A method for increasing the production of N-acetyl-5-hydroxytryptamine

Abstract

The present invention relates to a method for enhancing the production of N-acetyl-5-hydroxytryptamine. The substrate 5-hydroxytryptamine is converted by a recombinant cell comprising a functional gene related to catalyzing 5-hydroxytryptamine to generate N-acetyl-5-hydroxytryptamine to obtain N-acetyl-5-hydroxytryptamine, and the recombinant cell that catalyzes 5-hydroxytryptamine to generate N-acetyl-5-hydroxytryptamine-related functional genes expresses an N-acetyl-5-hydroxytryptamine transferase gene, or expresses an N-acetyl-5-hydroxytryptamine transferase gene and an acetyl-CoA synthetase gene that enhances the production of N-acetyl-5-hydroxytryptamine, producing N-acetyl-5-hydroxytryptamine transferase and acetyl-CoA synthetase. The present invention enhances the production of N-acetyl-5-hydroxytryptamine by overexpressing the AANTA gene and the ACS gene, thereby significantly improving the synthetic yield of N-acetyl-5-hydroxytryptamine.

Description

Technical field:

[0001] The invention relates to the field of biotechnology, and in particular to a method for enhancing the yield of N-acetyl-5-hydroxytryptamine. Background technology:

[0002] N-acetyl-5-methoxytryptamine, also known as melatonin, is a biological clock regulating hormone that participates in the expression and regulation of clock genes in nerve and peripheral tissue cells. In various complex physiological activities, N-acetyl-5-methoxytryptamine is also a powerful free radical of reactive oxygen (ROS) and reactive nitrogen (RNS). At the same time, as an amphiphilic molecule, N-acetyl-5-methoxytryptamine can easily enter all subcellular structural spaces including cell membrane structure, cytoplasm, nucleus and mitochondria. The known physiological functions of N-acetyl-5-methoxytryptamine mainly include regulating the circadian rhythm in the body, relieving sleep disorders, and anti-oxidation; the US FDA believes that N-acetyl-5-methoxytryptamine can be used as a common dietary supplement. my country's Ministry of Health has approved the production and sale of products containing N-acetyl-5-methoxytryptamine as health products for "improving sleep". The health functions of N-acetyl-5-methoxytryptamine in regulating immune function and anti-aging are showing its strong vitality.

[0003] The biosynthetic pathway of N-acetyl-5-methoxytryptamine mainly starts from tryptophan, undergoes hydroxylation and decarboxylation to generate 5-hydroxytryptamine, and then generates N-acetyl-5-hydroxytryptamine under the action of N-acetyl-5-hydroxytryptamine transferase, and then generates N-acetyl-5-hydroxytryptamine through the action of N-acetyl-5-hydroxytryptamine oxygen methyltransferase or caffeic acid oxygen methyltransferase. N-acetyl-5-hydroxytryptamine transferase has been proven to be the key rate-limiting enzyme in the biosynthesis of N-acetyl-5-methoxytryptamine. In the pineal gland, the main organ for the synthesis of blood N-acetyl-5-methoxytryptamine, 5-hydroxytryptamine (5-HT) comes from the decarboxylation reaction of tryptophan in the blood. It is converted into N-acetyl-5-hydroxytryptamine (Ac-HT) under the catalysis of N-acetyl-5-hydroxytryptamine transferase, and then N-acetyl-5-methoxytryptamine is generated by methoxytransferase. However, the activity of N-acetyl-5-hydroxytryptamine transferase in the pineal gland is inhibited by light, and the production is very unstable, showing a diurnal pattern, which is not conducive to production. With the development of synthetic biology, the biosynthesis gene of N-acetyl-5-methoxytryptamine is integrated into the genome of model microorganisms through genetic engineering, so that N-acetyl-5-methoxytryptamine can be produced in high yield, achieving the purpose of green biomanufacturing. Summary of the invention:

[0004] The technical problem to be solved by the present invention is to provide a method for enhancing the production of N-acetyl-5-hydroxytryptamine.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0006] Provided is a method for enhancing the production of N-acetyl-5-hydroxytryptamine, wherein a recombinant cell comprising a functional gene that catalyzes the production of N-acetyl-5-hydroxytryptamine from 5-hydroxytryptamine converts a substrate 5-hydroxytryptamine to obtain N-acetyl-5-hydroxytryptamine, wherein the recombinant cell comprising a functional gene that catalyzes the production of N-acetyl-5-hydroxytryptamine from 5-hydroxytryptamine expresses an N-acetyl-5-hydroxytryptamine transferase gene, or the recombinant cell comprising a functional gene that catalyzes the production of N-acetyl-5-hydroxytryptamine from 5-hydroxytryptamine expresses an N-acetyl-5-hydroxytryptamine transferase gene and an acetyl-CoA synthetase gene that enhances the production of N-acetyl-5-hydroxytryptamine, thereby producing N-acetyl-5-hydroxytryptamine transferase and acetyl-CoA synthetase.

[0007] According to the above scheme, the amino acid sequence of the N-acetyl-5-hydroxytryptamine transferase is:

[0008] a) a sequence represented by any one of SEQ ID NO: 002, SEQ ID NO: 004, SEQ ID NO: 006, and SEQ ID NO: 008;

[0009] b) or an amino acid sequence having a sequence identity of 75%, preferably 85%, more preferably 95% with the amino acid sequence described in (a) and having the function of the protein described in (a);

[0010] c) or an amino acid sequence formed by adding, replacing or deleting 1 to 30, more preferably 1 to 10, even more preferably 1 to 6, and most preferably 1 to 3 amino acid residues at the N-terminus and / or C-terminus of the amino acid sequence described in a), and having the function of catalyzing 5-hydroxytryptamine to produce N-acetyl-5-hydroxytryptamine enzyme described in (a);

[0011] The amino acid sequence of the enzyme (acetyl-CoA synthetase) that enhances the production of N-acetyl-5-hydroxytryptamine is:

[0012] a) the amino acid sequence of the enzyme that enhances the production of N-acetyl-5-hydroxytryptamine is shown in SEQ ID NO: 010, SEQ ID NO: 012 or SEQ ID NO: 014;

[0013] b) or an amino acid sequence having 75%, preferably 85%, more preferably 95% sequence identity with the amino acid sequence of (a) and having the function of the protein of (a);

[0014] c) or an amino acid sequence formed by adding, replacing or deleting 1 to 30, more preferably 1 to 10, even more preferably 1 to 6, most preferably 1 to 3 amino acid residues to the N-terminus and / or C-terminus of the amino acid sequence described in (a), and having the function described in (a).

[0015] According to the above scheme, the N-acetyl-5-hydroxytryptamine transferase gene sequence is shown in SEQ ID NO: 001, SEQ ID NO: 003, SEQ ID NO: 005 or SEQ ID NO: 007; the acetyl-CoA synthetase gene sequence is shown in SEQ ID NO: 009, SEQ ID NO: 011 or SEQ ID NO: 013.

[0016] According to the above scheme, it also includes further using the synthesized N-acetyl-5-hydroxytryptamine for the production of subsequent tryptophan derivatives such as N-acetyl-5-methoxytryptamine.

[0017] Provided is a recombinant vector comprising an N-acetyl-5-hydroxytryptamine transferase gene as described in any one of SEQ ID NO: 001, SEQ ID NO: 003, SEQ ID NO: 005 or SEQ ID NO: 007.

[0018] And further, a host cell comprising the above recombinant vector or an N-acetyl-5-hydroxytryptamine transferase gene integrated into its genome is provided.

