Melanoma molecular markers and their application in early diagnosis and treatment of melanoma

Abstract

The present invention discloses melanoma molecular markers and applications thereof in early diagnosis and treatment of melanoma. The melanoma molecular markers include miR-196a, miR-27a-5p and miR-27b-5p. Experimental verification by the present invention shows that the molecular markers miR-196a, miR-27a-5p and miR-27b-5p have good diagnostic efficacy when applied to the diagnosis of melanoma, and miR-196a, miR-27a-5p and miR-27b-5p have synergistic therapeutic effects when applied to the treatment of melanoma. The present invention provides a new approach for the diagnosis and treatment of melanoma.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology. Specifically, the present invention relates to melanoma molecular markers and their application in early diagnosis and treatment of melanoma. More specifically, the melanoma molecular markers involved in the present invention include miR-196a, miR-27a-5p, and miR-27b-5p. Background Art

[0002] Skin melanoma is the 12th most common cancer in the world. Melanoma is caused by the malignant transformation of melanocytes. It can occur in all parts of the skin and mucous membranes. It is easy to metastasize, highly invasive, and highly malignant, resulting in a high mortality rate. The diagnosis of melanoma is based on a combination of clinical and pathological criteria, including physical examination, pathological histological examination, and imaging examination. However, due to its variable histological morphology, or only a small amount or even no visible pigment, it is difficult for patients to detect it early. It is sometimes difficult to distinguish it from benign moles clinically, making early diagnosis difficult. The early treatment of melanoma is mainly surgical, while the late stage includes chemotherapy, targeted therapy, and immunotherapy. Compared with chemotherapy alone, targeted therapy and immunotherapy have significantly improved the survival rate of patients with advanced melanoma. However, these two therapies are usually limited by drug resistance and are not universally applicable. The absolute survival rate of patients is still low (Hamid O, Robert C, Daud A, et al. Five-year survival outcomes for patients with advanced melanoma treated with pembrolizumab in KEYNOTE-001[J]. Annals of Oncology, 2019, 30(4): 582-588.). Therefore, early diagnosis and early treatment are crucial to improving patients' survival rate and quality of life.

[0003] Biomarkers are biochemical indicators that can mark changes or possible changes in the structure or function of systems, organs, tissues, cells and subcellular structures. They have a wide range of uses in the biomedical field. Biomarkers can be used to diagnose diseases, determine disease stages, or evaluate the safety and effectiveness of new drugs or new therapies in target populations. Biomarkers can objectively reflect normal physiological and pathological processes. In recent years, microRNA (miRNA) has attracted much attention as a new type of cancer-specific biomarker. MiRNA is a type of endogenous non-coding small RNA found in eukaryotes. It exists in different organisms. Under the action of Drosha R Nase, pri-miRNA is cleaved into pre-miRNA with a stem-loop structure of 70 to 100 nucleotides in length. Pre-miRNA is cleaved into mature RNA with a length of 19 to 25 nucleotides, namely miRNA, under the action of Dicer enzyme. Mature miRNA specifically complements the 3' untranslated region (3'UTR) of the target mRNA, resulting in the inhibition of mRNA translation. miRNA has a wide range of gene regulatory functions. According to statistics, miRNA regulates the functions of about 30% of human genes and participates in a series of life activities, including cell proliferation and apoptosis, organ formation, hematopoiesis, developmental process, etc. It is closely related to the occurrence, diagnosis, treatment and prognosis of tumors. More than 50% of miRNA genes in tumors are located in chromosomal fragile sites or chromosomal amplification, deletion or translocation regions. Compared with protein markers, abnormal miRNA expression appears earlier, which is more beneficial for early diagnosis and more suitable as a tumor biomarker.

[0004] Therefore, it is very important to identify biomarkers that can be better used for melanoma diagnosis and treatment in this field. In view of this, the present invention screened miRNA markers related to the occurrence and development of melanoma, and verified the efficacy of the miRNA markers as predictive markers and therapeutic targets for melanoma through relevant validation experiments. Summary of the invention

[0005] The purpose of the present invention is to provide melanoma molecular markers and their use in early diagnosis and treatment of melanoma. The molecular markers include miR-196a, miR-27a-5p, and miR-27b-5p. The present invention has experimentally verified for the first time that the combination of miR-196a, miR-27a-5p, and miR-27b-5p has good diagnostic efficacy for melanoma and has a synergistic therapeutic effect.

[0006] The sequences of the molecular markers miR-196a, miR-27a-5p, and miR-27b-5p disclosed in the present invention can be queried in the miRBase database (http: / / microrna.sanger.ac.uk / ), wherein the sequence of miR-196a is shown in SEQ ID NO: 17, the sequence of miR-27a-5p is shown in SEQ ID NO: 18, and the sequence of miR-27b-5p is shown in SEQ ID NO: 19;

[0007] Sequence of miR-196a:

[0008] GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCACCCGAUUCAC(SEQ ID NO:17)

[0009] Sequence of miR-27a-5p:

[0010] AGGGCUUAGCUGCUUGUGAGCA(SEQ ID NO:18)

[0011] Sequence of miR-27b-5p:

[0012] AGAGCUUAGCUGAUUGGUGAAC(SEQ ID NO:19)

[0013] Furthermore, the miR-196a described in the present invention includes miR-196a initial miRNA, miR-196a precursor miRNA, and mature miR-196a, wherein the miR-196a initial miRNA is cleaved and expressed as mature miR-196a in human cells, and the miR-196a precursor miRNA is cleaved and expressed as mature miR-196a in human cells. As a further preference, the miR-196a also includes: a sequence obtained by base modification of miR-196a or adding bases at both ends.

