Recombinant protein from horseshoe crab and DNA encoding the recombinant protein

Abstract

The present invention provides a full-length recombinant protein related to the coagulation mechanism of horseshoe crab, cDNA encoding these recombinant proteins, and uses of these recombinant proteins. Recombinant proteins containing the amino acid sequence shown in sequence number 2 or 4; recombinant proteins containing the amino acid sequence shown in sequence number 6, 8, 10, or 12; recombinant proteins containing the amino acid sequence shown in sequence number 14, 16, 18, 20, or 22; variants of these recombinant proteins, cDNA encoding these recombinant proteins, and uses of these recombinant proteins.

Description

[0001] The present application is a divisional application based on the invention patent application with application number 201780055566.6, application date October 18, 2017, and invention name “Recombinant protein derived from horseshoe crab and DNA encoding the recombinant protein”. Technical Field

[0002] The present invention relates to a recombinant protein derived from the genus Limulus, a DNA encoding the recombinant protein, and a method for utilizing the same. The present invention also relates to a method for producing an endotoxin detection agent. Background Art

[0003] Horseshoe crabs are called "living fossils" and there are only two genera and four species on Earth. As a genus, there are only the "Limulus" genus that lives only on the east coast of North America and the "Tachypleus" genus that lives only in the southeastern waters of Asia.

[0004] The phenomenon that a group of organisms is distributed in two areas far from each other is called discontinuous distribution. Organisms like horseshoe crabs that are distributed in two areas on the earth are very precious.

[0005] There is only one species belonging to the genus Limulus, the American horseshoe crab (Limulus polyphemus), and only three species belonging to the genus Tachypleus, the Chinese horseshoe crab (Tachypleus tridentatus), the giant horseshoe crab (Tachypleus gigas), and the Southeast Asian horseshoe crab (Tachypleus rotundicauda, ​​also known as the round-tailed horseshoe crab (Carcinoscorpius rotundicauda)).

[0006] It is known that an extract of amoebocytes (amoebic lysate) present in the blood of this organism will coagulate when it comes into contact with endotoxins. Taking advantage of this property, amoebic lysate is widely used as a reagent for detecting endotoxins with high sensitivity, such as in the quality control of pharmaceuticals.

[0007] This reagent is called "Lysate reagent". In addition, since the property of endotoxin to produce coagulation was first discovered in the American horseshoe crab, this reagent is sometimes called "Horseshoe crab reagent" or "LAL (Limulus amoebocyte lysate) reagent". Even if the reagent uses the amoeba lysate of the genus Tachypleus, it is customarily called "Horseshoe crab reagent" or "LAL reagent".

[0008] Currently, the lysate reagent (horse crab reagent, LAL reagent) used by pharmaceutical manufacturers in Japan and Europe uses horseshoe crabs as raw materials. There are also reports that the number of horseshoe crabs caught has been strictly limited due to concerns about extinction, but the number of individuals is still decreasing.

[0009] In order to protect horseshoe crabs, there is an idea to artificially produce proteins in amoeba cell lysates and prepare reagents using recombinant technology (Patent Documents 1 to 8). In fact, products such as PyroGene (trademark) (Lonza), EndoZyme (trademark) (Hyglos), and PyroSmart (trademark) (Biochemical Industry) that use recombinant proteins are already on the market.

[0010] However, all of these use recombinant proteins derived from organisms of the genus Tachypleus, and there is no report on reagents using recombinant proteins derived from the horseshoe crab Polyphemus polyphemus, which is widely used as a lysate reagent.

[0011] The reason for this is that the proteins and genes involved in the mechanism of coagulation caused by endotoxin in the American horseshoe crab have not been fully identified in terms of structure and function.

[0012] In the genus Tachypleus, for example, regarding factor C, one of the proteins related to the coagulation mechanism, the complete gene sequence and amino acid sequence from the Chinese horseshoe crab were reported in 1991 (non-patent document 1), and the complete gene sequence and amino acid sequence from the Southeast Asian horseshoe crab (Trimeresurus cyprinidae) were reported in 1995 (non-patent document 2).

[0013] However, in the American horseshoe crab, even though the Tachypleus genus has been reported for more than 20 years, the complete identification of the structure and function of these proteins and genes has not been successful. This is because due to the various differences and diversity of biological molecules caused by the differences in the genus or species of horseshoe crabs, it is impossible to accurately determine the full-length sequence structure, expression, and functional elucidation of these proteins and genes using general methods.

[0014] Currently, as part of the invertebrate genome project using next-generation sequencers, the gene network analysis of the horseshoe crab is being conducted. ttp: / / genome.wustl.edu / genomes / detail / limulus- polyphemus / ), but the full-length sequences of all proteins and genes related to the coagulation mechanism of horseshoe crab have not been elucidated. This fact also proves the difficulty of accurately determining the full-length sequence structure of these proteins and genes in horseshoe crab.

[0015] Prior art literature

[0016] Patent Literature

[0017] Patent Document 1: U.S. Patent No. 5,712,144

[0018] Patent Document 2: U.S. Patent No. 5,716,834

[0019] Patent Document 3: U.S. Patent No. 5,858,706

[0020] Patent Document 4: U.S. Patent No. 5,985,590

[0021] Patent Document 5: U.S. Patent No. 6,645,724

[0022] Patent Document 6: International Publication No. 2008 / 004674

[0023] Patent Document 7: Japanese Patent Application No. 2014-510898

[0024] Patent Document 8: International Publication No. 2014 / 092079

[0025] Non-patent literature

[0026] Non-patent document 1: Muta T et al., Journal of Biological Chemistry, 266, 6554-6561 (1991)

[0027] Non-patent document 2: Ding JL et al., Molecular Marine Biology and Biotechnology, 4(1), 90-103 (1995) Summary of the invention

[0028] Technical problem to be solved by the invention

[0029] An object of the present invention is to provide all full-length recombinant proteins related to the coagulation mechanism of horseshoe crab, cDNAs encoding these recombinant proteins, and uses of these recombinant proteins.

[0030] Technical solutions to solve problems

[0031] The present inventors succeeded in obtaining full-length cDNA encoding all protein factors involved in the coagulation mechanism of horseshoe crab, and expressing all recombinant proteins thereof, which had not been successfully achieved before. They further found that these can be used for various purposes, thereby completing the present invention.

[0032] That is, the present invention includes the following aspects.

[0033] [1] A recombinant first protein such as a recombinant protein, which is any of the following.

[0034] (A) A recombinant protein comprising the amino acid sequence shown in SEQ ID NO: 2 or 4.

[0035] (B) A recombinant protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 2 or 4 and having Factor C activity.

[0036] (C) A recombinant protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 1 or 3 and having factor C activity.

[0037] (D) A recombinant protein having Factor C activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence represented by SEQ ID NO: 1 or 3.

[0038] [2] A recombinant second protein such as a recombinant protein, which is any of the following.

[0039] (A) A recombinant protein comprising the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12.

[0040] (B) A recombinant protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12, and having factor B activity.

[0041] (C) A recombinant protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11 and having factor B activity.

[0042] (D) A recombinant protein having factor B activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11.

[0043] [3] A recombinant third protein such as a recombinant protein, which is any of the following.

[0044] (A) A recombinant protein comprising the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20, or 22.

[0045] (B) A recombinant protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20, or 22, and having procoagulant activity.

[0046] (C) A recombinant protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 13, 15, 17, 19 or 21 and having procoagulant activity.

[0047] (D) A recombinant protein having procoagulant activity which is encoded by a DNA which hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 13, 15, 17, 19 or 21.

[0048] [1-1] Use of a recombinant first protein for activating a protein having factor B activity (for example, a second protein such as the following protein).

[0049] (A) A protein comprising the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12.

[0050] (B) A protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12, and having factor B activity.

[0051] (C) A protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11 and having factor B activity.

[0052] (D) A protein having factor B activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11.

[0053] [1-1-1] An application described in [1-1], wherein:

[0054] The second protein is a recombinant second protein.

[0055] [2-1] Use of a recombinant second protein for activating a protein having procoagulant activity (for example, a third protein such as the following protein).

[0056] (A) A protein comprising the amino acid sequence shown in SEQ ID NO:14, 16, 18, 20, or 22.

[0057] (B) A protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20 or 22 and having procoagulant activity.

[0058] (C) A protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 13, 15, 17, 19 or 21 and having procoagulant activity.

[0059] (D) A protein having procoagulant activity which is encoded by a DNA which hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 13, 15, 17, 19 or 21.

