Methods for scarless introduction of targeted modifications in targeted vectors

Abstract

Methods for introducing scarless targeted genetic modifications into pre-existing targeting vectors are provided. The methods can introduce such targeted genetic modifications into pre-existing targeting vectors in a scarless manner using a combination of bacterial homologous recombination (BHR) and in vitro assembly.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Application No. 62 / 829,327, filed April 4, 2019, which is incorporated herein in its entirety for all purposes.

[0003] References to sequence listings are submitted as text files via EFS WEB

[0004] The sequence listing written into file 544999SEQLIST.txt is 20.7 kilobytes, created on March 21, 2020, and is hereby incorporated by reference. Background Art

[0005] Seamless DNA construction is particularly important when creating transgenic animal lines, as scars created by restriction sites or other manipulations can negatively affect gene expression if they fall in regions important for regulation. Targeting mammalian genomes often requires the construction of large targeting vectors with long DNA arms to direct homologous recombination, as well as antibiotic resistance cassettes for selection of embryonic stem cell clones. Correctly targeted clones often contain multiple scars required for constructing the vector, not to mention the resistance cassette itself. For gene ablations, these lesions may not be relevant to the final outcome (null alleles), but there is always the possibility that expression of neighboring genes may be adversely affected. For modifications other than knockouts, such as knock-ins, reliable expression of the targeted locus is often important for the study in question.

[0006] Specifically, humanization, i.e., direct replacement of mouse genes with human counterparts, requires seamless connections between mouse and human sequences so that the mouse transcriptional machinery can reliably replicate the expression of the new allele. Care must be taken to bury construction scars and selection boxes in non-coding regions that do not affect gene regulation. As animal models become more and more complex, more modifications can be added on top of existing models, such as adding human pathogenic mutations on top of humanized alleles. Additional changes can then add even more scars and another selection box to the already highly engineered mouse locus, increasing the likelihood that expression is altered, and the mouse model will be unreliable for human disease. From a construction perspective, even if the two boxes encode different selections, adding a new box to a vector that already contains a box may become complicated due to undesired recombination between shared box elements such as promoters and poly (A) signals. Therefore, new methods are needed to simplify the generation of targets carrying multiple changes (such as humanized alleles and disease mutations layered on top) and minimize the scars incorporated into the final animal model. Summary of the invention

[0007] Methods are provided for scarless introduction of targeted gene modifications into pre-existing targeting vectors.

[0008] In one aspect, some such methods include: (a) performing bacterial homologous recombination between the pre-existing targeting vector and a modification cassette in a population of bacterial cells, wherein the modification cassette includes the targeted genetic modification and includes an insert nucleic acid flanked by a 5' homology arm corresponding to the 5' target sequence in the pre-existing targeting vector and a 3' homology arm corresponding to the 3' target sequence in the pre-existing vector, wherein the insert nucleic acid includes, from 5' to 3': (i) a first repeating sequence; (ii) a first target site for a first nuclease agent; (iii) a selection cassette; (iv) a second target site for a second nuclease agent; and (v) a second repeating sequence that is identical to the first repeating sequence; (b) selecting a modified targeting vector comprising the selection cassette; (c) cleaving the first target site in the modified targeting vector with the first nuclease agent and cleaving the second target site in the modified targeting vector with the second nuclease agent to remove the selection box and expose the first repeat sequence and the second repeat sequence in the modified targeting vector; and (d) assembling the exposed first repeat sequence with the exposed second repeat sequence in an endomolecular in vitro assembly reaction to produce the targeting vector including the scarless targeted gene modification, wherein the targeting vector including the scarless targeted gene modification does not contain either the first target site for the first nuclease agent or the second target site for the second nuclease agent, but only a single copy of the repeat sequence.

[0009] In some such methods, the repetitive sequence is identical to a sequence in the pre-existing targeting vector. In some such methods, the targeted genetic modification comprises an insertion, and the repetitive sequence is identical to the 5' end or the 3' end of the insertion.

[0010] In some such methods, the length of the repetitive sequence is at least about 20 nucleotides. Optionally, the length of the repetitive sequence is between about 20 nucleotides and about 100 nucleotides.

[0011] In some such methods, the modified box is a linear double-stranded nucleic acid. In some such methods, the length of the modified box is about 1kb to about 15kb. In some such methods, the length of the 5' homology arm and the 3' homology arm is at least about 35 nucleotides. In some such methods, the length of the 5' homology arm and the 3' homology arm is between about 35 nucleotides and about 500 nucleotides.

[0012] In some such methods, the first nuclease agent and / or the second nuclease agent is a rare-cutting nuclease agent. In some such methods, the first target site and / or the second target site are not present in the pre-existing targeting vector. In some such methods, the first target site is the same as the second target site, and the first nuclease agent is the same as the second nuclease agent.

[0013] In some such methods, the first and / or second nucleic acid enzyme reagents include rare-cutting restriction enzymes. Optionally, the rare-cutting restriction enzyme is NotI, XmaIII, SstII, Sall, NruI, NheI, Nb.BbvCI, BbvCI, AscI, AsiSI, FseI, PacI, PmeI, SbfI, SgrAI, SwaI, BspQI, SapI, SfiI, CspCI, AbsI, CciNI, FspAI, MauBI, MreI, MssI, PalAI, Rgal, RigI, SdaI, SfaAI, SgfI, SgrDI, SgsI, Smil, SrfI, Sse232I, Sse8387I, LguI, PciSI, AarI, AjuI, AloI, BarI, PpiI or PsrI.

[0014] In some such methods, the first nuclease agent and / or the second nuclease agent are clustered regularly spaced short palindromic repeats (Clustered Regularly Interspaced Short PalindromicRepeats, CRISPR) related (Cas) proteins and guide RNA (gRNA), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (Transcription Activator-Like Effector Nuclease, TALEN) or engineered large-range nucleases. Optionally, the first nuclease agent and / or the second nuclease agent described Cas protein and gRNA, wherein the Cas protein is Cas9, and wherein the gRNA includes targeted CRISPR RNA (crRNA) and trans-activating CRIPSR RNA (tracrRNA).

[0015] In some such methods, the targeted genetic modification comprises a modification in the 5' homology arm or the 3' homology arm. In some such methods, the targeted genetic modification comprises a modification in the insert nucleic acid. In some such methods, the targeted genetic modification comprises a point mutation, a deletion, an insertion, a substitution, or a combination thereof.

[0016] In some such methods, the selection cassette confers resistance to an antibiotic. Optionally, the selection cassette confers resistance to ampicillin, chloramphenicol, tetracycline, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin or polymyxin B.

[0017] In some such methods, the pre-existing targeting vector is a large targeting vector of at least about 10 kb in length. Optionally, the pre-existing targeting vector is at least about 100 kb in length.

[0018] In some such methods, the pre-existing targeting vector comprises a second selection cassette. Optionally, the second selection cassette confers resistance to an antibiotic. Optionally, the selection cassette in the modification cassette and the second selection cassette in the pre-existing targeting vector each confer resistance to a different antibiotic. Optionally, the second selection cassette allows selection in both bacterial cells and mammalian cells.

[0019] In some such methods, step (c) occurs in vitro.

[0020] In some such methods, step (d) comprises: (i) contacting the modified targeting vector with an exonuclease to expose the complementary sequence between the first repeat sequence and the second repeat sequence; (ii) annealing the exposed complementary sequence; (iii) extending the 3' end of the annealed complementary sequence; and (iv) ligating the annealed complementary sequence. Optionally, step (d) comprises incubating the modified targeting vector with an exonuclease, a DNA polymerase, and a DNA ligase.

[0021] Some such methods further comprise: (e) after the in vitro assembly in step (d), treating the targeting vector with the first nuclease agent and the second nuclease agent to verify that neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent is present.

[0022] On the other hand, some such methods include: (a) performing bacterial homologous recombination between the pre-existing targeting vector and a deletion cassette in a population of bacterial cells, wherein the deletion cassette includes an insert nucleic acid flanked by a 5' homology arm corresponding to a 5' target sequence in the pre-existing targeting vector and a 3' homology arm corresponding to a 3' target sequence in the pre-existing vector, wherein the 5' target sequence and the 3' target sequence flank a region of the pre-existing targeting vector into which the targeted genetic modification is to be introduced, and wherein the insert nucleic acid includes, from 5' to 3': (i) a first target site for a first nuclease agent; (ii) a selection cassette; and (iii) a second target site for a second nuclease agent; (b) selecting bacterial cells that include the modified targeting vector comprising the selection cassette; (c) cleaving the modified targeting vector with the first nuclease agent; and (d) removing the modified targeting vector from the pre-existing targeting vector. (d) assembling the cleaved targeting vector with a modification cassette comprising the targeted gene modification in an in vitro assembly reaction to produce the targeting vector comprising the scarless targeted gene modification, wherein the targeted gene modification is flanked by an upstream terminal sequence overlapping with the upstream terminal sequence in the modified targeting vector and a downstream terminal sequence overlapping with the downstream terminal sequence in the modified targeting vector, wherein neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent is present in the targeting vector comprising the scarless targeted gene modification.

[0023] In some such methods, the length of the deletion box is about 1 kb to about 15 kb. In some such methods, the length of the 5' homology arm and the 3' homology arm is at least about 35 nucleotides. Optionally, the length of the 5' homology arm and the 3' homology arm is between about 35 nucleotides and about 500 nucleotides. In some such methods, the deletion box is a linear double-stranded nucleic acid.

[0024] In some such methods, the first nuclease agent and / or the second nuclease agent is a rare-cutting nuclease agent. In some such methods, the first target site and / or the second target site are not present in the pre-existing targeting vector. In some such methods, the first target site is the same as the second target site, and the first nuclease agent is the same as the second nuclease agent.

[0025] In some such methods, the first and / or second nucleic acid enzyme reagents include rare-cutting restriction enzymes. Optionally, the rare-cutting restriction enzyme is NotI, XmaIII, SstII, Sall, NruI, NheI, Nb.BbvCI, BbvCI, AscI, AsiSI, FseI, PacI, PmeI, SbfI, SgrAI, SwaI, BspQI, SapI, SfiI, CspCI, AbsI, CciNI, FspAI, MauBI, MreI, MssI, PalAI, Rgal, RigI, SdaI, SfaAI, SgfI, SgrDI, SgsI, Smil, SrfI, Sse232I, Sse8387I, LguI, PciSI, AarI, AjuI, AloI, BarI, PpiI or PsrI.

[0026] In some such methods, the first nuclease agent and / or the second nuclease agent are clustered regularly spaced short palindromic repeats (CRISPR)-related (Cas) proteins and guide RNA (gRNA), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) or engineered meganucleases. Optionally, the first nuclease agent and / or the second nuclease agent are Cas proteins and gRNAs, wherein the Cas proteins are Cas9, and wherein the gRNAs include targeted CRISPR RNAs (crRNAs) and trans-activating CRIPSR RNAs (tracrRNAs).

[0027] In some such methods, the selection cassette confers resistance to an antibiotic. Optionally, the selection cassette confers resistance to ampicillin, chloramphenicol, tetracycline, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin or polymyxin B.

[0028] In some such methods, the pre-existing targeting vector is a large targeting vector of at least 10 kb in length. Optionally, the pre-existing targeting vector is at least 100 kb in length.

[0029] In some such methods, the pre-existing targeting vector comprises a second selection cassette. Optionally, the second selection cassette confers resistance to an antibiotic. Optionally, the selection cassette in the deletion cassette and the second selection cassette in the pre-existing targeting vector each confer resistance to a different antibiotic. Optionally, the second selection cassette allows selection in both bacterial cells and mammalian cells.

[0030] In some such methods, the length of the overlap between the upstream terminal sequence in the modification box and the upstream terminal sequence in the modified targeting vector and / or the length of the overlap between the downstream terminal sequence in the modification box and the downstream terminal sequence in the modified targeting vector is at least about 20 nucleotides. In some such methods, the length of the overlap between the upstream terminal sequence in the modification box and the upstream terminal sequence in the modified targeting vector and / or the length of the overlap between the downstream terminal sequence in the modification box and the downstream terminal sequence in the modified targeting vector is between about 20 nucleotides and about 100 nucleotides.

[0031] In some such methods, step (c) occurs in vitro.

[0032] In some such methods, step (d) comprises: (i) contacting the cleaved targeting vector and the modification box with an exonuclease to expose a complementary sequence between the terminal sequence in the modified targeting vector and the terminal sequence in the modification box; (ii) annealing the exposed complementary sequence; (iii) extending the 3' end of the annealed complementary sequence; and (iv) ligating the annealed complementary sequence. Optionally, step (d) comprises incubating the cleaved targeting vector and the modification box with an exonuclease, a DNA polymerase, and a DNA ligase.

[0033] In some such methods, the modified cassette is a linear double-stranded nucleic acid. In some such methods, the modified cassette is at least about 200 nucleotides in length. In some such methods, the modified cassette is a size that cannot be directly synthesized or produced by polymerase chain reaction. In some such methods, the modified cassette is at least about 10 kb in length.

[0034] In some such methods, the targeted genetic modification comprises a point mutation, deletion, insertion, substitution, or a combination thereof.

[0035] Some such methods further comprise: (e) after the in vitro assembly in step (d), treating the targeting vector with the first nuclease agent and the second nuclease agent to verify that neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent is present. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 (Not to scale) Schematic representation of a method for scarless introduction of point mutations in large targeting vectors by bacterial homologous recombination and intramolecular Gibson assembly.

[0037] Figure 2(not to scale) shows Figure 1 Schematic diagram of the synthetic nucleic acids used in the method shown in the schematic diagram.

[0038] Figure 3 (Not to scale) Schematic representation of a method for scarless introduction of point mutations in large targeting vectors by bacterial homologous recombination and intermolecular Gibson assembly.

[0039] Figure 4A-4B The construction from vector using modified mouse BAC as vector and self-deleting cassette technology is shown ( Figure 4A ) to generate F1 mice ( Figure 4B ). The deletion cassette of Cre recombinase expressed by mouse protamine leaves a 78 bp scar containing a single loxP.

[0040] definition

[0041] The terms "protein", "polypeptide", and "peptide" used interchangeably herein include amino acids of any length in polymeric form, including coded amino acids and non-coded amino acids as well as chemically or biochemically modified amino acids or chemically or biochemically derivatized amino acids. These terms also include polymers that have been modified, such as polypeptides with modified peptide backbones. The term "domain" refers to any portion of a protein or polypeptide that has a specific function or structure.

[0042] The terms "nucleic acid" and "polynucleotide" used interchangeably herein include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. The nucleotides include single-stranded, double-stranded, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers including purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derived nucleotide bases.

[0043] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced into a target location in the genome of a cell by homologous recombination, non-homologous end joining-mediated ligation, or any other recombination means.

[0044] The term "wild-type" encompasses an entity having the structure and / or activity found in a normal (as compared to a mutation, disease, altered, etc.) state or condition. Wild-type genes and polypeptides typically exist in multiple different forms (eg, alleles).

[0045] The term "endogenous sequence" refers to a nucleic acid sequence that naturally exists in a cell or non-human animal. For example, an endogenous Rosa26 sequence of a non-human animal refers to a native Rosa26 sequence that naturally exists at the Rosa26 locus of the non-human animal.

[0046] "Exogenous" molecules or sequences include molecules or sequences that are not usually present in the cell in the form or position (e.g., genomic locus). Normal existence includes the existence of the specific developmental stage and environmental conditions of the cell. For example, exogenous molecules or sequences can include a mutant version of the corresponding endogenous sequence in the cell, such as a humanized version of the endogenous sequence, or can include a sequence that is corresponding to the endogenous sequence in the cell but in a different form (i.e., not in the chromosome). In contrast, "endogenous" molecules or sequences are included in molecules or sequences that are usually present in the form and position in a specific cell at a specific developmental stage under specific environmental conditions.

[0047] When used in the context of a nucleic acid or protein, the term "heterologous" indicates that the nucleic acid or protein includes at least two segments that do not naturally occur together in the same molecule. For example, when used with respect to a segment of a nucleic acid or a segment of a protein, the term "heterologous" indicates that the nucleic acid or protein includes two or more subsequences that are not found in the same relationship (e.g., linked together) to each other in nature. As an example, a "heterologous" region of a nucleic acid vector is a segment of a nucleic acid that is not found in nature within or connected to another nucleic acid molecule associated with another molecule. For example, a heterologous region of a nucleic acid vector can include a coding sequence that is flanked by a sequence that is not found in nature to be associated with the coding sequence. Similarly, a "heterologous" region of a protein is a segment of amino acids that is not found in nature within or connected to another peptide molecule associated with another peptide molecule (e.g., a fusion protein or a tagged protein). Similarly, a nucleic acid or protein can include a heterologous marker or a heterologous secretion or localization sequence.

[0048] "Codon optimization" utilizes the degeneracy of codons, as shown by the diversity of the three base pair codon combinations of the specified amino acids, and generally includes the process of modifying the nucleic acid sequence to enhance expression in a specific host cell by replacing at least one codon of the native sequence with a more frequent or most frequently used codon in the genes of the host cell while maintaining the native amino acid sequence. For example, compared with the naturally occurring nucleic acid sequence, the nucleic acid encoding the Cas9 protein can be modified to replace a codon with a higher frequency of use in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells or any other host cells. Codon usage tables are easily available, for example, in "codon usage databases". These tables can be adjusted in a variety of ways. See Nakamura et al., (2000) "Nucleic Acids Research (Nucleic Acids Research)" 28:292, the document is incorporated herein as a whole for all purposes. Computer algorithms are also available for codon optimization of a specific sequence for expression in a specific host (see, e.g., Gene Forge).

[0049] The term "locus" refers to a specific location of a gene (or important sequence), a DNA sequence, a polypeptide coding sequence, or a location on a chromosome of a genome of an organism. For example, the Rosa26 locus can refer to the Rosa26 gene, the specific location of the Rosa26 DNA sequence, or the location of Rosa26 on a chromosome of a genome of an organism, which location has been identified as the location where such a sequence resides. "Rosa26 locus" can include regulatory elements of the Rosa26 gene, including, for example, enhancers, promoters, 5' and / or 3' untranslated regions (UTRs) or combinations thereof.

[0050] The term "gene" refers to a DNA sequence that encodes a product (e.g., RNA product and / or polypeptide product) in a chromosome and comprises a coding region interrupted by a non-coding intron and a sequence located in the adjacent coding region on both 5' and 3' ends, so that the gene corresponds to a full-length mRNA (comprising 5' and 3' untranslated sequences). The term "gene" also comprises other non-coding sequences, comprising regulatory sequences (e.g., promoters, enhancers and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences and matrix junctions. These sequences can be near the coding region of a gene (e.g., within 10kb) or at a distant site, and the transcription and translation levels or the rate of the genes affected.

[0051] "Promoter" is a regulatory region of DNA, which generally includes a TATA box capable of instructing RNA polymerase II to initiate RNA synthesis at an appropriate transcription start site for a specific polynucleotide sequence. The promoter may additionally include other regions that affect the transcription initiation rate. The promoter sequence disclosed herein regulates the transcription of an operably linked polynucleotide. The promoter may be active in one or more cell types (e.g., prokaryotic cells or eukaryotic cells (such as mammalian cells) or a combination thereof) in the cell types disclosed herein. The promoter may be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a time-limited promoter (e.g., a promoter regulated by development) or a spatially limited promoter (e.g., a cell-specific promoter or a tissue-specific promoter). Examples of promoters may be found, for example, in WO 2013 / 176772, which is incorporated herein by reference for all purposes.

[0052] "Operable linkage" or "operably linked" includes juxtaposing two or more components (e.g., a promoter and another sequence element) so that the two components function normally and at least one of the components is able to mediate a function imposed on at least one of the other components. For example, if a promoter controls the level of transcription of a coding sequence in response to the presence or absence of one or more transcriptional regulatory factors, the promoter can be operably linked to a coding sequence. Operable linkage can include these sequences being adjacent to each other or acting in trans (e.g., a regulatory sequence can act at a distance to control the transcription of a coding sequence).

