and the viral genome was extracted using the TIANamp viral DNA / RNA kit (TIANGEN, DP315). The viral A46R gene was detected by QPCR to detect the viral content. The primer sequences are shown in Table 2. The experiment was repeated 3 times, and the average value was taken for statistical analysis.

[0232] Table 2

[0233]

[0234] The results are as follows Fig.13 As shown, at different MOI values, the replication of MiTDvv virus in MRC-5 normal cells was significantly lower than that of DDvv virus (*p<0.01; **p<0.05).

[0235] Example 4: Comparison of the killing of normal cells by MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses

[0236] Human normal lung fibroblasts MRC-5 were cultured at 1×10 4 The cells / well were plated into 96-well culture dishes to reach 80% on the second day, and 0.3 MOI and 1 MOI of MiTDvv-hIL21 oncolytic poxvirus and DDvv-hIL21 oncolytic poxvirus prepared by the above method were added, respectively. After 2 hours of infection, the medium was replaced with DMEM culture medium containing 5% FBS at 37°C and 5% CO 2 After 12 hours of culture, the xCELLigence real-time label-free cell analyzer (RTCA) SP (ACEA, xCELLigenc RTCA SP) was used to detect cell growth. A group of MRC-5 cells was retained in the experiment without adding virus as the blank control group. The control group was subjected to corresponding fluid replacement at the corresponding time. Each group had 6 wells, and the experiment was repeated more than three times, and the average value was taken for statistical analysis.

[0237] The results are as follows Fig.14 As shown, the killing effect of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses on human normal lung fibroblasts MRC-5 showed a dose-increasing trend. At the same dose, the killing effect of MiTDvv-hIL21 oncolytic poxvirus on human normal lung fibroblasts MRC-5 was significantly weaker than that of DDvv-hIL21 oncolytic poxvirus (0.3MOI, p<0.05; 1MOI, p<0.01).

[0238] Example 5: Comparison of the replication of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses in normal cells

[0239] Human normal lung fibroblasts MRC-5 were cultured at 1×10 5 The cells / well were plated into 24-well culture plates to reach 80% on the second day. MiTDvv-hIL21 oncolytic poxvirus and DDvv-hIL21 oncolytic poxvirus prepared by the above method were added at 0.1MOI and 0.3MOI, respectively. After 2 hours of infection, the medium was replaced with DMEM culture medium containing 5% FBS and incubated at 37°C with 5% CO 2 After 24 hours of culture, the culture medium and cells were collected, and the viral genome was extracted using the TIANamp viral DNA / RNA kit. The viral A46R gene was detected by real-time fluorescence quantitative PCR for viral content detection. The primer sequences are shown in Table 2. In the experiment, a group of MRC-5 cells without virus was retained as a blank control group, and the control group was subjected to corresponding medium replacement operations at the corresponding time. Each group had 3 replicates, and the average value was taken for statistical analysis.

[0240] The results are as follows Fig.15 As shown, under 0.1MOI and 0.3MOI infection conditions, the replication of MiTDvv-hIL21 oncolytic poxvirus in normal MRC-5 cells was significantly lower than that of DDvv-hIL21 oncolytic poxvirus.

[0241] Example 6: Comparison of the replication of MiTDvv-hIL21 oncolytic poxvirus in normal cells and tumor cells

[0242] Human normal lung fibroblasts MRC-5 and human non-small cell lung cancer cells A549 were respectively 5 The cells / well were plated into 24-well culture dishes to reach 80% on the second day. MiTDvv-hIL21 oncolytic poxvirus prepared by the above method was added at 0.03MOI, 0.3MOI, and 3MOI, respectively. After infection for 2 hours, the medium was replaced with DMEM medium containing 5% FBS and cultured at 37°C with 5% CO 2 After 24 hours of culture, the culture medium and cells were collected, and the viral genome was extracted using the TIANamp viral DNA / RNA kit. The viral content was detected by real-time fluorescence quantitative PCR. The viral gene was A46R, and the primer sequences were shown in Table 2. In the experiment, a group of cells without virus was retained as a blank control group. The control group was subjected to corresponding medium replacement operations at the corresponding time, and each group had 3 replicate wells.