[0060] [2-1-1] The application according to [2-1], wherein:

[0061] The third protein is a recombinant third protein.

[0062] [3-1] A recombinant third protein is used to cut off a substrate.

[0063] [3-1-1] The application according to [3-1], wherein:

[0064] The substrate is a synthetic substrate.

[0065] [1-2] A method for detecting endotoxin in a sample, comprising the step of bringing a recombinant first protein into contact with the sample.

[0066] [1-2-1] The method according to [1-2], further comprising:

[0067] A step of bringing the recombinant first protein that has been brought into contact with a subject into contact with a protein having factor B activity, such as a second protein.

[0068] [1-2-1-1] The method according to [1-2-1], wherein:

[0069] The second protein is a recombinant second protein.

[0070] [1-2-2] The method according to [1-2-1] or [1-2-1-1], further comprising the step of contacting the protein having factor B activity after contact with the "recombinant first protein after contact with the subject" with a protein having procoagulant activity such as a third protein.

[0071] [1-2-2-1] The method according to [1-2-2], wherein:

[0072] The third protein is a recombinant third protein.

[0073] [1-2-3] The method according to [1-2-2] or [1-2-2-1], further comprising the step of contacting the protein having procoagulant activity after contacting the "protein having factor B activity after contacting the recombinant first protein after contacting the subject" with a detection substrate.

[0074] [1-3] An endotoxin detection agent comprising a recombinant first protein.

[0075] [1-3-1] The reagent according to [1-3], further comprising a protein having factor B activity such as a second protein.

[0076] [1-3-1-1] The reagent according to [1-3-1], wherein

[0077] The second protein is a recombinant second protein.

[0078] [1-3-2] The reagent according to [1-3-1] or [1-3-1-1], further comprising a protein having procoagulant activity such as a third protein.

[0079] [1-3-2-1] The reagent according to [1-3-2], wherein

[0080] The third protein is a recombinant third protein.

[0081] [1-4] A cDNA (hereinafter also referred to as "first cDNA"), which is any one of the following.

[0082] (A) cDNA containing the base sequence shown in SEQ ID NO: 1 or 3.

[0083] (B) A cDNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 1 or 3 and encoding a protein having Factor C activity.

[0084] (C) A cDNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 1 or 3 and encodes a protein having Factor C activity.

[0085] (D) cDNA encoding a protein containing the amino acid sequence shown in SEQ ID NO: 2 or 4.

[0086] (E) A cDNA encoding a protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 2 or 4 and having Factor C activity.

[0087] [1-4-1] A DNA construct comprising a first cDNA.

[0088] [1-4-2] A cell transformed with the DNA construct described in [1-4-1] to express a recombinant first protein.

[0089] [1-4-3] A method for producing a recombinant first protein, comprising the step of culturing the cell described in [1-4-2].

[0090] [2-4] A cDNA (hereinafter also referred to as "second cDNA"), which is any one of the following.

[0091] (A) cDNA comprising the base sequence shown in SEQ ID NO: 5, 7, 9, or 11.

[0092] (B) A cDNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11, and encoding a protein having factor B activity.

[0093] (C) A cDNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11 and encodes a protein having factor B activity.

[0094] (D) cDNA encoding a protein containing the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12.

[0095] (E) A cDNA encoding a protein having an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12 and having factor B activity.

[0096] [2-4-1] A DNA construct comprising a second cDNA.

[0097] [2-4-2] A cell transformed with the DNA construct described in [2-4-1] to express a recombinant second protein.

[0098] [2-4-3] A method for producing a recombinant second protein, comprising the step of culturing the cell described in [2-4-2].

[0099] [3-4] A cDNA (hereinafter also referred to as "third cDNA"), which is any one of the following.

[0100] (A) cDNA comprising the base sequence shown in SEQ ID NO: 13, 15, 17, 19, or 21.

[0101] (B) A cDNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 13, 15, 17, 19, or 21, and encoding a protein having procoagulant activity.

[0102] (C) A cDNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 13, 15, 17, 19, or 21 and encodes a protein having procoagulant activity.

[0103] (D) cDNA encoding a protein containing the amino acid sequence shown in SEQ ID NO:14, 16, 18, 20, or 22.

[0104] (E) A cDNA encoding a protein having an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20, or 22 and having procoagulant activity.

[0105] [3-4-1] A DNA construct comprising a third cDNA.

[0106] [3-4-2] A cell transformed with the DNA construct described in [3-4-1] to express a recombinant third protein.

[0107] [3-4-3] A method for producing a recombinant third protein, comprising the step of culturing the cell described in [3-4-2].

[0108] [1-5] A method for producing an endotoxin detecting agent, comprising the step of artificially expressing a protein using a first cDNA.

[0109] [1-5-1] The production method according to [1-5], further comprising the step of artificially expressing the protein using the second cDNA.

[0110] [1-5-2] The production method according to [1-5-1], further comprising the step of artificially expressing the protein using the third cDNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0111] Figure 1 This is a photograph of electrophoresis of PCR products in the process of obtaining cDNA of a protein having factor C activity from the Polyphemus polyphemus.

[0112] Figure 2 This is a photograph of electrophoresis of PCR products in the process of obtaining cDNA of a protein having factor C activity from the Polyphemus polyphemus.

[0113] Figure 3 This is a graph showing the cleavage activity of synthetic substrates caused by contact of each recombinant protein alone or various mixtures with endotoxin.

[0114] Figure 4 This is a graph showing a standard curve of endotoxin using a mixture of three types of recombinant proteins. DETAILED DESCRIPTION

[0115] <1> Recombinant first protein and method for producing the same

[0116] (1) Recombinant protein 1

[0117] The first recombinant protein is a recombinant protein having Factor C activity.

[0118] Specifically, the recombinant first protein is any of the following recombinant proteins.

[0119] (I) A recombinant protein comprising the amino acid sequence of a protein having Factor C activity of the Polyphemus polyphemus.

[0120] (II) is a variant of the above-mentioned (I), and is a recombinant protein having Factor C activity.

[0121] Examples of the amino acid sequence of the protein having Factor C activity of the horseshoe crab include the amino acid sequence shown in SEQ ID NO: 2 or 4. Examples of the base sequence encoding such an amino acid sequence include the base sequence shown in SEQ ID NO: 1 or 3.

[0122] More specifically, the recombinant first protein may be any of the following recombinant proteins.

[0123] (A) A recombinant protein comprising the amino acid sequence shown in SEQ ID NO: 2 or 4.

[0124] (B) A recombinant protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 2 or 4 and having Factor C activity.

[0125] (C) A recombinant protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 1 or 3 and having factor C activity.

[0126] (D) A recombinant protein having Factor C activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence represented by SEQ ID NO: 1 or 3.

[0127] It should be noted that the expression “containing an amino acid sequence” or “containing a base sequence” also includes the case of “consisting of the amino acid sequence” or the case of “consisting of the base sequence”.

[0128] This protein was obtained for the first time in the world by the method disclosed in the examples of this specification, and its full-length sequence structure and function were also clarified for the first time. Its function is to become active in the presence of endotoxin, and to change a protein having factor B activity such as the second protein described later into an active form (referred to as "factor C activity" in this application document). The recombinant first protein may be a protein that exhibits factor C activity at least in combination with a second protein such as a recombinant second protein.

[0129] The presence of factor C activity can be confirmed by combining the recombinant protein to be tested with a protein having factor B activity (inactive type) such as a second protein (a protein that has not become active; hereinafter referred to as "inactive type"), a protein having procoagulant activity (inactive type) such as a third protein (inactive type), and a detection substrate, and detecting the progress of the cascade reaction in the presence of endotoxin.

[0130] "Cascade reaction" refers to a series of reactions in which a protein having factor C activity (inactive form) is activated by endotoxin, a protein having factor B activity (inactive form) is activated by a protein having factor C activity (active form), and a protein having procoagulant activity (inactive form) is activated by a protein having factor B activity (active form). The progress of the cascade reaction can be detected by cleavage of a detection substrate.

[0131] Among the recombinant first proteins, the recombinant proteins described in (A) and (I) above are most preferred, but any variant of these recombinant proteins may be used as long as they have Factor C activity.