[0053] The "complementarity" of nucleic acids means that due to the orientation of their core base groups, the nucleotide sequence in one nucleic acid chain forms hydrogen bonds with the sequence on another relative nucleic acid chain. The complementary bases in DNA are usually A and T and C and G. In RNA, it is usually C and G and U and A. Complementarity can be perfect or substantial / sufficient. Perfect complementarity between two nucleic acids means that the two nucleic acids can form a duplex, wherein each base in the duplex is bonded to a complementary base by Watson-Crick pairing. "Substantially" or "sufficiently" complementary means that the sequence in one chain is not completely and / or completely complementary to the sequence in the relative chain, but enough bonding occurs between the bases on the two chains to form a stable hybrid complex under a set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by using sequences and standard mathematical calculations to predict the Tm (melting temperature) of the hybrid chain, or by using conventional methods to determine the Tm empirically. Tm includes the temperature when the hybrid complex group formed between the two nucleic acid chains is denatured 50% (i.e., the double-stranded nucleic acid molecule group is half-dissociated into a single chain). At temperatures below the Tm, the formation of hybridization complexes is favored, while at temperatures above the Tm, melting or separation of chains in the hybridization complex is favored. The Tm of a nucleic acid with a known G+C content in 1 M NaCl aqueous solution can be estimated by using, for example, Tm = 81.5 + 0.41 (% G+C), although other known Tm calculations take into account nucleic acid structural properties.

[0054] Although mismatch between bases is possible, hybridization requires that the two nucleic acids contain complementary sequences. The conditions applicable to hybridization between two nucleic acids depend on the length and complementary degree of nucleic acid, which is a well-known variable. The greater the complementary degree between two nucleotide sequences, the greater the melting temperature (Tm) value of the nucleic acid hybrid with these sequences. For hybridization between nucleic acids with short complementary segments (for example, complementarity exceeds 35 or less, 30 or less, 25 or less, 22 or less, 20 or less or 18 or less nucleotides), the position of mismatch becomes very important (see Sambrook et al., the same, 11.7-11.8). Usually, the length of hybridizable nucleic acids is at least about 10 nucleotides. The exemplary minimum length of hybridizable nucleic acids comprises at least about 15 nucleotides, at least about 20 nucleotides, at least about 22 nucleotides, at least about 25 nucleotides and at least about 30 nucleotides. In addition, the temperature and washing solution salt concentration can be adjusted as required according to factors such as the length and complementary degree of the complementary region.

[0055] The polynucleotide sequence does not need to be 100% complementary to the sequence of its target nucleic acid in order to specifically hybridize. In addition, the polynucleotide can hybridize on one or more segments so that the insertion or adjacent segments do not participate in the hybridization event (e.g., loop structure or hairpin structure). The polynucleotide (e.g., gRNA) can include at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence complementarity of the target region within the target nucleic acid sequence targeted thereto. For example, a gRNA in which 18 of the 20 nucleotides are complementary to the target region and thus specifically hybridize will represent 90% complementarity. In this embodiment, the remaining non-complementary nucleotides can be clustered or interspersed with complementary nucleotides and do not need to be adjacent to each other or adjacent to complementary nucleotides.

[0056] The percent complementarity between specific nucleic acid sequence segments within a nucleic acid can be conveniently determined using the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program (Altschul et al., (1990) J. Mol. Biol. 215:403-410; Zhang and Madden (1997) Genome Res. 7:649-656, each of which is incorporated herein in its entirety for all purposes) using default settings or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), which uses the algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482-489, which is incorporated herein in its entirety for all purposes.

[0057] The methods and compositions provided herein employ a variety of different components. Some components throughout the specification may have active variants and fragments. Such components include, for example, Cas proteins, CRISPR RNA, tracrRNA, and guide RNA. The biological activity of each of these components is described elsewhere herein. The term "functional" refers to the innate ability of a protein or nucleic acid (or its fragment or variant) to exhibit biological activity or function. Such biological activity or function may include, for example, the ability of a Cas protein to bind to a guide RNA and a target DNA sequence. Compared to the original, the biological function of a functional fragment or variant may be the same or may actually be changed (e.g., with respect to its specificity or selectivity or efficacy), but retains the basic biological function.

[0058] The term "variant" refers to a nucleotide sequence that differs from the most prevalent sequence in a population (eg, by one nucleotide) or a protein sequence that differs from the most prevalent sequence in a population (eg, by one amino acid).

[0059] When referring to proteins, the term "fragment" means a protein that is shorter or has fewer amino acids than the full-length protein. When referring to nucleic acids, the term "fragment" means a nucleic acid that is shorter or has fewer nucleotides than the full-length nucleic acid. A fragment can be, for example, an N-terminal fragment (i.e., a portion of the C-terminus of a protein is removed), a C-terminal fragment (i.e., a portion of the N-terminus of a protein is removed), or an internal fragment.

[0060] "Sequence identity" or "identity" in the context of two polynucleotides or polypeptide sequences refers to the same residues in the two sequences when aligned for maximum correspondence over a specified comparison window. When referring to the percentage of sequence identity of a protein, the residue positions that are not identical are usually different due to conservative amino acid substitutions, in which the amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity), and thus do not change the functional properties of the molecule. When the conservative substitutions of the sequences are different, the percentage sequence identity can be adjusted upward to correct for the conservative nature of the substitutions. Sequences that differ due to such conservative substitutions are considered to have "sequence similarity" or "similarity". Methods for making such adjustments are well known. Typically, this involves counting conservative substitutions as partial mismatches rather than complete mismatches, thereby increasing the percentage sequence identity. Thus, for example, given a score of 1 for the same amino acid and a score of zero for a given non-conservative substitution, the resulting score for conservative substitutions is between zero and 1. Scoring of conservative substitutions is calculated, for example, as implemented in Project PC / GENE (Intelligenetics, Mountain View, California).

[0061] "Percentage of sequence identity" includes the value determined by comparing two optimally aligned sequences over a comparison window (maximum number of fully matched residues), wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) compared to the reference sequence (excluding additions or deletions) to achieve optimal alignment of the two sequences. The number of matching positions is obtained by calculating the percentage by determining the number of positions where the same nucleic acid base or amino acid residue appears in the two sequences, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise specified (e.g., the shorter sequence includes a connected heterologous sequence), the comparison window is the full length of the shorter sequence in the two compared sequences.

[0062] Unless otherwise indicated, sequence identity / similarity values ​​comprise values ​​obtained using GAP version 10 using the following parameters: % identity and % similarity for nucleotide sequences using GAP weight 50 and length weight 3 and the nwsgapdna.cmp scoring matrix; % identity and % similarity for amino acid sequences using GAP weight 8 and length weight 2 and the BLOSUM62 scoring matrix; or any equivalent programs thereof. "Equivalent program" includes any sequence comparison program that produces an alignment with identical nucleotide or amino acid residue matches and the same percent sequence identity for any two sequences in question when compared to the corresponding alignment generated by GAP version 10.

[0063] The term "conservative amino acid substitution" refers to replacing the amino acid normally present in the sequence with a different amino acid having a similar size, charge or polarity. Examples of conservative substitutions include replacing another non-polar residue with a non-polar (hydrophobic) residue such as isoleucine, valine or leucine. Similarly, examples of conservative substitutions include replacing another polar residue with a polar (hydrophilic) residue, such as a polar residue between arginine and lysine, a polar residue between glutamine and asparagine, or a polar residue between glycine and serine. In addition, replacing another basic residue with a basic residue such as lysine, arginine or histidine or replacing another acidic residue with an acidic residue such as aspartic acid or glutamic acid is another example of conservative substitution. Examples of non-conservative substitutions include replacing polar (hydrophilic) residues such as cysteine, glutamine, glutamic acid or lysine and / or replacing non-polar residues with polar residues with non-polar (hydrophobic) amino acid residues such as isoleucine, valine, leucine, alanine or methionine. Typical amino acid classifications are summarized in Table 1.

[0064] Table 1: Amino acid classification.

[0065]

[0066] "Homologous" sequences (e.g., nucleic acid sequences) comprise sequences identical or substantially similar to known reference sequences, such that they, for example, have at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to known reference sequences. Homologous sequences can comprise, for example, orthologous sequences and paralogous sequences. For example, homologous genes are usually inherited from a common ancestor DNA sequence by speciation events (orthologous genes) or gene duplication events (paralogous genes). "Orthologous" genes comprise genes that have evolved from a common ancestor gene by speciation in different species. Orthologs usually retain the same function during evolution. "Paralogous" genes comprise genes related by replication within the genome. Paralogs can evolve new functions during evolution.

[0067] The term "in vitro" encompasses an artificial environment, and processes or reactions that occur within an artificial environment (e.g., a test tube). The term "in vivo" encompasses a natural environment (e.g., a cell, an organism, or the body), and processes or reactions that occur within a natural environment. The term "ex vivo" encompasses cells that have been removed from an individual's body, and processes or reactions that occur within such cells.

[0068] Repair in response to double-strand breaks (DSBs) occurs primarily through two conservative DNA repair pathways: homologous recombination (HR) and non-homologous end joining (NHEJ). See Kasparek and Humphrey (2011) Cell & Dev. Biol. 22: 886-897, which is incorporated herein in its entirety for all purposes. Similarly, repair of a target nucleic acid mediated by an exogenous donor nucleic acid can include any process of genetic information exchange between two polynucleotides.

[0069] The term "recombination" includes any process of gene information exchange between the two polynucleotides, and can occur by any mechanism. Recombination can occur by homology directed repair (HDR) or homologous recombination (HR). HDR or HR include a form of nucleic acid repair that may require nucleotide sequence homology, using a "donor" molecule as a template to repair a "target" molecule (i.e., a molecule that experiences double-strand breaks), and guide the transfer of gene information from the donor to the target. Without wishing to be bound by any particular theory, this transfer can involve mismatch correction and / or "synthesis-dependent strand annealing" of the heteroduplex DNA formed between the target of the fracture and the donor, wherein the donor is used to resynthesize the gene information and / or related processes that will become a part of the target. In some cases, a part of a donor polynucleotide, a part of a donor polynucleotide, a copy of a donor polynucleotide, or a copy of a donor polynucleotide is integrated into the target DNA. See Wang et al., (2013) Cell 153:910-918; Mandalos et al., (2012) PLOS ONE 7:e45768:1-9; and Wang et al., (2013) Nat Biotechnol. 31:530-532, each of which is incorporated herein in its entirety for all purposes.

[0070] A composition or method that "comprises" or "includes" one or more of the recited elements may include other elements not specifically recited. For example, a composition that "comprises" or "includes" a protein may contain the protein alone or in combination with other ingredients. The transition phrase "consisting essentially of" means that the scope of the claim should be interpreted to encompass the specified elements recited in the claim as well as elements that do not materially affect the basic and novel characteristics of the claimed invention. Therefore, when used in the claims of the present invention, the term "consisting essentially of" should not be interpreted as being equivalent to "comprising."

[0071] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.

[0072] The specification of a numerical range includes all integers within or defining the range and all sub-ranges defined by integers within the range.

[0073] Unless otherwise apparent from the context, the term "about" encompasses values ​​within the standard error of measurement (eg, SEM) for the stated value.

[0074] The term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items as well as the lack of a combination when interpreted in the alternative ("or").

[0075] The term "or" refers to any one member of a particular list and also includes any combination of members in that list.

[0076] Unless the context clearly indicates otherwise, the singular forms "a", "an" and "the" herein include plural references. For example, the term "a protein" or "at least one protein" may include a plurality of proteins, including mixtures thereof.

[0077] Statistically significant means p≤0.05. DETAILED DESCRIPTION

[0078] I. Overview

[0079] Provided herein are methods for introducing scarless targeted genetic modifications into pre-existing targeting vectors. The methods can use a combination of bacterial homologous recombination (BHR) and in vitro assembly methods (intramolecular or intermolecular) to introduce such targeted genetic modifications into the targeting vector in a scarless manner. The term scarless refers to the fact that no changes or undesired sequences are introduced into the assembled DNA by the reaction. The combined sequence will correspond to the exact sequence desired, with no changes or artifacts introduced by the BHR or in vitro assembly procedures.

[0080] One of the most effective methods for determining gene function relates to deliberately engineered gene mutation in mouse embryonic stem (ES) cells (or other non-human animal ES cells), and then generates mice (or other non-human animals) with corresponding gene changes. Two restrictive steps are the generation of gene targeting vectors and the selection of rare ES cell clones subsequently, in which the targeting vectors have correctly changed genes. In order to produce the desired gene change in ES cells, changes must first be introduced into the targeting vectors, which are subsequently used to replace the native gene in the ES cells by homologous recombination.

[0081] Scarless DNA construction is particularly important when creating transgenic animal lines, as scars created by restriction sites or other manipulations may negatively affect gene expression if they fall in regions important for regulation. Targeting mammalian genomes typically requires the construction of large targeting vectors with long DNA arms to direct homologous recombination, as well as antibiotic resistance cassettes for selection of embryonic stem cell clones. Correctly targeted clones typically contain multiple scars required for constructing the vector, as well as the resistance cassette itself. Even with self-deleting cassette technology, it is often impossible to avoid leaving behind "scars" of foreign sequences in the modified locus. See, e.g., Figure 4A-4B. Such scars may affect the reliable expression of the targeted locus, or even affect the expression of neighboring genes. As animal models become more complex, more modifications can be added on top of existing models, such as adding human pathogenic mutations to humanized alleles. Additional changes can then add even more scars and another selection cassette to the already highly engineered mouse locus, increasing the likelihood that expression will be altered and the mouse model will be unreliable. In addition, even if the two cassettes encode different selections, adding a new cassette to a vector that already contains one cassette may become complicated due to undesirable recombination between shared cassette elements such as promoters and poly (A) signals. However, such selection cassettes are important so that time and resources do not have to be wasted screening thousands of ES cell clones to obtain the desired modification.

[0082] Alternatively, using an initial targeting vector to generate and screen modified ES cells that include modifications from the initial targeting vector, and then retargeting those cells with a second targeting vector (e.g., ssODN) to make a second modification to the targeted locus is time consuming, and retargeting (e.g., with ssODN) may result in undesirable modifications, such as undesirable insertions, undesirable deletions, undesirable point mutations, or lack of targeting coupled to transgene insertion elsewhere in the genome.

[0083] The methods disclosed herein provide an efficient and scarless method for modifying a pre-existing targeting vector at the stage of preparing the targeting vector, rather than having to generate and screen ES cells that include an initial pre-existing targeting vector and then retargeting those cells to make a second modification to the targeted locus.

[0084] II. Scarless introduction of targeted modifications into targeting vectors by bacterial homologous recombination and in vitro assembly of molecules

[0085] Some methods disclosed herein for scarless introduction of targeted gene modifications in pre-existing targeting vectors utilize in vitro assembly methods for intramolecular assembly. As an example, such methods may include performing bacterial homologous recombination between the pre-existing targeting vector and a modification cassette in a bacterial cell population. The modification cassette may include an insert nucleic acid flanked by a 5' homology arm corresponding to the 5' target sequence in the pre-existing targeting vector and a 3' homology arm corresponding to the 3' target sequence in the pre-existing vector. The insert nucleic acid may include a selection cassette flanked by target sites and repeat sequences for one or more nuclease agents (e.g., rare-cutting nuclease agents). For example, the insert nucleic acid may include, from 5' to 3': (1) a first repeat sequence; (2) a first target site for a first nuclease agent; (3) a selection cassette; (4) a second target site for a second nuclease agent; and (5) a second repeat sequence.

[0086] The pre-existing targeting vector can be any type of targeting vector of any size. In a specific example, the pre-existing targeting vector is a large targeting vector (LTVEC) having a length of at least about 10 kb. In another example, the modification cassette has a length of at least about 100 kb. Targeting vectors and large targeting vectors are discussed in more detail elsewhere herein.

[0087] The modification box can be a linear nucleic acid or a circular nucleic acid, which can be a single-stranded nucleic acid or a double-stranded nucleic acid, and can include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In a specific example, the modification box is a linear double-stranded DNA.

[0088] The homology arms in the modification cassette are referred to herein as 5' and 3' (i.e., upstream and downstream) homology arms. This terminology relates to the relative position of the homology arms within the modification cassette to the nucleic acid insertion. The 5' and 3' homology arms correspond to the regions within the pre-existing targeting vector to be modified, and are referred to herein as the "5' target sequence" and "3' target sequence," respectively.

[0089] Homologous arms and target sequences "correspond" or "correspond" to each other when the two regions share a sufficient level of sequence identity to serve as substrates for a homologous recombination reaction (e.g., bacterial homologous recombination). The term "homology" encompasses DNA sequences that are identical to or share sequence identity with corresponding sequences. The sequence identity between a given target sequence and the corresponding homologous arms found in an exogenous repair template can be any degree of sequence identity that allows homologous recombination to occur. For example, the amount of the sequence identity shared by the homology arm of the exogenous repair template (or its fragment) and the target sequence (or its fragment) can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, so that the sequence undergoes homologous recombination. In addition, the corresponding homology region between the homology arm and the corresponding target sequence can be any length that is enough to promote homologous recombination. For example, the homology arm can be any size suitable for bacterial homologous recombination. For example, the homology arm can be at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides. For example, the homology arm can be between about 35 nucleotides and 500 nucleotides, between about 75 nucleotides and about 500 nucleotides, or between about 50 nucleotides and about 200 nucleotides (e.g., about 100 nucleotides). As another example, the length of the homology arm can be between about 35 nucleotides to about 2.5 kb, between about 35 nucleotides to about 1.5 kb, or between about 35 to about 500 nucleotides. For example, a given homology arm (or each of the homology arms) and / or the corresponding target sequence can include a corresponding homology region having a length of between about 35 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 150, about 150 to about 200, about 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, or about 450 to about 500 nucleotides, such that the homology arms have sufficient homology to undergo homologous recombination with the corresponding target sequence within the target nucleic acid. Alternatively, the length of the corresponding homology region included in a given homology arm (or each of the homology arms) and / or the corresponding target sequence can be between about 0.5 kb and about 1 kb, between about 1 kb and about 1.5 kb, between about 1.5 kb and about 2 kb, or between about 2 kb and about 2.5 kb.For example, the length of the homology arms can be about 100 nucleotides each. The homology arms can be symmetrical (each about the same length), or can be asymmetrical (one is longer than the other).

[0090] The trim box can be of any length. For example, the modification cassette can be about 10 kb to about 400 kb, about 20 kb to about 400 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, about 50 kb to about 75 kb, about 75 kb to about 100 kb, about 100 kb to 125 kb, about 125 kb to about 150 kb, about 150 kb to about 175 kb, about 175 kb to about 200 kb, about 200 kb to about 225 kb, about 225 kb to about 250 kb, about 250 kb to about 275 kb, or about 275 kb to about 300 kb, about 200 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb. In one example, the length of the modified cassette can be at least about 100 kb or 100 kb. The modified cassette can also be about 50 kb to about 500 kb, about 100 kb to about 125 kb, about 300 kb to about 325 kb, about 325 kb to about 350 kb, about 350 kb to about 375 kb, about 375 kb to about 400 kb, about 400 kb to about 425 kb, about 425 kb to about 450 kb, about 450 kb to about 475 kb, or about 475 kb to about 500 kb. Alternatively, the modified cassette can be at least 10 kb, at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, at least 300 kb, at least 350 kb, at least 400 kb, at least 450 kb, or at least 500 kb or more. In one example, the modified cassette is between about 1 kb and about 15 kb in length or between about 1 kb and about 10 kb in length (e.g., about 1.2 kb, about 5 kb, about 8 kb, or about 15 kb).

[0091] Modification box can include targeted gene modification.For example, targeted gene modification can be in 5' homology arm or 3' homology arm (for example, small modification that will not have a negative impact on the ability of homology arm and target sequence recombination, such as point mutation or small deletion, insertion or displacement).Alternately, targeted gene modification can be in inserting nucleic acid (for example, when targeted gene modification is insertion or displacement).If unique targeted gene modification is deletion, 5' homology arm and 3' homology arm can be designed to target 5' and 3' target sequence respectively, and the sequence of the targeted deletion in the pre-existing targeting vector of the target sequence flanking.As an example, targeted gene modification can be in the first repetitive sequence and / or the second repetitive sequence of inserting nucleic acid.The type of possible targeted gene modification is disclosed in more detail elsewhere herein.Some examples include point mutation, deletion, insertion, displacement or its combination.