[0243] The results are as follows Fig.16 As shown in A, the replication of MiTDvv-hIL21 oncolytic poxvirus in tumor cells A549 is significantly higher than that in normal cells MRC-5. The replication ratios of MiTDvv-hIL21 oncolytic poxvirus in tumor cells A549 and normal cells MRC-5 (A549 / MRC-5) at 0.03MOI, 0.3MOI, and 3MOI are 51, 23, and 16, respectively. Fig.16 B), wherein the X-axis is the ratio of oncolytic virus replication in A549 cells to that in MRC-5 cells (i.e., A549 / MRC-5), and the Y-axis is the virus infection MOI.

[0244] Example 7: In vitro killing of different tumor cell lines by MiTDvv-hIL21 oncolytic poxvirus

[0245] Various human tumor cells were plated in 96-well plates, including SK-HEP-1 cells (human liver cancer cells), A549 cells (human non-small cell lung cancer cells), FaDu cells (human head and neck cancer cells), PANC-1 (human pancreatic cancer cells), U251 cells (human glioma cells), LOVO cells (human colorectal cancer cells), and MNNG / HOS C1 cells (human osteosarcoma cells). 4000-5000 cells were plated in each well at 37°C and 5% CO. 2After overnight culture, the concentration was allowed to reach 70%. Half of the culture medium in each well was discarded, and an equal volume of serum-free culture medium containing different concentrations of MiTDvv-hIL21 oncolytic poxvirus prepared by the above method (0.001MOI, 0.003MOI, 0.01MOI, 0.03MOI, 0.1MOI, 0.3MOI, 1MOI, 3MOI, 10MOI) was added. After infection for 4 hours, the culture medium containing 5% FBS was used to replace the medium and the culture was incubated at 37°C with 5% CO 2 After 48 hours (MNNG / HOS C1, A549, LOVO, FaDu) or 72 hours (SK-HEP-1, U251, PANC-1), the MTT method was used to detect tumor cell apoptosis (n=6, 2-3 repeated experiments). The control groups of this experiment were: negative control group (no virus infection) and positive control group (10 μM paclitaxel, purchased from Beijing Shuanglu Pharmaceuticals). Each treatment group and control group were set up with 6 replicates, and the cell killing rate (inhibition rate) was the percentage value of the experimental group or positive control group to the negative control group.

[0246] The results showed that the killing effect of MiTDvv-hIL21 oncolytic poxvirus on tumor cells was dose-dependent ( Fig.17 ), half inhibition rate (IC) of SK-HEP-1 cells, U251 cells, PANC-1 cells, MNNG / HOS C1 cells, A549 cells, LOVO cells, and FaDu cells 50 ) were 0.18, 0.79, 0.54, 0.53, 0.66, 0.68 and 0.29 respectively (Table 3).

[0247] Table 3

[0248]

[0249] Example 8: Evaluation of the correlation between the expression level of mature miR-199 in different cells and the cell-killing effect of MiTDvv-hIL21 oncolytic poxvirus

[0250] 1) Evaluation of the expression level of miR-199 in different tumor cells: HEK-293T cells (Note: the expression level of miR-199 in all tumor cells is relative to that of HEK-293T cells), MNNG / HOS C1 cells, SaoS2 cells (human osteosarcoma cells), A549 cells, FaDu cells, SK-BR-3 cells (human breast cancer cells), HepG2 cells (human liver cancer cells), Hela cells (cervical cancer cells), SKOV3 cells (human ovarian cancer cells), MCF-7 cells (human breast cancer cells), C33A cells (human cervical cancer cells), LOVO cells, U251 cells, HCT116 cells (human colorectal cancer cells), SK-HEP-1 cells, CFPAC-1 cells (human pancreatic cancer cells), PANC-1 cells (human pancreatic cancer cells), NCI-H1299 cells (human non-small cell lung cancer), and U87MG cells (human glioma cells) were plated on 6-well plates. After the cells were completely full, the culture medium was discarded, 1 ml of Trizol reagent (Invitrogen) was added to extract RNA, and 1 μg After RNA was synthesized into cDNA using a reverse transcription kit (Tiangen cat#KR116-02), a fluorescent quantitative PCR kit (Tiangen cat#FP215-02) was used to detect the expression of mature miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p) in tumor cells. The universal stem-loop sequence GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC (SEQ ID NO.36) plus the reverse repeat sequence of 7 bases at the 3' end of the mature miR199-3p was used to obtain the reverse transcription primer miR199-RT, see Table 4; the QRT-PCR primer sequence (synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd.) is shown in Table 4, and the endogenous gene U6 was used as an internal reference to calculate the relative expression level of miR-199. The results showed that MNNG / HOS C1 cells and SaoS2 cells were miR-199 high-expression lines (++, ≥10), FaDu cells, HepG2 cells, and SK-BR-3 cells were miR-199 medium-expression cell lines (+, ≥1 and <10), and other tumor cell lines were miR-199 low-expression cell lines (±, <1) ( Fig.18 ).

