Application of TRIM2 in the prevention and treatment of porcine epidemic diarrhea virus infection

Abstract

The present invention provides an application of a three-domain protein 2 (TRIM2), which specifically targets and knocks out the gene to inhibit its protein expression, thereby inhibiting the infection of porcine epidemic diarrhea virus (PEDV) in host cells, thereby preventing porcine epidemic diarrhea caused by PEDV infection. Therefore, TRIM2 can be used as a potential target molecule for preparing drugs for preventing and treating porcine epidemic diarrhea or for manufacturing gene-edited animals resistant to porcine epidemic diarrhea, and has important economic value.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to the application of TRIM2 gene as a target molecule in the prevention and treatment of porcine epidemic diarrhea. Background Art

[0002] Porcine epidemic diarrhea is an acute, highly contagious enteric disease of pigs caused by porcine epidemic diarrhea virus (PEDV). The main characteristics are vomiting, watery diarrhea and severe dehydration in infected pigs. Pigs of all ages and breeds are susceptible, especially newborn piglets, with a mortality rate of up to 80-100%. Clinically, co-infection with TGEV, PCV-2 and other viruses is serious.

[0003] The fundamental reason for the lack of effective prevention and control measures for porcine epidemic diarrhea is that the pathogenic mechanism of PEDV is unclear and there is a lack of key and effective gene targets. Therefore, finding new therapeutic targets is particularly important for the development of host-targeted antiviral drugs.

[0004] The TRIM protein family plays an important role in different biological processes. It can coordinate the ubiquitination of target proteins to assemble signaling complexes, mediate proteolytic degradation, change subcellular localization or regulate the host's transcript or protein composition, and fight viruses. Among them, the N-terminal E3 ubiquitin ligase and the C-terminal globular folding structure B-Box region are the key regions of TRIM antiviral activity. TRIM2 belongs to the cytoplasmic filamentous TRIMs subgroup, and its filamentous structure may be involved in the cargo transport of viral particles. Sarute's team reported for the first time that TRIM2 can inhibit the entry of sand virus, indicating that TRIM2 can participate in cellular pathways that are critical for viral replication. However, the relationship between TRIM2 as a new antiviral member and resistance to porcine epidemic diarrhea has not been reported. Summary of the invention

[0005] Based on the technical problems existing in the background technology, the purpose of the present invention is to provide the application of TRIM2 in the prevention and treatment of porcine epidemic diarrhea, so as to solve the above technical problems.

[0006] One of the purposes of the present invention is to use the TRIM2 gene as a target molecule in the preparation of a drug for preventing or treating porcine epidemic diarrhea.

[0007] Preferably, TRIM2 gene expression is inhibited by targeted editing.

[0008] Preferably, the substance that inhibits the expression of the TRIM2 gene includes: any one of sgRNA or its expression vector for gene targeted knockout of TRIM2, small molecule inhibitors, dsRNA for RNA interference, and antisense oligonucleotides.

[0009] Preferably, the sgRNA sequence is: 5'-ATCCTAGACCACTGACATGG-3'.

[0010] The second purpose of the present invention is to provide a drug kit for preventing or treating porcine epidemic diarrhea, comprising sgRNA or its expression vector for targeted knockout of TRIM2 gene, and CRISPR / Cas9 plasmid, and the drug kit can be used to prepare drugs for preventing and treating porcine epidemic diarrhea.

[0011] The third object of the present invention is to provide an inhibitor of the TRIM2 gene, comprising: the above-mentioned sgRNA targeting the TRIM2 gene or its expression vector, and a CRISPR / Cas9 plasmid.

[0012] The fourth object of the present invention is to use the above-mentioned medicine kit and / or the above-mentioned inhibitor in the preparation of medicine for preventing and treating porcine epidemic diarrhea.

[0013] The fifth purpose of the present invention is to use the TRIM2 gene as a target in the preparation of gene-edited cells or animal models resistant to epidemic diarrhea virus infection.

[0014] The present invention uses the above-mentioned sgRNA to knock out the TRIM2 gene through CRISPR / Cas9 gene editing technology, thereby inhibiting TRIM2 gene transcription or protein expression, and further inhibiting the infection and replication ability of porcine epidemic diarrhea virus.