[0014] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0015] In a first aspect, the present invention provides the use of a reagent for detecting a molecular marker in the preparation of a product for diagnosing melanoma.

[0016] Furthermore, the molecular markers are miR-196a, miR-27a-5p, and miR-27b-5p.

[0017] Furthermore, the reagents include reagents for detecting the expression level of the molecular markers by reverse transcription PCR, real-time quantitative PCR, in situ hybridization, and chip technology.

[0018] Further, the reagent for detecting the expression level of the molecular marker by reverse transcription PCR includes primers for specifically amplifying the molecular marker;

[0019] The reagent for detecting the expression level of the molecular marker by real-time quantitative PCR includes primers for specifically amplifying the molecular marker;

[0020] The reagent for detecting the expression level of the molecular marker by in situ hybridization comprises a probe that specifically recognizes the molecular marker.

[0021] Further, the sequences of primers for specifically amplifying the molecular marker miR-196a are shown in SEQ ID NO:9-SEQ ID NO:10;

[0022] The sequences of the primers for specifically amplifying the molecular marker miR-27a-5p are shown in SEQ ID NO:11-SEQ ID NO:12;

[0023] The sequences of the primers for specifically amplifying the molecular marker miR-27b-5p are shown in SEQ ID NO:13-SEQ ID NO:14.

[0024] In a second aspect, the present invention provides a product for diagnosing melanoma.

[0025] Further, the product comprises reagents for detecting the expression levels of the molecular markers miR-196a, miR-27a-5p, and miR-27b-5p;

[0026] Preferably, the product includes a chip and a kit;

[0027] More preferably, the chip comprises a solid phase carrier and probes fixed on the solid phase carrier that specifically recognize the molecular markers miR-196a, miR-27a-5p, and miR-27b-5p;

[0028] More preferably, the kit comprises primers, probes or chips that specifically bind to the molecular markers miR-196a, miR-27a-5p, miR-27b-5p.

[0029] Furthermore, the solid phase carrier includes plastic products, microparticles, membrane carriers, etc. The most commonly used plastic products are small test tubes, beads and micro-reaction plates made of polystyrene; microparticles are microspheres or particles polymerized from polymer monomers, and their diameters are mostly micrometers; membrane carriers include microporous filter membranes such as nitrocellulose membranes, glass cellulose membranes and nylon membranes.

[0030] Furthermore, the kit also includes an RNA extraction reagent, a reverse transcription reagent, a fluorescent quantitative PCR reagent, and an internal reference quantitative reagent;

[0031] Preferably, the RNA extraction reagent includes TrizolLS, anhydrous ethanol, chloroform, isopropanol, and RNase-free water;

[0032] Preferably, the reverse transcription reagent comprises reverse transcription primer, reverse transcriptase, and RNase-free water;

[0033] Preferably, the fluorescent quantitative PCR reagent includes SYBR Green fluorescent quantitative PCR enzyme, RNase-free water, cDNA, forward primers and reverse primers of miR-196a, miR-27a-5p, and miR-27b-5p;

[0034] Preferably, the internal reference quantitative reagent includes a specific primer for the internal reference U6;

[0035] More preferably, the forward primer and reverse primer of miR-196a, miR-27a-5p, and miR-27b-5p are shown as SEQ ID NO:9-SEQ ID NO:10, SEQ ID NO:11-SEQ ID NO:12, and SEQ ID NO:13-SEQ ID NO:14, respectively;

[0036] More preferably, the sequence of the specific primer of the internal reference U6 is shown in SEQ ID NO:15-SEQ ID NO:16.

[0037] Furthermore, the application method of the product comprises the following steps:

[0038] (1) Collecting samples from subjects as the experimental group, and detecting the expression levels of miR-196a, miR-27a-5p, and miR-27b-5p in the samples of the subjects;

[0039] (2) Non-melanoma normal samples were used as the control group to detect the expression levels of miR-196a, miR-27a-5p, and miR-27b-5p in non-melanoma normal samples;

[0040] (3) If the expression level of miR-196a in the experimental group is higher than the expression level of miR-196a in the control group, and the expression levels of miR-27a-5p and miR-27b-5p are lower than the expression levels of miR-27a-5p and miR-27b-5p in the control group, it is determined that the subject is at risk of developing melanoma or has developed melanoma.

[0041] In a third aspect, the present invention provides a system for early screening of melanoma.