[0019] Provided is a recombinant vector comprising an N-acetyl-5-hydroxytryptamine transferase (AANAT) gene as described in any one of SEQ ID NO: 001, SEQ ID NO: 003, SEQ ID NO: 005, and SEQ ID NO: 007 and an acetyl-CoA synthetase (ACS) gene as described in any one of SEQ ID NO: 009, SEQ ID NO: 011, or SEQ ID NO: 013.

[0020] And further, a host cell comprising the above recombinant vector or a host cell having N-acetyl-5-hydroxytryptamine transferase gene and acetyl-CoA synthetase gene integrated into its genome is provided.

[0021] An N-acetyl-5-hydroxytryptamine transferase, wherein the amino acid sequence of the N-acetyl-5-hydroxytryptamine transferase is

[0022] a) a sequence represented by any one of SEQ ID NO: 002, SEQ ID NO: 004, SEQ ID NO: 006, and SEQ ID NO: 008;

[0023] b) or an amino acid sequence having a sequence identity of 75%, preferably 85%, more preferably 95% with the amino acid sequence described in (a) and having the function of the protein described in (a);

[0024] c) or an amino acid sequence formed by adding, replacing or deleting 1 to 30, more preferably 1 to 10, even more preferably 1 to 6, and most preferably 1 to 3 amino acid residues at the N-terminus and / or C-terminus of the amino acid sequence described in a), and having the function of catalyzing 5-hydroxytryptamine to produce N-acetyl-5-hydroxytryptamine enzyme described in (a);

[0025] A method for constructing a recombinant vector is to amplify the target gene using a gene amplifier, and connect the target gene and the expression vector by seamless cloning or enzyme ligation.

[0026] According to the above scheme, the target gene is transferred into the pCDF empty plasmid to obtain a recombinant vector carrying the pCDF replicon, the spectinomycin resistance gene, and the T7 promoter, and the recombinant vector is transferred into the host cell to construct a genetically engineered bacterium.

[0027] According to the above scheme, the primers for amplifying the target gene are:

[0028]

[0029]

[0030] A method for constructing a genetically engineered bacterium is provided, which comprises: introducing the above-mentioned recombinant vector into a host cell to obtain the bacterium; or integrating an N-acetyl-5-hydroxytryptamine transferase gene and an acetyl-CoA synthetase gene into the host cell genome to obtain the bacterium.

[0031] According to the above scheme, the host cell is any one of the prokaryotic cells Escherichia coli, Corynebacillus glutamicum, Bacillus subtillis, Brevibacterium flavum, Serratia marcescens, Saccharomyces cerecisiae, Yarrowia lipolytica and Aspergillus niger cells. According to the above scheme, the method for integrating the N-acetyl-5-hydroxytryptamine transferase gene and the acetyl-CoA synthetase gene into the genome is as follows: using the homologous recombinase of lamda phage to integrate the cat-sacB gene into the TrpR site of Escherichia coli, the strain integrated with the cat-sacB gene can grow on a chloramphenicol plate; continuing to use the homologous recombinase of lamda phage to replace the cat-sacB gene of Escherichia coli with the T7 promoter, the N-acetyl-5-hydroxytryptamine transferase gene, and the acetyl-CoA synthetase gene fragment, the strain carrying the cat-sacB gene cannot grow on a salt-free sucrose plate, thereby obtaining a correct strain integrated with the T7 promoter, the N-acetyl-5-hydroxytryptamine transferase gene and the acetyl-CoA synthetase gene.

[0032] Provided is a method for synthesizing N-acetyl-5-hydroxytryptamine, comprising the following steps: culturing the genetically engineered bacteria in a liquid LB culture medium overnight to obtain a seed solution; inoculating the bacteria in the seed solution into a fermentation culture medium for fermentation and culture, adding a feed culture medium containing a substrate 5-hydroxytryptamine during the fermentation, adding IPTG after fermentation for induction culture to synthesize N-acetyl-5-hydroxytryptamine, and adding a feed culture medium containing a substrate 5-hydroxytryptamine during the induction culture.

[0033] According to the above scheme, the LB medium and the fermentation medium contain spectinomycin.

[0034] As a key enzyme in the biosynthesis of N-acetyl-5-methoxytryptamine, N-acetyl-5-hydroxytryptamine transferase can convert 5-hydroxytryptamine into N-acetyl-5-hydroxytryptamine, but the recombinant bacteria yield of N-acetyl-5-hydroxytryptamine reported so far is no more than 2.5 g / l. Acetyl-CoA, as an important intermediate metabolic compound in the microbial metabolic pathway, participates in the synthesis of a variety of biological substances. It is a new direction to increase the yield of N-acetyl-5-hydroxytryptamine by increasing acetyl-CoA. The present invention constructs a biosynthetic pathway of N-acetyl-5-hydroxytryptamine by expressing a highly active AANTA gene in a host cell and further combining and expressing an ACS gene. The ability of AANAT to catalyze the substrate 5-hydroxytryptamine to generate N-acetyl-5-hydroxytryptamine is enhanced by overexpressing the AANTA gene and the ACS gene, which significantly improves the synthetic yield of N-acetyl-5-hydroxytryptamine and achieves excellent results.

[0035] Beneficial effects of the present invention:

[0036] The present invention constructs a new biosynthetic pathway of N-acetyl-5-hydroxytryptamine by expressing a highly active AANTA gene in a host cell and further combining and expressing an ACS gene. The purpose of enhancing the catalytic activity of AANAT in the substrate 5-hydroxytryptamine to generate N-acetyl-5-hydroxytryptamine by overexpressing the AANTA gene and the ACS gene is achieved, and the synthesis yield of N-acetyl-5-hydroxytryptamine is significantly increased, and excellent results are achieved. By using N-acetyl-5-hydroxytryptamine transferases from different sources and combining them with enzymes of acetyl-CoA synthesis functions from different sources, and overexpressing these two genes at the same time, the yield of N-acetyl-5-hydroxytryptamine transferase can reach 7.1 g / L, which is the highest level reported so far. Description of the drawings:

[0037] Figure 1 This is the plasmid map of pCDF-T7-A2;

[0038] Figure 2 The production of N-acetyl-5-hydroxytryptamine by fermentation of strains carrying pCDF-T7-A1, A2, A3, A4 plasmids;

[0039] Figure 3 This is the plasmid map of pCDF-T7-A2-ACS3;

[0040] Figure 4 The production of N-acetyl serotonin by fermentation of pCDF-T7-A2-ACS1 / ACS2 / ACS3 strains;

[0041] Figure 5The production of N-acetyl serotonin by fermentation of pCDF-T7-A4-ACS1 / ACS2 / ACS3 strains. Specific implementation method:

[0042] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with the examples. Unless otherwise specified, the equipment and reagents used in each example and experiment can be obtained from commercial sources. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0043] The host cell of the present invention can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell. In a further specific embodiment, the strain includes, but is not limited to, Escherichia coli, Corynebacterium glutamicum, Bacillus subtillis, Brevibacterium flavum, Serratia marcescens, Saccharmyces cerevisiae. In a preferred embodiment, the strain is Escherichia coli, and the present invention is also described in detail by taking Escherichia coli as an example.

[0044] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA are harvested after the exponential growth phase and treated with electroporation, and the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out by CaCl2. When the host is a eukaryotic cell, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation liposome packaging, etc.

[0045] Based on the teachings of the present invention and the prior art, those skilled in the art can also understand that the recombinant cells of the present invention can be made into other utilization forms such as immobilized cells.

[0046] In the present invention, the term "expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In short, any plasmid and vector can be used as long as they can replicate and stably express in the host. An important feature of an expression vector is that it contains a replication origin, a promoter, a marker gene and a translation control element.

