A method for accurately identifying plant protein interactions

Abstract

The present application relates to the technical field of molecular genetics, in particular to a method for accurately identifying plant protein interaction. The present application combines co-expression regulatory network analysis and yeast two-hybrid technology, which can not only obtain candidate target genes with significant correlation expression level in the same tissue as the candidate genes in high throughput, but also verify the interaction relationship between the candidate genes and the candidate target genes by using the yeast two-hybrid technology, thereby overcoming the false positive problem caused by high-throughput sequencing technology, and the time-consuming and tedious problem of repeatedly using the yeast two-hybrid technology to verify the interaction process. The present application has high throughput and strong accuracy, and provides a fast, efficient and reliable technical means for identifying plant protein interaction mechanism.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular genetics, in particular to a method for accurately identifying plant protein interaction. BACKGROUND

[0002] Protein-protein interaction refers to the process of forming a protein complex through non-covalent bonds between two or more protein molecules. The interaction between proteins constitutes a major component of the biochemical reaction network of cells and is involved in important biological processes such as cell signal transduction. Current methods for identifying protein interaction include constructing co-expression regulatory networks, yeast two-hybrid, and bi-molecular fluorescence complementation.

[0003] Gene co-expression network analysis is based on the dynamic changes of gene expression signal values to calculate the co-expression correlation between genes and establish a gene transcription regulation model, thereby finding the entire gene expression regulation network model and key genes of one or more species at different developmental stages or different tissues under different conditions or treatments. Weighted gene co-expression network analysis (WGCNA) is a method for constructing gene co-expression regulatory networks based on gene expression levels obtained through RNA sequencing (RNA-seq). It classifies gene co-expression data and efficiently discovers major genes. However, WGCNA can only predict and cluster genes with similar expression patterns or similar functions into the same module through bioinformatics, but cannot clearly determine the mutual regulation relationship between genes. If all genes in the module are verified one by one, it is extremely tedious.

[0004] Yeast two-hybrid system was first proposed and successfully established by Fields et al. in 1989 based on the characteristics of eukaryotic transcription regulation. It can accurately analyze the interaction relationship between known proteins. At the same time, yeast two-hybrid technology can directly screen gene fragments interacting with known proteins from cDNA library, and yeast has different marker genes such as auxotrophic genes and resistance genes, which can obtain false positive interaction proteins with extremely low probability under the screening standard of yeast galactosidase (X-α-Gal). However, due to the presence of low-affinity regions of other proteins on the surface of some proteins, it is easy to activate the expression of reporter genes, and there are also problems such as long experimental period. Therefore, yeast two-hybrid technology for detecting protein interaction still needs to be combined with other technical means for verification. SUMMARY

[0005] In order to solve the above problems, the present application provides a method for accurately identifying plant protein interaction. The method provided by the present application overcomes the false positive problem caused by high-throughput sequencing technology and the tedious experimental process of repeatedly verifying the interaction relationship by using the yeast two-hybrid system, and is more efficient, accurate and simple.

[0006] In order to achieve the above-mentioned purpose, the present application provides the following technical scheme:

[0007] The present application provides a method for accurately identifying plant protein interaction, comprising the following steps:

[0008] 1) Constructing a co-expression regulatory network of all genes in a certain tissue of a plant, and screening target genes having the same expression pattern as the candidate gene; the screening criteria include that the weight value between the candidate gene and the target gene is greater than 0.30;

[0009] 2) Constructing an AD-cDNA library of the same tissue of the plant as in step 1), and screening target genes interacting with the candidate gene by using the yeast two-hybrid technology;

[0010] 3) When the target genes screened in step 1) are the same as the target genes screened in step 2), it is considered that the protein encoded by the candidate gene has an interaction mode with the protein encoded by the same target gene;

[0011] The steps 1) and 2) are not limited in sequence.

[0012] Preferably, before constructing the co-expression regulatory network of all genes in a certain tissue of a plant in step 1), the method comprises obtaining the whole genome expression profile data of a certain tissue of a plant by using sequencing or a public database.

[0013] Preferably, the data obtained by using sequencing or a public database is at least 15 sets of repeated samples.

[0014] Preferably, the method for constructing the co-expression regulatory network of all genes in a certain tissue of a plant in step 1) comprises weighted gene co-expression network analysis.