[0042] Further, the system comprises:

[0043] (1) A melanoma assessment device comprising a control unit and a storage unit, for assessing whether a subject has melanoma or the risk probability of having melanoma;

[0044] (2) information communication terminal devices communicatively connected to each other: for providing data on the expression levels of the molecular markers miR-196a, miR-27a-5p, and miR-27b-5p in a sample from a subject;

[0045] The control unit of the melanoma assessment device includes the following four units:

[0046] 1) A data receiving unit: used to receive data on the expression levels of the molecular markers miR-196a, miR-27a-5p, and miR-27b-5p in the sample transmitted from the information communication terminal device;

[0047] 2) a discriminant value calculation unit: which calculates a discriminant value based on the discrimination of the expression levels of the molecular markers miR-196a, miR-27a-5p, and miR-27b-5p in the sample received by the data receiving unit and the expression levels of the molecular markers miR-196a, miR-27a-5p, and miR-27b-5p as explanatory variables stored in the storage unit;

[0048] 3) a discriminant value reference evaluation unit: which evaluates the risk of melanoma of the subject based on the discriminant value calculated by the discriminant value calculation unit;

[0049] 4) An evaluation result transmitting unit which transmits the evaluation result of the subject obtained by the discriminant value reference evaluating unit to the information communication terminal device.

[0050] In a fourth aspect, the present invention provides the use of molecular markers in the preparation of a pharmaceutical composition for treating melanoma.

[0051] Furthermore, the molecular markers are miR-196a, miR-27a-5p, and miR-27b-5p.

[0052] Furthermore, the pharmaceutical composition includes an inhibitor that reduces the expression level of miR-196a, and a promoter that increases the expression level of miR-27a-5p and miR-27b-5p;

[0053] Preferably, the sequence of the inhibitor that reduces the expression level of miR-196a is shown in SEQ ID NO: 1;

[0054] Preferably, the sequences of the promoters for increasing the expression levels of miR-27a-5p and miR-27b-5p are shown as SEQ ID NO: 2-SEQ ID NO: 3 and SEQ ID NO: 4-SEQ ID NO: 5, respectively.

[0055] Furthermore, the pharmaceutical composition may also include pharmaceutically acceptable carriers and / or excipients.

[0056] In a fifth aspect, the present invention provides the use of molecular markers in screening candidate drugs for preventing and / or treating melanoma.

[0057] Furthermore, the molecular markers are miR-196a, miR-27a-5p, and miR-27b-5p.

[0058] In a sixth aspect, the present invention provides a method for screening candidate drugs for preventing and / or treating melanoma.

[0059] Further, the method comprises the following steps:

[0060] (1) contacting the test substance with a system containing or expressing miR-196a, miR-27a-5p, or miR-27b-5p;

[0061] (2) detecting the expression levels of miR-196a, miR-27a-5p, and miR-27b-5p in the system;

[0062] (3) Selecting substances that can simultaneously reduce the expression level of miR-196a and increase the expression levels of miR-27a-5p and miR-27b-5p as candidate drugs for preventing and / or treating melanoma.

[0063] Furthermore, the system is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.

[0064] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0065] The present invention has discovered for the first time through experimental verification that the combination of molecular markers miR-196a, miR-27a-5p, and miR-27b-5p can be used in the diagnosis and treatment of early melanoma, and the combination of miR-196a, miR-27a-5p, and miR-27b-5p has a synergistic therapeutic effect and a high diagnostic efficacy. The present invention provides guidance for the early diagnosis, early intervention, and treatment of melanoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0067] Figure 1 The results of differential expression of miR-196a, miR-27a-5p, and miR-27b-5p in the training set and the validation set are shown in Figure A, where Figure A: miR-196a, training set, Figure B: miR-27a-5p, training set, Figure C: miR-27b-5p, training set, Figure D: miR-196a, validation set, Figure E: miR-27a-5p, validation set, and Figure F: miR-27b-5p, validation set;

[0068] Figure 2 The ROC curve results of miR-196a, miR-27a-5p, and miR-27b-5p in the training set and validation set are shown, wherein, Figure A: miR-196a, training set, Figure B: miR-27a-5p, training set, Figure C: miR-27b-5p, training set, Figure D: miR-196a, validation set, Figure E: miR-27a-5p, validation set, Figure F: miR-27b-5p, validation set;

[0069] Figure 3 The ROC curve results of miR-196a+miR-27a-5p+miR-27b-5p combined in the training set and validation set are shown, where A: training set, B: validation set;

[0070] Figure 4 The result graphs showing the relative expression of miR-196a, miR-27a-5p, and miR-27b-5p, wherein, graph A: miR-196a, graph B: miR-27a-5p, and graph C: miR-27b-5p;

[0071] Figure 5Statistical graphs showing the effects of miR-196a inhibitor, miR-27a-5p mimics, miR-27b-5p mimics, and the combined effects of miR-196ainhibitor + miR-27a-5p mimics + miR-27b-5p mimics on the apoptosis rate of melanoma cells, wherein: Figure A: blank control group, Figure B: negative control group, Figure C: miR-196ainhibitor group, Figure D: miR-27a-5p mimics group, Figure E: miR-27b-5p mimics group, and Figure F: miR-196a inhibitor + miR-27a-5p mimics + miR-27b-5p mimics group. DETAILED DESCRIPTION

[0072] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and are not to be construed as limiting the present invention. It will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and purposes of the present invention, and that the scope of the present invention is defined by the claims and their equivalents. The experimental methods for which specific conditions are not specified in the following examples are usually tested under conventional conditions or under conditions recommended by the manufacturer.

[0073] Example 1 Screening for differentially expressed genes in melanoma

[0074] 1. Data Source

[0075] The data used in this embodiment are all from the GEO database (Gene Expression Omnibus). Melanoma data sets GSE35579 and GSE20994 are downloaded from the GEO database. The data sets include gene expression data and complete clinical annotations. The downloaded data set GSE35579 is used as a validation set with a sample size of Case:Control=41:11, and the downloaded data set GSE20994 is used as a training set with a sample size of Case:Control=35:22.