[0251] Table 4

[0252]

[0253] Note: U6-RT and miR199-RT are reverse transcription primers; U6-F and U6-R are QPCR primers for U6; miR199-F and miR199-R are QPCR primers for miR199.

[0254] 2) According to Fig.18 The expression level of intracellular miR-199 was shown, and the low, medium and high expression tumor cell lines PANC-1, SK-HEP-1, FaDu, and MNNG / HOS C1 cells were selected to compare the killing effect of MiTDvv-hIL21 oncolytic poxvirus prepared by the above method: MNNG / HOS C1, FaDu, SK-HEP-1, and PANC-1 cells were respectively plated in 96-well plates, and the number of cells per well was adjusted according to the cell growth rate. After culturing overnight, it reached 80%, and 100 μl of serum-free culture medium containing 0.1 MOI MiTDvv-hIL21 oncolytic poxvirus was added after discarding the liquid. After infection for 4 hours, the cell culture medium containing 5% FBS was used to culture for 48 hours, and the MTT method was used to detect tumor cell apoptosis (n=6, 2-3 repeated experiments). The control group of this experiment was: negative control group (no virus infection), and 6 duplicate wells were set for each treatment group and control group, and the cell survival rate was the percentage value of the experimental group with virus added and the negative control group. The results showed that the killing effect of MiTDvv-hIL21 oncolytic poxvirus on tumor cells with low expression of miR-199 was significantly stronger than that on tumor cells with high expression of miR-199 ( Fig.19 ).

[0255] Example 9: Evaluation of the killing effect of MiTDvv-hIL21 oncolytic poxvirus on similar tumor cells stably expressing high miR-199

[0256] The purpose of this experiment is to further verify the mechanism of the oncolytic virus of the present invention. Since the TK / VGF double-deficient oncolytic poxvirus itself has different killing effects on different types of tumor cells, in order to further verify that the MiTDvv-hIL21 oncolytic poxvirus of the present invention can be regulated by microRNA, tumor cells with stable high expression of miR-199 (including has-miR-199a-3p and has-miR-199b-3p) were constructed for comparison in the same tumor cells.

[0257] 1) Construction of lentivirus carrying miR-199: HEK-293 cells (Agilent Technologies) were plated in 6-well plates using DMEM medium containing 10% FBS + 1% P / S, and 4×10 5Cells / well were added to make the cell density reach about 70% the next day. After replacing the DMEM medium with 5% FBS+1% P / S, 300 μl of plasmid / Lipo3000 mixture (prepared as in Preparation Example 2) was added to each well (the plasmids for preparing LV-miR199 lentivirus include: p59-rev, pP60-VSV-G, p61-gag-P01 and LV3-has-miR199-GFP, purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd., and the LV3-has-miR199-GFP plasmid contains a DNA sequence capable of expressing the mature miR199 hsa-miR-199a-3p or hsa-miR-199b-3p:

[0258] 5'-GATCCGACAGTAGTCTGCACATTGGTTATTCAAGAGATAACCAATGCAGACTACTGTCTTTTTTGAATT-3' (SEQ ID NO.37), and can express GFP green fluorescence that can be used for screening and detection; the plasmids for preparing LV-miRNC lentivirus include: p59-rev, pP60-VSV-G, p61-gag-P01 and LV3-shNC, purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd., LV3-shNC is a control plasmid containing an unrelated control DNA sequence:

[0259] 5'-GATCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTTGAATT-3' (SEQ ID NO.38); wherein LV3 is the number of the lentiviral plasmid vector of Genetron, and hsa indicates human origin). Incubator at 37°C, 5% CO 2 After 48 hours of culture, the supernatant was collected and centrifuged at 5000 rpm / min at 4°C for 30 minutes. The supernatant was collected and filtered through a 0.45 μm filter membrane into 1 ml tubes and stored at -80°C. They were lentivirus LV-miR199 carrying miR-199 and backbone lentivirus LV-miRNC.