[0015] Preferably, the gene screening criteria of the co-expression regulatory network in step 1) include that the gene expression amount is greater than 5 and the same gene is expressed in at least 80% of the measured individuals.

[0016] Preferably, the RNA amount of the AD-cDNA library in step 2) is greater than 300 μg.

[0017] Preferably, the method used for self-activation and toxicity detection of the candidate gene in the yeast two-hybrid technology in step 2) comprises co-transformation method.

[0018] Preferably, the method for screening the target gene interacting with the candidate gene in step 2) comprises: the protein in the AD-cDNA library binds with the bait protein.

[0019] Preferably, the screening criteria in step 2) comprises: the single colony containing the target gene presents blue color by using the synthetic auxotroph medium of adenine / histidine / leucine / tryptophan with the addition of yeast galactosidase.

[0020] Preferably, after the single colony presenting blue color is obtained by the rescreening in step 2), the method further comprises: obtaining the target gene having the same mode of action with the candidate gene by using the high-throughput sequencing technology.

[0021] Beneficial effects:

[0022] The application provides a method for accurately identifying the protein interaction of plants, comprising the following steps:

[0023] 1) constructing a co-expression regulatory network of all genes in a certain tissue of plants, and screening the target gene having the same expression mode with the candidate gene; the screening criteria comprises: the weight value between the candidate gene and the target gene is greater than 0.30;

[0024] 2) constructing an AD-cDNA library of the same certain tissue of plants as step 1), and screening the target gene interacting with the candidate gene by using the yeast two-hybrid technology;

[0025] 3) when the target gene screened in step 1) is the same as the target gene screened in step 2), it is considered that the protein encoded by the candidate gene has the interaction mode with the protein encoded by the same target gene;

[0026] The steps 1) and 2) are not limited in sequence.

[0027] The application combines the co-expression regulatory network analysis and the yeast two-hybrid technology, which can not only obtain the candidate target gene having the significant correlation expression level with the candidate gene in the same tissue in high throughput, but also verify the interaction relationship between the candidate gene and the candidate target gene by using the yeast two-hybrid technology, thereby overcoming the false positive problem caused by the high-throughput sequencing technology and the time-consuming and tedious problem of repeatedly verifying the interaction process by using the yeast two-hybrid technology, and providing a fast, efficient and reliable technical means for identifying the protein interaction mechanism of plants. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 The method flow diagram for accurately identifying the PPK4 target gene provided in embodiment 1 of the application is shown in the figure;

[0029] Figure 2The soft threshold parameter (power = 20) is selected when the first approximation of the fitting curve is 0.9;

[0030] Figure 3 The co-expression regulatory network of the PPK4 gene constructed in Example 1 of the present application;

[0031] Figure 4 The screening results of the target genes interacting with PPK4 obtained by the yeast two-hybrid technology in Example 1 of the present application; A is the initial screening results of the yeast culture medium with adenosine / histidine / leucine / tryptophan synthesis defects; B is the re-screening results by using QDO / X medium; C is a gel electrophoresis diagram of PCR amplification of randomly sampled binding bacteria liquid, and different lanes represent amplified interaction genes, and multiple bands indicate that multiple interaction genes exist in the PCR bacteria liquid;

[0032] Figure 5 The schematic diagram of the protein encoded by the PPK4 target gene overlapping with the protein encoded by PPK4 verified by the yeast two-hybrid experiment in Example 1 of the present application; QDO / X presents blue, indicating that the yeast colony of PPK4 target gene interacting with PPK4 is a positive colony. DETAILED DESCRIPTION

[0033] The present application provides a method for accurately identifying plant protein interaction, comprising the following steps:

[0034] 1) Constructing a co-expression regulatory network of all genes in a certain tissue of a plant, and screening target genes with the same expression pattern as the candidate gene; the screening criteria include: the weight value between the candidate gene and the target gene is greater than 0.30;

[0035] 2) Constructing an AD-cDNA library of the same plant tissue as in step 1), and screening target genes interacting with the candidate gene by using the yeast two-hybrid technology;

[0036] 3) When the target genes screened in step 1) are the same as the target genes screened in step 2), it is considered that the protein encoded by the candidate gene has an interaction mode with the protein encoded by the same target gene;

[0037] The steps 1) and 2) are not limited in sequence.