[0092] The first and second repetitive sequences in the modification cassette may be identical to each other. The repetitive sequence may be identical to a sequence in a pre-existing targeting vector. Alternatively, where the targeted gene modification comprises an insertion (e.g., a single insertion or an insertion and deletion (i.e., substitution) combination), the repetitive sequence may be identical to the 5' end or 3' end of the insertion.

[0093] Tumor-repellent sequence can be any suitable size, for the subsequent assembly between the first tumor-repellent sequence and the second tumor-repellent sequence in the in vitro assembly reaction.As an example, tumor-repellent sequence can include at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides or at least about 50 nucleotides.As another example, the length of tumor-repellent sequence can be between about 20 nucleotides and about 100 nucleotides, between about 20 nucleotides and about 90 nucleotides, between about 0 nucleotides and about 80 nucleotides, between about 20 nucleotides and about 70 nucleotides, between about 20 nucleotides and about 60 nucleotides, between about 20 nucleotides and about 50 nucleotides, between about 20 nucleotides and about 40 nucleotides, between about 30 nucleotides and about 60 nucleotides or between about 40 nucleotides and about 50 nucleotides.In a specific example, the length of tumor-repellent sequence can be between about 40 nucleotides and about 50 nucleotides (for example, about 40 nucleotides or about 50 nucleotides).

[0094] After bacterial homologous recombination, bacterial cells including modified targeting vectors comprising selection boxes (and including targeted gene modification) can be selected. Examples of selection boxes and selection methods are disclosed in more detail elsewhere herein. In a specific example, the selection box confers resistance to antibiotics. For example, the selection box can confer resistance to any of the following: ampicillin, chloramphenicol, tetracycline, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin or polymyxin B. In some methods, the pre-existing targeting vector also includes a second selection box. For example, the second selection box can also confer antibiotic resistance. The selection box in the modification box and the second selection box in the pre-existing targeting vector can each confer resistance to different antibiotics. For example, the selection box in the modification box can confer resistance to a first antibiotic, and the second selection box in the pre-existing targeting vector can confer resistance to a second different antibiotic. In some methods, the second selection box can allow selection in both bacterial cells and eukaryotic or mammalian cells.

[0095] After selection, the first target site in the modified targeting vector can be cut with a first nuclease agent and the second target site in the modified targeting vector can be cut with a second nuclease agent to remove the selection box and expose the first and second repeats in the modified targeting vector. For example, this step can be performed in vitro. As an example, DNA can be isolated from bacterial cells after bacterial homologous recombination and selection, after which the first target site in the modified targeting vector can be cut with a first nuclease agent in vitro and the second target site in the modified targeting vector can be cut with a second nuclease agent in vitro to remove the selection box and expose the first and second repeats in the modified targeting vector.

[0096] The first nuclease reagent and / or the second nuclease reagent can be a rare cutting nuclease reagent as described elsewhere herein. For example, in some methods, there is a first target site and / or a second target site in a pre-existing targeting vector. The first target site can be different from the second target site or the first target site can be the same as the second target site, and the first nuclease reagent can be the same as the second nuclease reagent. The first nuclease reagent and / or the second nuclease reagent can produce a blunt end, a 5' overhang or a 3' overhang. In an example, the first nuclease reagent and / or the second nuclease reagent produce a 3' overhang.

[0097] In a specific example, the first nucleic acid enzyme agent and / or the second nucleic acid enzyme agent is a restriction enzyme or a rare cutting restriction enzyme. Examples of rare cutting restriction enzymes are disclosed elsewhere herein, but can include, for example, NotI, XmaIII, SstII, Sall, NruI, NheI, Nb.BbvCI, BbvCI, AscI, AsiSI, FseI, PacI, PmeI, SbfI, SgrAI, SwaI, BspQI, SapI, SfiI, CspCI, AbsI, CciNI, FspAI, MauBI, MreI, MssI, PalAI, Rgal, RigI, SdaI, SfaAI, SgfI, SgrDI, SgsI, Smil, SrfI, Sse232I, Sse8387I, LguI, PciSI, AarI, AjuI, AloI, BarI, PpiI and PsrI.

[0098] In another specific example, the first nuclease agent and / or the second nuclease agent can be an engineered nuclease agent. For example, the nuclease agent can be a clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) protein and a guide RNA (gRNA) (e.g., Cas9 and a gRNA including CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA)), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or an engineered meganuclease.

[0099] After cleavage / digestion, the exposed first repeat sequence can be assembled with the exposed second repeat sequence in an intramolecular in vitro assembly reaction to produce a targeted vector comprising a scarless targeted genetic modification. For example, in some such methods, neither a first target site for a first nuclease agent nor a second target site for a second nuclease agent is present in the targeted vector comprising a scarless targeted genetic modification (i.e., after in vitro assembly). Likewise, in some such methods, only a single copy of a repeat sequence is present in the targeted vector comprising a scarless targeted genetic modification (i.e., after in vitro assembly).

[0100] Any suitable in vitro assembly method can be used. In a specific example, the in vitro assembly step can include incubating the modified targeting vector with an exonuclease, a DNA polymerase, and a DNA ligase. For example, the in vitro assembly method can include: contacting the modified targeting vector with an exonuclease to expose the complementary sequence between the first repeat sequence and the second repeat sequence; annealing the exposed complementary sequence; extending the 3' end of the annealed complementary sequence; and connecting the annealed complementary sequence. Examples of in vitro assembly methods are discussed in more detail elsewhere herein.

[0101] In some methods, to reduce background, vectors generated by in vitro assembly can be treated with a first nuclease agent and / or a second nuclease agent to reduce background (e.g., by cleaving any targeting vectors that were not successfully assembled and therefore still contain a target site for the first nuclease agent or the second nuclease agent). Such steps can help verify that neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent is present.

[0102] III. Scarless introduction of targeted modifications into targeting vectors via bacterial homologous recombination and in vitro intermolecular assembly

[0103] Other methods disclosed herein for scarless introduction of targeted genetic modifications in pre-existing targeting vectors utilize in vitro assembly methods for intermolecular assembly. As an example, such methods may include performing bacterial homologous recombination between the pre-existing targeting vector and a deletion cassette in a bacterial cell population. The deletion cassette may include an insert nucleic acid flanked by a 5' homology arm corresponding to the 5' target sequence in the pre-existing targeting vector and a 3' homology arm corresponding to the 3' target sequence in the pre-existing vector. The 5' target sequence and the 3' target sequence flank the region of the pre-existing targeting vector to be introduced into the targeted genetic modification. The insert nucleic acid may include a selection cassette flanked by target sites for one or more nuclease agents (e.g., rare-cutting nuclease agents). For example, the insert nucleic acid may include, from 5' to 3': (1) a first target site for a first nuclease agent; (2) a selection cassette; and (3) a second target site for a second nuclease agent.

[0104] The pre-existing targeting vector can be any type of targeting vector of any size. In a specific example, the pre-existing targeting vector is a large targeting vector (LTVEC) having a length of at least about 10 kb. In another example, the modification cassette has a length of at least about 100 kb. Targeting vectors are discussed in more detail elsewhere herein.

[0105] The deletion box can be a linear nucleic acid or a circular nucleic acid, which can be a single-stranded nucleic acid or a double-stranded nucleic acid, and can include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In a specific example, the modification box is a linear double-stranded DNA.

[0106] The homology arms in the deletion cassette are referred to herein as 5' and 3' (i.e., upstream and downstream) homology arms. This term refers to the relative position of the homology arms within the deletion cassette to the nucleic acid insertion. The 5' and 3' homology arms correspond to the regions within the pre-existing targeting vector to be modified, and are referred to herein as the "5' target sequence" and "3' target sequence", respectively.

[0107] Homologous arms and target sequences "correspond" or "correspond" to each other when the two regions share a sufficient level of sequence identity to serve as substrates for a homologous recombination reaction (e.g., bacterial homologous recombination). The term "homology" encompasses DNA sequences that are identical to or share sequence identity with corresponding sequences. The sequence identity between a given target sequence and the corresponding homologous arms found in an exogenous repair template can be any degree of sequence identity that allows homologous recombination to occur. For example, the amount of the sequence identity shared by the homology arm of the exogenous repair template (or its fragment) and the target sequence (or its fragment) can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, so that the sequence undergoes homologous recombination. In addition, the corresponding homology region between the homology arm and the corresponding target sequence can be any length that is enough to promote homologous recombination. For example, the homology arm can be any size suitable for bacterial homologous recombination. For example, the homology arm can be at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides. For example, the homology arm can be between about 35 nucleotides and 500 nucleotides, between about 75 nucleotides and about 500 nucleotides, or between about 50 nucleotides and about 200 nucleotides (e.g., about 100 nucleotides). As another example, the length of the homology arm can be between about 35 nucleotides to about 2.5 kb, between about 35 nucleotides to about 1.5 kb, or between about 35 to about 500 nucleotides. For example, a given homology arm (or each of the homology arms) and / or the corresponding target sequence can include a corresponding homology region having a length of between about 35 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 150, about 150 to about 200, about 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, or about 450 to about 500 nucleotides, such that the homology arms have sufficient homology to undergo homologous recombination with the corresponding target sequence within the target nucleic acid. Alternatively, the length of the corresponding homology region included in a given homology arm (or each of the homology arms) and / or the corresponding target sequence can be between about 0.5 kb and about 1 kb, between about 1 kb and about 1.5 kb, between about 1.5 kb and about 2 kb, or between about 2 kb and about 2.5 kb.For example, the length of the homology arms can be about 100 nucleotides each. The homology arms can be symmetrical (each about the same length), or can be asymmetrical (one is longer than the other).

[0108] Deletion boxes can be of any length. For example, the deletion box can be about 10 kb to about 400 kb, about 20 kb to about 400 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, about 50 kb to about 75 kb, about 75 kb to about 100 kb, about 100 kb to 125 kb, about 125 kb to about 150 kb, about 150 kb to about 175 kb, about 175 kb to about 200 kb, about 200 kb to about 225 kb, about 225 kb to about 250 kb, about 250 kb to about 275 kb, or about 275 kb to about 300 kb, about 200 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb. In one example, the length of the deletion box can be at least about 100 kb or 100 kb. The deletion box can also be about 50 kb to about 500 kb, about 100 kb to about 125 kb, about 300 kb to about 325 kb, about 325 kb to about 350 kb, about 350 kb to about 375 kb, about 375 kb to about 400 kb, about 400 kb to about 425 kb, about 425 kb to about 450 kb, about 450 kb to about 475 kb, or about 475 kb to about 500 kb. Alternatively, the deletion box can be at least 10 kb, at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, at least 300 kb, at least 350 kb, at least 400 kb, at least 450 kb, or at least 500 kb or more. In one example, the deletion box has a length between about 1 kb and about 15 kb or a length between about 1 kb and about 10 kb (e.g., about 1.2 kb, about 5 kb, about 8 kb, or about 15 kb).

[0109] After bacterial homologous recombination, bacterial cells including modified targeting vectors comprising selection boxes can be selected. Examples of selection boxes and selection methods are disclosed in more detail elsewhere herein. In a specific example, the selection box confers resistance to antibiotics. For example, the selection box can confer resistance to any of the following: ampicillin, chloramphenicol, tetracycline, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin or polymyxin B. In some methods, the pre-existing targeting vector also includes a second selection box. For example, the second selection box can also confer antibiotic resistance. The selection box in the deletion box and the second selection box in the pre-existing targeting vector can each confer resistance to different antibiotics. For example, the selection box in the deletion box can confer resistance to a first antibiotic, and the second selection box in the pre-existing targeting vector can confer resistance to a second different antibiotic. In some methods, the second selection box can allow selection in both bacterial cells and eukaryotic or mammalian cells.

[0110] After selection, the first target site in the modified targeting vector can be cut with a first nuclease reagent and the second target site in the modified targeting vector can be cut with a second nuclease reagent to remove the selection box and expose the upstream terminal sequence and downstream terminal sequence in the modified targeting vector. For example, this step can be performed in vitro. As an example, DNA can be isolated from bacterial cells after bacterial homologous recombination and selection, after which the first target site in the modified targeting vector can be cut with a first nuclease reagent in vitro and the second target site in the modified targeting vector can be cut with a second nuclease reagent in vitro to remove the selection box and expose the upstream terminal sequence and downstream terminal sequence in the modified targeting vector.

[0111] The first nuclease reagent and / or the second nuclease reagent can be a rare cutting nuclease reagent as described elsewhere herein. For example, in some methods, there is a first target site and / or a second target site in a pre-existing targeting vector. The first target site can be different from the second target site or the first target site can be the same as the second target site, and the first nuclease reagent can be the same as the second nuclease reagent. The first nuclease reagent and / or the second nuclease reagent can produce a blunt end, a 5' overhang or a 3' overhang. In an example, the first nuclease reagent and / or the second nuclease reagent produce a 3' overhang.

[0112] In a specific example, the first nucleic acid enzyme agent and / or the second nucleic acid enzyme agent is a restriction enzyme or a rare cutting restriction enzyme. Examples of rare cutting restriction enzymes are disclosed elsewhere herein, but can include, for example, NotI, XmaIII, SstII, Sall, NruI, NheI, Nb.BbvCI, BbvCI, AscI, AsiSI, FseI, PacI, PmeI, SbfI, SgrAI, SwaI, BspQI, SapI, SfiI, CspCI, AbsI, CciNI, FspAI, MauBI, MreI, MssI, PalAI, Rgal, RigI, SdaI, SfaAI, SgfI, SgrDI, SgsI, Smil, SrfI, Sse232I, Sse8387I, LguI, PciSI, AarI, AjuI, AloI, BarI, PpiI and PsrI.

[0113] In another specific example, the first nuclease agent and / or the second nuclease agent can be an engineered nuclease agent. For example, the nuclease agent can be a clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) protein and a guide RNA (gRNA) (e.g., Cas9 and a gRNA including CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA)), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or an engineered meganuclease.

[0114] After cleavage / digestion, the cleaved targeting vector can be assembled with a modification cassette comprising a targeted gene modification in an in vitro intermolecular assembly reaction to produce the targeting vector comprising the scarless targeted gene modification, the targeted gene modification flanked by an upstream terminal sequence overlapping with the upstream terminal sequence in the modified targeting vector and a downstream terminal sequence overlapping with the downstream terminal sequence in the modified targeting vector. For example, in some such methods, neither a first target site for a first nuclease agent nor a second target site for a second nuclease agent is present in the targeting vector comprising the scarless targeted gene modification.

[0115] Any suitable in vitro assembly method can be used. In a specific example, the in vitro assembly step can include incubating the cleaved targeting vector and the modified cassette with an exonuclease, a DNA polymerase, and a DNA ligase. For example, the in vitro assembly method can include: contacting the cleaved targeting vector and the modified cassette with an exonuclease to expose the complementary sequence between the terminal sequence in the modified targeting vector and the terminal sequence in the modified cassette; annealing the exposed complementary sequence; extending the 3' end of the annealed complementary sequence; and connecting the annealed complementary sequence.

[0116] The modification box can be a linear nucleic acid or a circular nucleic acid, which can be a single-stranded nucleic acid or a double-stranded nucleic acid, and can include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In a specific example, the modification box is a linear double-stranded DNA.

[0117] The trim box can be of any length. For example, the modification cassette can be about 10 kb to about 400 kb, about 20 kb to about 400 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, about 50 kb to about 75 kb, about 75 kb to about 100 kb, about 100 kb to 125 kb, about 125 kb to about 150 kb, about 150 kb to about 175 kb, about 175 kb to about 200 kb, about 200 kb to about 225 kb, about 225 kb to about 250 kb, about 250 kb to about 275 kb, or about 275 kb to about 300 kb, about 200 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb. In one example, the length of the modified cassette can be at least about 100 kb or 100 kb. The modified cassette can also be about 50 kb to about 500 kb, about 100 kb to about 125 kb, about 300 kb to about 325 kb, about 325 kb to about 350 kb, about 350 kb to about 375 kb, about 375 kb to about 400 kb, about 400 kb to about 425 kb, about 425 kb to about 450 kb, about 450 kb to about 475 kb, or about 475 kb to about 500 kb. Alternatively, the modified box can be at least 10kb, at least 15kb, at least 20kb, at least 30kb, at least 40kb, at least 50kb, at least 60kb, at least 70kb, at least 80kb, at least 90kb, at least 100kb, at least 150kb, at least 200kb, at least 250kb, at least 300kb, at least 350kb, at least 400kb, at least 450kb or at least 500kb or more. In a specific example, the length of the modified box is between about 400bp and about 2kb. In another example, the length of the modified box is between about 1kb and about 15kb or the length is between about 1kb and about 10kb (e.g., about 1.2kb, about 5kb, about 8kb or about 15kb). In a specific example, the length of the modified box is at least about 200 nucleotides. In another embodiment, the modification cassette is of a size that cannot be directly synthesized or produced by polymerase chain reaction. For example, the modification cassette can be at least about 5 kb, at least about 10 kb, at least about 15 kb, at least about 20 kb, at least about 25 kb, or at least about 30 kb in length.

[0118] For in vitro assembly reaction, the overlap length between the upstream terminal sequence in the modified cassette and the upstream terminal sequence in the modified targeting vector and / or the overlap length between the downstream terminal sequence in the modified cassette and the downstream terminal sequence in the modified targeting vector can be any suitable length. As an example, the overlap length can include at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, or at least about 50 nucleotides. As another example, the overlap length can be between about 20 nucleotides and about 100 nucleotides, between about 20 nucleotides and about 90 nucleotides, between about 0 nucleotides and about 80 nucleotides, between about 20 nucleotides and about 70 nucleotides, between about 20 nucleotides and about 60 nucleotides, between about 20 nucleotides and about 50 nucleotides, between about 20 nucleotides and about 40 nucleotides, between about 30 nucleotides and about 60 nucleotides, or between about 40 nucleotides and about 50 nucleotides. In specific examples, the overlap length can be between about 40 nucleotides and about 50 nucleotides (eg, about 40 nucleotides or about 50 nucleotides).

[0119] The modification cassette may include targeted gene modifications. Types of targeted gene modifications are disclosed in more detail elsewhere herein. Some examples include point mutations, deletions, insertions, substitutions, or combinations thereof.

[0120] In some methods, to reduce background, vectors generated by in vitro assembly can be treated with a first nuclease agent and / or a second nuclease agent to reduce background (e.g., by cleaving any targeting vectors that were not successfully assembled and thus still contain a target site for the first nuclease agent or the second nuclease agent). Such steps can help verify that neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent is present.

[0121] IV. Bacterial Homologous Recombination

[0122] Any suitable bacterial homologous recombination (BHR) method can be used in the methods disclosed herein. Bacterial homologous recombination involves the transient and controlled expression of genes that mediate homologous recombination in bacterial cells such as Escherichia coli, thereby allowing bacteria to mediate recombination between modification cassettes and targeting vectors (e.g., large targeting vectors) that share short homology segments. See, for example, US2004 / 0018626 and Valenzuela et al., (2003) Nature Biotechnology 21 (6): 652-659, each of which is incorporated herein in its entirety.

[0123] The short homology segment can include an upstream homology zone and a downstream homology zone. The homology zone can be any size suitable for bacterial homologous recombination. For example, the homology zone can be any size suitable for bacterial homologous recombination. For example, the homology zone can be at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides. For example, the homology zone can be between about 35 nucleotides and 500 nucleotides, between about 75 nucleotides and about 500 nucleotides, or between about 50 nucleotides and about 200 nucleotides (for example, about 100 nucleotides). As another example, the length of the homology zone can be between about 35 nucleotides to about 2.5kb, and the length is between about 35 nucleotides to about 1.5kb, or the length is between about 35 to about 500 nucleotides. For example, the length of the homology region can be between about 35 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 150, about 150 to about 200, about 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, or about 450 to about 500 nucleotides. Alternatively, the length of a given homology region can be between about 0.5 kb to about 1 kb, about 1 kb to about 1.5 kb, about 1.5 kb to about 2 kb, or about 2 kb to about 2.5 kb. For example, the region of homology may be about 100 nucleotides in length.

