Nucleic acid amplification and identification methods

Abstract

The present invention provides a method for generating a labeled amplified fragment of a nucleic acid template, comprising providing the template nucleic acid; annealing at least one oligonucleotide primer to the template nucleic acid; extending at least one oligonucleotide primer in a template-specific manner to generate an extension product, wherein the extension reaction stops when the extension product reaches the 5' end of the template nucleic acid or reaches an extension terminator annealed to the template nucleic acid downstream of the extension product; providing an adapter nucleic acid, the 5' end of which contains a recognition sequence, and the recognition sequence does not hybridize with the extension terminator when in contact with the extension terminator; and connecting the 5' end of the adapter nucleic acid to the 3' end of the extension product to generate a labeled amplified fragment.

Description

[0001] The present application relates to the field of nucleic acid analysis and amplification.

[0002] background

[0003] US 2010 / 0273219 A1 describes a multi-primer amplification method for barcoding a target nucleic acid.

[0004] WO 2012 / 134884 A1 describes barcode identification of template nucleic acids in multiplex amplification reactions.

[0005] WO 2013 / 038010 A2 describes a method for generating an amplified nucleic acid portion of a template nucleic acid using oligonucleotide primers and terminators to prevent strand displacement and polymerase read-through used to generate a nucleic acid portion for sequencing. The method will eliminate bias in the nucleic acid amplification process.

[0006] WO 2014 / 071361 A1 describes a method for preparing a double-barcoded nucleic acid using a barcoded adapter nucleic acid.

[0007] US 2014 / 0274729 A1 describes a method for generating a cDNA library using a DNA polymerase having strand displacement activity.

[0008] EP 3 119 886 B1 describes a quantitative method for generating nucleic acid products from template RNA.

[0009] US 2018 / 163201 A1 relates to a reverse transcription method in which a C-tail is added to the 3' end of a cDNA chain.

[0010] WO 2016 / 138500 A1 describes a method for barcode identification of nucleic acids for sequencing. Stochastic (i.e., random) barcodes are used as molecular tags.

[0011] Molecular tags or unique molecular identifiers (UMIs), also known as molecular barcodes, have been developed to identify PCR replicators to reduce sequence-specific PCR bias and detect rare mutations. Unique molecular identifiers are attached to RNA molecules before any PCR amplification of sequencing library preparations, establishing a unique identity for each input molecule. This makes it possible to eliminate the effects of subsequent PCR amplification bias, which is particularly important when multiple rounds of PCR cycles are required, for example, when generating sequencing libraries from low template input amounts in single-cell studies. After PCR, molecules sharing the same sequence and the same UMI are assumed to be derived from the same copy of the same input molecule (Sena et al., Scientific Reports (2018) 8: 13121). SUMMARY OF THE INVENTION

[0013] An object of the present invention is to provide an improved method for producing sequence fragments of template nucleic acid, which makes it easy to distribute and assemble these sequence fragments into a merged sequence (joined sequence) corresponding to the template nucleic acid sequence. The desired improvement also reduces sequence deviations during fragment generation, and increases the sequence fragment coverage rate over the entire template length to increase the confidence of the merged sequence generated.

[0014] Therefore, the present invention provides a method for generating a labeled amplification fragment of a nucleic acid template, comprising the following steps: providing the template nucleic acid, annealing at least one oligonucleotide primer to the template nucleic acid; extending at least one oligonucleotide primer in a template-specific manner to generate an extension product, wherein the extension reaction stops when the extension product reaches the 5' end of the template nucleic acid or reaches a nucleic acid extension terminator that anneals to the template nucleic acid downstream of the extension product; providing an adapter nucleic acid, comprising a recognition sequence at its 5' end, wherein the recognition sequence does not hybridize with the extension terminator when in contact with the extension terminator, and preferably does not hybridize with the template; connecting the 5' end of the adapter nucleic acid to the 3' end of the extension product to generate a labeled amplification fragment.

[0015] The present invention also provides a method for generating a labeled amplification fragment of a nucleic acid template, comprising the following steps: providing the template nucleic acid; annealing at least one oligonucleotide primer to the template nucleic acid; extending the at least one oligonucleotide primer in a template-specific manner to generate an extension product; providing an adapter nucleic acid comprising a recognition sequence, wherein the recognition sequence does not hybridize with the template; and connecting the adapter nucleic acid (preferably its 5' end) to the 3' end of the extension product to generate a labeled amplification fragment.

[0016] The present invention further provides a kit suitable for implementing the method. The kit of the present invention may include at least one oligonucleotide primer that can hybridize with the template nucleic acid and trigger an extension reaction at its 3' end; one or more extension terminators that can hybridize with the template nucleic acid (preferably can trigger an extension reaction at its 3' end); one or more adapter nucleic acids that contain a recognition sequence at its 5' end, wherein the recognition sequence does not hybridize with the extension terminator, preferably the adapter nucleic acid binds, hybridizes or does not bind to the extension terminator; reverse transcriptase, and oligonucleotide ligase. Different components of the kit can be provided in different containers (e.g., vials).

[0017] The following detailed disclosure relates to all aspects of the invention, including methods and kits, and embodiments. That is, the description of the method is applicable to the kit. Any component described in the method can be part of the kit. The components of the kit can be used in the method of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0019] The invention provides a method for producing a labeled amplified fragment of a nucleic acid template, wherein a recognition sequence is introduced as a tag before amplifying these fragments. Template nucleic acid can exist in multiple copies. According to the present invention, fragmentation is typically a process occurring during amplification, that is, during the amplification of each portion of the template, one or more (typically multiple) fragments are produced from a template of a given length. When multiple copies of multiple templates are produced in the same period and the primers for synthesizing these complementary nucleic acid fragments anneal at different positions of different template copies, the sequence of the fragment produced may overlap. Although these inventive concepts are applicable to each template single fragment, it is preferred to produce multiple fragments from a template molecule, typically by using multiple primers that bind to the template at different positions.

[0020] The present invention improves the existing methods by combining the recognition sequence with the generated fragment. The recognition sequence can be introduced together with the primer or introduced after extension (synthesis of complementary nucleic acid fragments). Then, the recognition sequence is introduced by connecting the extension product to the adapter nucleic acid. Surprisingly, the ligation reaction occurs in the single-stranded recognition sequence, that is, the part with a non-hybridized (or "free") 5' end in the recognition sequence can be connected to the 3' end of the extension product. The ligation reaction usually involves a phosphate residue, which is preferably provided at the 5' end of the recognition sequence. Surprisingly, there is no need for the adapter nucleic acid to rely on the template or terminator sequence (supported by hybridization) to approach the 3' end of the extension product (as shown in the embodiment). Although this approach can be supported by providing an adapter nucleic acid with a complementary sequence portion (downstream of the recognition sequence, i.e., 3' direction), the complementary sequence portion is used to hybridize with the oligonucleotide bound to the template (also referred to as an extension terminator or abbreviated terminator herein, and can also be a further primer in the case where each template produces more than one fragment), it does not need to be directly close, but can be the result of a simple diffusion process without direction. In particular, it has been shown that an adapter nucleic acid can be connected to an extension product that has reached the 5' end of a template nucleic acid, and where there is no further downstream extension terminator. This ligation reaction can occur directly at this end of the extension product, or after the polymerase adds one or more non-template nucleotides based on its terminal transferase activity (some polymerases have). This connection to the extension product corresponding to the 5' end of the template has some surprising and beneficial advantages: it increases the fragment occurrence rate at the 5' end of the template, and thus the sequence coverage is fundamentally increased, which is lacking in the prior art methods. In previous methods, the fragment starting site distribution is constant, which results in a high coverage distribution of fragments in the middle of the template, and extremely low coverage at the 3' and 5' ends, close to zero (this is a result of the template copy number, the average fragment size, and the sequencing read length). This effect of the 5' end is mitigated by the method of the present invention. In addition, the present invention also provides an embodiment for increasing the coverage of the 3' end of the template.

[0021] The amplified fragments (generated as one fragment molecule per extension reaction) are usually further amplified, i.e. copied. This means that the connected recognition sequences are amplified and therefore also copied. Usually, the recognition sequences are so diverse that the random selection process can uniquely identify individual fragments carrying the same sequence but from different copies of a template. In all embodiments of the present invention, the recognition sequences help determine whether the fragment copies after sequencing are different copies from the template because they have different recognition sequences, or they are copies from the same template molecule and are just generated in the further amplification.

[0022] Another method provides a marker amplification fragment for generating a nucleic acid template, comprising the following steps: providing the template nucleic acid; annealing at least one oligonucleotide primer to the template nucleic acid; extending the at least one oligonucleotide primer in a template-specific manner to produce an extension product; providing an adapter nucleic acid comprising a recognition sequence, wherein the recognition sequence does not hybridize with the template; connecting the adapter nucleic acid (preferably at its 5' end) to the 3' end of the extension product, thereby generating a marker amplification fragment. This method is substantially the same as described above, and all preferred embodiments described here are also applicable, and it is safe not to use a terminator. A variety of primers that may not have a termination function can be used. After the diffusion process, the adapter nucleic acid can still be connected to the extension product. For connection, the extension product can still hybridize with the template or be a single strand. However, it is preferred to use a terminator.