[0132] The variant may be, for example, a recombinant protein having Factor C activity, comprising an amino acid sequence containing substitution, deletion, insertion and / or addition of one or several amino acids at one or several positions in the amino acid sequence of the recombinant first protein as described above (e.g., the amino acid sequence shown in SEQ ID NO: 2 or 4). The above-mentioned "one or several" may be, for example, 1 to 20, 1 to 10, 1 to 5, or 1 to 3. The above-mentioned substitution, deletion, insertion, and / or addition of one or several amino acids is a conservative variation that maintains the normal function of the protein. A representative example of a conservative variation is a conservative substitution. Conservative substitutions include, for example, when the substitution site is an aromatic amino acid, a substitution is made between Phe, Trp, and Tyr; when the substitution site is a hydrophobic amino acid, a substitution is made between Leu, Ile, and Val; when the substitution site is a polar amino acid, a substitution is made between Gln and Asn; when the substitution site is a basic amino acid, a substitution is made between Lys, Arg, and His; when the substitution site is an acidic amino acid, a substitution is made between Asp and Glu; and when the substitution site is an amino acid having a hydroxyl group, a substitution is made between Ser and Thr. Specific examples of substitutions considered to be conservative substitutions include: substitutions from Ala to Ser or Thr; substitutions from Arg to Gln, His or Lys; substitutions from Asn to Glu, Gln, Lys, His or Asp; substitutions from Asp to Asn, Glu or Gln; substitutions from Cys to Ser or Ala; substitutions from Gln to Asn, Glu, Lys, His, Asp or Arg; substitutions from Glu to Gly, Asn, Gln, Lys or Asp; substitutions from Gly to Pro; substitutions from His to Asn, Lys, Gln, Arg or Tyr. substitution from Ser to Thr or Ala; substitution from Thr to Ser or Ala; substitution from Trp to Phe or Tyr; substitution from Tyr to His, Phe or Trp; and substitution from Val to Met, Ile or Leu.

[0133] In addition, the variant may be, for example, a recombinant protein comprising an amino acid sequence having 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology to the amino acid sequence of the recombinant first protein described above (for example, the amino acid sequence set forth in SEQ ID NO: 2 or 4), and having Factor C activity.

[0134] In addition, the variant may be, for example, a recombinant protein having Factor C activity which is encoded by a DNA comprising a base sequence having 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology to a base sequence encoding the amino acid sequence of the recombinant first protein as described above (for example, the base sequence set forth in SEQ ID NO: 1 or 3).

[0135] In addition, the variant may be, for example, a recombinant protein having Factor C activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to a base sequence encoding the amino acid sequence of the recombinant first protein described above (e.g., a base sequence represented by SEQ ID NO: 1 or 3). "Stringent conditions" refer to conditions under which a so-called specific hybrid is formed and a non-specific hybrid is not formed by a conventional hybridization procedure described in T. Maniatis et al., Molecular Cloning: A Laboratory Manual 2nd ed. (1989), Cold Spring Harbor Laboratory, etc. "Stringent conditions" specifically refer to conditions under which a sodium salt concentration is 15 to 750 mM, preferably 50 to 750 mM, more preferably 300 to 750 mM, a temperature is 25 to 70° C., preferably 50 to 70° C., more preferably 55 to 65° C., and a formamide concentration is 0 to 50%, preferably 20 to 50%, more preferably 35 to 45%. Furthermore, under stringent conditions, the filter washing conditions after hybridization are generally at a sodium salt concentration of 15 to 600 mM, preferably 50 to 600 mM, more preferably 300 to 600 mM, and a temperature of 50 to 70°C, preferably 55 to 70°C, more preferably 60 to 65°C.

[0136] Specifically, the variants are preferably the recombinant proteins of (B) to (D) above. The "95% or more" in (B) and (C) above means preferably 96% or more, more preferably 97% or more, more preferably 98% or more, and more preferably 99% or more.

[0137] Furthermore, any peptide such as a His tag or a V tag may be added to the recombinant first protein as long as it has Factor C activity.

[0138] In addition, in this application document, "recombinant protein" refers to a protein obtained by artificially introducing a gene encoding a protein into a host cell other than horseshoe crab and expressing it. Therefore, the protein obtained from natural horseshoe crab itself does not belong to the "recombinant protein" in this application document.

[0139] (2) Method for producing recombinant first protein

[0140] As for the recombinant first protein, since the present invention discloses its complete amino acid sequence for the first time, it can be produced, for example, using DNA encoding the sequence and using genetic engineering methods. The method of producing the recombinant first protein using genetic engineering methods is not particularly limited, and for example, a common method of producing proteins using genetic engineering methods can be used. The recombinant first protein can be produced, for example, using a heterologous expression system or a cell-free protein synthesis system.

[0141] For example, the recombinant first protein can be produced by artificially introducing the first cDNA described below into a host cell other than horseshoe crab and expressing the protein from the cDNA. The present invention also provides a method for producing such a recombinant first protein.

[0142] When artificially introducing DNA into a host cell, a DNA construct (vector, etc.) artificially recombined with the DNA can be used. As such an artificial DNA construct, an example of such a DNA construct recombined with the first cDNA can be given. Such an artificial DNA construct will be described later.

[0143] As for host cells other than horseshoe crab, as long as the protein can be functionally expressed by the first cDNA, there is no particular limitation. As host cells other than horseshoe crab, for example, mammalian cells or insect cells can be mentioned. As mammals, rodents or primates can be mentioned. As rodents, Chinese hamsters, hamsters, mice, rats, and guinea pigs can be mentioned. As cells of Chinese hamsters, for example, cell lines derived from Chinese hamster ovaries (CHO) can be mentioned. As CHO, CHO DG44, CHO S, or CHO K1 can be mentioned. As primates, there are no particular limitations, and humans, monkeys, and chimpanzees can be mentioned. As human cells, cell lines derived from human fetal kidney cells (HEK) can be mentioned. As HEK, HEK293 can be mentioned.

[0144] "Functionally expressed" means that the expressed recombinant first protein exhibits Factor C activity. The exhibiting of Factor C activity can be confirmed by the method described in the Examples described below. In addition, whether the expressed protein contains the target amino acid sequence such as any one of the structures (A) to (D) above can be confirmed by analyzing the amino acid sequence of the expressed protein and comparing it with the target amino acid sequence.

[0145] The method of artificially introducing the first cDNA into the host cell is not particularly limited as long as the cDNA is maintained in an expressible state in the host cell. The recombinant first protein can be expressed by artificially growing the host cell into which the first cDNA has been introduced.

[0146] The growth of the transformed host cells can be carried out, for example, by culturing the cells. The culture conditions at this time are not particularly limited as long as the cells can grow or proliferate, and the conditions commonly used for culturing the cells can be appropriately modified as needed. For example, when the host cells are mammalian cells, a culture medium commonly used for culturing mammalian cells can be used. As such a culture medium, for example, RPMI1640 culture medium (Sigma), DMEM culture medium (Sigma) or Expi CHO TM Expression Medium (Thermo Fisher Scientific), etc. For example, the culture can be carried out by static culture or suspension culture at 36°C to 38°C and 5% to 8% CO2 supply. A protein expression-specific kit can be used.

[0147] The expressed recombinant first protein is recovered as a solution fraction containing the recombinant first protein and can be used for various purposes described below.

[0148] The solution fraction containing the recombinant first protein may be, for example, a culture solution, a culture supernatant, a cell disrupted extract, or a mixture thereof. The recombinant first protein may be purified to a desired degree before use, or may be used as it is without purification.

[0149] Purification can be carried out by a known method for protein purification, such as ammonium sulfate precipitation, gel filtration chromatography, ion exchange chromatography, hydrophobic interaction chromatography, and hydroxyapatite chromatography.

[0150] According to the present invention, it is possible for the first time to artificially and functionally express a recombinant first protein. The recombinant first protein produced in this way can be used, for example, for the purposes described below.

[0151] <2> Recombinant second protein and method for producing the same

[0152] The recombinant second protein is a recombinant protein having factor B activity.

[0153] Specifically, the recombinant second protein is any of the following recombinant proteins.

[0154] (I) A recombinant protein comprising the amino acid sequence of a protein having factor B activity of the horseshoe crab Polyphemus polyphemus.

[0155] (II) is a variant of the above-mentioned (I), and is a recombinant protein having factor B activity.

[0156] Examples of the amino acid sequence of the protein having factor B activity of the horseshoe crab include the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12. Examples of the base sequence encoding such an amino acid sequence include the base sequence shown in SEQ ID NO: 5, 7, 9, or 11.

[0157] More specifically, the recombinant second protein may be any of the following recombinant proteins.

[0158] (A) A recombinant protein comprising the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12.

[0159] (B) A recombinant protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12, and having factor B activity.

[0160] (C) A recombinant protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11 and having factor B activity.

[0161] (D) A recombinant protein having factor B activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11.