[0076] 2. Data preprocessing

[0077] The raw data of the training set and validation set downloaded from the GEO database were standardized, and the standardized gene expression matrix was annotated through an annotation file (Platform file). When multiple probes corresponded to the same gene, the average value was taken as the expression level of the gene.

[0078] 3. Differential Expression Analysis

[0079] The "limma" package in R software was used to perform differential expression analysis on the data in the above datasets GSE35579 and GSE20994. The screening criteria for differentially expressed genes were: adj.P value < 0.05, |log2FC| > 0.5.

[0080] 4. Experimental results

[0081] The results are shown in Table 1 and Figure 1 A. Figure 1 B. Figure 1 C. Figure 1 D. Figure 1 E. Figure 1 F. The differentially expressed miR-196a, miR-27a-5p, and miR-27b-5p obtained by screening showed significant differential expression in the training set and the validation set. Among them, the expression of miR-196a was significantly upregulated in melanoma, the expression of miR-27a-5p was significantly downregulated in melanoma, and the expression of miR-27b-5p was significantly downregulated in melanoma.

[0082] Table 1 Results of differential expression of miR-196a, miR-27a-5p, and miR-27b-5p in the training set and the validation set

[0083]

[0084]

[0085] Example 2 Verification of diagnostic efficacy

[0086] 1. Experimental method

[0087] For the differentially expressed miRNAs miR-196a, miR-27a-5p, and miR-27b-5p screened in Example 1, the receiver operating characteristic curve (ROC curve) was plotted using the R package "pROC" (version 1.15.0) to analyze their sensitivity, specificity, and AUC value, so as to judge the diagnostic efficacy of the miRNAs alone and in combination in the training set and the validation set;

[0088] When judging the diagnostic efficacy of individual indicators in the training set and the validation set, the expression levels of the miRNAs were directly used for analysis, and the level corresponding to the point with the largest Youden index was selected as its cutoff value. Genes with 0.5 < AUC < 0.8 were used for combined analysis;

[0089] When judging the diagnostic efficacy of the combined indicators in the training set and the validation set, Logistic regression was performed on the expression level of each miRNA. The probability of each individual being sick or not was calculated through the fitted regression curve, and different probability division thresholds were determined. According to the determined probability division thresholds, the sensitivity, specificity and accuracy of the combined diagnostic scheme were calculated.

[0090] 2. Experimental results

[0091] The results are shown in Table 2 and Figure 2 A. Figure 2 B. Figure 2 C. Figure 2 D. Figure 2 E. Figure 2 F. Figure 3 A. Figure 3 B. The results showed that the diagnostic effect of the miRNA combination miR-196a+miR-27a-5p+miR-27b-5p on melanoma was significantly better than that of a single miRNA. The AUC values ​​in the training set and validation set were 0.843 and 0.942, respectively, and the sensitivity and specificity were high, indicating that the above miRNA combination miR-196a+miR-27a-5p+miR-27b-5p has good diagnostic efficacy and can be used in the diagnosis of melanoma.

[0092] Table 2 Diagnostic efficacy results of miR-196a, miR-27a-5p, miR-27b-5p, and miR-196a+miR-27a-5p+miR-27b-5p in the training set and validation set

[0093]

[0094]

[0095] Example 3 Study on the relationship between the expression of miR-196a, miR-27a-5p, miR-27b-5p and apoptosis of melanoma cells

[0096] 1. Experimental Materials

[0097] The main experimental equipment, reagents and consumables involved in the experiment are shown in Tables 3 and 4.

[0098] Table 3 Main equipment involved in the experiment

[0099] name factory model Micropipette EP Pendorf 248692Z Clean bench ZJ Suzhou Purification 16052007 <![CDATA[CO2 Incubator]]> YILIANG YCP Series Inverted microscope canon 126281 Low speed centrifuge eppendorf 47103

[0100] Table 4 Main reagents involved in the experiment

[0101] name factory Part Number Lipofectamine 2000 Invitrogen #11668-019 DMEM GIBCO C11995500BT Cell culture dishes, cell culture flasks Corning Other chemical reagents Domestic analytical grade FBS GIBCO 10270 P / S solution SCLENCELL NO.0503

[0102] 2. Cell source

[0103] Melanoma cells A375 were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, and were cultured in this laboratory for a long time after introduction. A375 culture medium was DMEM + 10% FBS + 1% P / S solution, 37°C, 5% CO2, 95% air, saturated humidity.