[0124] The technique of modifying targeting vectors using bacterial homologous recombination can be performed in a variety of systems (see, e.g., Yang et al., (1997) Nature Biotechnology 15:859-65; Muyrers et al., (1999) Nucleic Acids Res. 27:1555-1557; Angrand et al., (1999) Nucleic Acids Res. 27:el6; Narayanan et al., (1999) Gene Ther. 6:442-447; and Yu et al., (2000) Proc. Natl. Acad. Sci. USA 97:5978-5983, each of which is incorporated herein in its entirety for all purposes). An example is ET cloning (Zhang et al., (1998) Nat. Genet. 20: 123-128 and Narayanan et al., (1999) Gene Therapy, 6: 442-447, each of which is incorporated herein in its entirety for all purposes) and variants of this technology (Yu et al., (2000) Proc. Nat. Acad. Sci. USA 97: 5978-5983, which is incorporated herein in its entirety for all purposes). ET refers to recE and recT proteins that perform homologous recombination reactions. RecE is an exonuclease that trims a linear double-stranded DNA chain from 5' to 3', leaving a linear double-stranded fragment with a 3' single-stranded overhang. This single-stranded overhang is coated with recT protein, which has single-stranded DNA (ssDNA) binding activity. ET cloning is performed using E. coli that transiently expresses the E. coli gene products of recE and recT and the bacteriophage lambda (λ) protein λgam. The λgam protein is required to protect the donor DNA fragment from degradation by the recBC exonuclease system and is required for the recBC + A host such as the commonly used E. coli strain DH10b is required for efficient ET cloning.

[0125] V. In vitro assembly

[0126] Any in vitro assembly method that can be used to assemble at least two nucleic acids or at least two ends of a single nucleic acid under conditions where a DNA molecule is effectively connected to form a substantially complete DNA molecule can be used in the methods described herein. Some non-limiting examples of in vitro assembly methods include standard assembly using restriction enzymes, fusion assembly, sequence and ligase independent cloning (SLIC), Gibson assembly, and Golden Gate assembly. See, for example, Lee et al., (2013) Mol. Cells 35: 359-370, which is incorporated herein in its entirety for all purposes.

[0127] An example of a suitable in vitro assembly method is an isothermal single reaction method for assembling overlapping DNA molecules by the synergistic action of exonucleases (e.g., 5' exonucleases), DNA polymerases, and DNA ligases. Nucleic acids with overlapping ends (or single linear nucleic acids with overlapping ends) can be combined with ligases, exonucleases, and DNA polymerases. For example, two adjacent DNA fragments with overlapping shared end sequences can be connected into covalently sealed molecules in a one-step isothermal reaction. In a specific example, two or more DNA molecules to be assembled can be contacted in vitro in a single container with: (a) an isolated non-thermostable 5' to 3' exonuclease lacking 3' exonuclease activity (e.g., a non-processive exonuclease that chews up the ends of double-stranded DNA molecules to expose single-stranded overhangs including overlapping regions); (b) a crowding agent (which, among other functions, can accelerate nucleic acid annealing, thereby specifically annealing (hybridizing) single-stranded overhangs); (c) an isolated thermostable non-strand-displacing DNA polymerase with 3' exonuclease activity or a mixture of the DNA polymerase and a second DNA polymerase lacking 3' exonuclease activity (to fill in the remaining single-stranded gaps in the annealed molecules by extending the 3' end of the annealed region); (d) an isolated thermostable ligase (which seals (ligates) the nicks thus formed); (e) a mixture of dNTPs; and (f) a suitable buffer under conditions that effectively ligate the two or more DNA molecules to form a first assembled dsDNA molecule in a one-step reaction. For single-stranded molecules, exonucleases can but need not be omitted. In a specific example, T5 exonucleases remove nucleotides from the 5' end of a double-stranded DNA molecule, the complementary single-stranded DNA overhangs are annealed, and Phusion DNA polymerase fills the gap, and Taq DNA ligase seals the nick. See, for example, US 2010 / 0035768, US 2015 / 0376628, WO2015 / 200334 and Gibson et al., (2009) Nat. Methods 6 (5): 343-345, each of which is incorporated herein by reference for all purposes.

[0128] When the corresponding ends of the first single-stranded nucleic acid and the second single-stranded nucleic acid are complementary to each other, the first single-stranded nucleic acid and the second single-stranded nucleic acid have overlapping ends. When the 5' end of the first nucleic acid chain is complementary to the 3' end of the second nucleic acid chain, the first double-stranded nucleic acid and the second double-stranded nucleic acid have overlapping ends, and vice versa. For example, for double-stranded overlapping end sequences, one nucleic acid chain can have at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identity with the corresponding other nucleic acid chain. In the method disclosed herein, the 5' end of the dsDNA molecular chain to be assembled shares the overlapping end sequence with the 3' end of another dsDNA molecular chain. The term overlapping end sequence includes two chains of dsDNA molecules. Therefore, when the complementary region of the overlapping sequence exists as single-stranded overhangs from the 5' and 3' ends of the two polynucleotides to be assembled, a chain from the overlapping region can specifically hybridize with its complementary chain. Exonucleases can be used to remove nucleotides from the 5' or 3' ends to create overhanging end sequences.

[0129] The length of overlapping region can be long enough so that the region only occurs once in any assembled nucleic acid. Therefore, other polynucleotides are prevented from annealing with the terminal sequence, and the assembly can have specificity to the target nucleic acid. As an example, the overlapping length can include at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides or at least about 50 nucleotides. As another example, the overlapping length can be between about 20 nucleotides and about 100 nucleotides, between about 20 nucleotides and about 90 nucleotides, between about 0 nucleotides and about 80 nucleotides, between about 20 nucleotides and about 70 nucleotides, between about 20 nucleotides and about 60 nucleotides, between about 20 nucleotides and about 50 nucleotides, between about 20 nucleotides and about 40 nucleotides, between about 30 nucleotides and about 60 nucleotides or between about 40 nucleotides and about 50 nucleotides. In specific examples, the overlap length can be between about 40 nucleotides and about 50 nucleotides (eg, about 40 nucleotides or about 50 nucleotides).

[0130] Overlapping sequences can be contacted with exonucleases to expose the complementary sequence (e.g., complementary single-stranded sequence) between the overlapping sequences. Exonucleases digestion can be carried out under the conditions of effectively removing (chewing) a sufficient number of nucleotides to allow the specific annealing of the exposed single-stranded complementary regions. Usually, a part or the entire overlapping region of the overlapping region is chewed, leaving a protrusion including a part or the entire overlapping region of the overlapping region. In some methods, exonucleases digestion can be carried out by polymerase (e.g., T5 DNA polymerase) in the absence of dNTPs, and in other methods, exonucleases digestion can be carried out by exonucleases in the presence of dNTPs lacking polymerase activity (e.g., exonuclease III).

[0131] In the methods disclosed herein, any of a variety of 5' to 3' double-stranded specific deoxyribonuclease can be used to chew the ends of nucleic acids. The term 5' exonuclease is sometimes used herein to refer to a 5' to 3' deoxyribonuclease. Non-processive exonucleases refer to exonucleases that degrade a limited number (e.g., only a few) of nucleotides during each DNA binding event. Digestion with 5' exonucleases produces 3' single-stranded overhangs in DNA molecules. The 5' exonucleases used in the in vitro assembly method may lack 3' exonucleases activity, can produce 5' phosphate ends, and can start degradation from both 5' phosphorylated ends and non-phosphorylated ends. The exonucleases used in the in vitro assembly method described herein can start digestion from the 5' end of the molecule, whether it is a blunt end, or has a small 5' or 3' concave end. Suitable exonucleases are well-known and include, for example, bacteriophage T5 exonucleases (bacteriophage T5 gene D15 product), bacteriophage lambda exonucleases, RecE of the Rac prophage, exonucleases VIII from Escherichia coli, bacteriophage T7 exonucleases (bacteriophage T7 gene 6 product) or any of the various 5' exonucleases that participate in homologous recombination reactions. As an example, the exonucleases are T5 exonucleases or lambda exonucleases. In a specific example, the exonucleases are T5 exonucleases. In another specific example, the exonucleases are not bacteriophage T7 exonucleases.

[0132] In the case where the overlapping region is very long, it may be necessary to chew only a portion of the region, provided that the single-stranded overhangs thus produced have sufficient length and base content to specifically anneal under the reaction conditions. The term specifically annealing includes such a situation in which a pair of specific single-stranded overhangs will preferentially (or exclusively) anneal to each other, rather than to other single-stranded overhangs (e.g., non-complementary overhangs) present in the reaction mixture. Preferentially means that at least about 95% of the overhangs will anneal to the complementary overhangs. Typically, the overlapping homologous regions (single-stranded overhangs or their complements) contain the same sequence. However, partially identical sequences can be used, provided that the single-stranded overhangs can specifically anneal under the reaction conditions.

[0133] After annealing of single-stranded DNA (e.g., overhangs generated by the action of an exonuclease or by nicking at different target sites on each strand when the DNA molecule to be ligated is dsDNA), the single-stranded gap left by the exonuclease can be filled with a suitable non-strand-displacing DNA polymerase, and the nick thus formed can be sealed with a ligase. As used herein, a non-strand-displacing DNA polymerase is a DNA polymerase that terminates DNA synthesis when it encounters a DNA strand in the path of the DNA polymerase during the process of copying a dsDNA molecule, or the DNA polymerase degrades the encountered DNA strand while copying and simultaneously fills the resulting gap, thereby producing a mobile nick (nick translation).

[0134] After the single strand of the first polynucleotide is annealed to the complementary strand of the second polynucleotide, the 3' end of the first polynucleotide can be extended based on the template of the second polynucleotide strand, and the 3' end of the second polynucleotide strand can be extended based on the template of the first polynucleotide strand. By extending the complementary 3' end of each polynucleotide, polynucleotides can be assembled. After assembling, the 3' end of the extension from a chain of a fragment and the nick between the adjacent 5' ends of a chain from another fragment can be sealed by connection. More specifically, the hydroxyl at the 3' end of the extension of the first polynucleotide can be connected to the phosphate group at the 5' end of the second polynucleotide, and the hydroxyl at the 3' end of the extension of the second polynucleotide can be connected to the phosphate group at the 5' end of the first polynucleotide.

[0135] The ligation reaction can be performed by any of a variety of suitable thermostable DNA ligases. Suitable ligases are, for example, Taq ligase, Amplify Thermostable DNA Ligase or Thermostable Ligase disclosed in U.S. Pat. No. 6,576,453, which is incorporated herein in its entirety for all purposes.

[0136] An appropriate amount of crowding agents such as PEG in the reaction mixture can allow, enhance or promote molecular crowding. Such crowding agents can bring the components of the solution into closer contact with each other. For example, DNA molecules to be recombined can be brought closer together; this can promote annealing of single-stranded overhangs. Suitable crowding agents are known and include a variety of well-known macromolecules, such as polymers such as polyethylene glycol (PEG), Ficoll such as Ficoll 70 or dextran such as dextran 70.

[0137] The reaction components present in the assembly reaction mixture (e.g., salts, buffers, a suitable energy source (e.g., ATP or NAD), pH of the reaction mixture, etc.) may not be optimal for the individual enzymes (exonucleases, polymerases, and ligases), but may serve as a compromise that works well for the entire reaction set.

[0138] VI. Targeted Vectors and Large Targeted Vectors (LTVECs)

[0139] The targeting vector used in the methods disclosed herein can be any suitable targeting vector. The targeting vector can include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), which can be single-stranded or double-stranded, and can be linear or circular. The targeting vector can be a fragment of a bacterial artificial chromosome (BAC), a modified BAC or a BAC. The targeting vector can include human DNA, rodent DNA (e.g., mouse DNA or rat DNA), synthetic DNA or any combination thereof.

[0140] Some targeting vectors used in the methods disclosed herein are large targeting vectors (LTVECs). LTVECs include targeting vectors including homology arms corresponding to and derived from nucleic acid sequences larger than those nucleic acid sequences commonly used by other methods intended to carry out homologous recombination in cells. LTVECs also include targeting vectors including nucleic acid insertions, the nucleic acid sequences of which are larger than nucleic acid sequences commonly used by other methods intended to carry out homologous recombination in cells. For example, LTVECs can modify large loci that cannot be accommodated by traditional plasmid-based targeting vectors due to their size restrictions. For example, in the absence of a nick or double-strand break induced by a nuclease reagent (e.g., Cas protein), the targeting locus can be (i.e., 5' and 3' homology arms can correspond to) a locus of a cell that cannot be targeted or can only be mistargeted or only targeted with significant inefficiency using conventional methods. Examples of LTVECs include vectors derived from bacterial artificial chromosomes (BACs), human artificial chromosomes, or yeast artificial chromosomes (YACs). Non-limiting examples of LTVECs and methods of making them are described, for example, in U.S. Pat. Nos. 6,586,251; 6,596,541; and 7,105,348; and WO2002 / 036789, each of which is incorporated herein in its entirety for all purposes. LTVECs can be in linear or circular form. LTVECs can be of any length, and are typically at least 10 kb in length. The size of LTVECs may be too large to screen for targeted events by conventional assays such as Southern blots and long-range (e.g., 1 kb to 5 kb) PCR.

[0141] The targeting vectors (eg, LTVECs) used in the methods disclosed herein can be of any length. For example, the targeting vector can be about 10 kb to about 400 kb, about 20 kb to about 400 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, about 50 kb to about 75 kb, about 75 kb to about 100 kb, about 100 kb to 125 kb, about 125 kb to about 150 kb, about 150 kb to about 175 kb, about 175 kb to about 200 kb, about 200 kb to about 225 kb, about 225 kb to about 250 kb, about 250 kb to about 275 kb, or about 275 kb to about 300 kb, about 200 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb. In one example, the length of the targeting vector can be at least about 100 kb or 100 kb. The targeting vector can also be about 50 kb to about 500 kb, about 100 kb to about 125 kb, about 300 kb to about 325 kb, about 325 kb to about 350 kb, about 350 kb to about 375 kb, about 375 kb to about 400 kb, about 400 kb to about 425 kb, about 425 kb to about 450 kb, about 450 kb to about 475 kb, or about 475 kb to about 500 kb. Alternatively, the targeting vector can be at least 10 kb, at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, at least 300 kb, at least 350 kb, at least 400 kb, at least 450 kb, or at least 500 kb or more.

[0142] VII. Nuclease reagents

[0143] Any rare-cutting nuclease reagent can be used in the methods disclosed herein. A rare-cutting nuclease reagent is a nuclease reagent that has a target sequence or recognition sequence that rarely occurs in a genome. Similarly, any nuclease reagent that has a target sequence or recognition sequence that does not occur outside of the intended cleavage site in the targeting vectors described herein can be used. For example, any nuclease reagent that does not have a target sequence or recognition sequence in a pre-existing targeting vector can be used in the methods described herein.

[0144] Any nuclease reagent that induces nicks or double-strand breaks at the desired target sequence as described above can be used in the methods and compositions disclosed herein. Naturally occurring or natural nuclease reagents can be used, as long as the nuclease reagent induces nicks or double-strand breaks in the desired target sequence. Alternatively, modified or engineered nuclease reagents can be used. "Engineering nuclease reagents" include nucleases that are engineered (modified or derived from the native form) to specifically recognize and induce nicks or double-strand breaks in the desired target sequence from its native form. Therefore, engineered nuclease reagents can be derived from natural, naturally occurring nuclease reagents, or can be artificially produced or synthesized. Engineered nucleases can induce nicks or double-strand breaks in, for example, a target sequence, wherein the target sequence is not a sequence recognized by a natural (non-engineered or unmodified) nuclease reagent. The modification of the nuclease reagent can be as little as one amino acid in a protein cleavage agent or one nucleotide in a nucleic acid cleavage agent. Creating a nick or double-stranded break in a target sequence or other DNA may be referred to herein as "cutting" or "cleaving" the target sequence or other DNA.

[0145] Active variants and fragments of exemplary target sequences are also provided. Such active variants may include at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with a given target sequence, wherein the active variant retains biological activity and can therefore be recognized and cut by a nuclease reagent in a sequence-specific manner. The determination of double-strand breaks of target sequences measured by nuclease reagents is well known. See, for example, Frendwey et al., (2010) Methods in Enzymology 476: 295-307, which is incorporated herein in its entirety for all purposes.

[0146] Also provided are active variants and fragments of nuclease reagents (i.e., engineered nuclease reagents).Such active variants can include having at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with natural nuclease reagents, wherein the active variants retain the ability to cut at the desired target sequence and therefore retain nick or double-strand break inducing activity.For example, any nuclease reagent in the nuclease reagents described herein can be modified from the natural endonuclease sequence and is designed to recognize and induce nick or double-strand break at the target sequence not recognized by the natural nuclease reagent.Therefore, some engineered nucleases have specificity to induce nick or double-strand break at the target sequence different from the corresponding natural nuclease reagent target sequence.The determination of nick or double-strand break inducing activity is known, and the overall activity and specificity of endonucleases to the DNA substrate containing the target sequence are usually measured.

[0147] Nuclease target sequences include DNA sequences that induce nicks or double-strand breaks by nuclease agents. The length of the target sequence can vary, and include, for example, about 30-36 bp for zinc finger nucleases (ZFNs) (i.e., about 15-18 bp for each ZFN), about 36 bp for transcription activator-like effector nucleases (TALENs), or about 20 bp for CRISPR / Cas9 guide RNAs.

[0148] A. Restriction enzymes

[0149] Nuclease reagents suitable for use in the methods disclosed herein can include restriction endonucleases, which include type I, type II, type III and type IV endonucleases. Type I and type III restriction endonucleases recognize specific recognition sites, but usually cut at variable positions away from the nuclease binding site, and the nuclease binding site can be hundreds of base pairs away from the cutting site (recognition site). In type II systems, restriction activity is independent of any methylase activity, and cutting usually occurs at a specific site within or near the binding site. Most type II enzymes cut palindromic sequences, but type IIa enzymes recognize non-palindromic recognition sites and cut outside the recognition site, type IIb enzymes cut sequences twice at two sites outside the recognition site, and type IIs enzymes recognize asymmetric recognition sites and cut on one side, and cut at a limited distance of about 1-20 nucleotides from the recognition site. Type IV restriction enzymes target methylated DNA. Restriction enzymes are further described and catalogued in, for example, the REBASE database (webpage at rebase.neb.com; Roberts et al., (2003) Nucleic Acids Research 31:418-20); Roberts et al., (2003) Nucleic Acids Research 31:1805-12; and Belfort et al., (2002) in Mobile DNA II, pp. 761-783, eds., Craigie et al., (ASM Press, Washington, DC), each of which is incorporated herein in its entirety.

[0150] In some methods, rare-cutting restriction enzymes are used. Rare-cutting restriction enzymes are enzymes that have target sites or recognition sites that are rarely found in the genome. The size of the restriction fragments generated by cutting a hypothetical random genome with a restriction enzyme can be approximately 4 N , where N is the number of nucleotides in the enzyme recognition site. For example, an enzyme with a recognition site consisting of 7 nucleotides would have 4 7bp cuts a genome, thereby producing a fragment of about 16,384bp. Typically, rare cutting enzymes have a recognition site comprising 6 or more nucleotides. For example, rare cutting enzymes can have a recognition site comprising or consisting of 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotides. Examples of rare cutting restriction enzymes include NotI (GCGGCCGC), XmaIII (CGGCCG), SstII (CCGCGG), Sall (GTCGAC), NruI (TCGCGA), NheI (GCTAGC ), Nb.BbvCI(CCTCAGC), BbvCI(CCTCAGC), AscI(GGCGCGCC), AsiSI(GCGATCGC), FseI(GGCCGGCC), PacI(TTAATTA A), PmeI(GTTTAAAC), SbfI(CCTGCAGG), SgrAI(CRCCGGYG), SwaI(ATTTAAAT), BspQI(GCTCTTC), SapI(GCTCTTC), SfiI(GGCCNNNNNGGCC), CspCI(CAANNNNNGTGG), AbsI(CCTCGAGG), CciNI(GCGGCCGC), FspAI(RTGCGCAY), MauBI(C GCGCGCG), MreI(CGCCGGCG), MssI(GTTTAAAC), PalAI(GGCGCGCC), RgaI(GCGATCGC), RigI(GGCCGGCC), SdaI(CCT GCAGG), SfaAI(GCGATCGC), SgfI(GCGATCGC), SgrDI(CGTCGACG), SgsI(GGCGCGCC), SmiI(ATTTAAAT), SrfI(GCCCG GGC), Sse2321(CGCCGGCG), Sse83871(CCTGCAGG), LguI(GCTCTTC), PciSI(GCTCTTC), AarI(CACCTGC), AjuI(GAA NNNNNNNTTGG), AloI(GAACNNNNNNNTCC), BarI(GAAGNNNNNNNTAC), PpiI(GAACNNNNNCTC), PsrI(GAACNNNNNNNTAC), etc.