[0162] The function of the protein is to become active under the influence of a protein having factor C activity (active form) such as the first protein that has become active, and to make a protein having procoagulant activity such as the third protein described later active (referred to as "factor B activity" in the present application document). The recombinant second protein may be a protein that exhibits factor B activity in combination with at least a first protein such as the recombinant first protein and a third protein such as the recombinant third protein.

[0163] The presence of factor B activity can be confirmed by detecting the progress of the cascade reaction when the target recombinant protein is combined with a protein having factor C activity (active form) such as the first protein (active form), a protein having procoagulant activity (inactive form) such as the third protein (inactive form), and a detection substrate. In this system, endotoxin for converting the protein having factor C activity (inactive form) to an active form may further be present.

[0164] The other descriptions may refer to the description in <1> above. For example, in <1> above, "SEQ ID NO. 1 or 3" may be replaced with "SEQ ID NO. 5, 7, 9, or 11", "SEQ ID NO. 2 or 4" may be replaced with "SEQ ID NO. 6, 8, 10, or 12", "(recombinant) first protein" may be replaced with "(recombinant) second protein", "first cDNA" may be replaced with "second cDNA", "factor C" may be replaced with "factor B", and the like.

[0165] <3> Recombinant third protein and method for producing the same

[0166] The recombinant third protein is a recombinant protein having procoagulant activity.

[0167] Specifically, the recombinant third protein is any of the following recombinant proteins.

[0168] (I) A recombinant protein comprising the amino acid sequence of a protein having procoagulant activity of the horseshoe crab Polyphemus polyphemus.

[0169] (II) is a variant of the above-mentioned (I), and is a recombinant protein having procoagulant activity.

[0170] Examples of the amino acid sequence of the protein having procoagulant activity of the horseshoe crab include the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20, or 22. Examples of the base sequence encoding such an amino acid sequence include the base sequence shown in SEQ ID NO: 13, 15, 17, 19, or 21.

[0171] More specifically, the recombinant third protein may be any of the following recombinant proteins.

[0172] (A) A recombinant protein comprising the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20, or 22.

[0173] (B) A recombinant protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20, or 22, and having procoagulant activity.

[0174] (C) A recombinant protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 13, 15, 17, 19 or 21 and having procoagulant activity.

[0175] (D) A recombinant protein having procoagulant activity which is encoded by a DNA which hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 13, 15, 17, 19 or 21.

[0176] The function of the protein is to become active under the action of a protein having factor B activity (active form) such as the second protein that has become active, and to cleave a substrate (protein or peptide) described later (referred to as "procoagulant activity" in this application document). The recombinant third protein may be a protein that exhibits procoagulant activity at least in combination with a second protein such as the recombinant second protein.

[0177] The presence of procoagulant activity can be confirmed by detecting the progress of the cascade reaction when the recombinant protein to be tested is combined with a protein (active type) having factor B activity such as a second protein (active type) and a detection substrate. In this system, a protein (active type) having factor C activity for converting the protein (inactive type) having factor B activity into an active type may further exist. In addition, in this system, an endotoxin for converting the protein (inactive type) having factor C activity into an active type may further exist.

[0178] Other descriptions may refer to the description in <1> above. For example, in <1> above, "sequence number 1 or 3" may be replaced with "sequence number 13, 15, 17, 19, or 21", "sequence number 2 or 4" may be replaced with "sequence number 14, 16, 18, 20, or 22", "(recombinant) first protein" may be replaced with "(recombinant) third protein", "first cDNA" may be replaced with "third cDNA", "factor C" may be replaced with "procoagulant", etc.

[0179] <4> Application of recombinant first protein

[0180] The recombinant first protein can be used to activate a protein having factor B activity, such as the second protein. In other words, the present invention includes a method for activating a protein having factor B activity, the method comprising the step of contacting the recombinant first protein with a protein having factor B activity.

[0181] Examples of the protein having factor B activity include the second protein.

[0182] Specifically, the second protein is any of the following proteins.

[0183] (I) A protein comprising the amino acid sequence of a protein having factor B activity of the horseshoe crab Polyphemus polyphemus.

[0184] (II) is a protein which is a variant of the above-mentioned (I) and has factor B activity.

[0185] More specifically, the second protein may be any of the following proteins.

[0186] (A) A protein comprising the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12.

[0187] (B) A protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12, and having factor B activity.

[0188] (C) A protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11 and having factor B activity.

[0189] (D) A protein having factor B activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11.

[0190] In addition, examples of proteins having factor B activity include the following proteins.

[0191] (III) A protein comprising the amino acid sequence of a protein having factor B activity of horseshoe crabs other than Limulus polyphemus.

[0192] (IV) is a protein which is a variant of the above-mentioned (III) and has factor B activity.

[0193] The description of the protein having factor B activity can refer to the description of <2> above.

[0194] According to the present invention, it is clarified for the first time that the protein (A) of the recombinant first protein retains the factor C activity. The protein (A) and its variant having such function are applied to activate a protein having factor B activity.

[0195] The protein having factor B activity used herein may be a protein obtained from a natural substance or an artificially produced protein (e.g., a recombinant second protein) as long as it has the above-mentioned structure and function. According to the present invention, it is possible for the first time to artificially and functionally express a recombinant second protein, and it is possible to stably produce the second protein with a certain quality without obtaining the second protein from natural horseshoe crabs. Therefore, the protein having factor B activity is preferably a recombinant second protein.

[0196] The activation of a protein having factor B activity using a recombinant first protein can be performed by bringing a molecule of the recombinant first protein (active form) into contact with a molecule of a protein having factor B activity (inactive form). In order to convert the recombinant first protein into an active form, the recombinant first protein (inactive form) and a protein having factor B activity (inactive form) can be brought into contact in the presence of endotoxin.

[0197] The conditions for this contact are not particularly limited as long as the recombinant first protein (active form) exhibits factor C activity and can activate the protein having factor B activity (when performed in the presence of endotoxin, the endotoxin can further activate the recombinant first protein). For example, the reaction conditions of a known lysate reagent can be used.

[0198] Whether a protein having factor B activity is activated can be confirmed by the method described in the Examples below.

[0199] <5>Application of recombinant second protein

[0200] The recombinant second protein can be used to activate a protein having procoagulant activity such as the third protein. In other words, the present invention includes a method for activating a protein having procoagulant activity, the method comprising the step of contacting the recombinant second protein with a protein having procoagulant activity.

[0201] Examples of proteins having procoagulant activity include the third protein.

[0202] Specifically, the third protein is any of the following proteins.

[0203] (I) A protein comprising the amino acid sequence of a protein having procoagulant activity of the horseshoe crab Polyphemus polyphemus.

[0204] (II) is a protein which is a variant of the above-mentioned (I) and has procoagulant activity.

[0205] More specifically, the third protein may be any of the following proteins.

[0206] (A) A protein comprising the amino acid sequence shown in SEQ ID NO:14, 16, 18, 20, or 22.

[0207] (B) A protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20 or 22 and having procoagulant activity.

[0208] (C) A protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 13, 15, 17, 19 or 21 and having procoagulant activity.

[0209] (D) A protein having procoagulant activity which is encoded by a DNA which hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 13, 15, 17, 19 or 21.

[0210] In addition, examples of proteins having procoagulant activity include the following proteins.

[0211] (III) A protein comprising the amino acid sequence of a protein having procoagulant activity of horseshoe crabs other than Limulus polyphemus.

[0212] (IV) is a protein which is a variant of the above-mentioned (III) and has procoagulant activity.

[0213] The description of the protein having procoagulant activity can refer to the description of <3> above.

[0214] The protein having procoagulant activity used herein may be a protein obtained from a natural substance or an artificially produced protein (eg, a recombinant third protein) as long as it has the above-mentioned structure and function.

[0215] The activation of a protein having procoagulant activity using a recombinant second protein can be carried out by contacting a recombinant second protein (active form) molecule with a protein having procoagulant activity (inactive form) molecule. It should be noted that, in order to change the recombinant second protein to an active form, the recombinant second protein (inactive form) and the protein having procoagulant activity (inactive form) can be contacted in the presence of a protein having factor C activity (active form). Furthermore, in order to activate the protein having factor C activity, a protein having factor C activity (inactive form), a recombinant second protein (inactive form), and a protein having procoagulant activity (inactive form) can be contacted in the presence of endotoxin.

[0216] The conditions for the contact are not particularly limited as long as the recombinant second protein (active form) exhibits the B factor activity and can activate the protein having procoagulant activity (when the reaction is carried out in the presence of the protein having the C factor activity (active form), the protein having the C factor activity (active form) further exhibits the C factor activity and can activate the recombinant second protein. When the reaction is carried out in the presence of endotoxin, the endotoxin further activates the protein having the C factor activity). For example, the reaction conditions of the known Lysate reagent can be used.