[0260] 2) Construction of tumor cells with high expression of miR-199: After infecting HCT116 cells with LV-miR199 lentivirus and backbone lentivirus LV-miRNC (routine operation is not described here), monoclonal positive cells were selected to construct HCT116-miR199 cell line stably expressing miR-199 and negative control cell line HCT116-miRNC. The expression of GFP was detected using the green fluorescence channel of the cell flow cytometer ( Fig. 20 A) and PCR ( Fig. 20B) Identification and confirmation (can be adjusted according to routine operations according to experimental conditions, so it is not repeated here). The QPCR primer sequences are shown in Table 4. The flow cytometry results showed that the positive transfection rates of HCT116-miR199 cell line and HCT116-miRNC cell line were 99.91% and 99.64%, respectively. The PCR results confirmed that the HCT116-miR199 cell line highly expressed miR-199 (including has-miR-199a-3p and has-miR-199b-3p).

[0261] 3) HCT116-miR199 cell line and HCT116-miRNC cell line were plated in 96-well plates with 5000 cells per well in 10% FBS medium, cultured overnight to 80%, and then 100 μl of serum-free culture medium containing 0.03 MOI, 0.3 MOI, and 3 MOI of MiTDvv-hIL21 oncolytic poxvirus prepared by the above method was added after discarding the liquid. After 4 hours of infection, the medium was replaced with cell culture medium containing 5% FBS at 37°C and 5% CO 2 After 48 hours of culture, the MTT method was used to detect tumor cell apoptosis (n = 6, 2-3 repeated experiments). The control group of this experiment was a negative control group (no virus infection). Each treatment group and control group had 6 replicates, and the cell killing rate was the percentage value of the experimental group and the negative control group. The results showed that the killing ability of MiTDvv-hIL21 oncolytic poxvirus in tumor cells with high expression of miR-199 was significantly reduced ( Fig.21 ).

[0262] Example 10: Anti-tumor effect of MiTDvv-hIL21 oncolytic poxvirus on colorectal cancer

[0263] Human colorectal cancer HCT116 cells in the logarithmic growth phase were used to construct a severely immunodeficient NCG mouse tumor model. The experiment used severely immunodeficient NCG mice (obtained from Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd.) (8 weeks old, female) and 1 million HCT116 cells were inoculated subcutaneously on the back of the hind legs of the mice. When the tumor volume was 100 mm 3 At about 1:50 pm, 5×10 MiTDvv-hIL21 oncolytic poxvirus prepared by the above method was injected intratumorally 5 pfu / mouse, the administration volume was 50μl, 4 mice per group, and the tumor size and body weight were measured every 3 days. A control group given PBS was set up in the experiment. The results showed that MiTDvv-hIL21 oncolytic poxvirus can effectively inhibit tumor growth ( Fig. 22 A). Starting from the 10th day after administration, the relative tumor growth rate (T / C, i.e. the percentage of tumor volume in the administration group to the tumor volume in the control group, a value <40% indicates that the drug is effective) of the administration group was less than 40% ( Fig. 22 B). The mice did not show significant weight loss during the entire experiment ( Fig. 22 C).