[0151] B. CRISPR / Cas system

[0152] Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems can also be used as rare-cutting nuclease agents in the methods disclosed herein. The CRISPR / Cas system comprises transcripts and other elements involved in the expression of Cas genes or directing their activity. The CRISPR / Cas system can be, for example, a type I, type II, type III system, or a type V system (e.g., subtype VA or subtype VB). The CRISPR / Cas system used in the compositions and methods disclosed herein can be non-naturally occurring. A "non-naturally occurring" system includes anything indicating human involvement, such as one or more components of the system being altered or mutated from their naturally occurring state, at least substantially free of at least one other component that is naturally associated with it in nature, or associated with at least one other component that is not naturally associated with it. For example, some CRISPR / Cas systems employ non-naturally occurring CRISPR complexes including non-naturally occurring gRNAs and Cas proteins, employ non-naturally occurring Cas proteins, or employ non-naturally occurring gRNAs.

[0153] Cas protein and polynucleotides encoding Cas protein.Cas protein generally includes at least one RNA recognition or binding domain that can interact with guide RNA (gRNA).Cas protein can also include nuclease domain (e.g., DNase domain or RNase domain), DNA binding domain, helicase domain, protein-protein interaction domain, dimerization domain and other domains.Some such domains (e.g., DNase domain) can be from natural Cas protein.Other such domains can be added to prepare modified Cas protein.Nuclease domain has catalytic activity for nucleic acid cutting, and the nucleic acid cutting comprises the breaking of the covalent bond of nucleic acid molecule.Cutting can produce flat end or staggered end, and can be single-stranded or double-stranded.For example, wild-type Cas9 protein usually produces flat cutting product.Alternatively, wild-type Cpf1 protein (e.g., FnCpf1) can produce cutting product with 5 nucleotide 5' overhang, wherein cutting occurs after the 18th base pair from the PAM sequence on the non-targeting chain and after the 23rd base pair based on the targeting chain. The Cas protein can have full cleavage activity to generate double-strand breaks (e.g., double-strand breaks with blunt ends) at the target genomic locus, or can be a nickase that generates single-strand breaks at the target genomic locus.

[0154] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cu1966, and homologs or modified versions thereof.

[0155] An exemplary Cas protein is a Cas9 protein or a protein derived from a Cas9 protein. The Cas9 protein is from a type II CRISPR / Cas system and generally shares four key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is a HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, delbrueckii), Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp.), Acetohalobium arabaticum, Ammonifexdegensii, Caldicelulosiruptor becscii, CandidatusDesulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobiusthermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillusferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus), Nitrosococcuswatsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp.), Petrotoga mobilis, Thermosiphoafricanus, Acaryochloris marina, Neisseria meningitidis or Campylobacter jejuni. Additional examples of Cas9 family members are described in WO 2014 / 131833, which is incorporated herein in its entirety for all purposes. Cas9 (SpCas9) from Streptococcus pyogenes (S.pyogenes) (designated SwissProt accession number Q99ZW2) is an exemplary Cas9 protein. Cas9 (SaCas9) from Staphylococcus aureus (S.aureus) (designated UniProt accession number J7RUA5) is another exemplary Cas9 protein. Cas9 (CjCas9) from Campylobacter jejuni (designated UniProt accession number Q0P897) is another exemplary Cas9 protein. See, for example, Kim et al., (2017) Nat. Commun. 8: 14500, which is incorporated herein in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Cas9 from Neisseria meningitidis (Nme2Cas9) is another exemplary Cas9 protein. See, for example, Edraki et al., (2019) Mol. Cell 73 (4): 714-726, which is incorporated herein in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD-9Cas9 (St1Cas9) encoded by CRISPR1 locus or Streptococcus thermophilus Cas9 (St3Cas9) from CRISPR3 locus) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or an RHA Francisella novicida Cas9 variant that recognizes a replacement PAM (E1369R / E1449H / R1556A substitution) are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are summarized in, for example, Cebrian-Serrano and Davies (2017) Mammal Cell Genome 28(7):247-261, which is incorporated herein in its entirety for all purposes. An exemplary Cas9 protein sequence may include, consist essentially of, or consist of SEQ ID NO: 1. An exemplary DNA encoding a Cas9 protein may include, consist essentially of, or consist of SEQ ID NO: 2. .

[0156] Another example of a Cas protein is Cpf1 (CRISPR from Prevotella and Francisella 1) protein. Cpf1 is a large protein (about 1300 amino acids) that contains a RuvC-like nuclease domain homologous to the corresponding domain of Cas9, as well as a counterpart to the characteristic arginine-rich Cas9 cluster. However, compared to Cas9 containing long insertions including HNH domains, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and the RuvC-like domain is continuous in the Cpf1 sequence. See, for example, Zetsche et al., (2015) Molecular Cell 163(3):759-771, which is incorporated herein in its entirety for all purposes. Exemplary Cpf1 proteins are from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrioproteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae. Cpf1 from Francisella novicida U112 (FnCpf1; designated UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0157] The Cas protein can be a wild-type protein (i.e., those present in nature), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. In terms of the catalytic activity of a wild-type or modified Cas protein, the Cas protein can also be an active variant or fragment. In terms of catalytic activity, an active variant or fragment may include at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with a wild-type or modified Cas protein or a portion thereof, wherein the active variant retains the ability to cut at the desired cleavage site, and thus retains nick induction or double-strand break induction activity. Assays for nick induction or double-strand break induction activity are known, and the overall activity and specificity of the Cas protein to a DNA substrate containing a cleavage site are generally measured.

[0158] The Cas protein can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. The Cas protein can also be modified to change any other activity or property of the protein, such as stability. For example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains that are not essential for protein function or to optimize (e.g., enhance or reduce) the activity or property of the Cas protein.

[0159] An example of a modified Cas protein is a modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 with changes (N497A / R661A / Q695A / Q926A) intended to reduce nonspecific DNA contacts. See, for example, Kleinstiver et al., (2016) Nature 529(7587):490-495, which is incorporated herein in its entirety for all purposes. Another example of a modified Cas protein is a modified eSpCas9 variant (K848A / K1003A / R1060A) intended to reduce off-target effects. See, for example, Slaymaker et al., (2016) Science 351(6268):84-88, which is incorporated herein in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are summarized in, for example, Cebrian-Serrano and Davies (2017) Mammalian Cell Genome 28(7):247-261, which is incorporated herein in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is a SpCas9 variant that can recognize a wider range of PAM sequences. See, for example, Hu et al., (2018) Nature 556:57-63, which is incorporated herein in its entirety for all purposes.

[0160] Cas proteins can include at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 proteins typically include a RuvC-like domain, which cuts two strands of the target DNA, possibly in a dimer configuration. Cas proteins can also include at least two nuclease domains, such as a DNase domain. For example, wild-type Cas9 proteins typically include a RuvC-like nuclease domain and an HNH-like nuclease domain. RuvC and HNH domains can each cut different double-stranded DNA chains, thereby forming double-strand breaks in DNA. See, for example, Jinek et al., (2012) Science 337: 816-821, which is incorporated herein in its entirety for all purposes.

[0161] One or more nuclease domains in the nuclease domain can be missing or mutated so that it no longer has a function or has a reduced nuclease activity. For example, if one of the nuclease domains in the Cas9 protein is missing or mutated, the Cas9 protein produced can be referred to as a nickase, and single-strand breaks can be produced in double-stranded target DNA, but double-strand breaks will not be produced (i.e., it can cut complementary strands or non-complementary strands, but can not cut both at the same time). An example of a mutation that Cas9 is converted into a nickase is a D10A (aspartic acid-alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from Streptococcus pyogenes. Similarly, H939A (histidine-alanine at amino acid position 839), H840A (histidine-alanine at amino acid position 840) or N863A (asparagine-alanine at amino acid position N863) in the HNH domain of Cas9 from Streptococcus pyogenes can convert Cas9 into a nickase. Other examples of mutations that convert Cas9 into nickases include corresponding mutations of Cas9 from Streptococcus thermophilus. See, for example, Sapranauskas et al., (2011) Nucleic Acids Research 39 (21): 9275-9282 and WO 2013 / 141680, each of which is incorporated herein in its entirety for all purposes. Such mutations can be produced using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Other examples of mutations that produce nickases can be found in, for example, WO 2013 / 176772 and WO 2013 / 142578, each of which is incorporated herein in its entirety for all purposes.

[0162] The example of inactivating mutation in the catalytic domain of xCas9 is the same as the above-mentioned mutation for SpCas9. The example of inactivating mutation in the catalytic domain of Staphylococcus aureus Cas9 protein is also known. For example, Staphylococcus aureus Cas9 enzyme (SaCas9) can include a substitution at position N580 (e.g., N580A substitution) to produce a nickase. Alternatively, the SaCas9 enzyme may include a substitution at position D10 (e.g., D10A substitution) to produce a nickase. See, for example, WO 2016 / 106236, which is incorporated herein as a whole for all purposes. The example of inactivating mutation in the catalytic domain of Nme2Cas9 is also known (e.g., a combination of D16A and H588A). The example of inactivating mutation in the catalytic domain of St1Cas9 is also known (e.g., a combination of D9A, D598A, H599A and N622A). Examples of inactivating mutations in the catalytic domain of St3Cas9 are also known (e.g., a combination of D10A and N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., a combination of D8A and H559A). Examples of inactivating mutations in the catalytic domains of FnCas9 and RHAFnCas9 are also known (e.g., N995A).

[0163] Examples of inactivating mutations in the catalytic domain of Cpf1 proteins are also known. With respect to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovis 237 (MbCpf1 Cpf1), such mutations may comprise mutations at positions 908, 993, or 1263 of AsCpf1, or corresponding positions in Cpf1 orthologs, or positions 832, 925, 947, or 1180 of LbCpf1, or corresponding positions in Cpf1 orthologs. Such mutations may include, for example, one or more of the mutations D908A, E993A and D1263A of AsCpf1 or corresponding mutations in Cpf1 orthologs or D832A, E925A, D947A ​​and D1180A of LbCpf1 or corresponding mutations in Cpf1 orthologs. See, for example, US 2016 / 0208243, which is incorporated herein in its entirety for all purposes.

[0164] The Cas protein can also be operably linked to a heterologous polypeptide as a fusion protein. For example, the Cas protein can be fused to a cleavage domain. See WO 2014 / 089290, which is incorporated herein in its entirety for all purposes. The Cas protein can also be fused to a heterologous polypeptide to provide increased or decreased stability. The fusion domain or heterologous polypeptide can be positioned at the N-terminus, C-terminus, or inside the Cas protein.

[0165] As an example, the Cas protein can be fused with one or more heterologous polypeptides that provide subcellular localization. Such heterologous polypeptides may include, for example, one or more nuclear localization signals (NLS), such as a single-point SV40 NLS for targeting the nucleus and / or a double-point α-import protein NLS, a mitochondrial localization signal for targeting mitochondria, an ER retention signal, and the like. See, for example, Lange et al., (2007) Journal of Biological Chemistry (J.Biol.Chem.) 282 (8): 5101-5105, which is incorporated herein as a whole for all purposes. Such subcellular localization signals may be located at the N-terminus, at the C-terminus, or at any position within the Cas protein. The NLS may include a segment of basic amino acids, and may be a single-point sequence or a double-point sequence. Optionally, the Cas protein may include two or more NLSs, including an NLS at the N-terminus (e.g., an α-import protein NLS or a single-point NLS) and an NLS at the C-terminus (e.g., an SV40 NLS or a double-point NLS). The Cas protein may also include two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0166] Cas protein can also be operably connected to cell penetration domain or protein transduction domain.For example, cell penetration domain can be derived from HIV-1TAT protein, TLM cell penetration motif from human hepatitis B virus, MPG, Pep-1, VP22, cell penetration peptides or polyarginine peptide sequences from herpes simplex virus.See, for example, WO 2014 / 089290 and WO 2013 / 176772, each document in the document is incorporated herein as a whole for all purposes.Cell penetration domain can be positioned at any position at N-terminal, C-terminal or in Cas protein.

[0167] The Cas protein provided as mRNA can be modified to improve stability and / or immunogenic properties. One or more nucleosides within the mRNA can be modified. Examples of chemical modifications to mRNA nucleobases include pseudouridine, 1-methyl-pseudouridine, and 5-methyl-cytidine. For example, a capped and polyadenylated Cas mRNA containing N1-methylpseudouridine can be used. Similarly, the Cas mRNA can be modified by deleting uridine using synonymous codons.

[0168] Guide RNA. "Guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location within the target DNA. A guide RNA can include two segments: a "DNA targeting segment" and a "protein binding segment". A "segment" contains a portion or region of a molecule, such as a continuous segment of nucleotides in an RNA. Some gRNAs, such as gRNA for Cas9, can include two separate RNA molecules: an "activator-RNA" (e.g., tracrRNA) and a "targeting-RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which may also be referred to as "single-molecule gRNA", "single guide RNA" or "sgRNA". See, for example, WO 2013 / 176772, WO 2014 / 065596, WO2014 / 089290, WO 2014 / 093622, WO 2014 / 099750, WO 2013 / 142578, and WO 2014 / 131833, each of which is incorporated herein by reference for all purposes. For example, for Cas9, a single guide RNA may include a crRNA fused to tracrRNA (e.g., via a joint). For example, for Cpf1, only one crRNA is required to achieve binding and / or cutting with a target sequence. The terms "guide RNA" and "gRNA" include both bimolecular (i.e., modular) gRNA and single molecule gRNA.

[0169] Exemplary bimolecular gRNAs include crRNA-like ("CRISPR RNA" or "targeting sub-RNA" or "crRNA" or "crRNA repeats") molecules and corresponding tracrRNA-like ("trans-acting CRISPR RNA" or "activator-RNA") or "tracrRNA") molecules. The crRNA includes both the DNA targeting segment (single strand) of the gRNA and the nucleotide segment (i.e., the crRNA tail) that forms half of the dsRNA duplex of the protein binding segment of the gRNA. Examples of crRNA tails positioned downstream (3') of the DNA targeting segment include GUUUUAGAGCUAUGCU (SEQ ID NO: 3), consisting essentially of it, or consisting of it. Any of the DNA targeting segments disclosed herein can be connected to the 5' end of SEQ ID NO: 3 to form a crRNA.

[0170] The corresponding tracrRNA (activator-RNA) includes the other half of the nucleotide segment of the dsRNA duplex forming the protein binding segment of the gRNA. The nucleotide segment of the crRNA is complementary to the nucleotide segment of the tracrRNA and hybridizes with it to form the dsRNA duplex of the protein binding domain of the gRNA. In this way, each crRNA can be regarded as having a corresponding tracrRNA. Examples of tracrRNA sequences include AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (SEQ ID NO: 4), consisting essentially of it, or consisting of it. Other examples of tracrRNA sequences include, consist essentially of, or consist of AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 12) or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 13).

[0171] In a system where both crRNA and tracrRNA are needed, crRNA and corresponding tracrRNA hybridize to form gRNA. In a system where only crRNA is needed, crRNA can be gRNA. CrRNA additionally provides a single-stranded DNA targeting segment hybridized with the complementary strand of the target DNA. If used for intracellular modification, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecule will be used. See, e.g., Mali et al., (2013) Science 339(6121):823-826; Jinek et al., (2012) Science 337(6096):816-821; Hwang et al., (2013) Nature Biotechnology 31(3):227-229; Jiang et al., (2013) Nature Biotechnology 31(3):233-239; and Cong et al., (2013) Science 339(6121):819-823, each of which is incorporated herein in its entirety for all purposes.

[0172] The DNA targeting segment (crRNA) of a given gRNA includes a nucleotide sequence complementary to the sequence on the complementary strand of the target DNA, as described in more detail below. The DNA targeting segment of gRNA interacts with the target DNA in a sequence-specific manner by hybridization (i.e., base pairing). In this way, the nucleotide sequence of the DNA targeting segment can be different, and the position where the gRNA and the target DNA in the target DNA will interact is determined. The DNA targeting segment of the subject's gRNA can be modified to hybridize with any desired sequence in the target DNA. Naturally occurring crRNA varies due to CRISPR / Cas systems and organisms, but generally contains a targeting segment with a length between 21 and 72 nucleotides, and the targeting segment is flanked by two directional repeats (DR) with a length between 21 and 46 nucleotides (see, for example, WO 2014 / 131833, which is incorporated herein as a whole for all purposes). In the case of Streptococcus pyogenes, DR is 36 nucleotides long, and the targeting segment is 30 nucleotides long. The DR positioned at 3' is complementary and hybridized with the corresponding tracrRNA, and the tracrRNA is then combined with the Cas protein.

[0173] The length that the DNA targeting segment has can be, for example, at least about 12, 15, 17, 18, 19, 20, 25, 30, 35 or 40 nucleotides. The length that such DNA targeting segment has can be, for example, about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25 or about 12 to about 20 nucleotides. For example, the DNA targeting segment can be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides or about 17, 18, 19 or 20 nucleotides). See, for example, US 2016 / 0024523, which is incorporated herein in its entirety for all purposes. For Cas9 from S. pyogenes, typical DNA targeting segments are between 16 and 20 nucleotides in length or between 17 and 20 nucleotides in length. For Cas9 from S. aureus, typical DNA targeting segments are between 21 and 23 nucleotides in length. For Cpf1, typical DNA targeting segments are at least 16 nucleotides in length or at least 18 nucleotides in length.

[0174] TracrRNA can be in any form (e.g., full-length tracrRNA or active partial tracrRNA) and different lengths. It can include the original transcript or a processed form. For example, tracrRNA (as a part of a single guide RNA or as a separate molecule as a part of a bimolecular gRNA) can include a part of a wild-type tracrRNA sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of a wild-type tracrRNA sequence), consisting essentially of it or consisting of it. Examples of wild-type tracrRNA sequences from Streptococcus pyogenes include 171 nucleotide versions, 89 nucleotide versions, 75 nucleotide versions, and 65 nucleotide versions. See, for example, Deltcheva et al., (2011) Nature 471 (7340): 602-607; WO 2014 / 093661, each of which is incorporated herein in its entirety for all purposes. Examples of tracrRNA in a single guide RNA (sgRNA) include the tracrRNA segments found in the +48, ​​+54, +67, and +85 versions of sgRNA, where "+n" indicates that up to +n wild-type tracrRNA nucleotides are included in the sgRNA. See US 8,697,359, which is incorporated herein in its entirety for all purposes.

[0175] The percentage of complementarity between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%). The percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be at least 60% over about 20 consecutive nucleotides. As an example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be 100% over 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and as low as 0% in the rest. In this case, the length of the DNA targeting segment can be considered to be 14 nucleotides. As another example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be 100% over seven consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and as low as 0% in the rest. In this case, the length of the DNA targeting segment can be considered to be 7 nucleotides. In some guide RNAs, at least 17 nucleotides within the DNA targeting segment are complementary to the complementary strand of the target DNA. For example, the DNA targeting segment can be 20 nucleotides in length and can include 1, 2, or 3 mismatches with the complementary strand of the target DNA. In one example, the mismatch is not adjacent to the region of the complementary strand corresponding to the protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (e.g., the mismatch is located at the 5' end of the DNA targeting segment of the guide RNA, or the mismatch is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 base pairs away from the region of the complementary strand corresponding to the PAM sequence).

[0176] The protein binding segment of the gRNA can include two nucleotide segments that are complementary to each other. The complementary nucleotides of the protein binding segment hybridize to form a double-stranded RNA duplex (dsRNA). The protein binding segment of the subject's gRNA interacts with the Cas protein, and the gRNA guides the bound Cas protein to a specific nucleotide sequence in the target DNA through the DNA targeting segment.