[0217] The activation of the third protein can be confirmed by the method described in the Examples described later.

[0218] Examples of the protein having Factor C activity include the first protein.

[0219] Specifically, the first protein is any of the following proteins.

[0220] (I) A protein comprising the amino acid sequence of a protein having Factor C activity of the horseshoe crab Polyphemus polyphemus.

[0221] (II) is a protein which is a variant of the above-mentioned (I) and has Factor C activity.

[0222] More specifically, the first protein may be any of the following proteins.

[0223] (A) A protein comprising the amino acid sequence shown in SEQ ID NO: 2 or 4.

[0224] (B) A protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 2 or 4 and having Factor C activity.

[0225] (C) A protein encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 1 or 3 and having factor C activity.

[0226] (D) A protein having Factor C activity encoded by a DNA which hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence represented by SEQ ID NO: 1 or 3.

[0227] In addition, examples of proteins having Factor C activity include the following proteins.

[0228] (III) A protein comprising the amino acid sequence of a protein having Factor C activity of horseshoe crabs other than Limulus polyphemus.

[0229] (IV) is a protein which is a variant of the above-mentioned (III) and has factor C activity.

[0230] The description of the protein having factor C activity can refer to the description of <1> above.

[0231] The protein having Factor C activity used herein may be a protein obtained from a natural substance or an artificially produced protein (eg, a recombinant first protein) as long as it has the above-mentioned structure and function.

[0232] For other explanations, please refer to the above explanation of <4>.

[0233] <6>Application of recombinant tertiary protein

[0234] The recombinant third protein can be used to cleave a substrate. In other words, the present invention includes a method for cleaving a substrate, the method comprising the step of contacting the recombinant third protein with a substrate.

[0235] This substrate can also be used as the "detection substrate" and can be a natural substrate or a synthetic substrate. Such a substrate is not particularly limited as long as it is cleaved by the procoagulant activity of a protein (active form) having procoagulant activity such as the third protein (active form).

[0236] Examples of proteins that are cleaved due to procoagulant activity include proteins such as coagulogen, or a synthetic substrate represented by the general formula XYZ (wherein X- is a protecting group that forms a covalent bond with Y, Y is a peptide residue, and -Z is a signal substance that forms an amide bond with Y).

[0237] The protecting group X is not particularly limited, and a known protecting group for a peptide can be used. Examples of such protecting groups include tert-butoxycarbonyl and benzoyl.

[0238] The peptide residue Y is not particularly limited, and examples thereof include Leu-Gly-Arg (LGR) and Ile-Glu-Gly-Arg (IEGR) (SEQ ID NO: 23).

[0239] The signal substance Z is also not particularly limited, and examples thereof include dyes or fluorescent dyes that are detected under visible light. Examples of such dyes include pNA (p-nitroaniline), MCA (7-methoxycoumarin-4-acetic acid), DNP (2,4-dinitroaniline), and Dansyl dyes.

[0240] Among these substances, Boc-Leu-Gly-Arg-pNA (tert-butyloxycarbonyl-leucyl-glycyl-arginyl-p-nitroaniline; Boc-LGR-pNA) is preferred.

[0241] The cleavage of the substrate by the procoagulant activity can be detected by detecting "gelation" when coagulogen is used as the substrate, for example. Gelation can be detected by detecting a decrease in fluidity, for example, by visual inspection.

[0242] In addition, regarding the fact that the substrate is cut due to the activity of procoagulant, for example, when the synthetic substrate described above is used, the amide bond between Y and Z is cut and the signal Z is freed and emits a color or fluorescent signal, so it can be detected by detecting the signal. The detection of the signal can be performed by a method corresponding to the type of the signal. For example, the signal of pNA can be detected by absorbance (405nm).

[0243] The cleavage of the substrate using the recombinant third protein can be performed by contacting the recombinant third protein (active form) molecule with the substrate molecule. It should be noted that, in order to change the recombinant third protein to the active form, the recombinant third protein (inactive form) and the substrate can be contacted in the presence of a protein (active form) having factor B activity. Furthermore, in order to change the protein having factor B activity to the active form, the protein (inactive form) having factor B activity, the recombinant third protein (inactive form), and the substrate can be contacted in the presence of a protein (active form) having factor C activity. Furthermore, in order to change the protein having factor C activity to the active form, the protein (inactive form) having factor C activity, the protein (inactive form) having factor B activity, the recombinant third protein (inactive form), and the substrate can be contacted in the presence of endotoxin.

[0244] The conditions for the contact are not particularly limited as long as they are conditions under which the recombinant third protein (active form) can exert procoagulant activity and cleave the substrate (when the reaction is carried out in the presence of a protein (active form) having factor B activity, the protein (active form) having factor B activity can further exert factor B activity and activate the recombinant third protein. When the reaction is carried out in the presence of a protein (active form) having factor C activity, the protein (active form) having factor C activity can further exert factor C activity and activate the second protein. When the reaction is carried out in the presence of endotoxin, the endotoxin can further activate the protein having factor C activity). For example, the reaction conditions of a known lysate reagent can be used.

[0245] For other explanations, please refer to the above explanation of <4>.

[0246] <7> Endotoxin detection method

[0247] The method for detecting endotoxin of the present invention is a method for detecting endotoxin in a test subject, comprising the step of bringing a recombinant first protein into contact with the test subject.

[0248] The method may further include the step of contacting the recombinant first protein after contact with the subject with a protein having factor B activity such as a second protein. The protein having factor B activity may be the recombinant second protein.

[0249] In addition, the method may further include the step of contacting the protein having factor B activity after contacting the "recombinant first protein after contacting the subject" with a protein having procoagulant activity such as a third protein. The protein having procoagulant activity may be the recombinant third protein.

[0250] The detection of endotoxin in the subject can be performed by detecting the activation of the recombinant first protein after contact with the subject. The activation of the recombinant first protein can be confirmed by the method described in the examples described later. In addition, the activation of the recombinant first protein can also be directly detected using a substrate (detection substrate). That is, by using a substance that is cut off and emits a signal due to the C factor activity of the activated recombinant first protein as a detection substrate, the activation of the recombinant first protein can be directly detected. Therefore, the method may further include a step of contacting the "recombinant first protein after contact with the subject" with a detection substrate.

[0251] In the case where the method further comprises the step of contacting with a protein having factor B activity, the method can be performed by detecting the activation of the protein having factor B activity using the method described in <4> above. In addition, the activation of the protein having factor B activity can also be directly detected using a substrate (detection substrate). That is, by using a substance that is cleaved and emits a signal due to the factor B activity of the activated protein having factor B activity as a detection substrate, the activation of the protein having factor B activity can be directly detected. Therefore, the method can further comprise the step of contacting the "protein having factor B activity after contacting with the recombinant first protein" with a detection substrate.

[0252] In the case where the step of contacting with a protein having procoagulant activity is further included, the method can be performed by detecting the activation of the protein having procoagulant activity by the method described in <5> above (using the cleavage of the substrate by the method described in <6> above). Therefore, the method can further include the step of contacting the "protein having procoagulant activity after contacting with the protein having factor B activity" with a substrate (detection substrate). Examples of the detection substrate that can detect the activation of the protein having procoagulant activity include the substances exemplified in <6> above.

[0253] These steps may be performed sequentially or simultaneously. For example, when these steps are performed simultaneously, the test object, the recombinant first protein (inactive), the protein having factor B activity (inactive), the protein having procoagulant activity (inactive), and the detection substrate may be contacted simultaneously in the same system.

[0254] These contact conditions are the same as the conditions described in <4> to <6> above. For example, as far as the contact between the recombinant first protein and the test subject is concerned, there is no particular limitation as long as the endotoxin in the test subject can activate the recombinant first protein. The contact conditions can adopt, for example, the reaction conditions of the well-known Lysate reagent. For example, as the pH of the reaction solution, pH 5 to 10, preferably 7 to 8.5, can be adopted. As the reaction temperature, 10°C to 80°C, preferably 20°C to 50°C, and more preferably 30°C to 40°C can be adopted. As the reaction temperature, 37°C can be exemplified. The reaction time is also not particularly limited and can be appropriately set according to various conditions. The reaction time can be, for example, 5 minutes to 2 hours, preferably 15 minutes to 90 minutes, and more preferably 30 minutes to 40 minutes.