[0264] Example 11: Anti-tumor effect of MiTDvv-hIL21 oncolytic poxvirus on human osteosarcoma

[0265] The logarithmic growth phase human osteosarcoma MNNG / HOS C1 cells were used to construct a tumor model of NCG mice with severe immunodeficiency. The experiment used severely immunodeficient NCG mice (obtained from Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd.) (8 weeks old, female), and 500,000 MNNG / HOS C1 cells were inoculated subcutaneously on the back of the mouse's hind legs. When the tumor volume was 100mm 3 At about 1:10 pm, 1×10 MiTDvv-hIL21 oncolytic poxvirus prepared by the above method was injected intratumorally. 6 pfu / mouse, the administration volume was 50 μl, 4 mice per group, and the tumor size and body weight were measured every 3 days. A PBS control group was set up in the experiment. The results showed that MiTDvv-hIL21 oncolytic virus can also effectively inhibit the growth of MNNG / HOS C1 tumors with high expression of miR-199 in mice ( Fig.23 A). Starting from the 8th day after administration, the relative tumor growth rate (T / C) was less than 40% ( Fig.23 B). The mice did not show significant weight loss during the entire experiment ( Fig.23 C).

[0266] Example 12: Anti-tumor effect of MiTDvv-hIL21 oncolytic poxvirus on human liver cancer

[0267] The logarithmic growth phase human liver cancer SK-HEP-1 cells were used to construct a tumor model of NCG mice with severe immune deficiency. The experiment used NCG mice with severe immune deficiency (obtained from Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd.) (7 weeks old, female), and 10 million SK-HEP-1 cells were inoculated subcutaneously on the back of the mouse's hind legs. When the tumor volume was 100mm 3 At about 1:10 pm, 2×10 MiTDvv-hIL21 oncolytic poxvirus prepared by the above method was injected intratumorally. 5 pfu / mouse, the administration volume was 50μl, 3-4 mice per group, and the tumor size and body weight were measured every 3 days. A PBS control group was set up in the experiment. The results showed that MiTDvv-hIL21 oncolytic poxvirus can effectively inhibit tumor growth ( Fig.24 A), the mice did not show significant weight loss during the entire experiment ( Fig.24 B).

[0268] Example 13: Evaluation of the killing effect of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses on tumor cells with different miR-199 expression levels

[0269] Various human tumor cells, including MNNG / HOS C1, SaoS2, FaDu, SK-BR-3, HepG2, Hela, SKOV3, C33A, LOVO, U251, HCT116, SK-HEP-1, CFPAC-1, and PANC-1 cells, were plated in 96-well plates, with 4000-5000 cells per well at 37°C and 5% CO 2 After culturing overnight, the concentration reached 70%. The medium was changed and the infection was carried out for 4 hours with the serum-free culture medium containing MiTDvv-hIL21 oncolytic poxvirus or DDvv-hIL21 oncolytic poxvirus prepared by the above method, 0.3-10 MOI (due to the different sensitivity of various tumor cells to viruses, the infection MOI explored in the previous in vitro experiments was used: 0.3 MOI to infect MNNG / HOS C1, FaDu; 1 MOI to infect LOVO, U251, SK-HEP-1; 3 MOI to infect SaoS2, SK-BR-3, HepG2, Hela, SKOV3, C33A, CFPAC-1, PANC-1; 10 MOI to infect HCT116). After that, the medium was changed to a cell culture medium containing 5% FBS at 37°C and 5% CO 2 After 48 hours of culture, the apoptosis of tumor cells was detected by MTT method (n=6, 2-3 repeated experiments). The negative control group of this experiment was not infected with the virus. Six replicates were set for each treatment group and control group. The cell killing rate (cell growth inhibition rate) was the percentage value of the experimental group and the negative control group. The results showed that in the tumor cells MNNG / HOS C1 and SaoS2 with high expression of miR-199, MiTDvv-hIL21 oncolytic poxvirus and DDvv-hIL21 oncolytic poxvirus had no difference in cell killing, but in the tumor cells FaDu, SK-BR-3, HepG2, Hela, SKOV3, C33A, LOVO, U251, HCT116, SK-HEP-1, CFPAC-1, PANC-1 and other cells with medium or low expression of miR-199, MiTDvv-hIL21 oncolytic poxvirus showed stronger killing ability ( Fig.25 ).