[0177] A single guide RNA can include a DNA targeting segment connected to a scaffold sequence (i.e., a protein binding sequence or a Cas binding sequence of the guide RNA). For example, such a guide RNA can have a 5' DNA targeting segment and a 3' scaffold sequence. Exemplary scaffold sequences include, consist essentially of, or consist of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (version 1; SEQ ID NO:5); GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 2; SEQ ID NO:6); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 3; SEQ ID NO:7); and GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 4; SEQ ID NO:8). Other exemplary scaffold sequences include, consist essentially of, or consist of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (version 5; SEQ ID NO: 14); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU (version 6; SEQ ID NO: 15); or GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (version 7; SEQ ID NO: 16). A guide RNA targeting any guide RNA target sequence can comprise, for example, a DNA targeting segment on the 5' end of the guide RNA fused to any of the exemplary guide RNA scaffold sequences on the 3' end of the guide RNA. In other words, the DNA targeting segment can be linked to the 5' end of any one of SEQ ID NOs: 5-8 to form a single guide RNA (chimeric guide RNA).Likewise, a DNA targeting segment can be linked to the 5' end of any of SEQ ID NOs: 14-16 to form a single guide RNA (chimeric guide RNA). Guide RNA versions 1, 2, 3, and 4 as disclosed elsewhere herein refer to DNA targeting segments (i.e., guide sequences or guides) linked to scaffold versions 1, 2, 3, and 4, respectively. Guide RNA versions 5, 6, and 7 as disclosed elsewhere herein refer to DNA targeting segments (i.e., guide sequences or guides) linked to scaffold versions 5, 6, and 7, respectively.

[0178] The guide RNA may include modifications or sequences that provide additional desired features (e.g., modified or regulated stability; subcellular targeting; tracking with a fluorescent marker; binding sites for proteins or protein complexes; etc.). Examples of such modifications include, for example, a 5' cap (e.g., a 7-methylguanylate cap (m7G)); a 3' polyadenylation tail (i.e., a 3' poly (A) tail); a riboswitch sequence (e.g., to allow regulation of stability and / or regulation of accessibility to proteins and / or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin); a modification or sequence that targets RNA to a subcellular location (e.g., a nucleus, mitochondria, chloroplasts, etc.); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescence detection, a sequence that allows fluorescence detection, etc.); a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including a DNA methyltransferase, a DNA demethylase, a histone acetyltransferase, a histone deacetylase, etc.); and combinations thereof. Other examples of modification include engineered stem-loop duplex structures, engineered bulge regions, engineered hairpins 3' of stem-loop duplex structures, or any combination thereof. See, for example, US 2015 / 0376586, which is incorporated herein in its entirety for all purposes. The bulge can be an unpaired region of nucleotides within the duplex consisting of a crRNA-like region and a minimal tracrRNA-like region. The bulge can include an unpaired 5'-XXXY-3' on one side of the duplex, wherein X is any purine, and Y can include nucleotides that can form a wobble pair with nucleotides on the opposite chain; and include an unpaired nucleotide region on the other side of the duplex.

[0179] Unmodified nucleic acids may be susceptible to degradation. Exogenous nucleic acids may also induce an innate immune response. Modifications may help introduce stability and reduce immunogenicity. Guide RNAs may include modified nucleosides and modified nucleotides, including, for example, one or more of the following: (1) changes or replacements of one or both of the non-linked phosphate oxygens and / or one or more of the linked phosphate oxygens in the phosphodiester backbone bond; (2) changes or replacements of the ribose component, such as changes or replacements of the 2' hydroxyl on the ribose; (3) large-scale replacement of the phosphate moiety with a "dephosphorylated" linker; (4) modification or replacement of naturally occurring nucleobases; (5) replacement or modification of the ribose phosphate backbone; (6) modification of the 3' or 5' end of the oligonucleotide (e.g., removal, modification or replacement of the terminal phosphate group or conjugation of a portion thereof); and (7) modification of sugars. Other possible guide RNA modifications include modification or replacement of uracil or poly-uracil tracts. See, for example, WO 2015 / 048577 and US 2016 / 0237455, each of which is incorporated herein in its entirety for all purposes. Similar modifications can be made to Cas encoding nucleic acids such as Cas mRNA.

[0180] As an example, the nucleotides at the 5' or 3' end of the guide RNA may include a phosphorothioate bond (e.g., a base may have a modified phosphate group, i.e., a phosphorothioate group). For example, the guide RNA may include a phosphorothioate bond between 2, 3, or 4 terminal nucleotides at the 5' or 3' end of the guide RNA. As another example, the nucleotides at the 5' and / or 3' end of the guide RNA may have a 2'-O-methyl modification. For example, the guide RNA may include a 2'-O-methyl modification at 2, 3, or 4 terminal nucleotides at the 5' and / or 3' end (e.g., 5' end) of the guide RNA. See, for example, WO 2017 / 173054A1 and Finn et al., (2018) Cell Rep. 22 (9): 2227-2235, each of which is incorporated herein in its entirety for all purposes. In one specific example, the guide RNA includes 2'-O-methyl analogs and 3' phosphorothioate internucleotide bonds at the first three 5' and 3' end RNA residues. In another specific example, the guide RNA is modified so that all 2'OH groups that do not interact with the Cas9 protein are replaced by 2'-O-methyl analogs, and the tail region of the guide RNA with minimal interaction with Cas9 is modified with 5' and 3' phosphorothioate internucleotide bonds. See, for example, Yin et al., (2017) Nature Biotechnology 35 (12): 1179-1187, which is incorporated herein in its entirety for all purposes. Other examples of modified guide RNAs are provided in, for example, WO 2018 / 107028 A1, which is incorporated herein in its entirety for all purposes.

[0181] gRNA can be prepared by various other methods. For example, gRNA can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, for example, WO 2014 / 089290 and WO 2014 / 065596, each document in the document is incorporated herein as a whole for all purposes). Guide RNA can also be a synthetic molecule prepared by chemical synthesis. For example, guide RNA can be chemically synthesized to include 2'-O-methyl analogs and 3' phosphorothioate internucleotide bonds at the first three 5' and 3' end RNA residues.

[0182] Guide RNA target sequence. The target DNA for guide RNA includes a nucleic acid sequence present in DNA, and the DNA targeting segment of gRNA will be combined with it, provided that there are sufficient binding conditions. Suitable DNA / RNA binding conditions include physiological conditions commonly present in cells. Other suitable DNA / RNA binding conditions (e.g., conditions in cell-free systems) are known in the art (see, for example, "Molecular Cloning: Laboratory Manual (Molecular Cloning: A Laboratory Manual)", 3rd edition. (Sambrook et al., Harbor Laboratory Press (Harbor Laboratory Press) 2001), the document is incorporated herein as a whole for all purposes). The target DNA strand complementary to and hybridized with gRNA can be referred to as a "complementary strand", and the target DNA strand complementary to the "complementary strand" (and therefore not complementary to Cas protein or gRNA) can be referred to as a "non-complementary strand" or "template strand".

[0183] The target DNA comprises both a sequence on the complementary strand to which the guide RNA hybridizes and a corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer adjacent motif (PAM)). As used herein, the term "guide RNA target sequence" refers specifically to a sequence on a non-complementary strand, which corresponds to a sequence (i.e., its reverse complement) to which the guide RNA hybridizes on the complementary strand. In other words, the guide RNA target sequence refers to a sequence on a non-complementary strand adjacent to the PAM (e.g., in the case of Cas9, upstream or 5' of the PAM). The guide RNA target sequence is equivalent to the DNA targeting segment of the guide RNA, but with thymine instead of uracil. As an example, the guide RNA target sequence of the SpCas9 enzyme may refer to a sequence upstream of the 5'-NGG-3' PAM on the non-complementary strand. The guide RNA is designed to be complementary to the complementary strand of the target DNA, wherein the hybridization between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of the CRISPR complex. Complete complementarity is not necessarily required, as long as there is enough complementarity to cause hybridization and promote the formation of the CRISPR complex. If a guide RNA is referred to herein as targeting a guide RNA target sequence, it means that the guide RNA hybridizes to a complementary strand sequence of the target DNA, which is the reverse complement of the guide RNA target sequence on the non-complementary strand.

[0184] The target DNA or guide RNA target sequence can include any polynucleotide and can be located, for example, in the nucleus or cytoplasm of a cell or in an organelle of a cell, such as a mitochondria or chloroplast. The target DNA or guide RNA target sequence can be any nucleic acid sequence that is endogenous or exogenous to the cell. The guide RNA target sequence can be a sequence that encodes a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or can include both.

[0185] Site-specific binding and cleavage of the target DNA by the Cas protein can occur at a position determined by (i) base pairing complementarity between the guide RNA and the complementary strand of the target DNA and (ii) a short motif, referred to as a protospacer adjacent motif (PAM), located in the non-complementary strand of the target DNA. The PAM can flank the guide RNA target sequence. Optionally, the guide RNA target sequence can be flanked by a PAM at the 3' end (e.g., for Cas9). Alternatively, the guide RNA target sequence can be flanked by a PAM at the 5' end (e.g., for Cpf1). For example, the cleavage site of the Cas protein can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., the PAM sequence on the non-complementary strand) can be 5'-N1GG-3', where N1 is any DNA nucleotide, and where the PAM is adjacent to the 3' of the guide RNA target sequence on the non-complementary strand of the target DNA. Thus, the sequence corresponding to the PAM on the complementary strand (i.e., the reverse complement) will be 5'-CCN2-3', where N2 is any DNA nucleotide and is immediately 5' of the sequence to which the DNA targeting segment of the guide RNA on the complementary strand of the target DNA hybridizes. In some such cases, N1 and N2 can be complementary and the N1-N2 base pair can be any base pair (e.g., N1=C and N2=G; N1=G and N2=C; N1=A and N2=T; or N1=T and N2=A). In the case of Cas9 from Staphylococcus aureus, the PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. In the case of Cas9 from Campylobacter jejuni, the PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (eg, for FnCpf1), the PAM sequence may be 5' upstream and have the sequence 5'-TTN-3'.

[0186] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of guide RNA target sequences plus PAM are GN 19 NGG (SEQ ID NO: 9) or N 20 NGG (SEQ ID NO: 10). See, e.g., WO 2014 / 165825, which is incorporated herein in its entirety for all purposes. The guanine at the 5' end can promote transcription by RNA polymerase in cells. Other examples of guide RNA target sequences plus PAM can include two guanine nucleotides at the 5' end (e.g., GGN 20NGG; SEQ ID NO: 11) to promote efficient transcription by T7 polymerase in vitro. See, for example, WO2014 / 065596, which is incorporated herein in its entirety for all purposes. Other guide RNA target sequences plus PAM can have SEQ ID NOS: 9-11 with a length between 4-22 nucleotides, including 5'G or GG or 3'GG or NGG. Still other guide RNA target sequences plus PAM can have a length between 14 and 20 nucleotides SEQ ID NOS: 9-11.

[0187] The formation of a CRISPR complex hybridized with a target DNA can result in the cutting of one or both strands of the target DNA in or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of the target DNA and the reverse complement on the complementary strand to which the guide RNA hybridizes). For example, the cleavage site can be located within the guide RNA target sequence (e.g., at a defined position relative to the PAM sequence). The "cleavage site" comprises the position of the target DNA where the Cas protein produces a single-strand break or a double-strand break. The cleavage site can be located on only one strand (e.g., when a nickase is used) or on both strands of a double-stranded DNA. The cleavage site can be at the same position on both strands (producing a blunt end; e.g., Cas9)) or can be at different sites on each strand (producing staggered ends (i.e., overhangs); e.g., Cpf1). Staggered ends can be produced, for example, by using two Cas proteins, each of which produces a single-strand break at different cleavage sites on different strands, thereby producing a double-strand break. For example, a first nickase can generate a single-strand break on a first strand of a double-stranded DNA (dsDNA), and a second nickase can generate a single-strand break on a second strand of the dsDNA, thereby generating an overhang sequence. In some cases, the guide RNA target sequence or cleavage site for the nickase on the first strand is separated from the guide RNA target sequence or cleavage site for the nickase on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.

[0188] C. Other Nuclease Reagents

[0189] Any other type of known rare-cutting nuclease reagent can also be used in the methods disclosed herein. An example of such a nuclease reagent is a transcription activator-like effector nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in DNA. TAL effector nucleases are produced by fusing natural or engineered transcription activator-like (TAL) effectors or their functional parts to the catalytic domain of nucleases such as FokI. The unique modular TAL effector DNA binding domain allows the design of proteins with potential recognition specificity for any given DNA. Therefore, the DNA binding domain of the TAL effector nuclease can be engineered to recognize specific DNA target sites and, therefore, be used to make double-strand breaks at the desired target sequence. See WO 2010 / 079430; Morbitzer et al., (2010) Proceedings of the National Academy of Sciences of the United States of America 107(50):21617-21622; Scholze and Boch (2010) Virulence 1:428-432; Christian et al., Genetics (2010) 186:757-761; Li et al., (2010) Nucleic Acids Research (2010) 39(1):359-372; and Miller et al., (2011) Nat. Biotechnol. 29:143-148, each of which is incorporated herein in its entirety for all purposes.

[0190] Examples of suitable TAL nucleases and methods for making suitable TAL nucleases are disclosed in, for example, US 2011 / 0239315, US 2011 / 0269234, US 2011 / 0145940, US 2003 / 0232410, US 2005 / 0208489, US 2005 / 0026157, US 2005 / 0064474, US 2006 / 0188987, and US 2006 / 0063231, each of which is incorporated herein in its entirety for all purposes.

[0191] In some TALENs, each monomer of the TALEN includes 33-35 TAL repeats that recognize a single base pair through two hypervariable residues. TALEN can be a chimeric protein comprising a TAL repeat-based DNA binding domain operably linked to an independent nuclease such as a FokI nuclease. For example, a nuclease reagent may include a first TAL repeat-based DNA binding domain and a second TAL repeat-based DNA binding domain, wherein each of the first and second TAL repeat-based DNA binding domains is operably linked to a FokI nuclease, wherein the first and second TAL repeat-based DNA binding domains recognize two consecutive target DNA sequences in each chain of a target DNA sequence separated by spacer sequences of different lengths (12-20bp), and wherein the FokI nuclease subunits dimerize to produce an active nuclease that breaks a double strand on the target sequence.

[0192] Another example of a suitable nuclease agent is a zinc finger nuclease (ZFN). In some ZFNs, each monomer of the ZFN includes 3 or more zinc finger-based DNA binding domains, wherein each zinc finger-based DNA binding domain binds to a 3bp subsite. In other ZFNs, the ZFN is a chimeric protein including a zinc finger-based DNA binding domain, and the binding domain is operably connected to an independent nuclease such as a FokI nuclease endonuclease. For example, a nuclease agent may include a first ZFN and a second ZFN, wherein the first ZFN and the second ZFN are each operably connected to a FokI nuclease subunit, wherein the first ZFN and the second ZFN recognize two continuous target DNA sequences in each chain of a target DNA sequence separated by about 5-7bp spacers, and wherein the FokI nuclease subunits dimerize to produce an active nuclease that breaks a double strand. See, e.g., US 2006 / 0246567; US 2008 / 0182332; US 2002 / 0081614; US 2003 / 0021776; WO 2002 / 057308; US 2013 / 0123484; US 2010 / 0291048; WO 2011 / 017293; and Gaj et al. (2013) Trends Biotechnol. 31(7):397-405, each of which is incorporated herein in its entirety for all purposes.

[0193] Another type of suitable nuclease reagent is an engineered meganuclease. Meganucleases are classified into four families based on conserved sequence motifs, which are LAGLIDADG, GIY-YIG, HNH and His-Cys box families. These motifs are involved in the coordination of metal ions and the hydrolysis of phosphodiester bonds. Meganucleases are known for their long target sequences and for tolerating some sequence polymorphisms in their DNA substrates. Meganuclease domains, structures and functions are known, see, e.g., Guhan and Muniyappa (2003) Crit. Rev. Biochem. Mol. Biol. 38: 199-248; Lucas et al., (2001) Nucleic Acids Research 29: 960-9; Jurica and Stoddard, (1999) Cell. Mol. Life Sci. 55: 1304-26; Stoddard (2006) Q. Rev. Biophys. 38: 49-95; and Moure et al., (2002) Nat. Struct. Biol. 9: 764, each of which is incorporated herein in its entirety for all purposes. In some instances, naturally occurring variants and / or engineered derived meganucleases are used. Methods for modifying kinetics, cofactor interactions, expression, optimal conditions and / or target sequence specificity and screening for activity are known. See, e.g., Epinat et al. (2003) Nucleic Acids Res. 31:2952-62; Chevalier et al. (2002) Mol. Cell 10:895-905; Gimble et al. (2003) Mol. Biol. 334:993-1008; Seligman et al. (2002) Nucleic Acids Res. 30:3870-9; Sussman et al. (2003) Nucleic Acids Res. 31:2952-62; Chevalier et al. (2002) Mol. Cell 10:895-905; Gimble et al. (2003) Mol. Biol. 334:993-1008; Seligman et al. (2002) Nucleic Acids Res. 30:3870-9; Sussman et al. (2003) 2004) Journal of Molecular Biology 342:31-41; Rosen et al., (2006) Nucleic Acids Research 34:4791-800; Chames et al., (2005) Nucleic Acids Research 33:el78; Smith et al., (2006) Nucleic Acids Research 34:el49; Gruen et al., (2002) Nucleic Acids Research 30:e29; Chen and Zhao (2005) Nucleic Acids Research 33:el54; WO 2005 / 105989; WO 2003 / 078619; WO 2006 / 097854; WO 2006 / 097853; WO 2006 / 097784; and WO 2004 / 031346, each of which is incorporated herein in its entirety for all purposes.

[0194] Any meganuclease can be used, including, for example, I-Scel, I-ScelII, I-ScelIII, I-ScelIV, I-ScelV, I-ScelVI, I-ScelVII, I-CeuI, I-CeuAIIP, I-Crel, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-Scel, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI , I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-Na nI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-Pg rIP, I-PobIP, I-PorI, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I- TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII or any active variant or fragment thereof.

[0195] Meganucleases can recognize double-stranded DNA sequences of, for example, 12 to 40 base pairs. In some cases, meganucleases recognize a perfectly matched target sequence in a genome. Some meganucleases are homing nucleases. One type of homing nuclease is the LAGLIDADG family of homing nucleases, including, for example, I-SceI, I-CreI, and I-Dmol.

[0196] VIII. Selection Box

[0197] Any suitable selection box can be used in the methods described herein.The term selection box refers to an expression box comprising one or more expression control sequences (for example, promoters and / or other regulatory sequences for expression in bacterial cells, such as enhancers, post-transcriptional regulatory elements and poly (A) sequences), which are operably connected to the nucleic acid encoding the selectable marker. The selection box can allow selection in bacterial cells, or it can allow selection in both bacteria and eukaryotic or mammalian cells. As an example, genes such as neomycin phosphotransferase can be used. Neomycin phosphotransferase confers kanamycin resistance in prokaryotic cells and G418 resistance in eukaryotic cells. This gene can be used in combination with a dual promoter system of, for example, a combined eukaryotic promoter (for example, eukaryotic phosphoglycerate kinase (PGK) promoter) and a prokaryotic promoter (for example, a prokaryotic EM7 promoter).

[0198] Some selection boxes that can be used in the methods described herein can confer resistance to antibiotics, otherwise the antibiotic will kill or inhibit the growth of bacterial cells. For example, the selection box can confer resistance to kanamycin, spectinomycin, streptomycin, ampicillin, carbenicillin, bleomycin, erythromycin, polymyxin B, tetracycline or chloramphenicol. It is well known that this selection box and gene that confer resistance to these antibiotics and other antibiotics. Cells that can be selected to include the selection box can be selected by treating cells with antibiotics. Those cells that are resistant to antibiotics include the selection box.

[0199] Other selection boxes can include reporter genes that can be used to select cells including expected modifications. The term reporter gene refers to a nucleic acid having a sequence encoding a gene product (usually an enzyme), and when a construct including a reporter gene sequence operably connected to a heterologous promoter and / or an enhancer element is introduced into a cell, the gene product is easy to measure and quantitatively determine the factors necessary for the activation of the promoter and / or enhancer element. Examples of reporter genes include, but are not limited to, genes encoding fluorescent proteins. Reporter protein refers to a protein encoded by a reporter gene.