[0038] Unless otherwise specified, the source of the vectors, reagents and culture media used in the present application has no special requirements, and commercially available products known to those skilled in the art can be used.

[0039] In the present application, before constructing the co-expression regulatory network of all genes in a certain tissue of a plant, it is preferred to obtain the whole genome expression profile data of the certain tissue of the plant by sequencing or using public databases. The present application is not limited to a specific type of plant, and in the examples, a poplar is preferred as an example for illustration, but it cannot be solely identified as the entire protection scope of the present application. In the present application, the certain tissue preferably includes vascular tissue; the sequencing preferably includes transcriptome sequencing; the depth of the sequencing is preferably 30x; and the sequencing or the data obtained by using public databases is at least 15 sets of repeated samples. The present application does not have a special requirement for the method of sequencing, and any sequencing method known to those skilled in the art can be used. The present application selects the data obtained by sequencing or using public databases to be ≥15 sets of repeated samples, which can meet the requirement of constructing the co-expression regulatory network and improve the accuracy.

[0040] In the present application, the method of constructing the co-expression regulatory network of all genes in a certain tissue of a plant preferably includes WGCNA; and the gene screening criteria of the co-expression regulatory network include that the gene expression amount (Fragments Per Kilobase Million, FPKM) is >5 and the same gene is expressed in at least 80% of the measured individuals.

[0041] After constructing the co-expression regulatory network of all genes in a certain tissue of a plant, the present application preferably performs hierarchical clustering analysis based on the weighted correlation, finally obtains different expression modules, and then sets the screening criteria that the weight value between the candidate gene and the target gene is >0.30, so as to screen the target gene which has a strong interaction relationship with the candidate gene. In the present application, the generation of the co-expression regulatory network preferably includes: first, using the Pearson correlation coefficient to calculate the distance between each pair of genes, then selecting the soft threshold parameter (power=20) when the fitting curve approaches 0.9 for the first time, setting the minimum module parameter to 30-100 genes, setting the merging cutting height to 0.2-0.3, and finally classifying the genes to form a gene co-expression module; the minimum module parameter of 30-100 genes is more preferably 50 genes, and the merging cutting height is more preferably 0.25.

[0042] The present application constructs an AD-cDNA (Activating Domain with cDNA) library of a certain tissue of a plant, which is the same as the above, and uses the yeast two-hybrid technology to screen the target gene which interacts with the candidate gene. In the present application, the AD-cDNA library preferably includes an AD-cDNA library with an activating domain; and the plant tissue used for constructing the AD-cDNA library is the same as the plant tissue used for constructing the co-expression regulatory network.

[0043] In the present application, the method for constructing the AD-cDNA library of a certain tissue of the plant preferably comprises: extracting RNA of the same tissue of the plant sample, separating mRNA, and constructing the AD-cDNA library; the result of the RNA extraction preferably comprises: 18S:28S = 1.0-2.0, OD 260 / 280 = 1.8-2.0, and the RNA amount > 300 μg. The present application does not have special requirements for the method for extracting RNA and constructing the AD-cDNA library, and the method known to those skilled in the art can be used.

[0044] In the present application, the method for detecting self-activation and toxicity of the candidate gene in the yeast two-hybrid technique preferably comprises the co-transformation method; the co-transformation method comprises the following steps: respectively transforming the positive control vector (pGBKT7-53 + pGADT7-T), the negative control vector (pGBKT7-Lam + pGADT7-T), the bait vector (pGBKT7-X + pGADT7-T, wherein X represents the candidate gene), and the toxicity control vector (pGBKT7 + pGADT7-T) into the yeast Y2H competent cells, culturing at 30°C for 48 h, picking single colonies on the yeast leucine and tryptophan synthesis-deficient medium (Double Synthetic Dropout Medium without Leucine / Tryptophan, DDO), and culturing at 30°C until turbidity; taking 100 μl of the bacterial solution for gradient dilution by 10 -2 , 10 -3 , 10 -4 times, and then respectively spotting 2 μl of the undiluted bacterial solution and the gradient dilution bacterial solution on the DDO and QDO solid culture media in sequence, and culturing at 30°C for 2-4 days; if only the strain transformed with the positive control vector can grow on the QDO solid culture medium, the candidate gene does not have the self-activation and toxicity phenomenon. In the present application and the examples, the DDO medium preferably represents the yeast leucine and tryptophan synthesis-deficient medium, the QDO medium preferably represents the yeast adenine / histidine / leucine / tryptophan synthesis-deficient medium, and the QDO / X medium preferably represents the yeast adenine / histidine / leucine / tryptophan synthesis-deficient medium added with yeast galactosidase. In the present application and the examples, the reagents for preparing the DDO medium and the QDO medium are preferably purchased from Beijing Biorbyt Biotechnology Co., Ltd., and the model numbers are BN25162, BN25163, BN25174, BN25190, and BN25344, respectively. The present application does not have special requirements for the preparation method of the DDO medium, the QDO medium, and the QDO / X medium, and the preparation method known to those skilled in the art can be used.