[0104] 3. Cell culture

[0105] (1) A375 melanoma cell recovery

[0106] The cell recovery method uses a rapid thawing method in a water bath. Before the experiment, take protective measures, wear gloves and protective masks, take out an A375 melanoma cell cryopreservation tube from liquid nitrogen, pay attention to the label name, cryopreservation date and other information, confirm that it is the required cell, and then quickly put it into the prepared 37℃ water bath. The whole process must be fast, and it is best to completely melt the cryopreservation solution within 1 minute. At this time, pay attention to aseptic operation to prevent infection, and pay special attention to the protection of the bottle cap. After the thawing is completed, use a pipette to transfer the frozen cells to a centrifuge tube, add PBS buffer solution and blow evenly to ensure that it is completely integrated into the PBS buffer solution, then put the centrifuge tube into the centrifuge, adjust the speed to 1000rpm / min, and maintain the time for about 5min. Take out the supernatant, keep the material at the bottom of the centrifuge tube, add an appropriate amount of DMEM complete medium to resuspend, and plant it in a T25 culture flask at a ratio of 1:2. Add 5mL of DMEMF complete medium to each culture flask. Suspended round cells can be seen under the microscope, indicating that the cells have been successfully transferred, and then put them into a cell incubator containing 5% CO2 and a constant temperature of 37℃ for culture;

[0107] (2) A375 melanoma cell culture medium replacement

[0108] The time it takes for A375 melanoma cells to begin to adhere to the wall is generally about 4-6 hours. Generally, they can be completely attached to the wall in one day. The cells after attachment are polygonal. The medium can be changed according to the color of the culture medium and the observation under the microscope. Note that the DMEM complete culture medium must be preheated in a 37°C constant temperature water bath in advance. The old culture medium on top can be sucked with a Pasteur tube. Try not to touch the bottom of the culture dish to prevent scratches on the bottom cells and uneven cell growth. Then slowly add PBS buffer solution preheated in a 37°C water bath along the side wall for washing to remove some necrotic cells. You can rinse it three times with PBS preheated in a 37°C water bath. Finally, add 5mL DMEM complete culture medium preheated in a 37°C water bath to the culture dish and place it in a 5% CO2, 37°C constant temperature incubator for culture. Pay attention to aseptic operation throughout the process. The Pasteur tube should be discarded in time after contacting the outside world. The process should be clean and not too long.

[0109] (3) A375 melanoma cell culture

[0110] In about 2-3 days, A375 melanoma cells can reach 80%-100% cell confluence, at which time the cells are passaged. Personal protection should be carried out before the experiment. In the clean bench that has been disinfected for 30 minutes in advance, use a Pasteur tube to aspirate and discard the old culture medium, rinse three times with PBS preheated in a 37°C water bath, add 1mL of 0.25% trypsin, put it in a 37°C constant temperature incubator, and time it for about 1 minute. To determine whether the cells are completely digested, you can observe under an inverted microscope. If most of the round cells are suspended, stop trypsin digestion, add 1-2mL of 5-10mL DMEM / F-12 complete culture medium preheated in a 37°C water bath, and blow the cells in time to make the cells completely suspended in the solution, then transfer them to a centrifuge tube, balance the centrifuge, adjust the speed to 1000rpm / min, centrifuge for about 5min, and pass them at a ratio of 1:3-1:5. Put 5-10mL DMEM / F-12 complete culture medium in the culture dish and culture it in a cell constant temperature incubator at 37°C and 5% CO2.

[0111] 4. Cell transfection

[0112] (1) Take A375 cells in the logarithmic growth phase and cells in good growth condition and adjust the cell density to 1×10 5 / mL, inoculated into 6-well plates, 2mL of cell suspension per well, two wells per group, cultured at 37°C overnight;

[0113] (2) 2 hours before transfection, change to serum-free medium;

[0114] (3) Transfection step: For each transfection sample, prepare as follows:

[0115] 1) Count the cells one day before transfection and add 1 mL to a 6-well plate so that the cell density of the well plate is not less than 2×10 5 indivual;

[0116] 2) For each well of cells, dilute 10 μL of 100 nM inhibitor or mimics with 250 μL of serum-free medium and incubate at room temperature for 5 min;

[0117] 3) For each well of cells, dilute 5 μL of Lipo2000 with 250 μL of serum-free medium and incubate at room temperature for 5 min;

[0118] 4) Mix the liquids in step 2) and step 3) and incubate at room temperature for 20 minutes;

[0119] 5) Change the pre-separated adherent cells into serum-free medium, add the above complex, and culture at 37°C, 5% CO2 for 6 hours, then change into growth medium with serum, and continue to culture at 37°C, 5% CO2 for 48 hours. Collect the cell samples, wash twice with PBS, discard the liquid, and perform subsequent RNA extraction;

[0120] The experiment was set up into three groups: blank control group (A375 melanoma cells), negative control group (inhibitor-NC or mimics-NC group) and experimental group (inhibitor or mimics group).

[0121] Among them, the sequence information of the inhibitor for miR-196a is as follows:

[0122] 5'-CCCAACAACAUGAAACUACCUA-3'(SEQ ID NO:1)

[0123] The sequence information of mimics targeting miR-27a-5p is as follows:

[0124] The positive strand is 5'-AGGGCUUAGCUGCUUGUGAGCA-3' (SEQ ID NO: 2)

[0125] The antisense strand is 5'-UGCUCACAAGCAGCUAAGCCCU-3' (SEQ ID NO: 3)

[0126] The sequence information of mimics targeting miR-27b-5p is as follows:

[0127] The positive strand is 5'-AGAGCUUAGCUGAUUGGUGAAC-3' (SEQ ID NO: 4)

[0128] The antisense strand is 5'-GUUCACCAAUCAGCUAAGCUCU-3' (SEQ ID NO: 5)

[0129] The sequence information of inhibitor-NC is as follows:

[0130] 5'-CAGUACUUUUGUGUAGUACAAA-3'(SEQ ID NO:6)