[0200] Fluorescent reporter proteins are based on fluorescence detectable reporter proteins, wherein the fluorescence can come directly from the reporter protein, the activity of the reporter protein on a fluorescent substrate, or a protein with affinity for binding to a fluorescently labeled compound. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomer Azami Green, CopGFP, AceGFP, and ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, lemon yellow, Venus, YPet, PhiYFP, and ZsYellowl), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, azurite, mKalamal, GFPuv, sky blue, and T-sky blue), cyan fluorescent proteins (e.g., CFP, eCFP, azure, CyPet, AmCyanl, and Midoriishi-cyan), red fluorescent proteins (e.g., RFP, mKate, mKate2, mPet, mP lum, DsRed monomer, mCherry, mRFP1, DsRed-expression, DsRed2, DsRed-monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry and Jred), orange fluorescent protein (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine and tdTomato), and any other suitable fluorescent protein that can be detected in cells by flow cytometry. Cells comprising a fluorescent reporter gene can be selected, for example, by sorting cells comprising a fluorescent reporter protein encoded by a gene.

[0201] IX. Targeted Modification

[0202] Various types of targeted gene modification can be introduced using methods described herein.Such targeted gene modification can include, for example, the insertion of one or more nucleotides, the deletion of one or more nucleotides or the replacement (displacement) of one or more nucleotides.Such insertion, deletion or displacement can result in, for example, point mutation, knockout of a nucleic acid sequence of interest or its portion, knock-in of a nucleic acid sequence of interest or its portion, replacement of endogenous nucleic acid sequence with heterologous or exogenous nucleic acid sequence, replacement of endogenous nucleic acid sequence with homologous or orthologous nucleic acid sequence (for example, domain exchange, exon exchange, intron exchange, regulatory sequence exchange or gene exchange), change of regulatory element (for example, promoter or enhancer), missense mutation, nonsense mutation, frameshift mutation, truncation mutation, null mutation or its combination.For example, at least 1, 2, 3, 4, 5, 7, 8, 9, 10 or more nucleotides can be changed to form targeted gene modification.As disclosed elsewhere herein, deletion, insertion or replacement can be any size. See, e.g., Wang et al., (2013) Cell 153:910-918; Mandalos et al., (2012) PLoS One 7:e45768; and Wang et al., (2013) Nature Biotechnology 31:530-532, each of which is incorporated herein in its entirety.

[0203] The deletion, insertion or replacement can be of any length. The deleted, inserted or replaced nucleic acid can be, for example, about 1 bp to about 5 bp, about 5 bp to about 10 bp, about 10 bp to about 50 bp, about 50 bp to about 100 bp, about 100 bp to about 200 bp, about 200 bp to about 300 bp, about 300 bp to about 400 bp, about 400 bp to about 500 bp, about 500 bp to about 1 kb, about 1 kb to about 5 kb ... kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb to about 150 kb, or about 150 kb to about 200 kb, about 200 kb to about 300 kb, about 300 kb to about 400 kb, or about 400 kb to about 500 kb.

[0204] For all purposes, all patent applications, websites, other disclosures, accession numbers, etc. cited above or below are incorporated by reference in their entirety, to the extent that each individual project is individually and specifically indicated to be incorporated by reference. If different versions of a sequence are associated with accession numbers at different times, it is meant that the version associated with the accession number is meant on the effective filing date of the present application. The effective filing date refers to the earlier date in the actual filing date or the filing date of the priority application (where applicable) that mentions the accession number. Similarly, if different versions of disclosures, websites, etc. are published at different times, unless otherwise specified, the version most recently published on the effective filing date of the application is referred to. Unless otherwise specifically specified, any feature, step, element, embodiment, or aspect of the present invention may be used in combination with any other feature, step, element, embodiment, or aspect. Although the present invention has been described in detail by way of illustration and example for clarity and understanding, it is apparent that certain changes and modifications may be made within the scope of the appended claims.

[0205] Brief description of sequence

[0206] The nucleotide and amino acid sequences listed in the accompanying sequence table are shown using the standard letter abbreviations for nucleotide bases and the three-letter code for amino acids. The nucleotide sequence follows the standard convention starting from the 5' end of the sequence and reaching the 3' end forward (i.e., from left to right in each row). Each nucleotide sequence shows only one chain, but any display chain mentioned should be understood to include a complementary chain. When a nucleotide sequence encoding an amino acid sequence is provided, it should be understood that a degenerate variant of its codon encoding the same amino acid sequence is also provided. The amino acid sequence follows the standard convention starting from the amino terminal of the sequence and reaching the carboxyl terminal forward (i.e., from left to right in each row).

[0207] Table 2: Sequence description.

[0208] SEQ ID NO type describe 1 protein Cas9 protein 2 DNA Cas9 DNA 3 RNA crRNA tail 4 RNA tracrRNA 5 RNA gRNA Scaffold v1 6 RNA gRNA Scaffold v2 7 RNA gRNA Scaffold v3 8 RNA gRNA Scaffold v4 9 DNA Guide RNA target sequence plus PAM v1 10 DNA Guide RNA target sequence plus PAM v2 11 DNA Guide RNA target sequence plus PAM v3 12 RNA tracrRNAv2 13 RNA tracrRNAv3 14 RNA gRNA Scaffold v5 15 RNA gRNA Scaffold v6 16 RNA gRNA Scaffold v7

[0209] Examples

[0210] Example 1: Scarless introduction of targeted modifications in large targeting vectors by bacterial homologous recombination and intramolecular Gibson assembly

[0211] The Gibson assembly technique joins DNA segments with homologous ends into a single molecule. It differs from the traditional joining between complementary staggered ends produced by restriction enzymes because any minimum size of complementary sequences can be used. Since cloning by restriction sites usually results in the incorporation of foreign DNA scars (enzyme recognition sites) into the final product, Gibson assembly is advantageous because it can be seamless.

[0212] The Gibson assembly reaction is isothermal and involves three different enzymes: T5 exonuclease, DNA polymerase and ligase. See, for example, US 2010 / 0035768, US 2015 / 0376628, WO 2015 / 200334 and Gibson et al., (2009) Nature-Methods 6 (5): 343-345, each of which is incorporated herein by reference for all purposes. Due to the 5' to 3' exonuclease activity achieved by T5 exonuclease, the reaction begins with the generation of single-stranded DNA ends. DNA fragments with complementary single-stranded ends are then aligned by simple base pairing rules, and DNA polymerase fills the gap moving from 5' to 3'. DNA ligase seals the final incision, and the result is a seamless double-stranded DNA molecule. Forty base pairs of complementary ends have been shown to be effective, and the actual sequence is usually not important. The starting fragment can be produced by PCR, restriction or direct synthesis.

[0213] Seamless DNA construction is particularly important when creating transgenic animal lines, as scars created by restriction sites or other manipulations can negatively affect gene expression if they fall in regions important for regulation. Targeting mammalian genomes often requires the construction of large targeting vectors with long DNA arms to direct homologous recombination, as well as antibiotic resistance cassettes for selection of embryonic stem cell clones. Correctly targeted clones often contain multiple scars required to construct the vector, not to mention the resistance cassette itself. For gene ablation, these lesions may not be relevant to the final outcome (null alleles), but there is always the possibility that expression of neighboring genes may be adversely affected. For modifications other than knockouts, such as knockins (e.g., reporter genes or mutant alleles), reliable expression of the targeted locus is often important for the study in question. Gibson assembly can eliminate the need for some of these scars and even facilitate construction of the vector itself in some cases, but it can be difficult to find unique restriction sites.

[0214] Humanization, the direct replacement of mouse genes with their human counterparts, specifically requires seamless connections between mouse and human sequences so that the mouse transcriptional machinery can reliably replicate expression of the new allele. Care must be taken to bury construction scars and selection cassettes in non-coding regions that do not affect gene regulation. As animal models become more complex, more modifications can be added on top of existing models, such as adding human pathogenic mutations to humanized alleles. Additional changes can then add even more scars and another selection cassette to the already highly engineered mouse locus, increasing the likelihood that expression will be altered and the mouse model will be unreliable for human disease. From a construction perspective, adding a new cassette to a vector that already contains one cassette can be complicated by undesired recombination between shared cassette elements such as promoters and poly(A) signals, even if the two cassettes encode different selections.

[0215] Given these obstacles, methods have been developed to simplify the generation of targeting vectors carrying multiple changes, such as humanized alleles and disease mutations layered on top. These methods make construction easier and minimize scarring for incorporation into the final animal model.

[0216] In the first method, a short segment of DNA carrying the desired mutation flanked by short (<500bp) homology arms is synthesized. Several base pairs downstream of the desired mutation are selected and replicated in a 40-50 base pair region to produce a homologous repeat sequence, with a rare restriction site or Cas9 guide RNA target sequence flanked by a resistance box. This small construct is then homologously recombined with an established mouse targeting vector (such as a humanized targeting vector with its own resistance box) by recombineering technology. After confirming that the desired mutation is combined, the new vector is cut with a rare cutter / Cas9 guide, the box is removed and 40-50 base pairs of homologous repeat sequences are exposed. The Gibson assembly then seamlessly seals the fracture in an intramolecular reaction. The resulting targeting vector now carries the desired mutation, and there is no additional scar or box except those initially present in humanization.

[0217] In a specific example, an allele was generated that incorporated a point mutation into a targeting construct (large targeting vector) that included a humanized target gene 1. Figure 1 . The goal is to efficiently and seamlessly generate a large targeting vector including a humanized target gene 1 with a point mutation without having to re-target humanized mouse embryonic stem (ES) cells including the humanized target gene 1 so as to introduce point mutations in those humanized mouse ES cells. The initial targeting construct contains the human target gene 1 genomic sequence from the start codon to the stop codon, including all introns, to replace the corresponding mouse target gene 1 mouse genomic sequence from the start codon to the stop codon. In addition, the insert nucleic acid in the targeting construct includes a self-deleting hygromycin resistance box downstream of the poly (A) sequence. This initial humanized vector is then modified with a point mutation and a neomycin resistance box just downstream of the point mutation as described above, and the neomycin resistance box is flanked by an AscI restriction site and a 50 base pair direct repeat sequence of the human target gene 1 sequence. Nucleic acid is then synthesized to include an EM7 neomycin cassette flanked by rare restriction sites (AscI) and a 50 bp direct repeat sequence from the exon in which the mutation is to be introduced, as well as upstream and downstream homeoboxes, including the mutation to be introduced in the upstream homeobox. Figure 2. The neomycin resistance cassette is inserted into the middle of the exon for mutation, but since the method is seamless, the exon is replayed at the end of the method. The nucleic acid is linearized by cutting with HindIII, and the linearized synthetic nucleic acid is inserted into a large targeting vector including the humanized target gene 1 using bacterial homologous recombination. See, for example, US 2004 / 0018626 and Valenzuela et al., (2003) Nature Biotechnology 21 (6): 652-659, each of which is incorporated herein in its entirety. The neomycin cassette is excised with AscI, which removes the neomycin cassette and exposes the direct repeat sequence. The construct is then resealed by intramolecular Gibson assembly, which decomposes the direct repeat sequence into a single copy, leaving the exon (now including the mutation) intact and without scars. After Gibson assembly, the reaction is digested again with AscI to cut any content of the AscI site that was not missing during Gibson assembly, thereby reducing background. Final sequencing confirmed the presence of the point mutation, and there was no additional change in the original targeting vector. The new modified vector was electroporated into mouse embryonic stem cells, and positive clones were identified by TAQMAN followed by Sanger sequencing to confirm the incorporation of the point mutation.

[0218] Example 2: Scarless introduction of targeted modifications in large targeting vectors by bacterial homologous recombination and intermolecular Gibson assembly

[0219] In the second method, the desired mutation is introduced into bacterial artificial chromosome (BAC) DNA by two general steps. In the first step, the region of interest in the BAC (a region spanning approximately 100-200 bp on each side of the mutation) is deleted by bacterial homologous recombination using a selection cassette flanked by rare-cutting restriction enzyme sites on each side. In the second step, the BAC deletion is replaced with the desired mutant sequence by Gibson assembly using a DNA fragment of approximately 200-500 bp having heterologous 5' and 3' ends homologous to the targeted BAC sequence adjacent to the rare cutting site. To this end, the targeted BAC in the first step is digested with a rare-cutting enzyme, thereby exposing the two ends homologous to the mutant fragment. The restriction enzyme can also keep the targeted BAC open, allowing for a low background reaction without the need to add a selection marker. See Figure 3 This approach is particularly beneficial, for example, when a larger fragment (e.g., 15 kb or 30 kb) that cannot be obtained by PCR needs to be inserted into the construct. For example, such a large fragment can be cut from its source like a BAC (e.g., using CRISPR / Cas9), and then a modified BAC carrying homologs of the 5' and 3' ends of this fragment is inserted using Gibson assembly, thereby generating the final targeting construct.

[0220] In a specific example, this method is used to introduce splicing mutations into a large targeting vector including humanized target gene 2. The initial targeting construct contains wild-type target gene 2 genomic sequence, including introns, is intended to replace the corresponding genomic sequence of mouse target gene 2 from the start codon to the last exon, and is included in the intron to add a self-deletion neomycin resistance box. This initial humanization vector is then modified with a hygromycin resistance box as described above, and the hygromycin resistance box is flanked by an AscI restriction site and 40 base pairs of homologous sequences downstream and upstream of the desired splicing mutation. The hygromycin box is excised with AscI, and the construct is resealed by intermolecular Gibson assembly with a DNA fragment including splicing mutations, and the DNA fragment is flanked by a heterologous 5' end and 3' end homologous to the targeted targeting construct sequence of the adjacent rare cleavage site. Final sequencing confirmed the presence of splicing mutations, and the original targeting vector did not have additional changes. The new modified vector was electroporated into mouse embryonic stem cells, and positive clones were identified by TAQMAN followed by Sanger sequencing to confirm the incorporation of the splicing mutation.

[0221] In the third approach, a human DNA fragment was excised from a bacterial artificial chromosome (BAC) using CRISPR / Cas9. This human DNA fragment was fused to a mouse BAC previously targeted with a selection cassette via Gibson assembly. Rare-cutting restriction enzyme sites were designed in the region where the human fragment was to be integrated. In the targeted mouse BAC, each side of this rare-cutting restriction site was flanked by 40 bp of homology. The homologous sequences were homologous to the 5' and 3' ends of the human DNA fragment. The final construct was selected in the same antibiotic as the original mouse BAC targeting. Low background was observed even without incorporating the new selection in the final Gibson assembly reaction. Adding rare restriction enzymes after Gibson assembly can keep the background low.