[0045] In the present application, the method for indicating the target gene interacting with the candidate gene preferably comprises the binding of the protein in the AD-cDNA library with the bait protein; the specific indicating method preferably comprises picking 2-3 single colonies (single colonies of pGBKT7-X, wherein X represents the candidate gene) and placing them in 50 ml of liquid culture medium of yeast culture medium lacking tryptophan (Synthetic Dropout Medium without Tryptophan, SD-Trp), and culturing them at 30°C overnight for 16 h at a rotation speed of 250 rpm, until the OD 600 is greater than 0.8, and then centrifuging them in a refrigerated centrifuge (1000 g / 10 min), resuspending the cell bodies in 5 ml of liquid culture medium of SD-Trp, adding 1 ml of the library working solution to 5 ml of the bacterial liquid, and adding them to a 1L cell culture bottle, flushing a 50 ml centrifuge tube with 50 ml of liquid culture medium of yeast extract peptone dextrose medium with adenine (Yeast Extract Peptone Dextrose Medium with Adenine, YPDA), and then transferring them to the cell culture bottle, and combining them in a 30°C shaking bed for 20-24 h at a rotation speed of 30-50 rpm, more preferably 35 rpm-40 rpm; after 20 h of combination, observing the bacterial liquid under a 40x confocal microscope to determine whether the combination has a clover shape, and if so, continuing with the subsequent steps, and if not, continuing to culture for 4 h.

[0046] After screening the proteins binding with the bait protein, the method preferably further comprises screening the combined bacterial strain using QDO medium; the screening standard preferably comprises centrifuging the combined bacterial liquid in a refrigerated centrifuge (1000 g / 10 min), resuspending the cell bodies in 50 ml of liquid culture medium of 0.5x YPDA resistance, centrifuging them again (1000 g / 10 min), and finally resuspending the cell bodies in 10 ml of liquid culture medium of 0.5x YPDA resistance, gradiently diluting 100 μl of the bacterial liquid by 10 -2 , 10 -3 , 10 -4 times, coating 100 μl of each gradient on SD-Trp, yeast culture medium lacking leucine (Synthetic Dropout Medium without Leucine, SD-Leu), DDO medium, and coating the remaining bacterial liquid on QDO medium, coating 200-500 μl of each medium for primary screening, preferably 200-350 μl, more preferably 250 μl, and culturing them at 30°C for 4-5 days; performing secondary screening on QDO / X, and the single colonies containing the target gene appear blue.

[0047] After obtaining the single colony presenting blue color, preferably further comprising obtaining target genes having the same mode of action as the candidate gene by using high-throughput sequencing technology; more preferably comprising: picking up the blue single colonies on QDO / X medium into a PCR centrifuge tube containing 50 μl of sterilized Demineralized Water (ddH2O), adding 8-15 single colonies to each tube, more preferably adding 10-12 single colonies to each tube, and fully shaking to mix for bacterial liquid PCR; purifying the PCR reaction liquid using a PCR product purification kit, vortexing the purified product, and taking 100-200 μl of the mixed sample for high-throughput second-generation sequencing; comparing the sequencing results with the reference genome, and performing gene annotation to obtain target genes interacting with the candidate gene, and the specific method preferably comprises using Trimmomatic software to perform quality control analysis on raw data, using kallisto software to perform genome alignment, and screening genes with est_counts>10, and more preferably genes with length ratio>0.5. In the present application, the reference genome preferably comprises the genome of the sequencing material.