[0131] The sequence information of mimics-NC is as follows:

[0132] The positive strand is 5'-UUUGUACUACACAAAAGUACUG-3' (SEQ ID NO: 7)

[0133] The antisense strand is 5'-CAGUACUUUUGUGUAGUACAAA-3' (SEQ ID NO: 8)

[0134] 5. QPCR detection of the expression levels of miR-196a, miR-27a-5p, and miR-27b-5p in cells

[0135] (1) Extraction of total RNA from samples (Trizol method)

[0136] 1) Take an appropriate amount of the sample to be tested, add liquid nitrogen and grind it into powder;

[0137] 2) Transfer the ground sample to a 1.5 mL EP tube with 1 mL Trizol;

[0138] 3) Add 500 μL of phenol chloride to a 1.5 mL EP tube, shake and mix, and let stand for 5 minutes;

[0139] 4) Centrifuge at 12000 rpm at 4°C for 10 minutes and carefully transfer the supernatant into a new 1.5 mL EP tube;

[0140] 5) Add 700 μL of isopropanol to the separated supernatant and mix thoroughly;

[0141] 6) Centrifuge at 12000 rpm for 10 minutes at 4°C and carefully discard the supernatant;

[0142] 7) Wash the precipitate once with 75% ethanol and dry it at room temperature;

[0143] 8) Dissolve the RNA precipitate in 50 μL DEPC water;

[0144] 9) Agarose gel electrophoresis detection.

[0145] (2) Total RNA quality detection

[0146] 1) Use a nucleic acid concentration meter to measure RNA concentration and purity. Before measurement, use DEPC water for dissolving RNA to adjust the zero. The operation method is as follows: lift the sample arm and add the sample to the detection base; lower the sample arm and use the software on the computer to start the absorbance value detection. A sample column will be automatically pulled out between the upper and lower optical fibers, and then the test will be carried out; when the test is completed, lift the sample arm and wipe the samples on the upper and lower bases with clean dust-free paper;

[0147] 2) Concentration determination: A reading of 1 at 260 nm represents 40 ng RNA / μL. The formula for calculating the sample RNA concentration is: A260 X40 ng / μL;

[0148] 3) Purity detection: The A260 / A280 ratio of the RNA solution is a method for detecting RNA purity, and the ratio ranges from 1.8 to 2.1.

[0149] (3) Reverse transcription to synthesize cDNA

[0150] Reverse transcription was performed using Invitrogen's reverse transcription kit Superscript III;

[0151] The reaction system 1 was set up as shown in Table 5, mixed, centrifuged, 65°C, 5 minutes, and placed on ice after completion;

[0152] Table 5 Composition of reaction system 1

[0153] Reaction system 1 composition Content of each component RNA 200ng(10μL) Oligo-dT 1μL

[0154] The establishment of reaction system 2 is shown in Table 6;

[0155] Table 6 Composition of reaction system 2

[0156] Reaction system 2 composition Content of each component Reaction system 1 12μL dNTPs (10 μM) 1μL 0.1M DTT 2μL 5X Buffer 4μL RT enzyme 1μL

[0157] Mix well, centrifuge, and place in a 42°C water bath for 60 minutes; take out and place at 85°C for 10 minutes to inactivate the reverse transcriptase. After the reaction is completed, place the product at -20°C for later use.

[0158] (4) Real-time fluorescence quantitative detection

[0159] First, design the amplification primers for QPCR. The specific primer sequences are as follows:

[0160] miR-196a:

[0161] The forward primer was 5′-TAGGTAGTTTCATGTTGTTG-3′ (SEQ ID NO: 9);

[0162] The reverse primer was 5′-CTCAACTGGTGTCGTG-3′ (SEQ ID NO: 10);

[0163] miR-27a-5p:

[0164] The forward primer was 5′-AGGGCTTAGCTGCTTGTGA-3′ (SEQ ID NO: 11);

[0165] The reverse primer was 5′-CTCAACTGGTGTCGTG-3′ (SEQ ID NO: 12);

[0166] miR-27b-5p:

[0167] The forward primer was 5′-AGAGCTTAGCTGATTGGTG-3′ (SEQ ID NO: 13);

[0168] The reverse primer was 5′-CTCAACTGGTGTCGTG-3′ (SEQ ID NO: 14);

[0169] U6 internal reference primer:

[0170] The forward primer was 5′-GCTTCGGCAGCACATATACTAAAAT-3′ (SEQ ID NO: 15);

[0171] The reverse primer was 5′-CGCTTCACGAATTTGCGTGTCAT-3′ (SEQ ID NO: 16);

[0172] The establishment of the Real time PCR reaction system is shown in Table 7;

[0173] Table 7 Real time PCR reaction system

[0174] Reaction system composition Content of each component cDNA 2μL PCR mix 10μL primer F 1μL primer R 1μL <![CDATA[ddH2O]]> 6μL

[0175] After the system is mixed, centrifuge briefly, place on a fluorescent quantitative PCR instrument, and react according to the conditions described in Table 8;

[0176] Table 8 Realtime PCR reaction conditions

[0177]

[0178]

[0179] The relative quantitative results of each group of samples were analyzed, and the calculation formula for the relative expression of miR-196a, miR-27a-5p, and miR-27b-5p was as follows:

[0180]