[0047] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0048] The present invention specifically screens 4 kinds of N-acetyl-5-hydroxytryptamine transferases and 3 kinds of enzymes that increase the yield of N-acetyl-5-hydroxytryptamine. Based on the prior art knowledge, it is not difficult for those skilled in the art to know that the 3 kinds of ACS enzymes involved in the present invention are not limited to the enzymes of a certain specific source mentioned in the embodiment, and each enzyme can be replaced with enzymes of different sources with the same or similar catalytic function, or can use one or more variant forms of enzymes of the specific sources of the enzymes in the embodiment, and the variant forms have the same or similar functions as the enzymes, but their amino acid sequences are slightly different from the amino acid sequences provided by the present invention. These variant forms include, but are not limited to: one or more (usually 1-30, preferably 1-10, more preferably 1-6, and most preferably 1-3) amino acids are indeed, inserted and / or replaced, and one or more (usually within 20, preferably within 10, more preferably within 6 or 3) amino acids are added to the C-terminus and / or N-terminus. For example, it is well known to those skilled in the art that when amino acids with similar or similar properties are substituted, such as when isoleucine and leucine are substituted with each other, the function of the resulting protein will not be changed. For another example, adding one or more amino acids to the C-terminus and / or N-terminus, such as a protein tag added to facilitate separation, for example, a 6xHis tag, generally does not change the function of the resulting protein.

[0049] The present invention specifically includes the following embodiments:

[0050] Embodiment 1:

[0051] (1) Synthesis of N-acetyl-5-hydroxytryptamine transferase gene AANAT

[0052] According to the gene sequence of sheep, N-acetyl-5-hydroxytryptamine transferase A1 was synthesized, the nucleotide sequence of which is shown in SEQ ID NO.001, and the amino acid sequence of which is shown in SEQ ID NO.002; according to the gene sequence of fruit fly, N-acetyl-5-hydroxytryptamine transferase A2 was synthesized, the nucleotide sequence of which is shown in SEQ ID NO.003, and the amino acid sequence of which is shown in SEQ ID NO.004; according to the gene sequence of Streptomyces parvum, N-acetyl-5-hydroxytryptamine transferase A3 was synthesized, the nucleotide sequence of which is shown in SEQ ID NO.005, and the amino acid sequence of which is shown in SEQ ID NO.006; according to the gene sequence of Streptomyces griseus, N-acetyl-5-hydroxytryptamine transferase A4 was synthesized, the nucleotide sequence of which is shown in SEQ ID NO.007, and the amino acid sequence of which is shown in SEQ ID NO.008.

[0053] Design primers for amplifying the N-acetyl-5-hydroxytryptamine transferase gene. For example, the upstream primer of the A1 gene is F1: 5'--3'GAATTCCATGTCCACTCCGTCT, and the downstream primer of the A1 gene is R1 5'-3'AAGCTTTTAACGATCGCTGTTACG. Use the A1 gene as a template to perform PCR amplification to obtain a linear gene fragment. In the same way, perform PCR amplification on N-acetyl-5-hydroxytryptamine transferase A2, A3, and A4 to obtain a linear gene fragment. The primers used are shown in the following table:

[0054]

[0055] (2) Construction of recombinant vector and prokaryotic expression of N-acetyl-5-hydroxytryptamine transferase gene

[0056] The amplified A1, A2, A3, A4 gene fragments and the pCDF empty plasmid were double-digested with EcoR I and Hind III, respectively, and the recovered products were connected with T4 DNA ligase to obtain the recombinant vector, which was transferred into DH5α competent cells, and the positive clones were selected for sequencing. After identification, the sequencing was correct and the plasmid was named pCDF-T7-A1 plasmid, which carries the pCDF replicon, spectinomycin resistance gene, T7 promoter, and A1 gene. The same method was used to obtain plasmids pCDF-T7-A2, pCDF-T7-A3, and pCDF-T7-A4 with correct sequencing results.

[0057] Extract pCDF-T7-A1, pCDF-T7-A2, pCDF-T7-A3, pCDF-T7-A4 plasmids and transfer them into protein expression strain BL21 (DE3). Pick expression monoclonals carrying pCDF-T7-A1, pCDF-T7-A2, pCDF-T7-A3, pCDF-T7-A4 plasmids and inoculate them into 3ml LB liquid medium (containing spectinomycin at a final concentration of 50μg / ml) for overnight culture. Pipette 1ml bacteria and transfer to 100ml LB liquid (containing spectinomycin at a final concentration of 50μg / ml, 1mM IPTG) and shake and culture in a shaker at 30℃250rpm for 8h. Transfer the bacterial solution induced by isopropyl-β-D-thiogalactoside (IPTG) to a 50ml centrifuge tube, centrifuge at 4℃, 6000rpm for 5min to collect the bacteria, discard the supernatant, and wash the bacteria twice with PBS solution; the washed bacteria are placed on ice and crushed with an ultrasonic crusher, with an ultrasonic power of 200W, an ultrasonic time of 1.5s, a pause of 3s, and a total ultrasonic time of 20 minutes, until the solution in the centrifuge tube becomes clear and transparent. Pipette 1ml of the crushed solution into a 1.5ml clean EP tube, centrifuge at 4℃, 13000rpm for 20min, and pipette the supernatant into a new 1.5ml EP tube, take the supernatant after crushing and centrifugation, add an appropriate amount of 5*Loading buffer, mix well, and boil in water for 10min, then centrifuge at 12000rpm for 2min, and pipette the supernatant to detect the expression of the target protein. The results showed that the proteins of pCDF-T7-A1, pCDF-T7-A2, pCDF-T7-A3, and pCDF-T7-A4 plasmids were well expressed in the E. coli production strain.

[0058] (3) Biofermentation test of N-acetyl-5-hydroxytryptamine

[0059] A fermentation experiment of a strain producing N-acetyl-5-hydroxytryptamine was conducted by a shake flask test, and the steps are as follows: 1) Preparation of seed solution: the BL21 strain integrated with the pCDF-T7-A1, pCDF-T7-A2, pCDF-T7-A3, and pCDF-T7-A4 plasmids in (2) were selected and inoculated into 20 ml of LB medium containing spectinomycin (final concentration 50 μg / ml), and cultured at 37°C and 250 rpm for 12 h; then the 20 ml culture was transferred to 300 ml of LB medium containing spectinomycin (final concentration 50 μg / ml), and cultured at 37°C and 250 rpm for 12 hours to obtain the seed solution. 2) Bacterial culture: inoculate the seed liquid into 1L fermentation medium containing spectinomycin (final concentration 50μg / ml) at a 10% inoculum volume. Fermentation was carried out in a 5L fermenter. The culture temperature was controlled at 37°C, the stirring speed was 500-800 rpm, the ventilation volume (3L / min) was used to control the dissolved oxygen in the fermenter to about 30%, 1M phosphoric acid and 3M ammonia water were added to control the pH to be stable at 7.0, and the feed medium flow acceleration was 50ml / h.

[0060] The fermentation medium is a universal medium, and the specific components of each 1L fermentation broth are as follows: glucose 10g, (NH4)2PO4, 8g, KH2PO4 13.3g, MgSO4*7H2O, 1.2g, citric acid 1.7g, trace salt solution 10ml, dilute to 1L with water, and adjust the pH to 7.0 with NaOH. The components of each 1L feed medium: glucose 400g, MgSO4*7H2O, 10g, trace salt solution 10ml, 5-hydroxytryptamine 10g. The configuration of each 1L trace salt solution; FeSO4*7H2O, 10g, ZnSO4*7H2O, 2.25g, CuSO4*5H2O 1g, MnSO4*5H2O 5g, Na2B4O7*10H2O 0.23g, CaCl2*2H2O, 2g, (NH4)6Mo7O 24 0.1g, adjust the pH with 5M hydrochloric acid and make up to 1L.