[0222] In a specific example, the above experiment is to integrate the allele of the region encoding the extracellular domain of target protein 3 including target gene 3 into mouse target gene 3. The initial targeting construct contains wild-type mouse target gene 3 genomic sequence, including introns. The self-deletion neomycin resistance box is added by bacterial homologous recombination, so that the mouse target gene 3 extracellular domain coding region is deleted. Upstream of the neomycin resistance box, there is a SgrDI restriction site that separates the 5' and 3'40bp regions of the human homologs that interact with the human fragment. All these sequences are incorporated by the previously described bacterial homologous recombination. A human DNA fragment of 32kb in length is cut off from the human BAC by CRISPR / Cas9, exposing the 5' end and 3' end to be used for intramolecular Gibson assembly reaction with the mouse targeting BAC opened by SgrDI digestion. The new modified vector is electroporated into mouse embryonic stem cells, and positive clones are identified by TAQMAN. Sequence Listing <110> Razerne Pharmaceuticals <120> Methods for scarless introduction of targeted modifications in targeted vectors <130> 057766-544999 <150> US 62 / 829,327 <151> 2019-04-04 <160> 16 <170> PatentIn Version 3.5 <210> 1 <211> 1370 <212> PRT <213> Artificial Sequence <220> <223> synthesis <400> 1 Gly Ala Ala Ser Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 1 5 10 15 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 20 25 30 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 35 40 45 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 50 55 60 Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn 65 70 75 80 Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val 85 90 95 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 100 105 110 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 115 120 125 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 130 135 140 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 145 150 155 160 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 165 170 175 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 180 185 190 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 195 200 205 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 210 215 220 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 225 230 235 240 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 245 250 255 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 260 265 270 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 275 280 285 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 290 295 300 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 305 310 315 320 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 325 330 335 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 340 345 350 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 355 360 365 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 370 375 380 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 385 390 395 400 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 405 410 415 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 420 425 430 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 435 440 445 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 450 455 460 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 465 470 475 480 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 485 490 495 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 500 505 510 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 515 520 525 Lys Val Lys Tyr Val Thr Glu Gly Met Lys Pro Ala Phe Leu Ser Gly 530 535 540 Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys 545 550 555 560 Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys 565 570 575 Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser 580 585 590 Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe 595 600 605 Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr 610 615 620 Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr 625 630 635 640 Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg 645 650 655 Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile 660 665 670 Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp 675 680 685 Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu 690 695 700 Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp 705 710 715 720 Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys 725 730 735 Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val 740 745 750 Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu 755 760 765 Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys 770 775 780 Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu 785 790 795 800 His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr 805 810 815 Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile 820 825 830 Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe 835 840 845 Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys 850 855 860 Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys 865 870 875 880 Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln 885 890 895 Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu 900 905 910 Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln 915 920 925 Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys 930 935 940 Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu 945 950 955 960 Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys 965 970 975 Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn 980 985 990 Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser 995 1000 1005 Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1010 1015 1020 Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr 1025 1030 1035 Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr 1040 1045 1050 Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn 1055 1060 1065 Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala 1070 1075 1080 Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys 1085 1090 1095 Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu 1100 1105 1110 Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp 1115 1120 1125 Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr 1130 1135 1140 Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys 1145 1150 1155 Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg 1160 1165 1170 Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly 1175 1180 1185 Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1190 1195 1200 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1205 1210 1215 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys 1220 1225 1230 Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys 1235 1240 1245 Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1250 1255 1260 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe 1265 1270 1275 Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu 1280 1285 1290 Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala 1295 1300 1305 Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro 1310 1315 1320 Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr 1325 1330 1335 Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser 1340 1345 1350 Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly 1355 1360 1365 Gly Asp 1370 <210> 2 <211> 4104 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 2 gataagaaat actcaatagg cttagatatc ggcacaaata gcgtcggatg ggcggtgatc 60 actgatgaat ataaggttcc gtctaaaaag ttcaaggttc tgggaaatac agaccgccac 120 agtatcaaa aaaatcttat aggggctctt tattttgaca gtggagac agcggaagcg 180 actcgtctca aacggacagc tcgtagaagg tatacacgtc ggaagaatcg tattgttat 240 ctacaggaga tttttcaa tgagatggcg aaagtagatg atagttctt tcatcgactt 300 gaagagtctt dotggtgga agagacaag aagcatgaac gtcatcctat dotttggaat 360 atagtagatg aagttgctta tcatgagaaa tatccacta tctatcatct gcgaaaaaaa 420 ttggtagatt ctactgataa agcggattg cgcttaatct atttggcctt agcgcatatg 480 attaagtttc gtggtcattt ttgattgag ggagatttaa atcctgataa tagtgatgtg 540 vakaaactat ttccagtt ggtacaacc tacaatcaat tatttgaga aaaccctatt 600 aacgcaagtg gagtagatgc taagcgatt ctttctgcac gattgagtaa atcagacga 660 ttagaaaatc tcattgctca gctccccggt gagagaaaa atggcttt tgggaatctc 720 attgctttgt cattgggttt gaccctaat ttaatcaattttgatt ggcagaagat 780 gctaaattac agctttcaa agatacttac gatgatgat tegataattt attggcgcaa 840 attggagatc aatatgctga tttgtttttg gcagctaaga attatcaga tgctatttta 900 ctttcagata tcctaagagt aaatactgaa ataactaagg ctcccctatc agcttcaatg 960 attaaacgct acgatgaaca tcatcaagac ttgactcttt taaaagcttt agttcgacaa 1020 caacttccag aaaagtataa agaaatcttt tttgatcaat caaaaaacgg atatgcaggt 1080 tatattgatg ggggagctag ccaagaagaa ttttataaat tttcaaacc aattttagaa 1140 aaaatggatg gtactgagga attattggtg aaactaaatc gtgaagattt gctgcgcaag 1200 caacggacct ttgacaacgg ctctattccc catcaaattc acttgggtga gctgcatgct 1260 atttgagaa gacaagaaga cttttatcca ttttaaaag acaatcgtga gaagattgaa 1320 aaaatcttga cttttcgaat tccttattat gttggtccat tggcgcgtgg caatagtcgt 1380 tttgcatgga tgactcggaa gtctgaagaa acaattaccc catggaattt tgaagaagtt 1440 gtcgataaag gtgcttcagc tcaatcattt attgaacgca tgacaaactt tgataaaaat 1500 cttccaaatg aaaaagtact accaaaacat agtttgcttt atgagtattt tacggtttat 1560 aacgaattga caaaggtcaa atatgttact gaaggaatgc gaaaaccagc atttctttca 1620 ggtgaacaga agaaagccat tgttgattta ctcttcaaaa caaatcgaaa agtaaccgtt 1680 aagcaattaa aagaagatta tttcaaaaaa atagaatgtt ttgatagtgt tgaaatttca 1740 ggagttgaag atagatttaa tgcttcatta ggtacctacc atgatttgct aaaaattatt 1800 aaagataaag attttttgga taatgaagaa aatgaagata tcttagagga tattgtttta 1860 acattgacct tatttgaaga tagggagatg attgaggaaa gacttaaaac atatgctcac 1920 ctctttgatg ataaggtgat gaaacagctt aaacgtcgcc gttatactgg ttggggacgt 1980 ttgtctcgaa aattgattaa tggtattagg gataagcaat ctggcaaaac aatattagat 2040 tttttgaaat cagatggttt tgccaatcgc aattttatgc agctgatcca tgatgatagt 2100 ttgacattta aagaagacat tcaaaaagca caagtgtctg gacaaggcga tagtttacat 2160 gaacatattg caaatttagc tggtagccct gctattaaaa aaggtatttt acagactgta 2220 aaagttgttg atgaattggt caaagtaatg gggcggcata agccagaaaa tatcgttatt 2280 gaaatggcac gtgaaaatca gacaactcaa aagggccaga aaaattcgcg agagcgtatg 2340 aaacgaatcg aagaaggtat caaagaatta ggaagtcaga ttcttaaaga gcatcctgtt 2400 gaaaatactc aattgcaaaa tgaaaagctc tatctctatt atctccaaaa tggaagagac 2460 atgtatgtgg accaagaatt agatattaat cgtttaagtg attatgatgt cgatcacatt 2520 gttccacaaa gtttccttaa agacgattca atagacaata aggtcttaac gcgttctgat 2580 aaaaatcgtg gtaaatcgga taacgttcca agtgaagaag tagtcaaaaa gatgaaaaac 2640 tattggagac aacttctaaa cgccaagtta atcactcaac gtaagtttga taatttaacg 2700 aaagctgaac gtggaggttt gagtgaactt gataaagctg gtttatcaa acgccaattg 2760 gttgaaactc gccaaatcac taagcatgtg gcacaaattt tggatagtcg catgaatact 2820 aaatacgatg aaaatgataa acttattcga gaggttaaag tgattacctt aaaatctaaa 2880 ttagtttctg acttccgaaa agatttccaa ttctataaag tacgtgagat taacaattac 2940 catcatgccc atgatgcgta tctaaatgcc gtcgttggaa ctgctttgat taagaaatat 3000 ccaaaacttg aatcggagtt tgtctatggt gattataaag tttatgatgt tcgtaaaatg 3060 attgctaagt ctgagcaaga ataggcaaa gcaccgcaa atattcttt ttactctaat 3120 atcatgaact tctcaaac agaattaca cttgcaatg gagagattcg cieacgccct 3180 ctaatcgaaa ctaatgggga aactggagaa attgtctggg aataagggcg agatttgcc 3240 acagtgcgca aagtattgtc catgccccaa gtcaatattg tcaagaaaac agagtacag 3300 acaggcggat tctccaagga gtcaatttta ccaaaagaa attcggacaa gcttattgct 3360 cgtaaaaag actgggatcc aaaaaaatat ggtggttttg atagtccaac ggtagcttat 3420 tcagtcctag tggttgctaa ggtggaaaaa gggaatcga agaagttaaa atccgttaaa 3480 gagttactag ggatcacaat tatggaaga agttccttg aaaaaaatcc gattgacttt 3540 ttagaagcta aagatataa ggaagttaaaagactta tcattaact acctaata 3600 agtcttttg agttagaaaa cggtcgtaaa cggatgctgg ctagtgccgg agaattacaa 3660 aaaggaaatg agctggctct gccaagcaaa tatgtgaattt tttattt agctagtcat 3720 tatgaaaagt tgaagggtag tccagaagat aacgaacaaa aacaattgtt tgtggagcag 3780 cataagcatt atttagatga gattattgag caaatcagtg aattttctaa gcgtgttatt 3840 ttagcagatg ccaatttaga taaagttctt agtgcatata acaaacatag agacaaacca 3900 atacgtgaac aagcagaaaa tattattcat ttatttacgt tgacgaatct tggagctccc 3960 gctgctttta aatattttga tacaacaatt gatcgtaaac gatatacgtc tacaaaagaa 4020 gttttagatg ccactcttat ccatcaatcc atcactggtc tttatgaaac acgcattgat 4080 ttgagtcagc taggaggtga ctga 4104 <210> 3 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> Synthetic <400> 3 guuuuagagc uaugcu 16 <210> 4 <211> 67 <212> RNA <213> Artificial Sequence <220> <223> Synthetic <400> 4 agcauagcaa guuaaaauaa ggcuaguccg uuaucaacuu gaaaaagugg caccgagucg 60 gugcuuu 67 <210> 5 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 5 guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60 ggcaccgagu cggugcu 77 <210> 6 <211> 82 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 6 guuggaacca uucaaaacag cauagcaagu uaaaauaagg cuaguccguu aucaacuuga 60 aaaaguggca ccgagucggu gc 82 <210> 7 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 7 guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60 ggcaccgagu cggugc 76 <210> 8 <211> 86 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 8 guuuaagagc uaugcuggaa acagcauagc aaguuuaaau aaggcuaguc cguuaucaac 60 uugaaaaagu ggcaccgagu cggugc 86 <210> 9 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> synthesis <220> <221> misc_feature <222> (2)..(21) <223> n is a, c, g, or t <400> 9 gnnnnnnnnn nnnnnnnn ngg 23 <210> 10 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> synthesis <220> <221> misc_feature <222> (1)..(21) <223> n is a, c, g, or t <400> 10 nnnnnnnnnn nnnnnnnnnn ngg 23 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthesis <220> <221> misc_feature <222> (3)..(23) <223> n is a, c, g, or t <400> 11 ggnnnnnnnn nnnnnnnnnn nnngg 25 <210> 12 <211> 72 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 12 aaacagcaua gcaaguuaaa auaaggcuag uccguuauca acuugaaaaa guggcaccga 60 gucggugcuu uu 72 <210> 13 <211> 82 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 13 guuggaacca uucaaaacag cauagcaagu uaaaauaagg cuaguccguu aucaacuuga 60 aaaaguggca ccgagucggu gc 82 <210> 14 <211> 83 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 14 guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60 ggcaccgagu cggugcuuuu uuu 83 <210> 15 <211> 80 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 15 guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60 ggcaccgagu cggugcuuuu 80 <210> 16 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 16 guuuaagagc uaugcuggaa acagcauagc aaguuuaaau aaggcuaguc cguuaucaac 60 uugaaaaagu ggcaccgagu cggugcuuuu uu 92

Claims

1. A method for introducing scarless targeted gene modification into a pre-existing targeting vector, the method comprising: (a) performing bacterial homologous recombination between the pre-existing targeting vector and the modification cassette in a bacterial cell population, wherein the modification cassette comprises the targeted genetic modification and comprises an insert nucleic acid flanked by a 5' homology arm corresponding to a 5' target sequence in the pre-existing targeting vector and a 3' homology arm corresponding to a 3' target sequence in the pre-existing vector, wherein the insert nucleic acid comprises, from 5' to 3': (i) a first repeating sequence; (ii) a first target site for a first nuclease agent; (iii) selection box; (iv) a second target site for a second nuclease agent; and (v) a second repeating sequence that is identical to the first repeating sequence; (b) selecting bacterial cells comprising the modified targeting vector comprising the selection cassette; (c) cleaving the first target site in the modified targeting vector with the first nuclease agent and cleaving the second target site in the modified targeting vector with the second nuclease agent to remove the selection cassette and expose the first repeat sequence and the second repeat sequence in the modified targeting vector; and (d) assembling the exposed first repeat sequence with the exposed second repeat sequence in an in vitro assembly reaction to produce the targeting vector comprising the scarless targeted gene modification, The targeting vector including the scarless targeted gene modification contains neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent, but only a single copy of the repeat sequence.

2. The method according to claim 1, wherein: (I)(a) the repetitive sequence is identical to a sequence in the pre-existing targeting vector, or (b) the targeted genetic modification comprises an insertion, and the repeat sequence is identical to the 5' end or the 3' end of the insertion; and / or (II) The length of the repeat sequence is between 20 nucleotides and 100 nucleotides.

3. The method according to claim 1 or 2, wherein: (I) the modification box is a linear double-stranded nucleic acid; and / or (II) The length of the modification box is 1 kb to 15 kb.

4. The method according to claim 1 or 2, wherein the 5' homology arm and the 3' homology arm are each at least 35 nucleotides in length. 5 . The method of claim 4 , wherein the 5′ homology arm and the 3′ homology arm are each between 35 nucleotides and 500 nucleotides in length.

6. The method of any one of claims 1, 2, and 5, wherein the first nuclease agent and / or the second nuclease agent is a rare-cutting nuclease agent.

7. The method according to any one of claims 1, 2 and 5, wherein: (I) the first target site and / or the second target site does not exist in the pre-existing targeting vector; and / or (II) The first target site is the same as the second target site, and the first nuclease agent is the same as the second nuclease agent.

8. The method according to any one of claims 1, 2 and 5, wherein: (I) the first nuclease reagent and / or the second nuclease reagent comprises a rare-cutting restriction enzyme; or (II) The first nuclease agent and / or the second nuclease agent are clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) proteins and guide RNA (gRNA), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) or engineered large-range nucleases.

9. The method of claim 8, wherein the rare-cutting restriction enzyme is NotI, XmaIII, SstII, Sall, NruI, NheI, Nb.BbvCI, BbvCI, AscI, AsiSI, FseI, PacI, PmeI, SbfI, SgrAI, SwaI, BspQI, SapI, SfiI, CspCI, AbsI, CciNI, FspAI, MauBI, MreI, MssI, PalAI, Rgal, RigI, SdaI, SfaAI, SgfI, SgrDI, SgsI, SmiI, SrfI, Sse2321, Sse83871, LguI, PciSI, AarI, AjuI, AloI, BarI, PpiI or PsrI.

10. The method of claim 8, wherein the first nuclease agent and / or the second nuclease agent is the Cas protein and the gRNA, wherein the Cas protein is Cas9, and wherein the gRNA comprises CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA).

11. The method of any one of claims 1, 2, 5, 9 and 10, wherein the targeted genetic modification comprises: (I) modification in the 5' homology arm or the 3' homology arm, or (II) Modifications in the inserted nucleic acid.

12. The method of any one of claims 1, 2, 5, 9 and 10, wherein the targeted genetic modification comprises a point mutation, a deletion, an insertion, a substitution or a combination thereof.

13. The method of any one of claims 1, 2, 5, 9 and 10, wherein the selection cassette confers resistance to an antibiotic.

14. The method of claim 13, wherein the selection cassette confers resistance to ampicillin, chloramphenicol, tetracycline, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin or polymyxin B.

15. The method of any one of claims 1, 2, 5, 9, 10, and 14, wherein the pre-existing targeting vector is a large targeting vector of at least 10 kb in length.

16. The method of claim 15, wherein the pre-existing targeting vector is at least 100 kb in length.

17. The method of any one of claims 1, 2, 5, 9, 10, 14, and 16, wherein the pre-existing targeting vector comprises a second selection cassette.

18. The method of claim 17, wherein the second selection cassette confers resistance to an antibiotic.

19. The method of claim 18, wherein the selection cassette in the modification cassette and the second selection cassette in the pre-existing targeting vector each confer resistance to a different antibiotic.

20. The method of claim 17, wherein the second selection cassette allows for selection in both bacterial cells and mammalian cells.

21. The method of any one of claims 1, 2, 5, 9, 10, 14, 16, and 18-20, wherein step (c) occurs in vitro.

22. The method of any one of claims 1, 2, 5, 9, 10, 14, 16, and 18-20, wherein step (d) comprises: (i) contacting the modified targeting vector with an exonuclease to expose a complementary sequence between the first repeat sequence and the second repeat sequence; (ii) annealing the exposed complementary sequence; (iii) extending the 3' end of the annealed complementary sequence; and (iv) ligating the annealed complementary sequences.

23. The method of claim 22, wherein step (d) comprises incubating the modified targeting vector with an exonuclease, a DNA polymerase, and a DNA ligase.

24. The method of any one of claims 1, 2, 5, 9, 10, 14, 16, 18-20, and 23, further comprising: (e) after the in vitro assembly in step (d), treating the targeting vector with the first nuclease agent and the second nuclease agent to verify that neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent exists.

25. A method for introducing scarless targeted gene modification into a pre-existing targeting vector, the method comprising: (a) performing bacterial homologous recombination between the pre-existing targeting vector and the deletion cassette in a bacterial cell population, wherein the deletion cassette comprises an insert nucleic acid flanked by a 5' homology arm corresponding to a 5' target sequence in the pre-existing targeting vector and a 3' homology arm corresponding to a 3' target sequence in the pre-existing vector, wherein the 5' target sequence and the 3' target sequence flank a region of the pre-existing targeting vector into which the targeted genetic modification is to be introduced, and wherein the insert nucleic acid comprises, from 5' to 3': (i) a first target site for a first nuclease agent; (ii) a selection box; and (iii) a second target site for a second nuclease agent; (b) selecting bacterial cells comprising the modified targeting vector comprising the selection cassette; (c) cleaving the first target site in the modified targeting vector with the first nuclease agent and cleaving the second target site in the modified targeting vector with the second nuclease agent to remove the selection cassette and expose the upstream terminal sequence and the downstream terminal sequence in the modified targeting vector; and (d) assembling the cleaved targeting vector with a modifying cassette comprising the targeted gene modification in an in vitro assembly reaction to produce the targeting vector comprising the scarless targeted gene modification, the targeted gene modification flanked by an upstream terminal sequence overlapping with the upstream terminal sequence in the modified targeting vector and a downstream terminal sequence overlapping with the downstream terminal sequence in the modified targeting vector, The targeting vector comprising the scarless targeted gene modification contains neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent.

26. The method of claim 25, wherein: (I) the length of the deletion box is 1 kb to 15 kb, and / or (II) The deletion cassette is a linear double-stranded nucleic acid.

27. The method of claim 25 or 26, wherein the 5' homology arm and the 3' homology arm are each at least 35 nucleotides in length.

28. The method of claim 27, wherein the 5' homology arm and the 3' homology arm are each between 35 nucleotides and 500 nucleotides in length.

29. The method of any one of claims 25, 26 and 28, wherein the first nuclease agent and / or the second nuclease agent is a rare-cutting nuclease agent.

30. The method according to any one of claims 25, 26 and 28, wherein: (I) the first target site and / or the second target site does not exist in the pre-existing targeting vector; and\or (II) The first target site is the same as the second target site, and the first nuclease agent is the same as the second nuclease agent.

31. The method according to any one of claims 25, 26 and 28, wherein: (I) the first nuclease reagent and / or the second nuclease reagent comprises a rare-cutting restriction enzyme; or (II) The first nuclease agent and / or the second nuclease agent is a clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) protein and guide RNA (gRNA), zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) or an engineered meganuclease.

32. The method of claim 31 , wherein the rare-cutting restriction enzyme is NotI, XmaIII, SstII, Sall, NruI, NheI, Nb.BbvCI, BbvCI, AscI, AsiSI, FseI, PacI, PmeI, SbfI, SgrAI, SwaI, BspQI, SapI, SfiI, CspCI, AbsI, CciNI, FspAI, MauBI, MreI, MssI, PalAI, Rgal, RigI, SdaI, SfaAI, SgfI, SgrDI, SgsI, SmiI, SrfI, Sse2321, Sse83871, LguI, PciSI, AarI, AjuI, AloI, BarI, PpiI, or PsrI.

33. The method of claim 31, wherein the first nuclease agent and / or the second nuclease agent is the Cas protein and the gRNA, wherein the Cas protein is Cas9, and wherein the gRNA comprises CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA).

34. The method of any one of claims 25, 26, 28, 32 and 33, wherein the selection cassette confers resistance to an antibiotic.

35. The method of claim 34, wherein the selection cassette confers resistance to ampicillin, chloramphenicol, tetracycline, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin, or polymyxin B.

36. The method of any one of claims 25, 26, 28, 32, 33, and 35, wherein the pre-existing targeting vector is a large targeting vector of at least 10 kb in length.

37. The method of claim 36, wherein the pre-existing targeting vector is at least 100 kb in length.

38. The method of any one of claims 25, 26, 28, 32, 33, 35 and 37, wherein the pre-existing targeting vector comprises a second selection cassette.

39. The method of claim 38, wherein the second selection cassette confers resistance to an antibiotic.

40. The method of claim 39, wherein the selection cassette in the deletion cassette and the second selection cassette in the pre-existing targeting vector each confer resistance to a different antibiotic.

41. The method of claim 38, wherein the second selection cassette allows for selection in both bacterial cells and mammalian cells.

42. The method of any one of claims 25, 26, 28, 32, 33, 35, 37, and 39-41, wherein the length of the overlap between the upstream terminal sequence in the modification box and the upstream terminal sequence in the modified targeting vector and / or the length of the overlap between the downstream terminal sequence in the modification box and the downstream terminal sequence in the modified targeting vector is at least 20 nucleotides.

43. The method of claim 42, wherein the length of the overlap between the upstream terminal sequence in the modification box and the upstream terminal sequence in the modified targeting vector and / or the length of the overlap between the downstream terminal sequence in the modification box and the downstream terminal sequence in the modified targeting vector is between 20 nucleotides and 100 nucleotides.

44. The method of any one of claims 25, 26, 28, 32, 33, 35, 37, 39-41 and 43, wherein step (c) occurs in vitro.

45. The method of any one of claims 25, 26, 28, 32, 33, 35, 37, 39-41, and 43, wherein step (d) comprises: (i) contacting the cleaved targeting vector and the modification cassette with an exonuclease to expose a complementary sequence between the terminal sequence in the modified targeting vector and the terminal sequence in the modification cassette; (ii) annealing the exposed complementary sequence; (iii) extending the 3' end of the annealed complementary sequence; and (iv) ligating the annealed complementary sequences.

46. ​​The method of claim 45, wherein step (d) comprises incubating the cleaved targeting vector and the modification cassette with an exonuclease, a DNA polymerase, and a DNA ligase.

47. The method of any one of claims 25, 26, 28, 32, 33, 35, 37, 39-41, 43, and 46, wherein: (I) the modification box is a linear double-stranded nucleic acid; (II) the length of the modification box is at least 200 nucleotides; and / or (III) The modification cassette is of a size that cannot be directly synthesized or produced by polymerase chain reaction.

48. The method of claim 47, wherein the modification cassette is at least 10 kb in length.

49. The method of any one of claims 25, 26, 28, 32, 33, 35, 37, 39-41, 43, 46, and 48, wherein the targeted genetic modification comprises a point mutation, a deletion, an insertion, a substitution, or a combination thereof.

50. The method of any one of claims 25, 26, 28, 32, 33, 35, 37, 39-41, 43, 46, and 48, further comprising: (e) after the in vitro assembly in step (d), treating the targeting vector with the first nuclease agent and the second nuclease agent to verify that neither the first target site for the first nuclease agent nor the second target site for the second nuclease agent exists.

Images