[0015] The present invention first screened the host factors essential for the replication of porcine epidemic diarrhea virus by constructing a green monkey whole genome CRISPR / Cas9 knockout library, and found that under different PEDV infection conditions, the total sequencing reads of different sgRNA targeting the TRIM2 gene ranked first.

[0016] Further, the expression level of TRIM2 in green monkey kidney cells (Vero) is correlated with porcine epidemic diarrhea virus infection. According to an embodiment of the present invention, the expression level of TRIM2 gene in Vero cells is significantly increased after infection with porcine epidemic diarrhea virus, and increases with the extension of infection time.

[0017] Furthermore, the present invention found that TRIM2 is correlated with the replication of porcine epidemic diarrhea virus. According to the experiment of the present invention, when the TRIM2 gene of Vero cells is knocked out, the infection rate of porcine epidemic diarrhea virus can be reduced.

[0018] In the present invention, the porcine epidemic diarrhea virus is specifically the JS-A strain (NCBI ID: MH748550).

[0019] The beneficial effects of the present invention are as follows: the present invention confirms that TRIM2 has a significant correlation with porcine epidemic diarrhea virus infection and proliferation, that is, porcine epidemic diarrhea virus infection can upregulate the expression level of TRIM2 protein in green monkey kidney cells, thereby facilitating the intracellular proliferation and further infection of the virus. When the expression of TRIM2 protein is inhibited, the infection and intracellular replication ability of porcine epidemic diarrhea virus can be effectively reduced. The present invention confirms that TRIM2 can be used as an important target for the effective prevention and treatment of porcine epidemic diarrhea. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a graph showing the abundance detection results of the green monkey whole genome CRISPR / Cas9 knockout plasmid library constructed in Example 1.

[0021] Figure 2 This is a graph showing the abundance detection results of the whole genome cell mutant library constructed in Example 1.

[0022] Figure 3 The expression level of TRIM2 in Vero cells at different time points after PEDV infection was detected by fluorescence quantitative PCR technology in Example 2; wherein β-actin was an internal reference gene. The control group represented Vero cells not infected with PEDV.

[0023] Figure 4 is the genotype of the TRIM2 knockout cell line sequenced by TA cloning in Example 3. Wherein, WT is a wild-type cell, TRIM2-KO is a TRIM2 gene knockout cell constructed by CRISPR / Cas9 lentiviral strategy, +1bp represents the insertion of 1 base, and PAM represents the abbreviation of protospacer adjacent motif.

[0024] Figure 5 The protein expression level of the TRIM2 knockout cell line was detected by Western blot technology in Example 3. β-actin is an internal reference gene, and kDa represents kilodaltons.

[0025] Figure 6 The EdU cell proliferation experiment in Example 4 was used to evaluate the effect of TRIM2 gene knockout on cell proliferation; wherein WT is wild-type cells, and TRIM2-KO represents TRIM2 gene knockout cells. Blue fluorescence is DAPI-stained cell nuclei, and red fluorescence is EdU-stained positive cells.

[0026] Figure 7 This is the imaging result of the cell survival status of TRIM2 gene knockout cells infected with PEDV for 24 hours provided in Example 4.

[0027] Figure 8This is the absolute fluorescence quantitative PCR technology used in Example 5 to detect the change in the amount of virus in TRIM2 gene knockout cells after 24 hours of PEDV (MOI=0.01) infection.

[0028] Fig. 9 The expression changes of N protein in TRIM2 knockout cells were detected by immunofluorescence experiment in Example 5 under the infection condition of PEDV with a virus infection multiplicity (MOI) of 0.01 after 24 hours; wherein hpi is the virus infection time. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is described in detail below through specific embodiments.

[0030] Example 1: Screening of essential host factors for PEDV replication using a whole-genome CRISPR / Cas9 knockout library

[0031] 1.1 Construction of a Vero cell whole genome CRISPR / Cas9 knockout cell library

[0032] The whole genome annotation information of green monkeys from NCBI (https: / / www.ncbi.nlm.nih.gov / ) and Ensemble (www.ensembl.org) databases was collected, and the Vero cell line-based CRISPR / Cas9 knockout library (VeroCKO, Vero Genome-scale CRISPR Knock-Out library) was designed using sgRNAcas9 software. The library contains 75,608 gRNAs, 4 sgRNAs for one gene, and 1,000 negative control sgRNAs were designed; the company synthesized the oligonucleotide probe mixed pool.