[0023] The method of the present invention begins with the step of providing the template nucleic acid. The template molecule is made available to the technician for use in the method of the present invention. Generally, the template is provided in a nucleic acid molecule sample. Such template nucleic acid can be separated from a cell (e.g., a eukaryotic or prokaryotic cell). In a particularly preferred embodiment, the template is RNA. A portion of total RNA or RNA can be provided, such as RNA depleted of mRNA or rRNA of the cell. The amount of RNA that is easy to handle is, for example, 0.1 pg to 500 ng, 1 pg to 200 ng, 10 pg to 100 ng, or 0.1 ng to 100 ng rRNA depleted RNA or 0.1 ng to 1000 ng total RNA. In some embodiments, the amount of total RNA can be, for example, 10 pg, and the amount of non-rRNA RNA can be less than 1 pg. Primers, terminators, and adapters are preferably DNA.

[0024] The method further comprises annealing at least one oligonucleotide primer to the template nucleic acid. An oligonucleotide primer is an oligonucleotide molecule (preferably DNA) that anneals to a template and is capable of initiating an extension reaction, as this is standard practice in the art. An oligonucleotide primer (or simply "primer") preferably anneals to the template over at least a portion of its length (e.g., a length of 4 to 30 nucleotides (nt)). Annealing is performed by hybridization. A primer may have portions that do not anneal to the template. Such other portions may be used for annealing to other oligonucleotides and / or for further amplification when the amplified fragment is further amplified to produce copies thereof. Such other portions (parts or portions) may therefore have sequences that bind to other primers used in this amplification / replication reaction. Such portions are also referred to as primer adapter sequences. The primer adapter sequence preferably has a length of 4 nt to 30 nt.

[0025] Returning to the main inventive method, the at least one oligonucleotide primer is extended in a template-specific manner to produce an extension product (complementary sequence). Such reactions are standard in the art and usually use a polymerase. If the template is RNA, an RNA-dependent polymerase, such as a reverse transcriptase, is used. If the template is DNA, a DNA-dependent polymerase is used. When the extension reaction reaches the nucleic acid extension terminator annealed to the template nucleic acid downstream of the extension product or when the extension product reaches the 5' end of the template nucleic acid, the extension reaction stops. Obviously, when the extension reaction reaches the 5' end of the template and the template is therefore exhausted, it stops. Some polymerases may add one or more non-templated nucleotides to the extension product at this time, which is acceptable, or even when selecting 5' to cover the product in the sequence analysis of the generated marker amplification fragment, it may be beneficial. However, the addition of such non-templated nucleotides is not necessary. When the extension reaction reaches the nucleic acid extension terminator annealed to the template nucleic acid downstream of the extension product, the extension reaction also stops. This stopped reaction is detailed in WO 2013 / 038010A2 (incorporated herein by reference). In this WO document, the extension terminator is referred to as an "oligonucleotide terminator" or a "further oligonucleotide primer". According to the present invention, a term is used, namely a nucleic acid extension terminator or simply "extension terminator" or simply "terminator". The terminator of the present invention can also be a primer, which then corresponds to the "further oligonucleotide primer" of WO 2013 / 038010 A2. In essence, this terminator prevents the extension reaction of the upstream extension product by setting an obstacle on the template (therefore, this terminator is located downstream of the extension product). The terminator anneals or hybridizes with the template, and the extension reaction does not displace the terminator and is therefore terminated. Read through, that is, displacing the terminator is a side reaction. Measures to prevent terminator displacement are detailed in WO 2013 / 038010 A2, and these measures can be used according to the present invention. In short, the preferred methods and measures to prevent terminator displacement (attributed to strand displacement activity) are to use an extension terminator comprising one or more modified nucleotides, which increase the melting temperature of the annealing sequence to anneal with the template (the terminator portion annealed / hybridized with the template). The increased melting temperature refers to unmodified natural nucleic acids, such as DNA or RNA. The modification is, for example, LNA (locked nucleic acid), ZNA (zip nucleic acid), 2' fluoronucleoside / 2' fluoronucleotide or PNA (peptide nucleic acid). Other measures are the use of a polymerase without chain displacement activity or the use of an intercalator. Preferably, 1, 2, 3, 4, 5 or 6 nucleotides are modified. Preferably, the modified nucleic acid is located on the 5' side of the terminator sequence that hybridizes with the template. There may be other non-hybridized parts in the 5' direction of the terminator - for example, an amplification sequence ("primer adapter sequence") that plays the same role as the oligonucleotide primer used for amplification / replication in the further amplification reaction described above - in fact, such other parts are preferably used for binding / hybridization with the adapter nucleic acid - see below.The adapter may bind / hybridize to a "primer linker sequence" or another part of the oligonucleotide terminator. In a preferred embodiment, the extension terminator and preferably also the oligonucleotide primer comprise one or more modified nucleotides which increase the melting temperature of the annealing sequence (linker) to the template.

[0026] Preferably, after the extension reaction, primers and terminators that are not bound to the template are removed in a purification step. That is, the extension products hybridized to the template are purified and retained for further processing. Other embodiments of the present invention are carried out in a single volume without purification. Such purification can be carried out by methods known in the art, such as fixing the template or the extension product to a solid phase (e.g., beads) and washing to remove any unbound primers and terminators. An exemplary method is solid phase inverse immobilization (SPRI; DeAngelis et al., Nucleic Acids Research, 1995, 23 (22): 4742-4743).

[0027] The method of the present invention includes the step of providing an adapter nucleic acid, which includes a recognition sequence at its 5' end. Other sequence tags, such as sequences for amplification (amplification sequences), can also be part of the adapter nucleic acid. The 5' end is used to connect to the 3' end of the extension product so that it is subsequently labeled by the recognition sequence. The recognition sequence should not hybridize with the extension terminator or template. Therefore, it is usually single-stranded rather than hybridized. In this article, the term "recognition sequence" is used for the 5' end portion of the adapter nucleic acid that does not hybridize or anneal - even if only part of the recognition sequence is used for recognition later. The other parts of the adapter nucleic acid can form a hybrid with the extension terminator or anneal with it. The adapter nucleic acid can also include a complementary primer sequence as a target for further amplification reactions of the above-mentioned labeled amplification fragments (called adapter linker sequences). By selecting a sequence that is not complementary to the extension terminator for the recognition sequence, the recognition sequence can be prevented from hybridizing with the extension terminator or with the template. The recognition sequence can also be selected so that it is not complementary to the template. This is easily accomplished when the template sequence is known. If the template sequence is unknown but comes from a biological source, the recognition sequence can be selected from a sequence that is never seen or rare in biological nucleic acids. Such sequences are known to be derived from "spike-in" nucleic acids, such as ERCC (Exogenous RNA Control Consortium) sequences or SIRV (Internal Reference RNA Variant) sequences (see, e.g., ERCC, BMC Genomics 2005 6: 150; Jiang et al., Genome Res. 2011, 21(9): 1543–1551; WO 2016 / 005524A1, all incorporated herein by reference). If the recognition sequence would anneal to the template in a side reaction, this would typically prevent the next step of ligation, and thus no labeled fragments would be produced, and therefore would not be considered as a result. This side reaction is tolerable, but not preferred. The simplest and most preferred method to prevent the recognition sequence (and preferably the entire adapter nucleic acid) from annealing to the template is to simply provide the adapter nucleic acid after the extension reaction. After the extension reaction, the template is in a double-stranded form with the extension product (as well as the primer and terminator). In this form, the adapter nucleic acid can no longer bind to the template because the template has been covered by the hybridization partner. In this preferred method, the recognition sequence may even have a sequence complementary to the template and may be able to hybridize to the template, but be blocked by subsequent method steps. Thus, the template sequence need not be considered in this embodiment.

[0028] The most preferred option to prevent the recognition sequence from annealing to the terminator is that the part of the terminator and the part of the adaptor carry complementary sequences to each other, because when the adaptor approaches the terminator, the complementary sequence hybridizes first and the recognition sequence remains in a single-stranded state.

[0029] The method of the present invention also includes connecting the 5' end of the adapter nucleic acid to the 3' end of the extension product, thereby producing a labeled amplified fragment. The connection is usually carried out using a ligase. The type of ligase depends on the properties of the oligonucleotide to be connected and can be selected by a skilled practitioner. Exemplary ligases include DNA ligases or RNA ligases. Ligase can also be an RNA ligase, especially an RNA ligase with DNA ligation activity, such as T4 RNA ligase 2. Other ligases are T4 DNA ligase, T4 RNA ligase 1, DNA ligase I, DNA ligase III, DNA ligase IV, Escherichia coli DNA ligase, Ampligase DNA ligase, truncated Rnl2, Rnl2 truncated K227Q, Thermus scotoductus ligase, thermophilic autotrophic methanobacterium (Methanobacterium thermoautotrophicum) RNA ligase, thermostable App-ligase (NEB), Chlorella (Chlorella) virus DNA ligase or SplintR ligase. Ligase can be a single-stranded ligase or a double-stranded ligase. Ligase for different reactions can also be combined in one reaction volume for parallel reactions, for example, when different extension products and / or adapter nucleic acid molecules are present and need to be connected simultaneously. Preferred combinations are DNA ligase and RNA ligase or single-stranded ligase and double-stranded ligase. Ligase reactions generally involve a phosphate residue, which is preferably provided at the 5' end of the recognition sequence of the adapter nucleic acid. Other 5' half molecules (moieties) can also be used for connection, for example, connection of adenylated ends. This can be connected with truncated ligase or App-ligase.