[0270] Example 14: Evaluation of the tumor-suppressing effects of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses on tumor-bearing mice with different miR-199 expression levels

[0271] Human colorectal cancer HCT116 cells in the logarithmic growth phase and human osteosarcoma MNNG / HOS C1 cells in the logarithmic growth phase were used to construct a NCG mouse tumor model with severe immunodeficiency, wherein human osteosarcoma MNNG / HOS C1 cells with high expression of miR-199 and human colorectal cancer HCT116 cells with low expression of miR-199 were inoculated subcutaneously on the back of the hind legs of NCG mice according to the method for constructing the model described in Examples 10 and 11, respectively. When the tumor volume was 100 mm 3 At about 10 s, MiTDvv-hIL21 oncolytic virus and DDvv-hIL21 oncolytic poxvirus prepared by the above method were injected intratumorally, and the dose of MNNG / HOS C1 tumor-bearing mice was 1×10 6 pfu / mouse, the dosage for HCT116 tumor-bearing mice was 5×10 5 pfu / mouse, the administration volume was 50μl, 3 mice per group, and the tumor size and body weight were measured every 3 days. The results showed that both HCT116 and MNNG / HOS C1 tumor model groups showed good tumor inhibition effects. In comparison, in HCT116 tumors with low expression of miR-199, the tumor inhibition effect of MiTDvv-hIL21 oncolytic poxvirus was stronger than that of DDvv-hIL21 oncolytic poxvirus ( Fig.26 A), however, in MNNG / HOS C1 tumors with high expression of miR-199, the tumor inhibition effect of MiTDvv-hIL21 oncolytic poxvirus was weaker than that of DDvv-hIL21 oncolytic poxvirus ( Fig.26 B).

[0272] Example 15: Evaluation of tissue distribution of MiTDvv-hIL21 and DDvv-hIL21 oncolytic poxviruses in mice