[0033] The VeroCKO library was connected to the lenti-u6-sgRNA-EGFP vector by PCR amplification and Gibson assembly. The library was then sequenced by the second generation high throughput sequencing to calculate the genome coverage of 99.34%, targeting 75109 genes (such as Figure 1 shown).

[0034] The plasmid library was further packaged with lentivirus to infect Vero-Cas9 cells to construct a whole-genome knockout mutant cell library. The abundance of the lentiviral knockout vector library was identified by second-generation high-throughput sequencing. Compared with the design, the sgRNA coverage rate reached 83.69%, targeting 63,699 genes, and the VeroCKO mutant cell library was successfully constructed (such as Figure 2 shown).

[0035] 1.2 CRISPR / Cas9 knockout library screening and identification of host factors required for porcine epidemic diarrhea virus replication

[0036] After sgRNA lentiviral library infected Vero-Cas9 cells for 7 days, PEDV-JS-A (MOI = 0.00001) was used to infect cells for 3 days. A control group was set up at the same time. When all cells in the control group died, a small number of cells survived in the knockout cell library group. The surviving cell clusters in the knockout cell library group were collected and cultured for 11 days. When the cells grew into clonal cell clusters and all expressed GFP fluorescence, the first round of screening was completed.

[0037] Subsequently, the surviving cells screened in the first round were infected again with PEDV-JS-A at an MOI of 0.0001, and specific primers were designed for the surviving cells. The target gene fragments were recovered by PCR amplification and high-throughput sequencing was performed to obtain the key host gene data for resistance to PEDV. The results showed that under different PEDV infection conditions, the total sequencing reads of different sgRNAs targeting the TRIM2 gene ranked first.

[0038] Example 2: TRIM2 gene is highly expressed after PEDV infects Vero cells

[0039] Relative fluorescence quantitative PCR was used to compare the changes in TRIM2 mRNA expression levels before and after PEDV infection of wild-type cells (WT). PEDV infected wild-type Vero cells in logarithmic phase at an MOI of 0.01, and cells were collected 12, 24, and 36 hours later to extract total RNA to detect changes in TRIM2 mRNA expression, with β-actin as the internal reference gene;

[0040] The TRIM2 primer sequences are as follows:

[0041] TRIM2-F:GTATGAACCAGCACCAG;

[0042] TRIM2-R GAAGTGTCGAGACAGGGGA.

[0043] The results showed that after PEDV infection, the mRNA expression level of TRIM2 in Vero was significantly upregulated compared with that before infection, and it was time-dependent (e.g. Figure 3 shown).

[0044] Example 3: Genotype and protein expression detection of TRIM2 knockout cell lines

[0045] 3.1 Design of specific sgRNA targeting TRIM2 gene and construction of expression vector

[0046] Download the TRIM2 gene from the Ensemble database (accession number: ENSCSAG00000003302). Use the sgRNAcas9 software to design sgRNA, and then select the sgRNA targeting the TRIM2 gene exon based on the specificity evaluation results. The sequence of the selected sgRNA is:

[0047] TRIM2-sgRNA: 5'-ATCCTAGACCACTGACATGG-3'.

[0048] Among them, the PAM sequence for identifying the target is "GGG" (such as Figure 4 sgRNA lentiviral vector was constructed, and the primer pairs were as follows:

[0049] TRIM2-sgr-F: 5'-CACCGATCCTAGACCACTGACATGG-3';

[0050] TRIM2-sgr-R: 5'-AAACCCATGTCAGTGGTCTAGGATC-3'.

[0051] The synthesized oligonucleotide primers were diluted, denatured and annealed, and connected to the linearized lenticrispr v2 vector that was digested and purified by Bsmb1 (NEB). The reaction system and conditions were: 5 μL of each primer pair, annealing reaction: 95°C, 10 min; 65°C, 30 min; cooled to 4°C.