[0030] The generated tagged amplified fragment has a structure after connection from 5' to 3': primer sequence-extension product sequence-adapter sequence (with identification sequence bordering the extension product sequence). The primer sequence may have a "primer adapter sequence" and / or the adapter sequence may have an "adapter adapter sequence". The product of the method of the present invention, i.e., the generated tagged amplified fragment, is preferably further amplified. Such further amplification produces a copy of the resulting tagged amplified fragment by methods known in the art, such as PCR (polymerase chain reaction) or linear amplification. Such further amplification generally involves the use of further primers that bind to the tagged amplified fragment, preferably on the adapter sequence, especially the adapter sequence located at the end of these fragments, i.e., within the portion of the primer sequence and the adapter sequence, particularly preferably at the 5' end of the primer sequence and the 3' end of the adapter sequence. As described above with respect to these primers and adapters, they may have regions of known sequence to bind to such primers ("primer adapter sequence" and "adapter adapter sequence") for further amplification. These regions (or "parts") may be long and specific and unable to bind to the template; they may be universal primer binding sites, i.e., not selective between different adapters / primers - in contrast to recognition sequences, which are preferably unique. The recognition sequence provides a unique tag for the amplified fragment, and is therefore also referred to herein as a unique molecular identifier (UMI). The recognition sequence can identify the replicator of the further amplification (e.g., PCR) and reduce the impact of sequence-dependent amplification bias. In a preferred embodiment, the recognition sequence is an oligonucleotide (mainly having a random nucleotide distribution at each position) that is connected to the extension product (fragment) before further amplification. If the recognition sequences are evenly distributed and their number is much greater than the number of identical extension products, then the same recognition sequence is unlikely to be connected to two identical extension products (different copies). In this case, the number of distinct recognition sequences after further amplification is the same as the number before further amplification. The recognition sequence of the present invention can also be used as described by Sena et al. for UMI (Scientific Reports (2018) 8: 13121). In the next generation sequencing method and further sequence analysis, the entire sequence of the marker fragment or some parts of the entire sequence can be regarded as a "read value (read)". One or more read values ​​are assembled during data analysis to obtain the merged sequence of the template. Subsequently, the data analysis may also become a quantitative analysis of template molecules and fragments, which may provide insights when specific template copies are over-represented or under-represented, thereby, for example, suggesting different expression rates of RNA splice variants. In a preferred embodiment, the present invention further includes the step of assembling the sequence of unique amplified fragments, wherein the markers are used to identify the unique amplified fragments. Different recognition sequences in the amplified marker amplified fragments identify the unique amplified fragments.The recognition sequences enable duplicate and replicate identification and removal during assembly or any other data analysis step.

[0031] In a preferred embodiment, the length of the recognition sequence is 3 nt (nucleotide) or longer, preferably 3 nt to 20 nt, particularly preferably 4 nt to 15 nt or 5 nt to 10 nt, for example 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt or longer. Such a length is small enough for an easy-to-operate effective ligation reaction, but can provide a sufficiently large number of different recognition sequences due to their nucleotide arrangement, so that the desired recognition of individual amplified fragments can be performed, preferably providing their unique labels.

[0032] In a preferred embodiment, when the extension product reaches the 5' end of the template nucleic acid, the nucleotide polymerase is allowed to add non-templated nucleotides to the extension product, preferably by the terminal transferase activity of the polymerase, and / or preferably wherein 1 to 15 non-templated nucleotides are added in at least 70% of the extension products. As described above, such non-templated nucleotide addition is a property of some polymerases (see Chen et al., Biotechniques 2001, 30(3):574–582). This activity is most prominent in reverse transcriptases, such as M-MLV (murine leukemia virus) reverse transcriptase or AMV (alfalfa mosaic virus) reverse transcriptase. These non-templated nucleotides are typically any nucleotide type (A, T (U), G, C) and may appear randomly. This means that the extension products of the 5' ends of different templates may share the same sequence corresponding to the 5' end, but may then continue with different, seemingly random other nucleotides that are the products of such non-templated additions. These different additions can be used to identify the exact position of the 5' end of the template sequence at the transition between the templated repeat sequence and the non-templated random addition. After the non-templated nucleotides, the labeled fragments are followed by a recognition sequence (which can be used as described above). In the case where the recognition sequence is (also) random, the non-templated random nucleotides can be considered as part of the recognition sequence. The position of the recognition sequence relative to the constant part of the adapter sequence unambiguously identifies the recognition sequence.

[0033] In a particularly preferred embodiment, a variety of adapter nucleic acids are provided and used in the connection step. The various adapters may have different recognition sequences. This allows unique identification of adapters and the generated fragments to which they are connected. Preferably, at least 10, more preferably at least 50, or even 100 or more or 200 or more adapter nucleic acids with different recognition sequences are provided and used in the connection step. It is particularly preferred that the more adapters with different recognition sequences are used, the more it is expected to generate different fragments with the same sequence - or preferably more adapters with different recognition sequences. The expectation of the template copy number can be based on the sample type, such as whole cell RNA, whole cell mRNA (transcriptome), RNA amount, and the complexity of the sample (how many different transcript variants are targeted, which can be the entire transcriptome, or just selected genes or transcripts, as in the case of gene panels), etc.

[0034] Particularly preferably, the recognition sequence is a random sequence. "Random sequence" should be understood as a mixture of highly inconsistent different sequences due to the random synthesis of at least a portion of the recognition sequence. The random sequence may cover the entire combination region of the 4 natural nucleotides (A, T (U), G, C) of the sequence. The random sequence may cover 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more nucleotides randomly selected from A, G, C or T (U). With regard to the hybridization ability of the sequence of nucleotides, T and U are used interchangeably in this article. The total possible region of the random sequence portion is m n , where m is the number of nucleotide types used (preferably all four A, G, C, T (U)), and n is the number of random nucleotides. Thus, a random hexamer (in which every possible sequence is represented) consists of 4 6 =4096 different sequences. The recognition sequence should not bind to the template. In all cases, but especially for random recognition sequences, it is preferred to add the adapter nucleic acid after the extension reaction. When the extension product reaches the terminator (or template end) and substantially the entire template then forms a double-stranded form with the extension product, the adapter nucleic acid is prevented from binding to the template.

[0035] In a further embodiment of the present invention, primers and terminators are selected to bind to one or more specific target sequences in the template nucleic acid (the terminator is located downstream of the extension product), thereby obtaining an extension sequence of a specific template portion. This targeting of a specific region is preferably used when a transcript (RNA) or a gene (gDNA) is used as a template. When used in a gene detection combination, the recognition sequence is particularly useful. For example, it is used to analyze sequence variants of different types of templates, such as splice variants or other changes in the template sequence.

[0036] In the particularly preferred embodiment of all embodiments of the present invention and aspects, the extension terminator has primer activity and is also extended during the extension step. This means that more than one primer is used, and most of the primers have terminator function (i.e., prevent displacement-see above). Using multiple primers means that a template will produce multiple fragments, i.e., the coverage rate is improved. Although each of the multiple primers is combined with a template, when different primers are combined with the different positions of the template, they will provide comprehensive coverage. The method of the present invention using multiple primers (preferably also terminators) will increase the coverage rate, because the new extension product will start at the position where the upstream extension product on the template has just stopped. This will produce many fragments covering the entire template. In addition, this also means using terminators / primers (synonymically used in this embodiment) combined with different parts of the template molecule. Usually, the combination with the template molecule is determined by the annealing sequence of primers and terminators. This sequence hybridizes with the template and can be changed to combine with the different positions on the template. Preferably, at least 9, at least 10, more preferably at least 49, at least 50, for example 100 or more or 200 or more extension terminators are used, and they have different annealing sequences for annealing to the template. Therefore, they may anneal to different positions of the template nucleic acid. Preferably, the annealing sequence is a random sequence. The random sequence is described above for the recognition sequence, and those descriptions are also applicable to the annealing sequence of the primer, the annealing sequence of the terminator, and the annealing sequence of the terminator with the primer function. Preferably, the random sequence of the annealing sequence can cover 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more nucleotides randomly selected from A, G, C or T (U).

[0037] Preferably, the adapter nucleic acid is bound, hybridized or not bound to the extension terminator. This binding reaction, such as a binding reaction achieved by chemical reaction, complex formation or hybridization, helps the adapter nucleic acid to be positioned near the 3' end of the upstream extension product, while its recognition sequence itself does not hybridize with the terminator or template and surprisingly is not necessary for the ligation reaction to proceed normally. Preferably, when the adapter nucleic acid is bound or hybridized to the extension terminator, a recognition sequence can be selected that is independent of the extension terminator annealing sequence used to anneal the extension terminator to the template. Both the annealing sequence and the recognition sequence can be random sequences, preferably selected independently of each other. This is usually guaranteed when the nucleic acid portions of the terminator and the adapter are universal sequences, that is, any adapter can be bound to any terminator (which is preferred for all embodiments of the present invention), and the terminator is no longer bound by another adapter nucleic acid, such as when the adapter is only provided after the extension reaction. In other embodiments or other parts of the reaction, they do not bind, for example when the extension reaction reaches the 5' end of the template, where there is usually no terminator to hybridize to, because the terminator requires at least a minimal annealing sequence on the template, which moves the most downstream termination position a few nucleotides upstream from the 5' end. The adapter can also be connected to the extension product without binding or hybridizing to the extension terminator. However, it is preferred in all embodiments that when the adapter nucleic acid is connected to the extension product, the extension terminator and / or the extension product, particularly preferably its 3' end, is still hybridized to the template. It is also preferred that the adapter nucleic acid hybridizes to the extension terminator, particularly preferably after the extension reaction and / or - particularly preferably - for connection.