[0061] Induction culture: the temperature of the fermentation broth after the above bacterial culture was reduced to 30°C, IPTG was added to make the final concentration of IPTG 1mM, and the induction culture was carried out. During the induction process, feed medium was added at a flow rate of 20ml / h; the feed medium was added until the bacterial density OD 600 When the pH value reached 250, the induction culture process was terminated and the production of N-acetyl-5-hydroxytryptamine was measured.

[0062] The fermentation broth yields of the strains carrying pCDF-T7-A1, pCDF-T7-A2, pCDF-T7-A3, and pCDF-T7-A4 plasmids were measured respectively, and the N-acetyl-5-hydroxytryptamine concentration was detected every 24 hours. After 96 hours of final fermentation, the yield of N-acetyl-5-hydroxytryptamine was 3.8-5.6 g / L. The yield of the strain carrying the pCDF-T7-A2 plasmid was significantly higher than that of the strains carrying the pCDF-T7-A1, pCDF-T7-A2, and pCDF-T7-A4 plasmids, and the yield of N-acetyl-5-hydroxytryptamine reached 5.6 g / L. Figure 2 .

[0063] HPLC method for detecting the production of N-acetyl-5-hydroxytryptamine

[0064] Take the test solution, centrifuge at 5000rpm for 15min, absorb the supernatant, prepare the sample to be tested according to the volume ratio of supernatant: water: methanol 1:7.5:1.5, filter with 0.22um organic filter to remove insoluble matter and obtain the HPLC test sample to be tested. The HPLC detector is Agilent 1260 infinity LV, and the detection column is Agilent ZOBAX C18 column. The ultraviolet detection wavelength of N-acetyl-5-hydroxytryptamine is 275nm, the mobile phase is 15% (v / v) methanol, the flow rate is 1.0ml / min, the injection volume is 10μl, and the external standard method is used for quantification according to the peak area.

[0065] Embodiment 2:

[0066] (1) Construction of tandem expression plasmid for acetyl-CoA synthetase

[0067] According to the gene sequence of Pantoea agglomerans, an enzyme ACS1 with the function of synthesizing acetyl-CoA was synthesized, and its nucleotide sequence is shown in SEQ ID NO.009, and its amino acid sequence is shown in SEQ ID NO.010; according to the gene sequence of Escherichia coli, an enzyme ACS2 with the function of synthesizing acetyl-CoA was synthesized, and its nucleotide sequence is shown in SEQ ID NO.011, and its amino acid sequence is shown in SEQ ID NO.012; according to the gene sequence of Shigella sordellii, an enzyme ACS3 with the function of synthesizing acetyl-CoA was synthesized, and its nucleotide sequence is shown in SEQID NO.013, and its amino acid sequence is shown in SEQ ID NO.014.

[0068] Using pCDF-T7-A2 plasmid as a vector, the nucleotides of Pantoea agglomerans ACS1, Escherichia coli ACS2, and Shigella sordellii were expressed in tandem with N-acetyl-5-hydroxytryptamine transferase on the plasmid by seamless cloning and splicing to construct pCDF-T7-A2-ACS1, pCDF-T7-A2-ACS2, and pCDF-T7-A2-ACS3 plasmids. pCDF-T7-A2-ACS2 was as follows: Figure 2 The plasmid was transformed into DH5α strain according to the method of Example 1, and the positive clones on the LB plate (containing spectinomycin at a final concentration of 50 μg / ml) were sequenced and verified. The sequencing results were consistent with the sequences of SEQ ID 009, SEQ ID 011, and SEQ ID 013, indicating that the pCDF-T7-A2-ACS1, pCDF-T7-A2-ACS2, and pCDF-T7-A2-ACS3 plasmids were successfully constructed.

[0069] According to the method in the previous step, pCDF-T7-A4 plasmid with better N-acetyl 5-hydroxytryptamine production was used as a vector to construct pCDF-T7-A4-ACS1, pCDF-T7-A4-ACS2 and pCDF-T7-A4-ACS3 plasmids.

[0070] (2) Biofermentation test of N-acetyl-5-hydroxytryptamine

[0071] The pCDF-T7-A2-ACS1, pCDF-T7-A2-ACS2 and pCDF-T7-A2-ACS3 plasmids constructed above were transferred into the BL21 (DE3) strain, and the plasmids expressed in series were fermented and evaluated according to the method of Example 1. The fermentation results showed that the strain carrying the pCDF-T7-A2-ACS3 plasmid had the best N-acetyl-5-hydroxytryptamine result, with a yield of 7.1 g / L, and the strains carrying the pCDF-T7-A2-ACS2 and pCDF-T7-A2-ACS1 plasmids had yields of 5.8 g / L and 6.4 g / L.

[0072] Similarly, pCDF-T7-A4-ACS1, pCDF-T7-A4-ACS2 and pCDF-T7-A4-ACS3 plasmids were fermented according to the above method. The fermentation results are shown in Figure 5 shown.

[0073] The results showed that the synthesis yield of N-acetyl-5-hydroxytryptamine can be further increased by tandem expression of acetyl-CoA synthetase. The enzyme with acetyl-CoA synthesis function from Shigella sorneri significantly improved the yield of N-acetyl-5-hydroxytryptamine, and the ACS enzyme from Shigella sorneri had the best effect on enhancing the expression of acetyl-CoA.

[0074] Embodiment 3:

[0075] (1) Construction of recombinant N-acetyl-5-hydroxytryptamine bacteria

[0076] The key genes expressed on plasmids are less stable than those expressed on chromosomes. Therefore, in this example, the N-acetyl-5-hydroxytryptamine transferase gene A2 and the acetyl-CoA synthetase gene ACS3 were integrated into the chromosome of Escherichia coli to obtain the integrated N-acetyl-5-hydroxytryptamine synthesis strain BL-S16.

[0077] In the first step, the first homologous recombination fragment I with TrpR knockout was obtained. The pXZ-SC plasmid (Tan et al, 2013AEM) was used as a template and primers TrpR-F and TrpR-R were used for PCR amplification to obtain a PCR product of about 3 kb, which was the first homologous recombination fragment DNA, containing cat, sacB genes and 50 bp upstream and downstream homologous arms.

[0078] In the second step, the DNA fragment with the TrpR gene knocked out was used for the first step of homologous recombination: first, the pTKred (Cox et al, 2010 Nucleic acid Res) tool enzyme plasmid was transformed into the BL21 strain by electroporation, and then the DNA fragment 1 was electroporated into the BL21 strain carrying the pTKRed plasmid.

[0079] Electroporation conditions: Prepare competent E. coli BL21 cells with pTKRed plasmid (Dower et al. 1998 Nuclei acid Res); place 50 μl competent cells on ice, add 50 ng DNA fragment I, and transfer to a 1 mm Bio-Rad electroporation cup. Use Micro Pulser (Bio-Rad) electroporator for electroporation, and then transfer competent cells to 1 ml LB liquid culture medium, incubate at 30°C and 75 rpm for 3 hours, then spread on a plate containing spectinomycin (final concentration 50 μg / ml) and chloramphenicol (34 μg / ml), and culture overnight at 37°C. Use cat-F and sacB-R primers for verification, and select a correct single clone, named BL-TrpRC.

[0080] In the third step, the second step fragment II of homologous recombination was obtained, and the pCDF-T7-A2-ACS3 plasmid was used as a template and T7-A2 / ACS3-down was used as primers to amplify a homologous linear fragment containing 50 bp upstream of the TrpR gene, the T7 promoter, the A2 gene, the ACS3 gene, and 50 bp downstream of the TrpR gene. The amplified fragment was electroporated into the BL-TrpRC strain.