[0048] In the present application, the reaction system of the PCR is 50 μL, preferably comprising 2xPhanta Max MasterMix 25 μL, bacterial liquid 2 μL, upstream primer AD-F 1 μL, downstream primer AD-R 1 μL, and the balance of ddH2O; and the reaction program of the PCR preferably comprises: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 30 s, 51℃ annealing for 30 s, 72℃ extension for 3 min, 30 cycles; and 72℃ extension for 5 min.

[0049] When the target gene screened by the co-expression regulatory network coincides with the target gene screened by the yeast two-hybrid technology, it is considered that the candidate gene has an interaction mode with the target gene, so as to accurately determine the interaction relationship between the protein encoded by the candidate gene and the protein encoded by the target gene.

[0050] In order to further illustrate the present application, a method for accurately identifying plant protein interaction provided by the present application is described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0051] Example 1

[0052] A method for accurately identifying plant protein interaction (flow chart is shown in Figure 1 ), comprising the following steps:

[0053] The selected material is poplar vascular tissue, and the target gene of the protein kinase Potri.003G049700 (Photoregulatory Protein Kinase 4, PPK4) is identified;

[0054] Step S1, using public database (NCBI) in 15 groups of poplar vascular tissue transcriptome sequencing (Table 1), obtain the whole genome expression profile data.

[0055] Table 1 15 groups of poplar vascular tissue transcriptome sequencing data

[0056]

[0057] Step S2, based on the expression profile data obtained in step S1, the co-expression regulatory network of poplar vascular tissue is constructed, and the target genes with the same expression mode as PPK4 are identified, the specific steps are as follows:

[0058] Firstly, WGCNA is used to construct the co-expression regulatory network of poplar xylem, and the gene screening standard for constructing the co-expression network is: FPKM>5, and the same gene is expressed in at least 80% of the measured individuals; secondly, based on the WGCNA analysis, first use the Pearson correlation coefficient to calculate the distance between each pair of genes, and then select the soft threshold parameter (power=20) when the fitting curve is close to 0.9 for the first time, Figure 2 ), the minimum module parameter is set to 50 genes, and the combined cutting height is 0.25, and finally the 7 co-expression modules are obtained by cutting clustering, and then the target genes with the same mode of action as PPK4 are determined by screening weight value>0.30 (Table 2), and finally, the co-expression regulatory network map of PPK4 is obtained by Cytoscape software Figure 3 ).

[0059] Table 2 Co-expression regulatory network identifies target genes with the same mode of action as PPK4

[0060]

[0061]

[0062] Step S3, construct AD-cDNA library of poplar, and obtain target genes interacting with PPK4 by yeast two-hybrid technology, the specific steps are as follows:

[0063] First, extract total RNA from poplar plants, the RNA quality inspection requirements are 18S:28S=1.0-2.0, OD260 / 280=1.8-2.0, and the RNA amount is >300μg, separate mRNA from RNA, construct AD-cDNA library and obtain library working solution.

[0064] Secondly, pGBKT7-53+pGADT7-T, pGBKT7-Lam+pGADT7-T, pGBKT7-PPK4+pGADT7-T, pGBKT7+pGADT7-T and pGBKT7-PPK4 (all vectors are provided by Shanghai Eurobio-Technology Co., Ltd.) were respectively transformed into yeast Y2H competent cells; the specific transformation method is as follows: 1) 50 μl of Y2H competent cells melted on ice were taken, and the pre-cooled target plasmid, 2-5 μg, Carrier DNA (95-100 ℃, 5 min, rapid ice bath, repeated once) 10 μl, PEG / LiAC 500 μl and several times of pipetting were added and mixed; 2) 30 ℃ water bath for 30 min (15 min, turn over 6-8 times); 3) the tube was placed in 42 ℃ water bath for 15 min (7.5 min, turn over 6-8 times); 4) 5000 rpm centrifugation for 40 s, discard the supernatant, resuspend the bacterial body with 400 μl of sterile water, centrifuge for 30 s and discard the supernatant; 5) resuspend the bacterial body with 100 μl of sterile water in the clean bench, and then spread on DDO medium, and culture at 30 ℃ for 48-96 h; after single colonies grow, take single colonies in DDO liquid medium, and culture at 30 ℃ until turbid, take 100 μl of bacterial liquid for gradient dilution 10 -2 、10 -3 、10 -4 times, then take 2 μl of undiluted bacterial liquid and gradient dilution bacterial liquid respectively on DDO and QDO solid medium, and culture at 30 ℃ for 2 to 4 days, all strains grow on DDO solid medium to form obvious white round bacterial plaques, and only the strain transformed with pGBKT7-53+pGADT7-T grows white bacterial plaques on QDO solid medium, and the strain transformed with pGBKT7-Lam+pGADT7-T, the strain transformed with pGBKT7-PPK4+pGADT7-T, and the strain transformed with pGBKT7+pGADT7-T only leave liquid traces, indicating that PPK4 does not exist self-activation and toxicity phenomenon.