[0038] In a preferred embodiment of the method and kit of the invention, the oligonucleotide primers - and preferably but not necessarily also the extension terminator - comprise a universal amplification sequence ("primer adapter sequence", see above) and / or wherein the adapter nucleic acid comprises a universal adapter amplification sequence ("adapter adapter sequence", see above). This amplification sequence or "adapter" can be used to bind to the primers used for further amplification as described above. A universal sequence means that it is the same for all primers, for all terminators or for all adapters, respectively. This allows the same primer type to be bound to these oligonucleotides. In a particularly preferred embodiment, the universal amplification sequence (adapter sequence) is also the same for primers, terminators and adapters, i.e. another amplification primer can be bound to the oligonucleotide primer, the extension terminator and the adapter nucleic acid in the same manner. This contributes to simple operation, since only one type of primer is required for further amplification. In other embodiments, primers, terminators and adapters have different universal amplification sequences (adapter sequences), i.e. one further amplification primer can be bound only to the oligonucleotide primer, another further amplification primer can be bound only to the extension terminator, and yet another further amplification primer can be bound only to the adapter nucleic acid. In these sets, the primers are preferably all universal. This still allows simple handling but better control, since the primers at both ends of the tagged fragment will be different and can be specifically chosen.

[0039] In a preferred embodiment, a specific oligonucleotide primer is used to select and anneal to a selected sequence of the template (preferably at the 3' end of the template). In the case of mRNA or any other type of RNA comprising an oligo(A) tail, such a 3' end can be annealed to a complementary oligonucleotide primer, for example, the primer comprises an oligo(dT) annealing sequence complementary to the oligo(A) tail. Preferably, at least one oligonucleotide primer comprises an annealing sequence that anneals to a selected sequence of the template (which may be located at or near the 3' end of the template). Such a selected sequence is any known sequence of the template, such as an oligo(A) tail, but any other sequence may also be used once known. Preferably, the oligonucleotide primer of the selected sequence comprises an oligo(dT) sequence that anneals to an oligo(A) sequence in the template. Preferably, the oligo(dT) sequence comprises one or more 3' anchoring nucleotides that are different from the oligo(dT) sequence. This allows correct positioning and binding to the 5' end of the oligo(A) template sequence. The anchor nucleotide will anneal with the next non-A (e.g., T, G, C) immediately following the oligo (A) portion on the template. If the next non-A nucleotide is unknown, a mixture of oligonucleotide primers and different anchor primers can be used, for example, three oligonucleotide primers are used, each of which has a non-T (e.g., A, G, C) nucleotide (complementary to the next non-A (e.g., T, G, C) on the template). In a preferred embodiment, two anchor nucleotides are used. The anchor nucleotide immediately following the non-T nucleotide can be selected from any nucleotide type (A, T (U), G, C) because it is not adjacent to the oligo (T). The specific oligonucleotide primer may not be a terminator and may not contain a sequence that hybridizes with an adapter, because if the specific oligonucleotide primer is annealed to the 3' end of the template or close to the 3' end of the template, these sequences are not needed - this means that there will be no upstream extension product arriving at its position. Of course, for the convenience or uniformity in the production of primers / terminators, such sequences and / or terminator functions may exist.

[0040] Preferably, the ligation reaction is carried out in the presence of a crowding agent. Crowding agents increase the likelihood of interaction between adapters and extension products by reducing the effective reaction volume, see Zimmerman et al., Proc Natl Acad Sci US A. 1983; 80(19): 5852-6. Other crowding agents are disclosed in, for example, US5,554,730, US 8,017,339 and WO2013 / 038010 A2. Preferably, the crowding agent is a macromolecule, a polymer or a complex comprising a polymer, such as a polyalkylene glycol, preferably PEG, Octoxinol or Triton X, or a polysorbate, preferably Tween. In a preferred embodiment, the crowding agent is used at a concentration of 5% to 35% (v / v), particularly preferably 10% to 25% (v / v). Preferably, the molecular weight of the crowding agent is 200 to 35000 g / mol, preferably 1000 to 10000 g / mol. Particularly preferred are polyalkylene glycols, such as PEG, especially having said molecular weights.The crowding agent is preferably provided in the kit of the invention, preferably in the ligation buffer.

[0041] Other components of the kit include buffers, salts, enzyme cofactors, and metals (e.g., Mn for polymerases and ligases). 2+ and Mg 2+ ), solvent, container.

[0042] The present invention provides a kit for performing the method of the present invention. Such a kit may comprise any of the compounds and tools described so far. Preferably, the kit comprises (i) at least one oligonucleotide primer capable of hybridizing with a template nucleic acid and initiating an extension reaction at its 3' end, (ii) one or more extension terminators capable of hybridizing with a template nucleic acid, preferably capable of initiating an extension reaction at its 3' end, (iii) one or more adapter nucleic acids comprising a recognition sequence at its 5' end, wherein the recognition sequence does not hybridize with the extension terminator, preferably wherein the adapter nucleic acid is bound, hybridized or not bound to the extension terminator, (iv) a reverse transcriptase, and (v) an oligonucleotide ligase, (iv) and (v) may be optional, as they are available in many laboratories independent of the present invention. The important part is the design of the adapter / terminator, in particular the recognition sequence on the adapter. Preferably, a variety of adapters with different recognition sequences are provided in the kit - as described above. All of these components in the kit have been described above, and any preferred embodiments thereof are also applicable to the kit. Preferably, the kit comprises at least 10, more preferably at least 50 adapter nucleic acids with different recognition sequences. The reasons for such a preferred embodiment have been given above. Preferably, the oligonucleotide primer comprises an annealing sequence that anneals to the template, which comprises an oligo(dT) sequence that anneals to an oligo(A) sequence in the template, preferably wherein the oligo(dT) sequence comprises one or more 3' anchoring nucleotides that are different from the oligo(dT) sequence. The kit may also comprise a solid phase for purification, such as beads, preferably magnetic beads (see above for method details, and for applicability and embodiments of kit composition).

[0043] All of the preferred embodiments described above can be combined. One such method uses a random primer (with an adapter sequence) that is also a terminator (also referred to as a "chain displacement termination primer"). After the extension reaction, purification of the extension product (hybridized with the template) is preferably performed to remove unbound primers and terminators. Then an adapter with an adapter and a recognition sequence is connected to the extension product. The recognition sequence has a random sequence preferably 4 to 12 nt in length. A preferred option is to use a mixture of recognition sequences of different lengths, because the ligase tends to impose a connection bias by preferring certain 5' nucleotides at the last and penultimate positions. Since such biases affect the read quality in sequencing, such mixtures will balance the nucleotide distribution when sequencing across the junction region. However, variable recognition sequences provide more unbiased connections than any other determined sequence, and are also used as UMIs (unique molecular indexes). Recognition sequences (such as UMIs) allow determination of whether sequencing read values ​​belonging to minor sequencing errors that have the same sequence or are mapped to the same position in the reference sequence are from different template molecules or from the same template molecule, and are simply the result of further amplification (PCR repetition). The adapter hybridizes with the primer when present.

[0044] Identifier sequences (such as UMIs) can also distinguish true SNPs (single nucleotide polymorphisms) between individuals from errors (mutations) introduced during reverse transcription or in early PCR cycles (and subsequently amplified). All of these randomly occurring and amplified errors should have the same identifier, while "true SNPs" within a sample have a variety of different identifiers. Alternatively, RNA editing events that introduce modified bases during RT, leading to misincorporation and therefore introducing errors, can be quantified more reliably.

[0045] Identification sequences (such as UMIs) can also be used to reliably determine and quantify allele frequencies, molecular markers, and causative mutations of genetic diseases in a population. Preferably, a DNA template is used in this embodiment.

[0046] A further preferred combination is the method of the invention, wherein at least one, preferably at least 9, extension terminators have primer activity and are also extended during the extension step, and at least two, preferably at least 10, adapter nucleic acids comprising different recognition sequences are used, thereby generating at least two, preferably at least 10 different marker fragments, optionally amplifying the marker fragments, further comprising assembling the sequence of unique amplified fragments, wherein the markers are used to identify the unique amplified fragments. Different markers in the amplified marker fragments can be used to identify the unique amplified fragments.