[0273] Normal C57BL / 6N female mice aged 8 weeks were intravenously administered with 200 μl PBS containing 1×10 9pfu / kg MiTDvv-hIL21 oncolytic poxvirus and DDvv-hIL21 oncolytic poxvirus prepared by the above method, 5 mice in each group. One group of mice (5 mice) were killed on the first day (D1), the third day (D3), the seventh day (D7) and the fifteenth day (D15) after administration, and peripheral blood, heart, liver, spleen, lung, kidney, ovary and uterus were collected. The distribution of poxvirus in various organs was detected by QPCR. The detected viral gene was A46R, and the primer sequence was shown in Table 2. The results showed that the replication of MiTDvv-hIL21 oncolytic poxvirus in the ovary, uterus, liver and spleen was lower than that of DDvv-hIL21 oncolytic poxvirus, and the virus content in the lung was similar to that of DDvv-hIL21 oncolytic poxvirus. The content of MiTDvv-hIL21 oncolytic poxvirus in peripheral blood was higher than that of DDvv-hIL21 oncolytic poxvirus ( Fig. 27 Neither MiTDvv-hIL21 oncolytic poxvirus nor DDvv-hIL21 oncolytic poxvirus was detected in the heart or kidney (figure not shown). SEQUENCE LISTING <110> Hangzhou Kangwanda Pharmaceutical Technology Co., Ltd. <120> Isolated recombinant oncolytic poxvirus regulated by microRNA and its application <130> FI-200300-59:52 / C <160> 38 <170> PatentIn version 3.5 <210> 1 <211> twenty two <212> DNA <213> Homo sapiens <400> 1 acagtagtct gcacattggt ta 22 <210> 2 <211> 30 <212> DNA <213> Artificial sequence <400> 2 agtcctcgag ctaatattga gaaattcatc 30 <210> 3 <211> 66 <212> DNA <213> Artificial sequence <400> 3 ctgcacattg gttattaaga agcatagtct ggaacatcat atggatataa agggttaacc 60 tttgtc 66 <210> 4 <211> 59 <212> DNA <213> Artificial sequence <400> 4 tggttaggac agtagtctgc acattggtta ggacagtagt ctgcacattg gttattaag 59 <210> 5 <211> 61 <212> DNA <213> Artificial sequence <400> 5 atgtgcagac tactgtccta accaatgtgc agactactgt ccaaaaattg aaaataaata 60 c 61 <210> 6 <211> 32 <212> DNA <213> Artificial sequence <400> 6 gatcaagatc tttagtcctg ctcctcggcc ac 32 <210> 7 <211> 36 <212> DNA <213> Artificial sequence <400> 7 gatcaagatc tttataaact taacccatta taaaac 36 <210> 8 <211> 33 <212> DNA <213> Artificial sequence <400> 8 agtcggatcc ttgacagtct tgaacaatta tac 33 <210> 9 <211> 28 <212> DNA <213> Artificial sequence <400> 9 cccaagcttt tagtcctgct cctcggcc 28 <210> 10 <211> 61 <212> DNA <213> Artificial sequence <400> 10 ataacttcgt atagcataca ttatacgaag ttatctttat aaacttaacc cattataaaa 60 c 61 <210> 11 <211> 34 <212> DNA <213> Artificial sequence <400> 11 ataacttcgt ataatgtatg ctatacgaag ttat 34 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 12 cgcgtatttg ggatcagatg 20 <210> 13 <211> twenty one <212> DNA <213> Artificial sequence <400> 13 caaaggttct tgagggttgt g 21 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <400> 14 gttgatcggc acgtaagagg 20 <210> 15 <211> twenty three <212> DNA <213> Artificial sequence <400> 15 gtcacagaaa ccatgccgtg tag 23 <210> 16 <211> 19 <212> DNA <213> Artificial sequence <400> 16 ggagcttcca gggggaaac 19 <210> 17 <211> 19 <212> DNA <213> Artificial sequence <400> 17 gacctcagcg tcgtagtgg 19 <210> 18 <211> twenty one <212> DNA <213> Artificial sequence <400> 18 ccaattaatg caccgaacat c 21 <210> 19 <211> twenty one <212> DNA <213> Artificial sequence <400> 19 atgaattgga ggagatggtg g 21 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <400> 20 taatacgact cactataggg 20 <210> twenty one <211> twenty four <212> DNA <213> Artificial sequence <400> twenty one atcgcatttt ctaacgtgat ggat 24 <210> twenty two <211> twenty three <212> DNA <213> Artificial sequence <400> twenty two tatctaacga cacaacatcc att 23 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <400> twenty three gcacggtaag gaagtagatc 20 <210> twenty four <211> twenty two <212> DNA <213> Artificial sequence <400> twenty four cagtacacgg tcctcagcat aa 22 <210> 25 <211> 18 <212> DNA <213> Artificial sequence <400> 25 cagggaaacg gatgtata 18 <210> 26 <211> twenty two <212> DNA <213> Artificial sequence <400> 26 tgtgttacag aatcatataa gg 22 <210> 27 <211> 52 <212> DNA <213> Artificial sequence <400> 27 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaaaata tg 52 <210> 28 <211> 19 <212> DNA <213> Artificial sequence <400> 28 ctcgcttcgg cagcacata 19 <210> 29 <211> 19 <212> DNA <213> Artificial sequence <400> 29 cgcagggtcc gaggtattc 19 <210> 30 <211> 51 <212> DNA <213> Artificial sequence <400> 30 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactaacca a 51 <210> 31 <211> twenty three <212> DNA <213> Artificial sequence <400> 31 gccgacagta gtctgcacat tgg 23 <210> 32 <211> 19 <212> DNA <213> Artificial sequence <400> 32 cgcagggtcc gaggtattc 19 <210> 33 <211> 28 <212> DNA <213> Artificial sequence <400> 33 ccgctcgagg ctggcgtttt tccatagg 28 <210> 34 <211> 33 <212> DNA <213> Artificial sequence <400> 34 cgcggatccc ggtctggtta taggtacatt gag 33 <210> 35 <211> 261 <212> DNA <213> Artificial sequence <400> 1 caatttaaca caaccctcaa gaacctttgt atttattttc aatttttata acttcgtata 60 atgtatgcta tacgaagtta tggacagtag tctgcacatt ggttaggaca gtagtctgca 120 cattggttag gacagtagtc tgcacattgg ttaggacagt agtctgcaca ttggttatta 180 agaagcatag tctggaacat catatggata taaagggtta acctttgtca catcgatcgc 240 gtatttggga tcagatggta c 261 <210> 36 <211> 44 <212> DNA <213> Artificial Sequence <400> 36 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgac 44 <210> 37 <211> 69 <212> DNA <213> Artificial Sequence <400> 37 gatccgacag tagtctgcac attggttatt caagagataa ccaatgcaga ctactgtctt 60 ttttgaatt 69 <210> 38 <211> 65 <212> DNA <213> Artificial Sequence <400> 38 gatccgttct ccgaacgtgt cacgtttcaa gagaacgtga cacgttcgga gaactttttt 60 gaatt 65

Claims

1. An isolated recombinant oncolytic poxvirus, which can be regulated by microRNA, wherein the expression level of the microRNA in tumor cells of a mammal is lower than that in normal cells of the same mammal, wherein the target sequence of the microRNA is integrated into the 3'UTR region of the E10R gene in the genome of the recombinant oncolytic poxvirus; in, The recombinant oncolytic poxvirus is TK gene function-deficient and / or VGF gene function-deficient.