[0081] Electroporation conditions: Prepare electroporation competent cells of BL21-TrpRC carrying pTKRed plasmid (see Dower et al. 1988 for preparation); place 50 μl competent cells on ice, add 50 ng DNA fragments, and transfer to a 1 mm electroporation cup. Use Micro Pulser (Bio-Rad) electroporator for electroporation, and then transfer competent cells to 1 ml LB liquid medium, incubate at 30°C 75 rpm for 4 h, and then transfer to salt-free LB liquid medium containing 10% sucrose (containing spectinomycin at a final concentration of 50 μg / ml), shake culture at 30°C 220 rpm for 24 h, and then streak on salt-free LB medium containing 6% sucrose (containing spectinomycin at a final concentration of 50 μg / ml). Use T7-A2 / ACS3-down primers to verify the single clone, and the positive clone is named BL-S16.

[0082] The primers for integrating A2 and ACS genes are shown in the table below:

[0083]

[0084] (2) Fermentation of recombinant bacteria BLR-S16

[0085] The fermentation experiment was carried out on the BLR-S1 strain in the manner of Example 1. The HPLC yield detected that the N-acetyl-5-hydroxytryptamine yield reached 7.0 g / L, reaching a relatively ideal level.

[0086] In summary, the present invention uses a plasmid to express N-acetyl-5-hydroxytryptamine transferase, and further enhances the expression of N-acetyl-5-hydroxytryptamine in tandem, and the obtained target strain has an N-acetyl-5-hydroxytryptamine production of up to 7.1 g / L, which is the highest level reported so far. <110> Hebei Vidakang Biotechnology Co., Ltd. <120> A method for enhancing the production of N-acetyl-5-hydroxytryptamine <160> 14 <210> 1 <211> 624bp <212> DNA <213> Artificial sequence <400> 1 atgtccactc cgtctgttca ctgcctgaaa ccgagcccgc tgcacctgcc gtccggcatc 60 ccaggctctc cgggtcgtca gcgtcgtcac accctgccgg cgaacgaatt tcgttgcctg 120 accccggaag atgcggcggg tgttttcgaa atcgaacgtg aagcgttcat ctctgtttcc 180 ggtaactgcc cgctgaacct ggatgaagtt cagcacttcc tgaccctgtg cccggaactg 240 agcctgggct ggttcgttga aggccgtctg gttgcgttca tcatcggctc actgtgggat 300 gaagaacgtc tgacccagga atcactggcg ctgcaccgtc cgcgtggcca cagcgcgcac 360 ctgcacgcgc tggcggttca ccgtagcttc cgtcagcagg gcaaaggcag cgttctgctg 420 tggcgttacc tgcaccacgt tggcgcgcag ccggcggttc gtcgtgcggt tctgatgtgc 480 gaagatgcgc tggttccgtt ctatcagcgt ttcggcttcc acccggctgg cccgtgcgcg 540 atcgttgttg gtagcctgac cttcaccgaa atgcactgca gcctgcgtgg ccacgcggcg 600 ctgcgtcgta acagcgatcg ttaa 624 <210> 2 <211> 207 <212> PRT <213> Artificial sequence <400> 2 MSTPSVHCLK PSPLHLPSGI PGSPGRQRRH TLPANEFRCL TPEDAAGVFE IEREAFISVS 60 GNCPLNLDEV QHFLTLCPEL SLGWFVEGRL VAFIIGSLWD EERLTQESLA LHRPRGHSAH 120 LHALAVHRSF RQQGKGSVLL WRYLHHVGAQ PAVRRAVLMC EDALVPFYQR FGFHPAGPCA 180 IVVGSLTFTE MHCSLRGHAA LRRNSDR 207 <210> 3 <211> 723bp <212> DNA <213> Artificial sequence <400> 3 atggaagatg cgctgaccgt tagcggcaaa ccggcggcgt gcccggttga tcaggattgc 60 ccgtacacca tcgaactgat ccagccggaa gatggcgaag cggttatcgc gatgctgaaa 120 accttcttct tcaaagatga accgctgaac accttcctgg atctgggcga atgcaaagaa 180 ctggaaaaat acagcctgaa accgctgccg gataactgca gctacaaagc ggttaacaaa 240 aaaggtgaaa tcatcggcgt tttcctgaac ggcctgatgc gtcgtccgtc cccggatgat 300 gttccggaaa aagcggcgga ttcttgcgaa cacccgaaat tcaagaaaat cctgagcctg 360 atggatcacg ttgaagaaca gttcaacatc ttcgatgttt acccggatga agaactgatc 420 ctggatggta aaatcctgag cgttgatacc aactaccgtg gtctgggcat cgctggtcgt 480 ctgaccgaac gtgcgtacga atacatgcgt gaaaacggta tcaacgttta ccacgttctg 540 tgctcttctc actactctgc gcgtgttatg gaaaaactgg gcttccacga agttttccgt 600 atgcagttcg cggattacaa accgcagggt gaagttgttt tcaaaccggc ggcgccgcac 660 gttggcatcc aggttatggc gaaagaagtt ggcccggcga aagcggcgca gaccaaactg 720 taa 723 <210> 4 <211> 240 <212> PRT <213> Artificial sequence <400> 2 MEDALTVSGK PAACPVDQDC PYTIELIQPE DGEAVIAMLK TFFFKDEPLN TFLDLGECKE 60 LEKYSLKPLP DNCSYKAVNK KGEIIGVFLN GLMRRPSPDD VPEKAADSCE HPKFKKILSL 120 MDHVEEQFNI FDVYPDEELI LDGKILSVDT NYRGLGIAGR LTERAYEYMR ENGINVYHVL 180 CSSHYSARVM EKLGFHEVFR MQFADYKPQG EVVFKPAAPH VGIQVMAKEV GPAKAAQTKL 240 <210> 5 <211> 549bp <212> DNA <213> Artificial sequence <400> 3 atgaacacct tccgtaccgc gaccgcgcgt gatctgccgg atgttgcggc gaccctgacc 60 gaagcgttcg cggcggatcc gccgacccag tgggttttcc cggatggcgc ggcggcggtt 120 agccgtttct tcttcggcgt tgctgatcgt gcgcgtgaag cgggtggcat cgttgaactg 180 ctgccgggta ccgcggcgat gatcgcgctg ccgccgcacg ttcgtctgcc ggatgcgccg 240 gcgtgcggcc gccaggcgga aatgcagcgt cgcctgggcg aacgtcgtcc gcgtaccccg 300 cactactacc tgctgttcta cggcgttcgt accgcgcacc agagcagcgg cctgggtggt 360 cgtatgctga gcgatctgat cagcttggcg gatcgtgatc gtgttggcac ctacaccgaa 420 gcgagcacct ggcgtggtgc gcgtctgatg ctgcgtcacg gcttccacac cgcgcagccg 480 ctgcgtctgc cgcacggtcc tccgatgttc ccgctgtggc gtgacccgat tcatgatcat 540 tgtgattaa 549 <210> 6 <211> 182 <212> PRT <213> Artificial Sequence <400> 6 MNTFRTATAR DLPDVAATLT EAFAADPPTQ WVFPDGAAAV SRFFFGVADR AREAGGIVEL 60 LPGTAAMIAL PPHVRLPDAP ACGRQAEMQR RLGERRPRTP HYYLLFYGVR TAHQSSGLGG 120 RMLSDLISLA DRDRVGTYTE ASTWRGARLM LRHGFHTAQP LRLPHGPPMF PLWRDPIHDH 180 CD 182 <210> 7 <211> 549bp <212> DNA <213> Artificial sequence <400> 7 atgaacacct tccgtaccgc gaccgcgcgt gatatcccgg atgttgcggc gaccctgacc 60 gaagcgttcg cgaccgatcc gccgacccag tgggttttcc cggatggtac cgcggcggtt 120 agccgcttct tcacccacgt tgcggatcgt gttcacaccg cgggtggcat cgttgaactg 180 ctgccggacc gtgcggctat gatcgcactg ccgccgcacg ttcgtctgcc gggtgaagcg 240 gcggatggcc gtcaggcgga aatccagcgc cgtctggctg