[0065] Thirdly, the pGBKT7-PPK4 colony was activated, 2-3 single colonies were taken and placed in 50 ml of SD-Trp liquid medium, and cultured at 30 ℃ for 16 h, at a speed of 250 rpm, to OD 600greater than 0.8, then centrifuged by a refrigerated centrifuge (1000g / 10min), resuspended the cell bacteria with 5ml SD-Trp liquid medium, added 1ml library working solution obtained in the previous stage to 5ml bacterial liquid into a 1L cell culture bottle, rinsed a 50ml centrifuge tube with 50ml 2xYPDA(Kana) liquid medium (Beijing Baileijibioscience Technology Co., Ltd. BN25325) and moved into the cell culture bottle, combined (mating) in a 30℃ shaking bed for 20-24h, at a speed of 37rpm. After mating for 20h, 40x confocal microscopy observed that the bacterial liquid appeared clover-shaped zygotes.

[0066] Then, the mating bacterial liquid was centrifuged by a refrigerated centrifuge (1000g / 10min), resuspended the bacteria with 50ml 0.5xYPDA(Kana) liquid medium, centrifuged again (1000g / 10min), finally resuspended the cell bacteria with 10ml 0.5xYPDA(Kana), gradiently diluted 10 -2 ,10 -3 ,10 -4 times with 100μl bacterial liquid each time, coated 100μl of each gradient on SD-Trp, SD-Leu, DDO medium, and coated the remaining bacterial liquid on QDO medium, coated 250μl of each medium, cultured at 30℃ for 4-5 days Figure 4 (A), preliminarily screened 1-2mm sized round colonies on QDO medium, picked all single colonies on QDO / X medium for re-screening, and the colonies appeared blue Figure 4 (B).

[0067] Finally, picked the blue single colonies on QDO / X medium into sterilized 50μl ddH2O PCR centrifuge tubes, added 12 single colonies to each tube, designed primers for pGADT7 vector (AD-F: TACCACTACAATGGATGATG, SEQ ID NO. 1; AD-R: AGATGGTGCACGATGCACAG, SEQ ID NO. 2), then performed bacterial liquid PCR using high-fidelity enzyme 2xPhanta Max Master Mix (Nanjing Novozyme Biotech Co., Ltd.) (the reaction system of PCR was: 2xPhanta Max Master Mix 25μL, bacterial liquid 2μL, upstream primer AD-F 1μL, downstream primer AD-R 1μL and ddH2O 21μL; the reaction program of PCR was: 98℃ pre-denaturation for 5min; 98℃ denaturation for 30s, 51℃ annealing for 30s, 72℃ extension for 3min, 30 cycles; 72℃ extension for 5min), randomly sampled for gel electrophoresis, and verified the reliability of the screening library results according to the band sizeFigure 4 The PCR reaction solution was purified using a general DNA product purification kit DP204 from Beijing TransGen Biotech Co., Ltd. (C in the step S3), and the purified product was vortexed and mixed. 150 μl of the mixed sample was subjected to high-throughput second-generation sequencing, and the remaining sample was stored at -80°C. The sequencing results were aligned with the Populus trichocarpa genome and annotated. The raw data was analyzed using Trimmomatic software, and the genome was aligned using kallisto software. The genes with est_counts>10 and length ratio>0.5 were screened, and the target genes interacting with PPK4 were finally obtained (Table 3).