[0052] Ligate to the lentiCrispr v2 vector linearized by BbsI. The reaction system is: 1 μL primer pair, 50 ng linearized vector, 5 μL ligation mix, and ddH 2 Make up to 10 μL with 1% O. Ligate at 16°C for 1.5 h.

[0053] The product was transformed into DH5a Escherichia coli and cultured overnight at 37°C. Single clones were picked and expanded for bacterial liquid PCR detection. The bacterial liquid with positive test results was sent to the company for sequencing. The plasmid was extracted using an endotoxin removal kit, and the successfully constructed sgRNA lentiviral expression vector was named "lenticrispr-TRIM2-KO".

[0054] 3.2 Construction and identification of TRIM2 gene knockout cell lines

[0055] The sgRNA lentivirus targeting the TRIM2 gene was packaged using a three-plasmid system. The target plasmid was lenticrispr-TRIM2-KO, and the auxiliary system plasmids were psPAX2 and pMD2.G, with a ratio of pMD2.G:psPAX2:target plasmid = 1:2:3.

[0056] All plasmids were extracted using OMEGA's Endo-free Plasmid DNA Mini Kit II (Cat. No. D6950-01). The cell transfection reagent used for lentiviral packaging was jePRIME, and the cell line was HEK293T cells.

[0057] Subsequently, the Vero cell line was revived, and 48 hours after sgRNA lentivirus infection, positive expression cells were selected and enriched, and a certain number of monoclonal cells were selected for expanded culture.

[0058] Gene and protein expression levels were then tested, and sgRNA was designed using software to target genomic regions. The primer pairs were as follows:

[0059] TRIM2-PCR-F: 5'-TGCTTTGAAACCCAGCGAAC-3';

[0060] TRIM2-PCR-R: 5'-GGAGGTCAGCCTGTGAAACT-3'.

[0061] TA cloning was used to detect the deletion of TRIM2 gene. The DNA of monoclonal cells was extracted according to the method of Tiangen DNA extraction kit (KG203) and PCR reaction was performed. The system was as follows: 5 μL 10× Buffer; dNTPs; 1 μL 10 μmol / L TRIM2-PCR-F; 1 μL 10 μmol / L TRIM2-PCR-R; 0.5U LaTaq enzyme; ~200ng DNA template; H 2 The reaction conditions were: 95°C, 5 min; (95°C, 30 s; 60°C, 30 s; 72°C, 45 s), 35 cycles, 72°C, 5 min; 15°C, 2 min.

[0062] After the reaction is completed, the PCR product is purified using a DNA product purification kit, then connected to the pMD19-T Vector vector, transformed into DH5a Escherichia coli, coated with ampicillin-resistant plates, cultured overnight at 37°C, and 5 to 10 monoclonal bacteria were picked for expansion and sent to the company for sequencing.

[0063] Results: The sequencing data were compared with the wild-type (WT) control group, and it was found that in the No. 3 bacterial solution "TRIM2-KO", the corresponding gene-edited cell line TRIM2 gene had a base insertion (such as Figure 4 ), indicating that the gene was deleted.

[0064] Then, the expression level of TRIM2 gene protein in gene-edited cells was detected using Western blot technology. Total cell protein was extracted, and the TRIM2 protein content of cells was detected using TRIM2 antibody and β-actin internal reference antibody.

[0065] Results: By Figure 5 It can be seen that compared with the control group cells (WT), it was found that the TRIM2 protein was completely not expressed in the TRIM2-KO gene-edited cell line, indicating that the TRIM2 knockout cell line was successfully constructed.

[0066] Example 4: TRIM2 knockout cells grow normally and can inhibit host cell cytopathic effects caused by PEDV infection

[0067] First, it was detected whether the normal growth of Vero cells was affected after the knockout of TRIM2. 50 μM EdU was added to the culture dishes of wild-type cells and TRIM2-KO cells in the logarithmic growth phase to make the final EdU concentration 1×, and incubated for 2 hours; the cells were fixed with 4% paraformaldehyde and incubated at room temperature for 15 minutes, then the cells were rinsed, incubated with 0.3% TritonX-100 cell permeabilizer for 10 minutes, and the cells were rinsed again and incubated with Click reaction solution at room temperature in the dark for 30 minutes, and the cells were rinsed again. Finally, the DAPI nuclei were stained in the dark for 10 minutes and the fluorescence was observed under a fluorescence microscope. The results showed that there was no significant difference in the proliferation of TRIM2 gene knockout cells and control cells (such as Figure 6 shown).