accgtcaccc gctgaccccg 300 cactactacc tgctgttcta cggcgttcgt accgcgcacc agggtagcgg cctgggcggc 360 cgtatgctgg cgcgcctgac cagccgtgcg gatcgtgatc gtgttggtac ctacaccgaa 420 gcgtccacct ggcgtggcgc gcgtctgatg ctgcgtcacg gcttccacgc gacccgtccg 480 ctgcgtctgc cggatggccc gagcatgttc ccgttatggc gtgatccgat ccacgatcac 540 agcgattaa 549 <210> 8 <211> 182 <212> PRT <213> Artificial sequence <400> 8 MNTFRTATAR DIPDVAATLT EAFATDPPTQ WVFPDGTAAV SRFFTHVADR VHTAGGIVEL 60 LPDRAAMIAL PPHVRLPGEA ADGRQAEIQR RLADRHPLTP HYYLLFYGVR TAHQGSGLGG 120 RMLARLTSRA DRDRVGTYTE ASTWRGARLM LRHGFHATRP LRLPDGPSMF PLWRDPIHDH 180 SD 182 <210> 9 <211> 1956bp <212> DNA <213> Artificial sequence <400> 9 atgagccaaa tacacaaaca tcccgttcca gagaatattg cagcaaacac cctgattact 60 gcagaacagt atcaggcgat gtatcagcaa tctgtcgacg atccagacag tttctggggc 120 gaacagggca aaatccttga ctggatcaag ccttacagca aagtgaaaaa ctgctcgttt 180 gcaccaggta acattaacat tcgctggtac gaagatggca cgctcaacct ggcggcaaac 240 tgccttgacc gtcatttagc cacgcgcggc gatcacccgg cgattatctg ggaaggcgac 300 gacgccagcg aaagcaaaac cctgactttc cgccagctgc atgccgaagt ctgtcgcttc 360 gccaacgtgc tggaactgct ggaagtgaaa aaaggcgacg tggtggcgat ctatatgccg 420 atggtgccgg aagccgcagt agcgatgctg gcctgtgcgc gtatcggtgc cgttcactcg 480 gtgatctttg gcggtttctc accggaggcg gtcgcgggcc gcatcgtcga ttccagcgcc 540 tcgctggtaa tcacggccga tgaagggatc cgcgccggtc gcagcattcc gctgaagaaa 600 aatgtcgatg acgcgttaaa aaatcctaat gtcaccagcg tgaaaaacgt ggtggtgttc 660 cagcgcactg gtaaagatgt gggctgggtt gaaggccgcg atcagtggtg gcacgacctg 720 atgctgaacg cgagcaccaa ccacgctgcc gcagaagtcg gcgcggaaga tccgctgttt 780 atcctttata cctccggctc aaccggcaaa cccaaaggcg tgttgcactc caccggtggg 840 tatctggtct atgccgccac aacctttaag ttcgtctttg attaccatca ggatgatatc 900 tactggtgca ccgccgatgt tggctgggtg acgggccaca gctatctggt ttatggaccg 960 ctggcctgtg gcgccaccac actgatgttt gaaggggtgc cgaactggcc aacgccgagc 1020 cgtatggcgg aagtggtcga taaacataaa gtcacgctgc tctacaccgc gcccactgca 1080 atccgtgcgc tgatggcgga aggtgataag gcgattgccg gcaccgaccg cagcagcctg 1140 cgcattatgg gatcggtcgg tgagccaatt aacccggaag cctgggagtg gtactacaag 1200 aaaatcggca acagccgctg cccgattgtt gatacctggt ggcagaccga aaccggcggc 1260 ttcatgatca cgccgctgcc gggtgcgacc gaactgaaag cgggttccgc cacccgaccg 1320 ttctttggcg tgcagcccgc gctggtggat aacgaaggtc agccacagga aggtgcctgt 1380 gaaggcaatc tggtgatcac cgagtcgtgg ccgggtcagg cacgtaccct ctatggcgat 1440 cacgaccgtt tcgagcagac ctacttctct acctttaaaa atgtctactt cagtggtgat 1500 ggtgcccgtc gtgatgagga tggctactac tggatcaccg gacgcgtcga tgacgtgctc 1560 aatgtttccg gtcaccgact cggcaccgcc gaaattgaat cggcgctggt ctcgcaccca 1620 aaaattgccg aagcggcggt agtggggatt ccgcacagca tcaaaggcca ggcgatctat 1680 gcctatatca cgctgaatca tggcgaagag ccgtcgccgg agttgtacac cgaagtgcgc 1740 cagtgggtcc gtaaagagat tggcccgata gccacaccgg atgtgctgca ctggaccgac 1800 tcactgccga aaacccgctc cggcaaaatc atgcggcgta ttctgcgcaa aattgccacc 1860 ggggatacca gtaatcttgg tgatacttct acgctcgccg atcctggcgt agtagaaaaa 1920 ctgcttgagg agaagcagtc gatcaaaatg ccttaa 1956 <210> 10 <211> 651 <212> PRT <213> Artificial Sequence <400> 10 MSQIHKHPVP ENIAANTLIT AEQYQAMYQQ SVDDPDSFWG EQGKILDWIK PYSKVKNCSF 60 APNNINIRWY EDGTLNLAAN CLDRHLATRG DHPAIIWEGD DASESKTLTF RQLHAEVCRF 120 ANVLELLEVK KGDVVAIYMP MVPEAAVAML ACARIGAVHS VIFGGFSPEA VAGRIVDSSA 180 SLVITADEGI RAGRSIPLKK NVDDALKNPN VTSVKNVVVF QRTGKDVGWV EGRDQWWHDL 240 MLNASTNHAA AEVGAEDPLF ILYTSGSTGK PKGVLHSTGG YLVYAATTFK FVFDYHQDDI 300 YWCTADVGWV TGHSYLVYGP LACGATTLMF EGVPNWPTPS RMAEVVDKHK VTLLYTAPTA 360 IRALMAEGDK AIAGTDRSSL RIMGSVGEPI NPEAWEWYYK KIGNSRCPIV DTWWQTETGG 420 FMITPLPGAT ELKAGSATRP FFGVQPALVD NEGQPQEGAC EGNLVITESW PGQARTLYGD 480 HDRFEQTYFS TFKNVYFSGD GARRDEDGYY WITGRVDDVL NVSGHRLGTA EIESALVSHP 540 KIAEAAVVGI PHSIKGQAIY AYITLNHGEE PSPELYTEVR QWVRKEIGPI ATPDVLHWTD 600 SLPKTRSGKI MRRILRKIAT GDTSNLGDTS TLADPGVVEK LLEEKQSIKM P 651 <210> 11 <211> 1959bp <212> DNA <213> Artificial sequence <400> 11 atgagccaaa ttcacaaaca caccattcct gccaacatcg cagaccgttg cctgataaac 60 cctcagcagt acgaggcgat gtatcaacaa tctattaacg tacctgatac cttctggggc 120 gaacagggaa aaattcttga ctggatcaaa ccttaccaga aggtgaaaaa cacctccttt 180 gcccccggta atgtgtccat taaatggtac gaggacggca cgctgaatct ggcggcaaac 240 tgccttgacc gccatctgca agaaaacggc gatcgtaccg ccatcatctg ggaaggcgac 300 gacgccagcc agagcaaaca tatcagctat aaagagctgc accgcgacgt ctgccgcttc 360 gccaataccc tgctcgagct gggcattaaa aaaggtgatg tggtggcgat ttatatgccg 420 atggtgccgg aagccgcggt tgcgatgctg gcctgcgccc gcattggcgc ggtgcattcg 480 gtgattttcg gcggcttctc gccggaagcc gttgccgggc gcattattga ttccaactca 540 cgactggtga tcacttccga cgaaggtgtg cgtgccgggc gcagtattcc gctgaagaaa 600 aacgttgatg acgcgctgaa aaacccgaac gtcaccagcg tagagcatgt ggtggtactg 660 aagcgtactg gcgggaaaat tgactggcag gaagggcgcg acctgtggtg gcacgacctg 720 gttgagcaag cgagcgatca gcaccaggcg gaagagatga acgccgaaga tccgctgttt 780 attctctaca cctccggttc taccggtaag ccaaaaggtg tgctgcatac taccggcggt 840 tatctggtgt acgcggcgct gacctttaaa tatgtctttg attatcatcc gggtgatatc 900 tactggtgca ccgccgatgt gggctgggtg accggacaca gttacttgct gtacggcccg 960 ctggcctgcg gtgcgaccac gctgatgttt gaaggcgtac ccaactggcc gacgcctgcc 1020 cgtatggcgc aggtggtgga caagcatcag gtcaatattc tctataccgc acccacggcg 1080 atccgcgcgc tgatggcgga aggcgataaa gcgatcgaag gcaccgaccg ttcgtcgctg 1140 cgcattctcg gttccgtggg cgagccaatt aacccggaag cgtgggagtg gtactggaaa 1200 aaaatcggca acgagaaatg tccggtggtc gatacctggt ggcagaccga aaccggcggt 1260 ttcatgatca ccccgctgcc tggcgctacc gagctgaaag