[0255] The test object is not particularly limited as long as it is a sample that needs to be tested for endotoxin. Examples of the test object include: medical water, pharmaceuticals, infusions, blood products, medical equipment, medical instruments, cosmetics, food and beverages, environmental samples, biological components, natural proteins, recombinant proteins, nucleic acids, and sugars. As for the test object, it can be mixed, dispersed, or dissolved in the reaction system by itself or its extract or cleaning solution for endotoxin detection.

[0256] The detection of endotoxin can be a qualitative detection or a quantitative detection. Quantitative detection can be performed, for example, as follows: using a plurality of standard samples with different endotoxin amounts (concentrations), the relationship between the amount (concentration) and the detection level corresponding to the type of substrate (for example, the degree of "gelation" when coagulogen is used as a substrate, and the degree of signal when a synthetic substrate is used) is pre-associated using, for example, a standard curve or a relational expression, and the endotoxin amount (concentration) is converted from the detection level when an actual test subject is used.

[0257] <8>Endotoxin detection reagent

[0258] The endotoxin detecting agent of the present invention is an endotoxin detecting agent containing a recombinant first protein.

[0259] The detection agent may further include a protein having factor B activity, such as a second protein. The protein having factor B activity may be a recombinant second protein.

[0260] The detection agent may further contain a protein having procoagulant activity such as a third protein. The protein having procoagulant activity may be a recombinant third protein.

[0261] As described in <1> to <3> above, these proteins may be present in, for example, a culture solution, a culture supernatant, a cell disrupted extract, or a mixture thereof. These proteins may be purified to a desired degree before use, or may be used directly without purification. For example, when these proteins are contained in a culture supernatant, they may be used in a state containing the culture medium components.

[0262] The amounts of the recombinant first protein, the protein having factor B activity, and the protein having procoagulant activity in the detection agent can be appropriately set according to the activity of each protein, etc. For example, the final concentration of each protein in the reaction solution mixed with the specimen can be 15 to 30 μg / mL.

[0263] The detection agent may further contain a substrate (detection substrate).

[0264] The detection agent can be manufactured by containing these substances as constituent components. The detection agent can also contain additives such as excipients, stabilizers, buffers, etc. In addition, the shape of the detection agent is not particularly limited, and can be formulated in any form such as solid (e.g., freeze-dried form) or liquid.

[0265] In the detection agent, these substances may be stored together as constituent components in an integrated container, or may be stored in separate containers.

[0266] In addition, the detection agent may further include a buffer for dissolution, an endotoxin standard, a reaction container (eg, a tube or a microplate), etc. The detection agent may also be in the form of a kit.

[0267] This detection agent can be used in the method described in <7> above, for example.

[0268] <9> The first cDNA and its application

[0269] (1) 1st cDNA

[0270] The first cDNA is any of the following cDNAs.

[0271] (A) cDNA containing the base sequence shown in SEQ ID NO: 1 or 3.

[0272] (B) A cDNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 1 or 3 and encoding a protein having Factor C activity.

[0273] (C) A cDNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 1 or 3 and encodes a protein having Factor C activity.

[0274] (D) cDNA encoding a protein containing the amino acid sequence shown in SEQ ID NO: 2 or 4.

[0275] (E) A cDNA encoding a protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 2 or 4 and having Factor C activity.

[0276] This cDNA was obtained for the first time in the world by the method disclosed in the Examples of this specification, and its full-length sequence structure and the function of the protein encoded thereby were clarified for the first time. This function is "Factor C activity".

[0277] Among the first cDNAs, the cDNA (A) described above is most preferred, but the protein encoded thereby may be a variant of these cDNAs as long as it has Factor C activity.

[0278] Specifically, the variants are preferably cDNAs of (B) to (E). The "95% or more" in (B), (C), and (E) is preferably 96% or more, more preferably 97% or more, more preferably 98% or more, and more preferably 99% or more.

[0279] In addition, the meaning of "strict conditions" and other explanations can refer to the explanation in <1> above.

[0280] In addition, the first cDNA may be a cDNA in which any codon is substituted with a codon equivalent thereto. For example, a cDNA in which any codon is substituted with a codon equivalent thereto in the cDNA of (A) above is included in (D) above.

[0281] As for the first cDNA, since the present invention discloses its complete base sequence, it can be produced by a known DNA synthesis method or a genetic engineering method using the sequence information. The first cDNA is first obtained by the method described in the examples described below, but its base sequence has been disclosed in the present invention, so it can also be produced by methods other than the methods described in the examples.

[0282] (2) DNA construct containing first cDNA, transformed cell, and method for producing recombinant first protein using the same

[0283] The present invention provides a DNA construct containing the first cDNA. As such an artificial DNA construct, for example, a vector can be exemplified. As a vector, plasmids, viruses, and other known vectors can be appropriately selected according to the purposes of amplification, maintenance, introduction, library preparation, cloning, protein translation (protein expression), etc. of recombinant DNA. By introducing the first cDNA into such a vector, a DNA construct containing the first cDNA can be manufactured.

[0284] In addition, the present invention provides a cell containing the first cDNA. Such a cell may be, for example, a cell transformed with such a DNA construct to express the recombinant first protein. In addition, the present invention provides a method for producing the recombinant first protein, comprising the step of culturing such a cell.

[0285] The method of transforming cells (host cells) with a DNA construct and culturing the cells to produce the recombinant first protein can refer to the description in <1> (2) above.

[0286] <10>2nd cDNA

[0287] (1) 2nd cDNA

[0288] The second cDNA is any of the following cDNAs.

[0289] (A) cDNA comprising the base sequence shown in SEQ ID NO: 5, 7, 9, or 11.

[0290] (B) A cDNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11, and encoding a protein having factor B activity.

[0291] (C) A cDNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11 and encodes a protein having factor B activity.

[0292] (D) cDNA encoding a protein containing the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12.

[0293] (E) A cDNA encoding a protein having an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12 and having factor B activity.

[0294] The other explanations can be based on the explanations in <9> (1) above. For example, in <9> (1) above, "factor C" can be replaced by "factor B", and "first cDNA" can be replaced by "second cDNA".

[0295] (2) DNA construct containing the second cDNA, transformed cells, and method for producing a recombinant second protein using the same

[0296] The present invention provides a DNA construct containing a second cDNA. In addition, the present invention provides a cell containing a second cDNA, such as a cell transformed with the DNA construct and expressing a recombinant second protein. In addition, the present invention provides a method for producing a recombinant second protein, which comprises the step of culturing the cell.

[0297] For other explanations, reference can be made to the above-mentioned explanation of <9> (2).

[0298] <11>3rd cDNA

[0299] (1) 3rd cDNA

[0300] The third cDNA is any of the following third cDNAs.

[0301] (A) cDNA comprising the base sequence shown in SEQ ID NO: 13, 15, 17, 19, or 21.

[0302] (B) A cDNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 13, 15, 17, 19, or 21, and encoding a protein having procoagulant activity.

[0303] (C) A cDNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 13, 15, 17, 19, or 21 and encodes a protein having procoagulant activity.

[0304] (D) cDNA encoding a protein containing the amino acid sequence shown in SEQ ID NO:14, 16, 18, 20, or 22.

[0305] (E) A cDNA encoding a protein having an amino acid sequence having 95% or more homology to the amino acid sequence shown in SEQ ID NO: 14, 16, 18, 20, or 22 and having procoagulant activity.

[0306] The other explanations can be referred to the explanation of <9> (1) above. That is, for example, "factor C" in <9> (1) above may be replaced by "procoagulant", "first cDNA" may be replaced by "third cDNA", and the like.

[0307] (2) DNA construct containing the third cDNA, transformed cells, and method for producing a recombinant third protein using the same

[0308] The present invention provides a DNA construct containing a third cDNA. In addition, the present invention provides a cell containing a third cDNA, such as a cell transformed with the DNA construct and expressing a recombinant third protein. In addition, the present invention provides a method for producing a recombinant third protein, which comprises the step of culturing the cell.

[0309] For other explanations, reference can be made to the above-mentioned explanation of <9> (2).

[0310] <12> Method for producing endotoxin detection agent

[0311] The present invention also provides a method for producing an endotoxin detecting agent, comprising the step of artificially expressing a protein using a first cDNA.

[0312] The method may further include the step of artificially expressing the protein using the second cDNA. In addition, the method may further include the step of artificially expressing the protein using the third cDNA.

[0313] The method for artificially expressing proteins using these cDNAs is not particularly limited, and for example, the methods described in <9> (2), <10> (2), and <11> (2) above can be used.