[0068] Furthermore, an inhibitory analysis experiment of TRIM2 gene knockout on PEDV-induced cytopathic effect was conducted. Wild-type cells and TRIM2 gene knockout cells were infected with PEDV at MOI of 0.01 and 0.05. After 1 hour, the maintenance medium was replaced and incubated for a further 48 hours. The cytopathic effect was observed and photographed under a microscope.

[0069] It was found that when wild-type cells formed obvious synuclein, cell death and large-scale shedding, Vero cells with TRIM2 knockout did not have synuclein and a large number of cells survived. Therefore, knocking out the TRIM2 gene can significantly inhibit the cell lesions caused by PEDV (such as Figure 7 ), which has the ability to resist PEDV infection-induced cell death.

[0070] Example 5: Knockout of TRIM2 can inhibit the replication of PEDV in host cells

[0071] The PEDV absolute fluorescence quantitative PCR standard plasmid is the full-length PEDV-186 fragment gene connected to pMD18-T. After multiple dilutions, fluorescence PCR amplification is performed to obtain the relationship between the Ct value and the virus copy number, and a standard curve is drawn.

[0072] The primer sequences are as follows:

[0073] PEDV-186-F: TACTAAGCGTAACATCCTGCC;

[0074] PEDV-186-R: GTAGTACCAATAACAACCGAAGC.

[0075] PEDV-infected TRIM2 knockout and wild-type control group cell samples were collected, and the viral RNA in the cell infection fluid was extracted using the TAKARA kit (Cat. No.: 9766). Subsequently, the cDNA was reverse transcribed using the TAKARA PrimeScript RT reagent Kit with gDNA Eraser kit (Cat. No.: RR047A) for fluorescence quantitative PCR amplification.

[0076] Results: The absolute fluorescence quantitative PCR data obtained were analyzed. Figure 8 It can be seen that 24 hours after PEDV infection, the mRNA expression level of the PEDV-186 fragment gene was significantly decreased compared with the TRIM2-KO and control group cells, indicating that knocking out the TRIM2 gene affects the replication of PEDV in the host Vero cells.

[0077] By immunofluorescence technology, the expression of N gene after PEDV infection in TRIM2 knockout and control cells was further compared. After being fixed with pre-cooled 4% paraformaldehyde at room temperature, the cells were rinsed, and pre-cooled 0.3% TritonX-100 was added. After standing at room temperature for 10 minutes, the cells were rinsed, and the blocking solution was added for 1-2 hours at room temperature. The cells were rinsed, and then PEDV-N antibody (1:100) was added and stood at 4°C overnight. The cells were rinsed, and then incubated with secondary antibodies (the dilution ratio of Anti-mouse IgG was 1:1000), incubated on a shaker at room temperature for 1-2 hours, rinsed, and cell nucleus staining: DAPI was added and stained at room temperature in the dark for 10 minutes. Discard DAPI, rinse the cells, and observe the fluorescence under a fluorescence microscope.

[0078] The results are as follows Fig. 9 As shown, compared with the control group, it was found that after TRIM2 gene knockout, the N gene encoding PEDV protein could not be expressed, indicating that PEDV depends on TRIM2 to replicate in the host.

[0079] In the above steps, the techniques not described in detail or specified are all conventional techniques in the prior art and can be performed according to conventional molecular biology and cell biology experimental conditions or according to the conditions recommended by the manufacturer's instructions.

[0080] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. Use of a substance that inhibits TRIM2 gene expression in the preparation of a drug for treating porcine epidemic diarrhea, wherein the substance that inhibits TRIM2 gene expression is a sgRNA or its expression vector for gene targeted knockout of TRIM2.

2. The use according to claim 1, characterized in that: The sgRNA sequence is: 5'-ATCCTAGACCACTGACATGG -3'.

Images