ccggttcggc aacacgtccg 1320 ttcttcggcg tgcaaccggc gctggtcgat aacgaaggta acccgctgga gggggccacc 1380 gaaggtagcc tggtaatcac cgactcctgg ccgggtcagg cgcgtacgct gtttggcgat 1440 cacgaacgtt ttgaacagac ctacttctcc accttcaaaa atatgtattt cagcggcgac 1500 ggcgcgcgtc gcgatgaaga tggctattac tggataaccg ggcgtgtgga cgacgtgctg 1560 aacgtctccg gtcaccgtct ggggacggca gagattgagt cggcgctggt ggcgcatccg 1620 aagattgccg aagccgccgt agtaggtatt ccgcacaata ttaaaggtca ggcgatctac 1680 gcctacgtca cgcttaatca cggggaggaa ccgtcaccag aactgtacgc agaagtccgc 1740 aactgggtgc gtaaagagat tggcccgctg gcgacgccag acgtgctgca ctggaccgac 1800 tccctgccta aaacccgctc cggcaaaatt atgcgccgta ttctgcgcaa aattgcggcg 1860 ggcgatacca gcaacctggg cgatacctcg acgcttgccg atcctggcgt agtcgagaag 1920 ctgcttgaag agaagcaggc tatcgcgatg ccatcgtaa 1959 <210> 12 <211> 652 <212> PRT <213> Artificial Sequence <400> 12 MSQIHKHTIP ANIADRCLIN PQQYEAMYQQ SINVPDTFWG EQGKILDWIK PYQKVKNTSF 60 APGNVSIKWY EDGTLNLAAN CLDRHLQENG DRTAIIWEGD DASQSKHISY KELHRDVCRF 120 ANTLLELGIK KGDVVAIYMP MVPEAAVAML ACARIGAVHS VIFGGFSPEA VAGRIIDSNS 180 RLVITSDEGV RAGRSIPLKK NVDDALKNPN VTSVEHVVVL KRTGGKIDWQ EGRDLWWHDL 240 VEQASDQHQA EEMNAEDPLF ILYTSGSTGK PKGVLHTTGG YLVYAALTFK YVFDYHPGDI 300 YWCTADVGWV TGHSYLLYGP LACGATTLMF EGVPNWPTPA RMAQVVDKHQ VNILYTAPTA 360 IRALMAEGDK AIEGTDRSSL RILGSVGEPI NPEAWEWYWK KIGNEKCPVV DTWWQTETGG 420 FMITPLPGAT ELKAGSATRP FFGVQPALID NEGNPLEGAT EGSLVITDSW PGQARTLFGD 480 HERFEQTYFS TFKNMYFSGD GARRDEDGYY WITGRVDDVL NVSGHRLGTA EIESALVAHP 540 KIAEAAVVGI PHNIKGQAIY AYVTLNHGEE PSPELYAEVR NWVRKEIGPL ATPDVLHWTD 600 SLPKTRSGKI MRRILRKIAA GDTSNLGDTS TLADPGVVEK LLEEKQAIAM PS 652 <210> 13 <211> 1959 bp <212> DNA <213> Artificial sequence <400> 13 atgagccaaa ttcacaaaca caccattcct gccaacatcg cagaccgttg cctgataaac 60 cctcagcagt acgaggcgat gtatcaacaa tctattaacg tacctgatac cttctggggc 120 gaacagggaa aaattcttga ctggatcaaa ccttaccaga aggtgaaaaa cacctccttt 180 gcccccggta atgtgtccat taaatggtac gaggacggca cgctgaatct ggcggcaaac 240 tgccttgacc gccatctgca agaaaacggc gatcgtaccg ccatcatctg ggaaggcgac 300 gacgccagcc agagcaaaca tatcagctat aaagagctgc accgcgacgt ctgccgcttc 360 gccaataccc tgctcgagct gggcattaaa aaaggtgatg tggtggcgat ttatatgccg 420 atggtgccgg aagccgcggt tgcgatgctg gcctgcgccc gcattggcgc ggtgcattcg 480 gtgattttcg gcggcttctc gccggaagcc gttgccgggc gcattattga ttccaactca 540 cgactggtga tcacttccga cgaaggtgtg cgtgccgggc gcagtattcc gctgaagaaa 600 aacgttgatg acgcgctgaa aaacccgaac gtcaccagcg tagagcatgt ggtggtactg 660 aagcgtactg gcgggaaaat tgactggcag gaagggcgcg acctgtggtg gcacgacctg 720 gttgagcaag cgagcgatca gcaccaggcg gaaaagatga acgccgaaga tccgctgttt 780 attctctaca cctccggttc taccggtaag ccaaaaggtg tgctgcatac taccggcggt 840 tatctggtgt acgcggcgct gacctttaaa tatgtctttg attatcatcc gggtgatatc 900 tactggtgca ccgccgatgt gggctgggtg accggacaca gttacttgct gtacggcccg 960 ctgacctgcg gtgcgaccac gctgatgttt gaaggcgtac ccaactggcc gacgcctgcc 1020 cgtatggcgc aggtggtgga caagcatcag gtcaatattc tctataccgc acccacggcg 1080 atccgcgcgc tgatggcgga aggcgataaa gcgatcgagg gtaccgaccg ttcgtcgctg 1140 cgcattctcg gttccgtggg cgagccaatt aacccggaag cgtgggagtg gtactggaaa 1200 aaaatcggca acgagaaatg tccggtggtc gatacctggt ggcagaccga aactggcggt 1260 ttcatgatca cgccgctgcc tggcgctacc gagctgaaag ccggttcggc aacacgtccg 1320 ttcttcggcg tgcaaccggc gctggtcgat aacgaaggta acccgctgga aggcgctacc 1380 gaaggcagcc tggtgatcac cgactcctgg ccgggtcagg cgcgtacgct gtttggcgat 1440 cacgaacgtt ttgaacagac ctacttctcc accttcaaaa atatgtattt cagcggcgac 1500 ggcgcgcgtc gcgatgaaga tggctattac tggatcaccg ggcgtgtgga cgacgtgctg 1560 aacgtctccg gtcaccgtct ggggacggca gagattgagt cggcgctggt ggcgcatccg 1620 aagattgccg aagccgccgt agtaggtatt ccgcacaata ttaaaggtca ggcgatctac 1680 gcctacgtca cgcttaatca cggggaggaa ccgtcaccag aactgtacgc agaagtccgc 1740 aactgggtgc gtaaagagat tggcccgctg gcgacgccag acgtgctgca ctggaccgac 1800 tccctgccta aaacccgctc cggcaaaatt atgcgccgta ttctgcgcaa aattgcggcg 1860 ggcgatacca gcaacctggg cgatacctcg acgcttgccg atcctggcgt agtcgagaag 1920 ctgcttgaag agaagcaggc tatcgcgatg ccatcgtaa 1959 <210> 14 <211> 652 <212> PRT <213> Artificial Sequence <400> 14 <h2 style=";text-align:left;direction:ltr">MSQIHKHTIP ANIADRCLIN PQQYEAMYQQ SINVPDTFWG EQGKILDWIK PYQKVKNTSF 60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> APGNVSIKWY EDGTLNLAAN CLDRHLQENG DRTAIIWEGD DASQSKHISY KELHRDVCRF 120<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ANTLLELGIK KGDVVAIYMP MVPEAAVAML ACARIGAVHS VIFGGFSPEA VAGRIIDSNS 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> RLVITSDEGV RAGRSIPLKK NVDDALKNPN VTSVEHVVVL KRTGGKIDWQ EGRDLWWHDL 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> VEQASDQHQA EKMNAEDPLF ILYTSGSTGK PKGVLHTTGG YLVYAALTFK YVFDYHPGDI 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> YWCTADVGWV TGHSYLLYGP LTCGATTLMF EGVPNWPTPA RMAQVVDKHQ VNILYTAPTA 360<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IRALMAEGDK AIEGTDRSSL RILGSVGEPI NPEAWEWYWK KIGNEKCPVV DTWWQTETGG 420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> FMITPLPGAT ELKAGSATRP FFGVQPALVD NEGNPLEGAT EGSLVITDSW PGQARTLFGD 480<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> HERFEQTYFS TFKNMYFSGD GARRDEDGYY WITGRVDDVL NVSGHRLGTA EIESALVAHP 540<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> KIAEAAVVGI PHNIKGQAIY AYVTLNHGEE PSPELYAEVR NWVRKEIGPL ATPDVLHWTD 600<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SLPKTRSGKI MRRILRKIAA GDTSNLGDTS TLADPGVVEK LLEEKQAIAM PS 652