[0047] A further preferred method uses a terminator with a primer function. It is preferred to use a plurality of such primers. In such a method, terminators and primers are not distinguished, and one embodiment of the present invention can be defined as follows: a method for producing a labeled amplification fragment of a nucleic acid template, comprising providing the template nucleic acid; annealing a plurality of oligonucleotide primers to the template nucleic acid; extending the oligonucleotide primers in a template-specific manner to produce a plurality of extension products, wherein the extension reaction terminates when the extension product reaches the 5' end of the template nucleic acid or reaches the oligonucleotide primer annealed to the template nucleic acid downstream of the extension product; providing a plurality of adapter nucleic acids containing a recognition sequence at their 5' end, wherein the recognition sequence does not hybridize with the oligonucleotide primer or the template; connecting the plurality of adapter nucleic acids at their respective 5' ends to the 3' end of the extension product, thereby producing a plurality of labeled amplification fragments. This is a preferred embodiment that can be combined with the claims and any of the specifically described aspects described above. All of the above descriptions of terminators apply to the primers in this embodiment, because these primers are terminators with primer functions. The term "multiple" is used for oligonucleotide primers, extension products (the result of primer extension), adapter nucleic acids, and labeled amplified fragments (the result of extension and adapter ligation). As noted, the amount of some of these pluralities is a result of the present method. The amounts of oligonucleotide primers and adapter nucleic acids can be selected - as described above. Their amounts can be selected independently, but are preferably approximately the same so as to be paired with a given extension product. Preferably, the plurality is, for example, 10 or more, 50 or more, 100 or more, 200 or more, etc. Many different oligonucleotide primers and adapter nucleic acids can be used: for the binding of oligonucleotide primers to multiple different positions on the template, for making the adapter nucleic acids have different recognition sequences, preferably unique recognition sequences of labeled amplified fragments. Although the primers and terminators are the same in this embodiment, special primers that do not require (but may have) terminator function can also be added, such as 5' end specific primers, just like the above-mentioned oligo (A) targeting primers.

[0048] The invention is further illustrated in the following figures and examples, but is not limited to these embodiments of the invention.

[0049] Attached pictures:

[0050] Figure 1 : Schematic diagram of the creation of a UMI-adapter-tagged short cDNA library using primers with SDS properties and adapter oligonucleotides containing partially complementary UMIs inside the RNA body.

[0051] a) The universal chain displacement termination primer Pn hybridizes to the RNA transcript, and primer Pn+1 hybridizes to a more upstream (5') position of the template RNA than primer Pn. When the reverse transcriptase extends Pn to primer Pn+1, the polymerase reaction will be terminated by the chain displacement termination technology described in WO 2013 / 038010 A2. An adapter oligonucleotide containing a UMI hybridizes to primers Pn and Pn+1, and the adapter oligonucleotide also contains L2 that is complementary to L1. b) During the ligation process, the extension product is now connected to the UMI in front of the L2 strand of the adapter. In this way again, a cDNA library is created, which has two adapter sequences (L1, L2) located at the ends and contains a unique molecular identifier. c) Finally, PCR is performed to amplify these libraries.

[0052] Figure 2 : Generate a library containing UMI

[0053] Figure 2 a) shows the library generated by the SDS+ligation method. The partially complementary L2 adapter containing the UMI (ref. Figure 1 ) can be connected using single-strand (ss) ligase or double-strand (ds) ligase (lanes 2, 3). No library is generated when the ligase is omitted (lane 1). After ligation, the cDNA fragments containing the L1 and L2 adapters are amplified by PCR and analyzed. A gel photo of the HS DNA Assay run on the Bioanalyzer (Agilent Technologies, Inc.) is shown. b) Schematic diagram of the generation of a UMI-containing library using the SDS+ ligation method and non-hybridizing initiator and adapter oligonucleotides. In this case, the adapter oligonucleotide L2' does not contain a sequence complementary to the extension initiator Pn. c) Gel photo and electropherogram of the replicon library generated using a non-hybridizing extension initiator and a UMI-containing adapter oligonucleotide (SEQ ID No.10). Photos are from the HS DNA Assay run on the Bioanalyzer (Agilent Technologies, Inc.).

[0054] Figure 3 : Improved coverage of the 5' end of transcripts is achieved by ligating an L2 adapter to the cDNA at the 5' end of the RNA template.

[0055] a) Schematic representation of the reverse transcription (RT) reaction at the 5' end of the transcript. Without the SDS introduced by the downstream primer Pn+1, the terminal deoxynucleotidyl transferase activity (TdT) of the RT adds non-templated nucleotides to the 3' end of the cDNA, thereby generating an overhang. b) The non-templated nucleotides (nt) can serve as hybridization sites for the primer Pn+1 containing L1. Together with the partially hybridized L2, ligation of the UMI-L2 adapter can occur in the double strand. c) Alternatively, in the absence of primer priming, the UMI-L2 adapter can be ligated as a single strand. d) Press Figure 3 The libraries generated as shown in (a-c) were sequenced on an Illumina NextSeq 500 (single read, 75 bp). Read values ​​for 5' end mapping of ERCC-0130 are shown (found in SIRV set 3, Lexogen catalog #051.0N). The read values ​​were analyzed without trimming added bases and mismatched bases. Nucleotides marked in gray correspond to the ERCC-0130 annotation code, and nucleotides shown in black are non-templated additions due to the TdT activity of RT. Thirty representative sequences of read values ​​obtained from the 5' end of ERCC-0130 are shown below. The read sequences are SEQ ID NO: 12 to 42, from top to bottom. e) The SDS / ligation method improves 5' end coverage compared to traditional protocols. Using conventional protocols ( Ultra TM II directional RNA Library Prep Kit for Libraries were prepared using either the conventional RNA library preparation protocol (New England Biolabs, catalog number E7760S) or the SDS / ligation method and sequenced on an Illumina NextSeq 500 (paired-end reads, 150 bp). Reads mapped to ERCC-0130 were overlaid and compared to the expected coverage values ​​shown as rectangles, left: conventional RNA library preparation protocol, right: coverage obtained using the new SDS / ligation technique.

[0056] Figure 4 : Schematic diagram of the reaction using the SDS / ligation method and the combination of a universal primer (Pn) and an oligo-dT primer (PdT) for improving 3' end coverage.

[0057] a) Universal primer Pn hybridizes to the RNA template inside the RNA body. In addition, the existing oligo-dT primer (PdT) hybridizes to the poly(A) tail at the 3' end of the polyadenylated transcript. RT will extend PdT until it reaches the downstream primer Pn and stops strand displacement. b) During the ligation process, the L2 adapter containing the UMI is ligated to the cDNA fragment across the 3' end, generating a cDNA library covering the 3' end of the transcript, connecting L1 and L2, and containing the UMI. c) Genome coverage mapping shows increased coverage of the 3' end of the transcript across the transcriptome. The library was prepared using the SDS+ ligation protocol and a mixture of random primers and oligo-dT first-strand synthesis primers (as described in Example 3). The library was sequenced on a NextSeq 500 machine, and the genome coverage profile of the entire transcriptome was mapped and compared with the aforementioned SDS+ ligation protocol. d) Exemplary coverage of an endogenous housekeeping gene (HSP90) for conventional library preparation (top) and the SDS+ligation protocol (bottom) with oligo-dT titration resulting in improved 3' end coverage.

[0058] Figure 5 : Overall improvement in 5' and 3' coverage of transcripts. The transcription start site (i.e., the true 5' end of the transcript) and transcript stop site (i.e., the true 3' end of the transcript) were resolved using the SDS+ligation protocol, but not using the two exemplary conventional library preparation methods. Figure 3 Libraries generated with the SDS+ligation protocol shown in Figures ac) were sequenced on an Illumina NextSeq 500 (paired end, 150 bp). Conventional libraries were prepared using TruSeq Stranded Total RNA Library Prep Human / Mouse / Rat, Illumina catalog number 20020596 or 20020597 according to the instructions (= Conventional 1) or using Ultra TM II directional RNA Library Prep Kit for New England Biolabs, catalog number E7760S prepared according to the instructions (= Conventional 2). a) Reads mapped to the true 5' and 3' ends of the detected ERCC are shown (found in SIRV set 3, Lexogen catalog number 051.0N). The reads were mapped to the ERCC internal reference RNA of known sequence. The normalized coverage of the cumulative mapped reads of all detected ERCCs is plotted as the absolute nucleotide position relative to the transcription start site (TSS) and transcription end site (TES), marked by dotted lines. b) Extended 5' coverage reveals all TSSs. Top: Abbreviated intron-visual gapdh coverage map, generated using the SDS+ligation protocol or conventional library preparation as described above. b) Reads mapped to gapdh were analyzed without trimming of added bases and mismatched bases. The read sequences are SEQ ID No.43 to 67 from top to bottom. Nucleotides labeled in black correspond to the gapdh annotation code, nucleotides shown in gray are mismatches or non-templated additions due to the TdT activity of the RT. Start site clusters generated by stacking reads from the 5' end of the transcript can be used to re-annotate the TSS. Annotated and manually determined TSSs are indicated by arrows at the annotated consensus sequence shown in bold black. Example:

[0059] Example 1: Linking of unique molecular identifiers (UMIs) to first-strand cDNA fragments.

[0060] Libraries were prepared from Universal Human Reference RNA (Agilent Technologies, Catalog #740000) containing SIRV Set 3 Internal Control Mix (Lexogen, Catalog #051.0N) according to the manufacturer's instructions.