[0181] ΔCt q = Average Ct value of target gene in the test group - Average Ct value of reference gene in the test group

[0182] ΔCt cb = Average Ct value of target gene in control group - Average Ct value of reference gene in control group

[0183] 6. Cell apoptosis experiment

[0184] In this example, flow cytometry was used to detect the effect of the expression of miR-196a, miR-27a-5p, miR-27b-5p, and miR-196a+miR-27a-5p+miR-27b-5p on apoptosis of A375 melanoma cells. First, A375 melanoma cells that were not transfected, transfected with miR-196a inhibitor, transfected with miR-27a-5p mimics, transfected with miR-27b-5p mimics, and simultaneously transfected with miR-196a inhibitor, miR-27a-5p mimics, and miR-27b-5p mimics were collected, the cells were washed and fixed with ethanol, the cells were resuspended and filtered, and stained with PI dye solution, and then detected by flow cytometry;

[0185] Among them, in the cell apoptosis detection, different quadrants in the flow cytometry detection result diagram represent different meanings. Q1-1 (AnnexinV-FITC)- / PI+ represents necrotic cells, Q1-2 (AnnexinV+FITC)+ / PI+ represents mid-to-late apoptotic cells, Q1-4 (AnnexinV-FITC)+ / PI- represents early apoptotic cells, and Q1-3 (AnnexinV-FITC)- / PI- represents normal living cells. The percentage of each quadrant represents the proportion of the corresponding cells, and the total cell apoptosis rate = mid-to-late apoptosis rate + early apoptosis rate.

[0186] 7. Experimental results

[0187] The results of transfection showed that the expression level of miR-196a in the blank control group was set as 1 as the reference. Compared with the expression level of miR-196a in the blank control group (relative expression level was 1) and the expression level of miR-196a in the negative control group (NC group) transfected with inhibitor-NC, the expression level of miR-196a in the experimental group transfected with miR-196a inhibitor was significantly downregulated, and the difference was statistically significant (P < 0.05), while there was no significant difference between the blank control group and the negative control group (see Figure 4A);

[0188] The results of transfection showed that the expression level of miR-27a-5p in the blank control group was set as a reference of 1. Compared with the expression of miR-27a-5p in the blank control group (relative expression was 1) and the expression of miR-27a-5p in the negative control group (NC group) transfected with mimics-NC, the expression of miR-27a-5p in the experimental group transfected with miR-27a-5p mimics was significantly upregulated, and the difference was statistically significant (P < 0.05), while there was no significant difference between the blank control group and the negative control group (see Figure 4 B);

[0189] The results of transfection showed that the expression level of miR-27b-5p in the blank control group was set as a reference of 1. Compared with the expression level of miR-27b-5p in the blank control group (relative expression level was 1) and the expression level of miR-27b-5p in the negative control group (NC group) transfected with mimics-NC, the expression level of miR-27b-5p in the experimental group transfected with miR-27b-5p mimics was significantly upregulated, and the difference was statistically significant (P < 0.05), while there was no significant difference between the blank control group and the negative control group (see Figure 4 C);

[0190] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group transfected with miR-196a inhibitor (10.11%) was significantly higher than that in the blank control group (3.06%) and the negative control group (3.16%) (see Table 9 and Figure 5 A. Figure 5 B. Figure 5 C), indicating that miR-196a can affect the apoptosis of melanoma cells, and inhibiting the expression level of miR-196a can promote the apoptosis of melanoma cells;

[0191] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group transfected with miR-27a-5p mimics (10.00%) was significantly higher than that in the blank control group (3.06%) and the negative control group (3.16%) (see Table 9 and Figure 5 A. Figure 5 B. Figure 5 D), indicating that miR-27a-5p can affect the apoptosis ability of melanoma cells, and increasing the expression level of miR-27a-5p can promote the apoptosis of melanoma cells;

[0192] The results of the cell apoptosis experiment showed that the total apoptosis rate of cells in the experimental group transfected with miR-27b-5p mimics (10.32%) was significantly higher than that in the blank control group (3.06%) and the negative control group (3.16%) (see Table 9 and Figure 5 A. Figure 5 B. Figure 5 E), indicating that miR-27b-5p can affect the apoptosis ability of melanoma cells, and increasing the expression level of miR-27b-5p can promote the apoptosis of melanoma cells;

[0193] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group co-transfected with miR-196a inhibitor and miR-27a-5p mimics and miR-27b-5p mimics (39.99%) was significantly higher than that in the experimental group transfected with miR-196a inhibitor alone (10.11%), the experimental group transfected with miR-27a-5p mimics alone (10.00%), and the experimental group transfected with miR-27b-5p mimics alone (10.32%) (see Tables 9 and Figure 5 C. Figure 5 D. Figure 5 E. Figure 5 F);

[0194] In addition, the cell inhibition rate of each group was calculated. The results are shown in Table 10. Using the Jin's formula expression q = E A+B+C / (E A +E B +E C -E A ×E B ×E C ) to determine whether the combined effect of the three is synergistic, where E A+B+C is the inhibition rate of miR-196a inhibitor+miR-27a-5p mimics+miR-27b-5p mimics on melanoma cells, E A is the inhibition rate of miR-196a inhibitor on melanoma cells, E B is the inhibition rate of miR-27a-5p mimics on melanoma cells, E Cis the inhibition rate of miR-27b-5p mimics on melanoma cells; if q=0.85-1.15, it is simple superposition, 1.15<q<20 is synergy, q>20 is significant synergy, q<0.85 is antagonism, that is, when q>1.15, it can be determined that the promotion of apoptosis of melanoma cells by miR-196a inhibitor, miR-27a-5p mimics and miR-27b-5p mimics is a synergistic effect rather than a simple superposition;