2. The recombinant oncolytic poxvirus according to claim 1, wherein the microRNA is selected from the group consisting of miR-9, miR-15a, miR-16, miR-26a, miR-27b, miR-29b, miR-30a, miR-32, miR-33, miR-34, miR-95, miR-101, miR-122, miR-124, miR-125a, miR-125b, miR-126, miR-127, miR-128, miR-133b,miR-139,miR-140,miR-142,miR-143,miR-145,miR-181,miR-192,miR-195,miR-198,miR-199a ,miR-199b,miR-200,miR-203,miR-204,miR-205,miR-218,miR-219,miR-220,miR-224,miR-345,miR-375.

3. The recombinant oncolytic poxvirus according to claim 1, wherein the target sequence of the microRNA is repeated, and the repeat comprises 2-8 repeats.

4. The recombinant oncolytic poxvirus according to claim 1, wherein an exogenous IL-21 gene is integrated into the genome of the recombinant oncolytic poxvirus, and the IL-21 gene can be expressed in tumor cells.

5. The recombinant oncolytic poxvirus according to claim 1, wherein the TK gene is rendered functionally defective by inserting an exogenous nucleotide sequence.

6. The recombinant oncolytic poxvirus according to claim 4, wherein the exogenous IL-21 gene is inserted into the TK gene, thereby rendering the TK gene functionally defective.

7. The recombinant oncolytic poxvirus according to claim 1, wherein the VGF gene is functionally defective by gene knockout or insertion of an exogenous nucleotide sequence.

8. The recombinant oncolytic poxvirus according to claim 1, wherein the recombinant oncolytic poxvirus is a WR strain or a Wyeth strain.

9. The recombinant oncolytic poxvirus according to claim 1, wherein an exogenous screening gene is also integrated into the genome of the recombinant oncolytic poxvirus, and the exogenous screening gene includes a gpt gene and / or a LacZ gene.

10. The recombinant oncolytic poxvirus according to claim 4, wherein the exogenous IL-21 gene is from mouse or human.

11. The recombinant oncolytic poxvirus according to claim 2, wherein the microRNA is selected from miR-199a and miR-199b.

12. A pharmaceutical composition, wherein the pharmaceutical composition comprises as an active ingredient the recombinant oncolytic poxvirus according to any one of claims 1 to 11, and a pharmaceutically acceptable excipient.

13. The pharmaceutical composition according to claim 12, wherein the pharmaceutical composition comprises 1×10 5 -5×10 9 pfu of the recombinant oncolytic poxvirus.

14. The pharmaceutical composition according to claim 12, wherein the recombinant oncolytic poxvirus is administered by intratumoral injection or intravenous administration.

15. A vector for preparing a recombinant oncolytic poxvirus according to any one of claims 1 to 11, wherein the vector comprises left and right homologous arms of the E10R gene and a target sequence of a microRNA, so that the target sequence of the microRNA is integrated into the 3'UTR region of the E10R gene in the genome of the recombinant oncolytic poxvirus, wherein the expression level of the microRNA in tumor cells of a mammal is lower than that in normal cells of the same mammal. The vector according to claim 15 , wherein the vector comprises an exogenous IL-21 gene under the control of a promoter.

17. A host cell containing the vector according to claim 15 or 16.

18. Use of the recombinant oncolytic poxvirus according to any one of claims 1 to 11 in the preparation of a medicament for treating tumors.

19. The method of claim 18, wherein the tumor comprises lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumor, colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

Citation Information

Patent Citations

  • Isolated recombinant oncolytic poxvirus, pharmaceutical composition and use thereof in the treatment of tumors and / or cancer

    CN109554353A