[0061] After cDNA synthesis, a downstream primer (Pn+1(L2)) containing a unique molecular identifier of 2 to 24 nucleotides, preferably 6 to 12 nucleotides in length can be ligated to the newly transcribed cDNA strand (in the hybrid with the template RNA). Reverse transcription is performed using the oligonucleotides, templates and conditions described in WO 2013 / 038010 A2. Various ligases and combinations thereof can be used to ligate the following oligonucleotides:

[0062] SEQ ID No: 1: (phosphorylated) (5'-NNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3' (3 inverted dT)),

[0063] SEQ ID No: 2: (phosphorylated) (5'-NNNNNNNNNNAGATCGGAAGAGCACACGTCTGAA-3' (3 inverted dT)),

[0064] SEQ ID No:3: (phosphorylated) (5'-NNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG-3' (3 inverted dT)),

[0065] SEQ ID No:4: (phosphorylated) (5'-NNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGG-3' (3 inverted dT)),

[0066] SEQ ID No: 5: (phosphorylated) (5'-NNNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG-3' (3 inverted dT)),

[0067] SEQ ID No:6: (phosphorylated)(5'-NNNNNNNNNNNNGAATCGGAAGAGCGTCGTGTAGGGAAAGAGTG-3'(3 inverted dT)),

[0068] SEQ ID No:7: (phosphorylated) (5'-NNNNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGG-3' (3 inverted dT)),

[0069] SEQ ID No: 8: (phosphorylated) (5'-+NNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGG-3' (3 inverted dT)),

[0070] SEQ ID No: 9: (phosphorylated) (5'-+NNNNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGG-3' (3 inverted dT)).

[0071] After reverse transcription (RT), samples were purified using solid phase reversible immobilization (SPRI) and magnetic purification beads (AMPure Beads; Agentcourt) according to the manufacturer's instructions. cDNA: RNA hybrids were eluted in 20 μl of water or 10 mM Tris, pH 8.0, and 17 μl of supernatant was transferred to a new PCR plate. Then, ligation reactions were performed in 60 μl using 20% ​​PEG-8000, 50 mM Tris-HCl (pH 7.5, 25°C), 10 mM MgCl2, 5 mM DTT, 0.4 mM ATP, 0.01% Triton-x100, 50 μg / ml BSA, and 20 units of ligase (single-strand specific ligase and / or double-strand specific ligase). Unligated small fragments and remaining oligonucleotides were removed by SPRI purification. All remaining primary cDNA libraries were amplified in PCR reactions using a high-fidelity polymerase and the following program: 98°C for 30 seconds, followed by 10-25 PCR cycles of 98°C for 10 seconds, 65°C for 20 seconds, and 72°C for 30 seconds. The final extension was performed at 72°C for 60 seconds. Figure 1 b) shows the basic principle of ligating the extended cDNA to a UMI-containing adapter oligonucleotide (L2) with complementary sequence to the strand displacement terminator primer (L1).

[0072] Figure 2 The examples in show that various ligases can perform ligation reactions of oligonucleotides containing UMIs and thereby generate cDNA fragments containing two PCR adapters that can be amplified by PCR ( Figure 2 a), lanes 2-3). In contrast, a control experiment omitting any ligase showed no library amplification, emphasizing the specificity of the above reaction ( Figure 2 a), lane 1).

[0073] Example 2: Generation of libraries using non-hybridizing extension initiator and adapter oligonucleotides.

[0074] Libraries were prepared from Universal Human Reference RNA (Agilent Technologies, Catalog #740000) containing SIRV Set 3 Internal Control Mix (Lexogen, Catalog #051.0N) according to the manufacturer's instructions.

[0075] Reverse transcription (RT) was performed as described in Example 1. Following RT, samples were purified using solid phase reversible immobilization (SPRI) and magnetic purification beads (AMPure Beads; Agentcourt) according to the manufacturer's instructions, the purified cDNA:RNA hybrids were eluted in 20 μl of 10 mM Tris, pH 8.0, and 17 μl of the supernatant was transferred to a new PCR plate. Ligation was performed using the conditions described in Example 1, but the adapter oligonucleotides provided did not contain a sequence complementary to the extension initiator used to prime the reverse transcription reaction. In this way, the oligonucleotide adapters were unable to hybridize and therefore would not be recruited close to the 3' end of the newly generated extension product ( Figure 2 b)). The oligonucleotide SEQ ID No. 10: (phosphorylated) (5'-NNNNNNNNNNNNTGGAATTCTCGGGTGCCAAGG-3' (SpcC3)) does not have sequence complementarity with the extension initiator. The fragment containing the two adapter sequences was amplified as described in Example 1 after clean-up. Figure 2 c) Gel photograph and electropherogram showing library tracking of two replicon SDS+ ligation libraries generated using non-hybridizing extension initiator and adapter oligonucleotides.

[0076] Example 3: Improved 5' end coverage due to terminal transferase activity and ss ligation of UMI-adapters to first strand cDNA fragments.

[0077] Libraries were prepared from Universal Human Reference RNA (Agilent Technologies, Catalog #740000) containing SIRV Set 3 Internal Control Mix (Lexogen, Catalog #051.0N) according to the manufacturer's instructions.

[0078] First-strand cDNA synthesis terminates at the 5' end of the template RNA molecule. The terminal transferase activity of reverse transcriptase catalyzes the non-templated addition of nucleotides to the 3' end of the cDNA strand ( Figure 3 a).

[0079] After reverse transcription, ligation of UMI-adapter oligonucleotides (e.g., SEQ ID 1-9) can occur during duplex formation ( Figure 3 b) and at single-stranded overhangs ( Figure 3 c). After SPRI purification and PCR amplification, the library was sequenced on NextSeq 500 in single read or paired-end mode. Reads mapped to the 5' end of ERCC-0130 were analyzed without prior trimming of mismatched nucleotides. Reads covering the 5' end of ERCC-0130 are exemplarily shown in Figure 3d. Addition of terminal nucleotides and UMI ligation on the extended single strand results in improved 5' coverage. A comparison of the coverage of conventional RNA-seq library preparation and the present invention is shown in Figure 3 e. Coverage can be seen as a superposition of all aligned reads (traces shown in grey) and compared to the expected uniform coverage shown as rectangles. In sequencing data from conventional protocols, both the 5' and 3' ends are covered less efficiently, evident in the slopes towards either end ( Figure 3 e, left), while the new protocol generates more reads mapped to the extreme 5' end of the transcript ( Figure 3 e, right).

[0080] Example 4: Improvement of 3' end coverage via titration of oligo-dT first strand synthesis primer.

[0081] The coverage of the 3' end of the transcript can be altered, preferably increased, by using first-strand primers containing oligo-dT (Pn containing L1) that are added to a mixture of random priming SDS oligonucleotides that already contain a portion of T-rich priming sequences and T-only priming sequences based on the normal distribution of random nucleotides (e.g., SEQ ID No: 11 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT+TTT TTT TTT TTT TTT TTT+V-3') to increase the coverage of the 3' end. Depending on the selection ratio between random primers and poly-dTL1 primers, the change in sequencing depth of the 3' end site can be predicted ( Figure 4 ). The ratio of random SDS primers to specific oligo dT primers, as well as primer length and LNA content may be varied and will determine the amount of over-representation of the 3' end.

[0082] Libraries were prepared by SDS+ligation using either random primed displacement stop primers alone or in mixtures with various amounts of oligo-dT first strand primer (SEQ ID No: 11). The resulting libraries were sequenced on NextSeq500, data analyzed, and transcriptome-wide gene body coverage maps were generated from mapped reads using the geneBody_coverage python script available from rseqc ( Figure 4 c) 3' end coverage can be significantly increased by adding an oligo-dT primer during reverse transcription.

[0083] In addition, gene coverage of endogenous genes was exemplarily observed using a custom script to assess the coverage of individual genes. Figure 4d shows the coverage of the housekeeping gene HSP90 obtained with a conventional RNA library preparation protocol (top), where the 5' and 3' ends are grossly underrepresented. In contrast, the oligo-dT titrated SDS ligation protocol shows improved 5' and 3' coverage (bottom).

[0084] Example 5: Improved 5' and 3' coverage helps determine the true transcript start and end sites.

[0085] SDS+ ligation libraries were prepared from ribo-depleted universal human reference RNA (Agilent Technologies, catalog #740000) containing SIRV Set 3 internal control mix (Lexogen, catalog #051.0N) as described in Examples 3 and 4. Ribosomal RNA removal was achieved using RiboCop (Lexogen, catalog #037.96) as per the manufacturer's instructions. For comparison, two conventional library preparation methods used the same ribo-depleted universal human reference RNA: TruSeq Stranded Total RNA Library Prep Human / Mouse / Rat, Illumina catalog #20020596 or 20020597 (=Conventional 1) or Ultra TM II directionalRNALibrary Prep Kit for New England Biolabs, catalog number E7760S (= Conventional 2), following the manufacturer's instructions. The resulting libraries were sequenced on a NextSeq 500 and the data analyzed. Genome coverage plots were generated for all detected ERCCs in SIRV Set 3. Figure 5 a) shows the normalized coverage of the accumulated mapped reads across ERCC at absolute nucleotide positions relative to known transcription start sites (TSS) and transcription end sites (TES), both indicated by dashed lines. Samples derived from SDS+ligation libraries have significantly increased coverage at both 5' and 3' ends compared to two conventional library preparation methods, which show reduced coverage at the 3' end and cannot resolve the true 5' end.