Claims

1. A method for increasing the production of N-acetyl-5-hydroxytryptamine, characterized in that: The substrate 5-hydroxytryptamine is converted into N-acetyl-5-hydroxytryptamine by a recombinant cell comprising a functional gene related to catalyzing 5-hydroxytryptamine to generate N-acetyl-5-hydroxytryptamine. The recombinant cell expresses an N-acetyl-5-hydroxytryptamine transferase gene to produce N-acetyl-5-hydroxytryptamine transferase, or the recombinant cell expresses an N-acetyl-5-hydroxytryptamine transferase gene and an acetyl-CoA synthetase gene for enhancing the production of N-acetyl-5-hydroxytryptamine to produce N-acetyl-5-hydroxytryptamine transferase and acetyl-CoA synthetase. The amino acid sequence of the N-acetyl-5-hydroxytryptamine transferase is any one of SEQ ID NO: 002, SEQ ID NO: 004, SEQ ID NO: 006, and SEQ ID NO: 008; the amino acid sequence of the acetyl-CoA is shown in SEQ ID NO: 010, SEQ ID NO: 012, or SEQ ID NO:

014.

2. The method according to claim 1, characterized in that: It also includes the use of the synthesized N-acetyl-5-hydroxytryptamine in the production of subsequent tryptophan derivatives of N-acetyl-5-methoxytryptamine.

3. A recombinant vector comprising an N-acetyl-5-hydroxytryptamine transferase (AANAT) gene as described in any one of SEQ ID NO: 001, SEQ ID NO: 003, SEQ ID NO: 005, and SEQ ID NO: 007 and an acetyl-CoA synthetase (ACS) gene as described in any one of SEQ ID NO: 009, SEQ ID NO: 011, or SEQ ID NO:

013. A host cell comprising the recombinant vector according to claim 3.

5. A host cell having an N-acetyl-5-hydroxytryptamine transferase gene and an acetyl-CoA synthetase (ACS) gene integrated into its genome, wherein the N-acetyl-5-hydroxytryptamine transferase gene sequence is shown in SEQ ID NO: 001, SEQ ID NO: 003, SEQ ID NO: 005 or SEQ ID NO: 007; and the acetyl-CoA synthetase gene sequence is shown in SEQ ID NO: 009, SEQ ID NO: 011 or SEQ ID NO:

013.

6. A method for constructing a recombinant vector as claimed in claim 3, comprising: amplifying the target gene using a gene amplifier, and connecting the target gene and the expression vector by seamless cloning or enzyme ligation, wherein the primers for amplifying the target gene are: Primers for amplifying the AANAT gene shown in SEQ ID NO: 001: F1:GAATTCCATGTCCACTCCGTCT R1:AAGCTTTTAACGATCGCTGTTACG Primers for amplifying the AANAT gene shown in SEQ ID NO: 003: F2:GAATTCCATGGAAGATGCGCTG R2:AAGCTTTTACAGTTTGGTCTGCG Primers for amplifying the AANAT gene shown in SEQ ID NO: 005: F3:GAATTCCATGAACACCTTCCGTAC R3: AAGCTTTTAATCACAATGATCATGAATCGG Primers for amplifying the AANAT gene shown in SEQ ID NO: 007: F4:GAATTCCATGAACACCTTCCGTACC R4: AGCTTTTAATCGCTGTGATCGTG Primers for amplifying the ACS gene shown in SEQ ID NO: 009: ACS1-F: AAACTGTAAAAGCTTATGAGCCAAATACACAAACATCCC ACS1-R:TTATGCTAGAAGCTTTTAAGGCATTTTGATCGACTGCTTC Primers for amplifying the ACS gene shown in SEQ ID NO: 011: ACS2-F: AAACTGTAAAAGCTTATGAGCCAAATTCACAAACACACC ACS2-R:TTATGCTAGAAGCTTTTACGATGGCATCGCGATAG Primers for amplifying the ACS gene shown in SEQ ID NO: 013: ACS3-F: AAACTGTAAAAGCTTATGAGCCAAATTCACAAACACACC ACS3-R:TTATGCTAGAAGCTTTTACGATGGCATCGCGATAG.

7. A host cell according to claim 5, characterized in that: The host cell is a prokaryotic cell Escherichia coli ( Escherichia coli ), Corynebacterium glutamicum ( Corynebacerium glutamicum ), Bacillus subtilis ( Bacillus subtillis ), Brevibacterium flavum ( Brevibacterium flavum ), Serratia marcescens ( Serratia marcescens ), lower eukaryotic cells Saccharomyces cerevisiae ( Saccharomyces cerecisiae ), Yarrowia lipolytica ( Yarrowia lipolytica ) and Aspergillus niger ( Aspergillus niger ) of any type of cell.

Images