[0068] Table 3 Target genes interacting with PPK4 screened by yeast two-hybrid

[0069]

[0070]

[0071] Step S4, when the target genes with the same expression pattern as PPK4 identified by the co-expression regulatory network and the target genes interacting with PPK4 screened by the yeast two-hybrid technique coincide, the coinciding target genes are the target genes interacting with PPK4 (Table 4), which also indicates that the protein encoded by the PPK4 gene has an interaction mode with the proteins encoded by Potri.004G227700, Potri.006G117700, Potri.005G019800, Potri.003G128000, or Potri.008G041000. At the same time, the yeast two-hybrid experiment was used to verify again that PPK4 indeed has an interaction relationship with Potri.004G227700, Potri.006G117700, Potri.005G019800, Potri.003G128000, Potri.008G041000. Figure 5

[0072] Table 4 Target genes interacting with PPK4

[0073]

[0074]

[0075] ​In summary, the present application combines the co-expression regulatory network analysis and the yeast two-hybrid technology, which can not only obtain the candidate target genes with significant correlation expression level in the same tissue with the candidate genes in high throughput, but also verify the interaction between the candidate genes and the candidate target genes by using the yeast two-hybrid technology, overcome the false positive problem caused by high-throughput sequencing technology, and the time-consuming and tedious problem of repeatedly using the yeast two-hybrid technology to verify the interaction process, and provide a fast, efficient and reliable technical means for identifying the plant protein interaction mechanism with high throughput and high accuracy.

[0076] Although the present application has been disclosed with the preferred embodiments as above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, therefore the protection scope of the present application should be defined by the claims. SEQUENCE LISTING <110> Beijing Forestry University <120> A method for accurately identifying plant protein interaction <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 taccactaca atggatgatg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 agatggtgca cgatgcacag 20

Claims

1. A method for accurately identifying plant protein interactions, characterized in that, Includes the following steps: 1) Construct a co-expression regulatory network of all genes in a plant tissue using weighted gene co-expression network analysis, perform hierarchical clustering analysis based on weighted correlation to obtain different expression modules, and screen target genes with the same expression pattern as candidate genes. The screening criteria include: the weight value between candidate genes and target genes > 0.30; the gene screening criteria for the co-expression regulatory network include: gene expression level > 5 and the same gene is expressed in at least 80% of the tested individuals; 2) Construct an AD-cDNA library from a plant tissue identical to that in step 1), and use yeast two-hybrid technology to screen for target genes that interact with candidate genes; the AD-cDNA library includes an AD-cDNA library with an activation domain. 3) When the target gene selected in step 1) is the same as the target gene selected in step 2), it is considered that the protein encoded by the candidate gene has an interaction pattern with the protein encoded by the same target gene. There is no requirement for the order of steps 1) and 2). Before constructing the co-expression regulatory network of all genes in a certain plant tissue in step 1), the process includes obtaining whole-genome expression profile data of a certain plant tissue using sequencing or public databases; the data obtained by sequencing or using public databases shall be at least 15 sets of replicate samples.

2. The method according to claim 1, characterized in that, The generation of the co-expression regulatory network includes: calculating the distance between each pair of genes using the Pearson correlation coefficient, selecting the soft threshold parameter when the fitted curve first approaches 0.9, setting the minimum module parameter to 30-100 genes, merging the cleavage height to 0.2-0.3, and finally classifying the genes to form a gene co-expression module.

3. The method according to claim 1, characterized in that, In step 2), the amount of RNA in the AD-cDNA library is >300 μg.

4. The method according to claim 1, characterized in that, The methods used for candidate gene self-activation and toxicity detection in step 2) of the yeast two-hybrid technology include co-transformation.

5. The method according to claim 1, characterized in that, The method for indicating the target genes that interact with the candidate genes in step 2) includes: binding the proteins in the AD-cDNA library to the bait proteins.

6. The method according to claim 1, characterized in that, The screening criteria in step 2) include: secondary screening using a yeast adenine / histidine / leucine / tryptophan synthesis defective culture medium supplemented with yeast galactosidase, and single colonies containing the target gene appearing in blue.

7. The method according to claim 6, characterized in that, The blue single colony fallout obtained in step 2) also includes using high-throughput sequencing technology to obtain target genes with the same mode of action as candidate genes.

Images