[0086] In addition, the gene coverage of the endogenous housekeeping gene gapdh was exemplarily observed using a custom script to assess the coverage of each individual gene. Figure 5b) shows an abbreviated version of the gapdh coverage map with intron visualization. Reads mapped to gapdh (SEQ ID No. 43-67) were analyzed without trimming of added bases and mismatched bases. Nucleotides matching the consensus sequence (top row) are marked in black, nucleotides that deviate from the annotated consensus sequence or originate from non-templated additions are marked in gray. Based on the stacking of reads observed for the SDS+ ligation library preparation samples, the true transcription start site can be determined and the transcript of interest can be re-annotated. Figure 5 In the example shown in b), the TSS was manually adjusted to position -15 (relative to the annotated +1 position). Similarly, the true transcription start and stop sites of other transcripts of interest can be re-evaluated, allowing comprehensive analysis of the entire transcriptome in a high-throughput NGS experiment, including resolution of individual nucleotides at the true TSS. This can be achieved simply by using the SDS+ligation library preparation method, without the need for specialized more complex methods such as 5' capture sequencing technology (CAGE-Seq) or low-throughput methods such as 5'RACE (rapid amplification of cDNA ends). Sequence Listing <110> LEXOGEN GMBH <120> Nucleic acid amplification and identification methods <130> R 75980 <150> EP18212743 <151> 2018-12-14 <160> 67 <170> BiSSAP 1.3 <210> 1 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 41 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 1 nnnnnagat cggaagagca cacgtctgaa ctccagtcac n 41 <210> 2 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 35 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 2 nnnnnnnnnn agatcggaag agcacacgtc tgaan 35 <210> 3 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 43 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 3 nnnnnnnnnn agatcggaag agcgtcgtgt agggaaagag tgn 43 <210> 4 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 34 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 4 nnnnnnnnnn agatcggaag agcgtcgtgt aggn 34 <210> 5 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10,11 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 44 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 5 nnnnnnnnnn nagatcggaa gagcgtcgtg tagggaaaga gtgn 44 <210> 6 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10,11,12 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 45 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 6 nnnnnnnnnn nnagatcgga agagcgtcgt gtagggaaag agtgn 45 <210> 7 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10,11,12 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 36 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 7 nnnnnnnnnnnnagatcgga agagcgtcgt gtaggn 36 <210> 8 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 34 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 8 nnnnnnnnnn agatcggaag agcgtcgtgt aggn 34 <210> 9 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10,11,12 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 36 <223> / mod_base="Other" / Comment="3'Reverse dT (reverse connection)" <400> 9 nnnnnnnnnnnnagatcgga agagcgtcgt gtaggn 36 <210> 10 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <220> <221> modified_base <222> 1 <223> / mod_base="Other" / Annotation="5' phosphorylated; a or g or c or t" <220> <221> misc_difference <222> 2,3,4,5,6,7,8,9,10,11,12 <223> / comment="a or g or c or t" <220> <221> modified_base <222> 33 <223> / mod_base="Other" / Comment="g, 3' spacer arm C3" <400> 10 nnnnnnnnnn nntggaattc tcgggtgcca agn 33 <210> 11 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides <400> 11 gtgactggag ttcagacgtg tgctcttccg atctttttttttttttttttttv 53 <210> 12 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 12 cgatttctaa agggaattcg agctcgcatt ttgaaaattc tatggaagag ctagcatctc 60 tgacgaaaac agcag 75 <210> 13 <211> 68 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 13 cctttgggga attcgagctc gcattttgaa aattctatgg aagagctagc atctctgacg 60 aaaaccag 68 <210> 14 <211> 68 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 14 caaaacggga attcgagctc gcattttgaa aattctatgg aagagctagc atctctgacg 60 aaaacaac 68 <210> 15 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 15 agtggtggga attcgagctc gcattttgaa aattctatgg aagagctagc atctctgacg 60 aaatgc 66 <210> 16 <211> 70 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 16 caaaatggga attcgagctc gcattttgaa aattctatgg aagagctagc atctctgacg 60 aaaacagcgt 70 <210> 17 <211> 65 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 17 tcggacggga attcgagctc gcattttgaa aattctatgg aagagctagc atctcttacg 60 aaaac 65 <210> 18 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 18 ggggacggga attcgagctc gcattttgaa aattctatgg aagagctagc atctctgaca 60 aaaaca 66 <210> 19 <211> 73 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 19 cccgagggga attcgagctc gcattttgaa aattctatgg aagagctagc atctctgacg 60 aaaacggcag aca 73 <210> 20 <211> 71 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 20 aatacaggga attcgagctc gcattttgaa aattctatgg aagagctagc atctctgacg 60 aaaacagaga g 71 <210> twenty one <211> 70 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> twenty one caaaatggga attcgagctc gcattttgaa aattctatgg aagagctagc atctctgacg 60 aaaacagcgt 70 <210> twenty two <211> 74 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> twenty two atttggggaa ttcgagctcg cattttgaaa attctatgga agagctagca tctctgacga 60 aaacagcagg cgga 74 <210> twenty three <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> twenty three aatggggaat tcgagctcgc attttgaaaa ttctatggaa gagctagcat ctctgacgaa 60 aacagcaatc ggaaa 75 <210> twenty four <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> twenty four aaggggaatt cgagctcgca ttttgaaaat tctctggaag agctagcatc tctgacgaaa 60 acagcagaac agaaa 75 <210> 25 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 25 ggggaattcg agctcgcatt ttgaaaatac tatggaagag ctagcatctc tgacgaaaac 60 agcagacgaa aaagt 75 <210> 26 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 26 gggaattcga gctcgcattt tgaaaattct atggaagagc tagcatctct gactactaca 60 g 61 <210> 27 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 27 aagatctcgc attttgaaaa ttctatggaa gagctagcat ctctgacgaa aacagcagaa 60 <210> 28 <211> 74 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 28 cgagctcgca ttttgaaaat tctatggaag agctagcatc tctgacgaaa acagcagacg 60 gaaaaggaga gacc 74 <210> 29 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 29 cgagctcgca ttttgaaaat tctatggaag agctagcatc tctgacgaaa acagcagacg 60 gaaaagtact gacca 75 <210> 30 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 30 cgagctcgca ttttgaaaat tctatggaag agctagcacc tctgacgaaa acagcagacg 60 gaaaaggact gaaaa 75 <210> 31 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 31 cgagctcgca ttttgaaaat tctatggaag agctagcatc tctgacgaaa acagcagacg 60 gaaaagtact gagcc 75 <210> 32 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 32 cgagctcgca ttttgaaaat tctatggaag agctagcacc tctgacgaaa acagcagacg 60 gaaaaggact gaaaa 75 <210> 33 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 33 cgagctcgca ttttgaaaat tctatggaag agctagcatc tctgacgaaa acagcagacg 60 gaaaagtact gactc 75 <210> 34 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 34 cgagctcgca ttttgaaaat tctatggaag agctagcatc tctgacgaaa acagcagacg 60 gaaaagtact gacca 75 <210> 35 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 35 cgagctcgca ttttgaaaat tctatggaag agctagcatc tctgacgaaa acagcagacg 60 gaaaagtaca aaacc 75 <210> 36 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 36 gagctcgcat tttgaaaatt ctatggaaga gctagcatct ctgacgaaaa cagcagacgg 60 aaaagtagct gacca 75 <210> 37 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 37 agctcgcattttgaaaattc tatggaagag ctagcatctc tgacgaaaac agcagacgga 60 aaagtactga ccaga 75 <210> 38 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 38 gctcgcattt tgaaaattct atggaagagc tagcatctct gacgaaaaca gcagacggaa 60 aagtacagac ccaac 75 <210> 39 <211> 74 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 39 cgcattttga aaattctatg gaagagctag catctctgac gaaaacagca gacggaaaag 60 tactgaccag ctag 74 <210> 40 <211> 73 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 40 cgcattttga aaattctatg gaagagctag catctctgac gaaaacagca gacggaaaag 60 tactgaccat gca 73 <210> 41 <211> 74 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 41 cgcattttga aaattctatg gaagagctag catctctgac gaaaacagca gacggaaaag 60 tactgaccag ccac 74 <210> 42 <211> 73 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 42 cgcattttga aaattctatg gaagagctag catctctgac gaaaacagca gacggaaaag 60 tactgaccag cat 73 <210> 43 <211> 129 <212> DNA <213> Artificial sequence <220> <223> consensus sequence <400> 43 ataaattgag cccgcagcct cccgcttcgc tctctgctcc tcctgttcga cagtcagccg 60 catcttcttt tgcgtcgcca gccgagccac atcgctcaga caccatgggg aaggtgaagg 120 tcggagtca 129 <210> 44 <211> 104 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 44 acgtgtgctc gtcactacct ccccgggtgc tctctgctcc tcctgttcga cagtcagccg 60 catcttcttt tgcgtcgcca gccgagccac atcgctcaga cacc 104 <210> 45 <211> 129 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 45 gaaaattgag cccgcagcct cccgcttcgc tctctgctcc tcctgttcga cagtcagccg 60 catcttcttt tgcgtcgcca gccgagccac atcgctcaga caccatgggg aaggtgaagg 120 tcggagtca 129 <210> 46 <211> 122 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 46 aaaatgcatt agaggaactg taaaaatctg ctcctccgtt cgacagtcag ccgcatcttc 60 ttttgcgtcg ccagccgagc cacatcgctc agacaccatg gggaaggtga aggtcggagt 120 ca 122 <210> 47 <211> 122 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 47 ctagaggaga ttggccaacg agattcactg gactcctgtt cgacagtcag ccgcatcttc 60 ttttgcgtcg ccagccgagc cacatcgctg agacaccatg gggaaggtga aggtcggagt 120 ca 122 <210> 48 <211> 118 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 48 ttttctgaac gctctggccg ctctgctcct cctgttcgac agtcagccgc ctcttcgttt 60 gcgtcgccag ccgagccaca tagctcagac accaagggga aggtgaaggt cggagtca 118 <210> 49 <211> 114 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 49 accgagcacc agctttctcc gacgccggga agtcgcagtc agccgcatct tcttttgcgt 60 cgccagccga gccacatcgc tcagacacca tggggaaggt gaaggtcgga gtca 114 <210> 50 <211> 112 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 50 aacgtgtgct ggctctctgc tcctcctgtt cgacagtcag ccgcatcttc ttttgcgtcg 60 ccagccgagc cacatcgctc agacaccatg gggaaggtga aggtcggagt ca 112 <210> 51 <211> 110 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 51 ttgctttggg ctctctgctc ctcctgttcg acagtcagcc gcatcttctt ttgcgtcgcc 60 agccgagcca catcgctcag acaccatggg gaaggtgaag gtcggagtca 110 <210> 52 <211> 106 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 52 gatgggctct ctgctcctcc tgttcgacag tcagccgcat cttcttttgc gtcgccagcc 60 gagccacatc gctcagacac catggggaag gtgaaggtcg gagtca 106 <210> 53 <211> 106 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 53 atagggctct ctgctcctcc tgttcgacag tcagccgcat cttcttttgc gtcgccagcc 60 gagccacatc gctcagacac catggggaag gcgaaggtcg gagtca 106 <210> 54 <211> 106 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 54 atctggctct ctgctcctcc tgttcgacag tcagccgcat cttcttttgc gtcgccagcc 60 gagccacatc gctgagacac catggggaag gtgaaggtcg gagtca 106 <210> 55 <211> 106 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 55 acgtggctct ctgctcctcc tgttcgacag tcagccgcat cttcttttgc gtcgccagcc 60 gagccacatc gctcagacac catggggaag gtgaaggtcg gagtca 106 <210> 56 <211> 106 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 56 acgtggctct ctgctcctcc tgttcgacag tcagccgcat cttcttttgc gtcgccagcc 60 gagccacatc gctcagacac catggggaag gtgaaggtcg gagtca 106 <210> 57 <211> 97 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 57 ttgcggctct ctgctcctcc tgttcgacag tcagccgcat cttcttttgc gtcgccagcc 60 gagccacatc gctcagacac catggggaag cggaaca 97 <210> 58 <211> 82 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 58 gggggctctc tgctcctcct gttcgacagt cagccgcatc ttcttttgcg tcgccagccg 60 agccacatcg ctcagacccc ac 82 <210> 59 <211> 105 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 59 aatggctctc tgctcctcct gttcgacagt cagccgcatc ttcttttgcg tcgccagccg 60 agccacatcg ctcagacacc atggggaagg tgaaggtcgg agtca 105 <210> 60 <211> 105 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 60 atcggctctc tgctcctcct gttcgacagt cagccgcatc ttcttttgcg tcgccagccg 60 agccacatcg ctcagacacc atggggaagg tgaaggtcgg agtca 105 <210> 61 <211> 105 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 61 attggctctc tgctcctcct gttcgacagt cagccgcatc ttcttttgcg tcgccagccg 60 agccacatcg ctcagacacc atggggaagg tgaaggtcgg agtca 105 <210> 62 <211> 57 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 62 gttggctctc tgctcctcct gttcgacagt cagccgcatc ttcttttgca atcgcca 57 <210> 63 <211> 104 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 63 atggctctct gctcctcctg ttcgacagtc agccgcatct tcttttgcgt cgccagccga 60 gccacatcgc tcagacacca tggggaaggt gaaggtcgga gtca 104 <210> 64 <211> 104 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 64 ttggctctct gctcctcctg ttcgacagtc agccgcatct tcttttgcgt cgccagccga 60 gccacatcgc tcagacacca tggggaaggt gaaggtcgga gtca 104 <210> 65 <211> 82 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 65 ggggctctct gctcctcctg ttcgacagtc agccgcatct tcttttgcgt cgccagccga 60 gccacatcgc tcagaacagc ca 82 <210> 66 <211> 104 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 66 gtggctctct gctcctcctg ttcgacagtc agccgcatct tcctttgcgt cgccagccga 60 gccacatcgc tcagacacca tggggaaggt gaaggtcgga gtca 104 <210> 67 <211> 103 <212> DNA <213> Artificial sequence <220> <223> Sequencing reads <400> 67 gggctctctg ctcctcctgt tcgacagtca gccgcatctt cttttgcgtc gccagccgag 60 ccacatcgct cagacaccat ggggaaggtg aaggtcggag tca 103