[0314] By artificially expressing using the first cDNA in this way, the first recombinant protein is expressed. Similarly, by further artificially expressing using the second cDNA, the second recombinant protein is expressed, and by artificially expressing using the third cDNA, the third recombinant protein is expressed.

[0315] The expressed protein may be in the form of, for example, a culture solution, a culture supernatant, a cell fragment extract, or a mixture thereof, as described in <1> to <3> above. These proteins may be purified to a desired degree before use, or may be used directly without purification. For example, when these proteins are contained in the culture supernatant, they may be used in a state containing the culture medium components.

[0316] For other explanations, the explanations in <8> above can be cited. Therefore, the method for producing an endotoxin detecting agent of the present invention also includes a method for producing a kit.

[0317] It should be noted that in the present invention, any one or both of the second protein (recombinant second protein, etc.) and the third protein (recombinant third protein, etc.) can be replaced with their counterparts derived from horseshoe crabs other than the American horseshoe crab. The same applies to the second cDNA and the third cDNA. As horseshoe crabs other than the American horseshoe crab, organisms belonging to the genus Tachypleus, such as the Chinese horseshoe crab (Tachypleustridentatus), the giant horseshoe crab (Tachypleus gigas), and the Southeast Asian horseshoe crab (Tachypleus rotundicauda) can be cited.

[0318] That is, the second protein (recombinant second protein, etc.) can be replaced by factor B (recombinant factor B, etc.) derived from horseshoe crabs other than the American horseshoe crab (Chinese horseshoe crab, etc.), the third protein (recombinant third protein, etc.) can be replaced by procoagulant (recombinant procoagulant, etc.) derived from the above-mentioned organisms, the second cDNA can be replaced by factor B genes (cDNA, etc.) derived from the above-mentioned organisms, and the third cDNA can be replaced by procoagulant genes (cDNA, etc.) derived from the above-mentioned organisms.

[0319] These proteins or genes may contain amino acid sequences or base sequences actually found in horseshoe crabs other than Limulus polyphemus, or may be variants thereof. Regarding variants, the descriptions of variants in <1> to <11> above may be cited. In addition, these proteins or genes may or may not be derived from the same horseshoe crab other than Limulus polyphemus.

[0320] Moreover, it can be seen from the above description that the method for producing the endotoxin detection agent of the present invention also includes the following method: the first cDNA, the second cDNA, and the third cDNA (regarding the second cDNA and the third cDNA, any one or both of them can be replaced by genes derived from horseshoe crabs other than American horseshoe crabs (such as Chinese horseshoe crabs)) are artificially introduced into host cells other than horseshoe crabs, and respective recombinant proteins (a total of 3 types) are expressed from these respective cDNAs, and then, as described in <8> above, these respective recombinant proteins expressed are contained as constituent components.

[0321] Example

[0322] Hereinafter, the present invention will be specifically described by way of Examples. However, these Examples are intended to illustrate the present invention, and the scope of the present invention is not limited to these Examples.

[0323] (1) Primer synthesis

[0324] In order to attempt to clone a protein having Factor C activity in the horseshoe crab, the following primers were synthesized.

[0325] <Primers for cloning a protein having factor C activity>

[0326] SK15-dT20: CTGCAGGAATTCGATTTTTTTTTTTTTTTTTTTT (serial number 24)

[0327] SK15-FC-S: ATCGATAAGCTTGATGATCTGGGCTTGTGTGATGA (serial number 25)

[0328] SK15-As: CTGCAGGAATTCGAT (sequence number 26)

[0329] LFC-5race: CTACACCAAGTTCCA (sequence number 27)

[0330] LFC-1st-S: GTAAACCATGTGACAAACTGGAGGC (sequence number 28)

[0331] LFC-1st-As: AATAAGGCCTCCATCGATAGAAGTA (sequence number 29)

[0332] LFC-EcoRI-kozak-S: GGGGAATTCAAGCTTGCCACCATGGTACTAGCGTCGTTC (serial number 30)

[0333] LFC-XhoI-stop-As: GGGCTCGAGTCAAATGAACTGCCGAATCCACGATA (SEQ ID NO: 31)

[0334] In addition, the following primers were synthesized in order to attempt to clone a protein having factor B activity and a protein having procoagulant activity.

[0335] <Primers for cloning a protein having factor B activity and a protein having procoagulant activity>

[0336] SK15-FB-S: ATCGATAAGCTTGATCACATGCAAGGAAAAGTTCT (serial number 32)

[0337] SK15-FB-As: CTGCAGGAATTCGATCACTGTTTAAACAAACTGAA (serial number 33)

[0338] SK15-PCE-S: ATCGATAAGCTTGATAGACCAGAGTGGTCTTTCTG (serial number 34)

[0339] SK15-As: CTGCAGGAATTCGAT (sequence number 26)

[0340] (2) Preparation of total RNA from blood cells of horseshoe crab

[0341] Total RNA was prepared using PureLink (registered trademark) RNA Mini Kit and PureLink (registered trademark) DNase kit (Thermo Fisher Scientific), and basic operations were performed according to the attached instructions. TRIzol solution was added to 2.23 g of the blood cell pool of American horseshoe crab to disrupt the cells. Thereafter, chloroform was added thereto and centrifuged to obtain an aqueous layer. After adding ethanol to the obtained aqueous layer, it was passed through the silica membrane box attached to the kit, thereby bonding the nucleic acid components to the silica membrane. DNaseI attached to the kit was added to the silica membrane to decompose the DNA. After washing the box, an elution buffer was added to recover the total RNA (1.3 mg).

[0342] (3) Obtaining cDNA (first cDNA) of a protein having Factor C activity from the horseshoe crab

[0343] (3-1) Step 1

[0344] The total RNA recovered in (2) above was used as a template, and a reverse transcription reaction was performed using SK15-d20 (SEQ ID NO: 24) as a primer to obtain cDNA. This primer is designed to selectively bond to the poly A sequence of mRNA, and further has an additional sequence that can be used for polymerase chain reaction (PCR) on its outside. In this reaction, SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) was used as a reverse transcriptase, and the reaction conditions were in accordance with the attached instructions.

[0345] (3-2) Step 2

[0346] PCR was performed using the obtained cDNA as a template, SK15-FC-S (SEQ ID NO: 25) as a sense chain primer, SK15-As (SEQ ID NO: 26) as an antisense chain primer, and Tks Gflex DNA polymerase (Takara Bio) as a polymerase.

[0347] The PCR products were confirmed by agarose gel electrophoresis. As a result, the target DNA (LpFC1) was hardly detected, and nonspecific DNA amplification was detected ( Figure 1 A). Therefore, the following steps were tried. It should be noted that Figure 1 The band "1" in A is a size marker, and the band "2" is a PCR product. In addition, the triangle symbol indicates the part where LpFC1 is expected to exist.

[0348] (3-3) Step 3

[0349] The portion where LpFC1 is expected to be present was cut out from the gel, and the DNA was extracted and purified. PCR was performed using this as a template, SK15-FC-S (SEQ ID NO: 25) as a sense strand primer, SK15-As (SEQ ID NO: 26) as an antisense strand primer, and TksGflex DNA polymerase (Takara Bio) as a polymerase.

[0350] The results of agarose gel electrophoresis of the PCR products showed that the target DNA (LpFC1) was significantly amplified ( Figure 1 B) LpFC1 was cut out from the gel, extracted, and purified. Thus, a partial fragment of DNA (LpFC1) that may encode a protein with factor C activity of the American horseshoe crab was successfully obtained. It should be noted that Figure 1The band "1" in B is a size marker, and the band "2" is a PCR product. In addition, the triangle symbol indicates the position of LpFC1.

[0351] (3-4) Step 4

[0352] LpFC1 was mixed with pBluescript II SK(+) treated with EcoRV enzyme, and the vector was introduced by recombination reaction using In-Fusion HD Enzyme premix (Takara Bio). The reaction product was transformed into E. coli DH5α competent cells, spread on ampicillin LB medium plates containing X-Gal and IPTG, and colonies were selected by blue-white screening.

[0353] Afterwards, DNA amplification was performed by colony PCR for candidate colonies. At this time, M13-20 Primer was used as a positive strand primer, M13 Reverse Primer was used as an antisense strand primer, and Tks Gflex DNA polymerase (Takara Bio) was used as a polymerase. The obtained PCR product was subjected to agarose gel electrophoresis, cut out and extracted from the gel, and the sequence was confirmed by sequencing PCR using purified DNA (LpFC1) as a template. Thus, the DNA sequence of LpFC1 was determined.