[0195] According to the results of cell inhibition rate calculated in Table 10, the synergistic q value was calculated using King's formula to evaluate whether the combined effect of miR-196a inhibitor, miR-27a-5p mimics, and miR-27b-5p mimics was a synergistic effect. Substituting the results of cell inhibition rate calculated, it can be seen that q = E A+B+C / (E A +E B +E C -E A ×E B ×E C )=0.3693 / (0.0705+0.0694+0.0726-0.0705×0.0694×0.0726)=1.742, that is, q=1.742, q>1.15, indicating that the combination of miR-196a inhibitor, miR-27a-5p mimics and miR-27b-5pmimics has a synergistic effect in promoting the apoptosis of melanoma cells, further proving that the combination of miR-196a inhibitor, miR-27a-5p mimics and miR-27b-5p mimics is a synergistic treatment rather than a simple additive effect.

[0196] Table 9 Statistics of cell apoptosis experiments

[0197]

[0198] Table 10 Calculation results of cell inhibition rate of each group

[0199]

[0200]

[0201] The above-mentioned embodiments are only used to understand the method and core idea of ​​the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention. Sequence Listing <110> Kangtai Medical Testing Services Hebei Co., Ltd. Beijing Bioscience Biomedical Technology Co., Ltd. <120> Melanoma molecular markers and their application in early diagnosis and treatment of melanoma <141> 2021-10-13 <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> RNA <213> Artificial Sequence <400> 1 cccaacaaca ugaaacuacc ua 22 <210> 2 <211> twenty two <212> RNA <213> Artificial Sequence <400> 2 agggcuuagc ugcuugugag ca 22 <210> 3 <211> twenty two <212> RNA <213> Artificial Sequence <400> 3 ugcucacaag cagcuaagcc cu 22 <210> 4 <211> twenty two <212> RNA <213> Artificial Sequence <400> 4 agagcuuagc ugauugguga ac 22 <210> 5 <211> twenty two <212> RNA <213> Artificial Sequence <400> 5 cuucaccaau cagcuaagcu cu 22 <210> 6 <211> twenty two <212> RNA <213> Artificial Sequence <400> 6 caguacuuuu guguaguaca aa 22 <210> 7 <211> twenty two <212> RNA <213> Artificial Sequence <400> 7 uuuguacuac acaaaaguac ug 22 <210> 8 <211> twenty two <212> RNA <213> Artificial Sequence <400> 8 caguacuuuu guguaguaca aa 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 taggtagttt catgttgttg 20 <210> 10 <211> 16 <212> DNA <213> Artificial Sequence <400> 10 ctcaactggt gtcgtg 16 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <400> 11 agggcttagc tgcttgtga 19 <210> 12 <211> 16 <212> DNA <213> Artificial Sequence <400> 12 ctcaactggt gtcgtg 16 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <400> 13 agagcttagc tgattggtg 19 <210> 14 <211> 16 <212> DNA <213> Artificial Sequence <400> 14 ctcaactggt gtcgtg 16 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <400> 15 gcttcggcag cacatatact aaaat 25 <210> 16 <211> twenty three <212> DNA <213> Artificial Sequence <400> 16 cgcttcacga atttgcgtgt cat 23 <210> 17 <211> 70 <212> RNA <213> Artificial Sequence <400> 17 gugaauuagg uaguuucaug uuguugggcc uggguuucug aacacaacaa cauuaaacca 60 cccgauucac 70 <210> 18 <211> twenty two <212> RNA <213> Artificial Sequence <400> 18 agggcuuagc ugcuugugag ca 22 <210> 19 <211> twenty two <212> RNA <213> Artificial Sequence <400> 19 agagcuuagc ugauugguga ac 22

Claims

1. Use of an inhibitor that reduces the expression level of miR-196a and a promoter that increases the expression level of miR-27a-5p and miR-27b-5p in the preparation of a pharmaceutical composition for treating melanoma; The sequence of the inhibitor that reduces the expression level of miR-196a is shown in SEQ ID NO: 1; The sequences of the promoters for increasing the expression levels of miR-27a-5p and miR-27b-5p are shown in SEQ ID NO: 2-SEQ ID NO: 3 and SEQ ID NO: 4-SEQ ID NO: 5, respectively.

2. The use of molecular markers in screening candidate drugs for treating melanoma, characterized in that: The molecular markers are miR-196a, miR-27a-5p and miR-27b-5p.

3. A method for screening candidate drugs for treating melanoma, characterized in that: The method comprises the following steps: (1) contacting the test substance with a system containing or expressing miR-196a, miR-27a-5p, and miR-27b-5p; (2) detecting the expression levels of miR-196a, miR-27a-5p and miR-27b-5p in the system; (3) Select substances that can simultaneously reduce the expression level of miR-196a and increase the expression levels of miR-27a-5p and miR-27b-5p as candidate drugs for the treatment of melanoma.

Images