Claims

1. A method for generating a labeled amplified fragment of a nucleic acid template, comprising the following steps: Providing a template nucleic acid, annealing at least two oligonucleotide primers to the template nucleic acid, wherein at least one downstream primer is a nucleic acid extension terminator, and the at least two oligonucleotide primers are capable of priming an extension reaction at their 3' ends and include a portion that does not anneal to the template, The at least two oligonucleotide primers are extended in a template-specific manner to generate extension products, wherein the extension reaction is terminated when the extension product reaches (a) the 5' end of the template nucleic acid or reaches (b) an oligonucleotide primer that serves as a nucleic acid extension terminator annealed to the template nucleic acid downstream of the extension product, providing a plurality of at least two adaptor nucleic acids, the plurality of adaptors comprising different recognition sequences at their 5' ends that do not hybridize to an oligonucleotide primer that serves as an extension terminator and does not hybridize to a template, The 5' end of the adaptor nucleic acid is ligated to the 3' end of the extension product, which is hybridized to the template for ligation, thereby generating a labeled amplified fragment.

2. The method of claim 1, wherein when the extension product reaches the 5' end of the template nucleic acid, the nucleotide polymerase is allowed to add non-templated nucleotides to the extension product.

3. The method of claim 2, wherein the non-templated nucleotides are added by terminal transferase activity of a polymerase, and / or 1 to 15 non-templated nucleotides are added to at least 70% of the extension products.

4. The method of claim 1 or 2, wherein at least 10 adaptor nucleic acids having different recognition sequences are provided and used in the ligation step.

5. The method of claim 4, wherein at least 50 adapter nucleic acids having different recognition sequences are provided and used in the ligation step.

6. The method of claim 1 or 2, wherein the recognition sequence is a random sequence.

7. The method of claim 1 or 2, using at least 9 oligonucleotide primers as extension terminators having different annealing sequences for annealing to the template, thereby potentially annealing to different sites of the template nucleic acid.

8. The method of claim 7, using at least 49 oligonucleotide primers as extension terminators having different annealing sequences for annealing to the template, thereby potentially annealing to different sites of the template nucleic acid.

9. The method of claim 7, wherein the annealing sequence is a random sequence.

10. The method of claim 1 or 2, wherein the portion other than the recognition sequence on the adaptor nucleic acid binds to, hybridizes to, or does not bind to or hybridize with the oligonucleotide primer serving as an extension terminator.

11. The method of claim 10, wherein when the adaptor nucleic acid binds or hybridizes to the oligonucleotide primer serving as an extension terminator, the recognition sequence is independent of an annealing sequence on the oligonucleotide primer serving as an extension terminator that causes the oligonucleotide primer serving as an extension terminator to anneal to the template.

12. The method of claim 1 or 2, wherein the template is RNA.

13. The method of claim 12, wherein the extension reaction is performed using a reverse transcriptase.

14. The method of claim 1 or 2, wherein the oligonucleotide primers each comprise a universal amplification sequence and / or wherein the adaptor nucleic acid comprises a universal adaptor amplification sequence.

15. The method of claim 1 or 2, wherein the oligonucleotide primer comprises an annealing sequence that anneals to the template, and the annealing sequence comprises an oligo(T) sequence that anneals to an oligo(A) sequence in the template.

16. The method of claim 15, wherein the oligo(T) sequence comprises one or more 3' anchor nucleotides that are different from the oligo(A) sequence.

17. The method of claim 1 or 2, wherein the ligation reaction is performed in the presence of a crowding agent; and / or wherein the oligonucleotide primer comprises one or more modified nucleotides that increase the melting temperature of the annealing sequence that anneals to the template.

18. The method of claim 17, wherein the crowding agent is selected from a polymer or a composite comprising a polymer.

19. The method of claim 18, wherein the crowding agent is selected from a polyalkylene glycol or a polysorbate.

20. The method of claim 18, wherein the crowding agent is selected from PEG, octoxynol, Triton X, or Tween.

21. The method of claim 1 or 2, wherein at least two adaptor nucleic acids comprising different recognition sequences are used, thereby generating at least two different labeled amplified fragments.

22. The method of claim 21, further comprising amplifying the labeled amplified fragments, and assembling sequences of unique amplified fragments, wherein the labels are used to identify the unique amplified fragments.

23. The method of claim 21, wherein at least 10 adaptor nucleic acids comprising different recognition sequences are used, thereby generating at least 10 different labeled amplified fragments.

Images