[0354] (3-5) Step 5

[0355] The 5' end of synthetic DNA LFC-5race (SEQ ID NO. 27) prepared with reference to the sequence information of LpFC1 was phosphorylated using T4 Polynucleotide Kinase (Takara Bio) in the presence of ATP. The total RNA was used as a template, and the target DNA (LpFC2) was obtained by reverse transcription reaction using the obtained phosphorylated primer and reverse transcriptase SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). Thus, a partial fragment (LpFC2) of DNA that may encode a part of the amino acid sequence of a protein having Factor C activity of the horseshoe crab was obtained.

[0356] LpFC2 was treated at high temperature (95°C, 2 minutes) in the presence of RNase A, and then ethanol precipitated. Subsequently, it was treated with T4 RNA Ligase (New England Biolabs), and as a result, concatemerized DNA (LpFC3) to which LpFC2 was continuously linked was obtained. Thus, a partial fragment of DNA (LpFC3) that may encode a part of the amino acid sequence containing a protein having factor C activity of the horseshoe crab was obtained.

[0357] The target DNA (LpFC4) was amplified by PCR using LpFC3 as a template, LFC-1st-S (SEQ ID NO: 28) as a positive chain primer, LFC-1st-As (SEQ ID NO: 29) as an antisense chain primer, and Tks Gflex DNA polymerase (Takara Bio).

[0358] The PCR products were confirmed by agarose gel electrophoresis. As a result, the target DNA (LpFC4) was hardly detected, and nonspecific DNA amplification ( Figure 2 A). Therefore, try the following steps. It should be noted that Figure 2 The band "1" in A is a size marker, and the band "2" is a PCR product. In addition, the triangle symbol indicates the position of LpFC4.

[0359] (3-6) Step 6

[0360] The portion where LpFC4 was expected to be present was cut out from the gel, and the DNA was extracted and purified. PCR was performed using this as a template, LFC-1st-S (SEQ ID NO: 28) as a sense strand primer, LFC-1st-As (SEQ ID NO: 29) as an antisense strand primer, and Tks Gflex DNA polymerase (Takara Bio) as a polymerase.

[0361] The PCR products were subjected to agarose gel electrophoresis. Surprisingly, the target DNA (LpFC4) was significantly amplified and detected at a very high concentration ( Figure 2 B). LpFC4 was cut out from the gel, extracted, and purified. Thus, a partial fragment of DNA (LpFC4) that may encode a part of the amino acid sequence of a protein having Factor C activity of the horseshoe crab was successfully obtained. It should be noted that Figure 2 The band "1" in B is a size marker, and the band "2" is a PCR product. In addition, the triangle symbol indicates the part where LpFC4 is expected to exist.

[0362] The sequence of LpFC4 was analyzed by sequencing PCR using LpFC4 as a template, thereby identifying the DNA sequence on the 5' side of the target protein.

[0363] (3-7) Step 7

[0364] PCR was performed using the cDNA obtained in (3-1) as a template, LFC-EcoRI-kozak-S (sequence number 30) as a sense chain primer, LFC-XhoI-stop-As (sequence number 31) as an antisense chain primer, and Tks Gflex DNA polymerase (Takara Bio) as a polymerase.

[0365] The PCR product was extracted with phenol-chloroform, purified by ethanol precipitation, and then treated with EcoRI and XhoI. The restriction enzyme-treated product was subjected to agarose gel electrophoresis and cut out from the gel, and the DNA was extracted and purified to obtain the target DNA (LpFC5).

[0366] The expression vector pCA7 (Takeda et al., 2005, J virol 79: 14346-14354) in which LpFC5 was treated with EcoRI and XhoI was mixed and ligated using Ligation Mix (Takara Bio). The reaction product was transformed into E. coli DH5α competent cells and spread on LB medium plates containing ampicillin. The obtained colonies were selected by colony PCR and inoculated on LB medium containing ampicillin.

[0367] After the culture, the plasmid was purified using NucleoSpin (registered trademark) Plasmid Easy Pure (Machalai Nager), and the base sequences of the two clones were analyzed by sequencing PCR using the plasmids obtained as templates.

[0368] Thus, the full-length sequence of cDNA encoding a protein with the potential of having Factor C activity of horseshoe crab (SEQ ID NO. 1, SEQ ID NO. 3) and the full-length sequence of amino acids of the protein (SEQ ID NO. 2, SEQ ID NO. 4) were successfully elucidated for the first time. The relationship between SEQ ID NO. 1 and 3 (SEQ ID NO. 2 and 4) is a variant, which is believed to be based on polymorphism between individuals. The expression and activity analysis of the protein will be described later.

[0369] (4) Obtaining cDNA (second cDNA) of a protein having factor B activity from the horseshoe crab Polyphemus polyphemus

[0370] PCR was performed using the cDNA obtained in (3-1) as a template, SK15-FB-S (SEQ ID NO. 32) as a sense strand primer, SK15-FB-As (SEQ ID NO. 33) as an antisense strand primer, and Tks Gflex DNA polymerase (TakaraBio) as a polymerase. The amplified fragments were cloned using the same steps as in (3-4) above, and the base sequences of the four clones obtained were analyzed.

[0371] Thus, the full-length sequences of cDNA encoding proteins that may have B factor activity of horseshoe crab (SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11) and the full-length sequences of amino acids of the proteins (SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12) were clarified. The relationship between the existence of variants in SEQ ID NOs. 5, 7, 9 and 11 (SEQ ID NOs. 6, 8, 10 and 12) is considered to be based on polymorphism between individuals. The expression and activity analysis of the protein will be described later.

[0372] (5) Obtaining cDNA (third cDNA) of a protein having procoagulant activity from the horseshoe crab

[0373] PCR was performed using the cDNA obtained in (3-1) as a template, SK15-PCE-S (SEQ ID NO: 34) as a sense strand primer, SK15-As (SEQ ID NO: 26) as an antisense strand primer, and Tks Gflex DNA polymerase (Takara Bio) as a polymerase. The amplified fragments were cloned using the same steps as in (3-4) above, and the base sequences of the five clones obtained were analyzed.

[0374] Thus, the full-length sequences of cDNA encoding proteins with the possibility of procoagulant activity of horseshoe crab (SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 19, SEQ ID NO. 21) and the full-length sequences of amino acids of the proteins (SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 18, SEQ ID NO. 20, SEQ ID NO. 22) were clarified. The relationship between the existence of variants of sequence numbers 13, 15, 17, 19 and 21 (sequence numbers 14, 16, 18, 20 and 22) is considered to be based on polymorphism between individuals. The expression and activity analysis of the protein will be described later.

[0375] (6) Expression of recombinant proteins

[0376] The cDNA (SEQ ID NO. 13) obtained in (5) above was connected to the protein expression vector pCA7 in mammalian cells to obtain an expression plasmid. The cDNA (SEQ ID NO. 5) obtained in (4) above was connected to the protein expression vector pCA7 according to the literature (Kobayashi et al., 2015, J Biol Chem, 290: 19379-19386) to obtain an expression plasmid. These expression plasmids and the expression plasmids obtained in (3-7) above (plasmids recombinant with the cDNA of SEQ ID NO. 1) and ExpiCHO TM Expression System (Thermo Fisher Scientific), and each recombinant protein was obtained in the form of culture supernatant fraction.

[0377] The transfection of expression plasmids into cells and the recovery of recombinant proteins were carried out according to the attached instructions.

[0378] As a result, the first success in expressing and obtaining a protein (SEQ ID NO. 2) that may have factor C activity, a protein (SEQ ID NO. 6) that may have factor B activity, and a protein (SEQ ID NO. 14) that may have procoagulant activity in horseshoe crab was achieved. The activity analysis of these proteins will be described later.

[0379] (7) Activity assay

[0380] In the presence of 50 mM Tris buffer (pH 8.0) and a synthetic substrate (Boc-LGR-pNA), various combinations of the three recombinant proteins obtained in (6) above were examined using United States Pharmacopoeia standard endotoxin (USP-RSE. Seikagaku Kogyo Co., Ltd.) (0 EU / mL, 0.05 EU / mL. EU is endotoxin unit) as the test substance to study the activation of the three recombinant proteins dependent on endotoxin. The reaction was carried out at 37°C for 30 minutes.

[0381] If a cascade reaction is performed in this analytical system, a protein having factor C activity is activated under the action of endotoxin, and a protein having factor B activity is activated by the activated protein having factor C activity, and a protein having prothrombin activity is activated by the activated protein having factor B activity, and the synthetic substrate Boc-LGR-pNA is cleaved by the activated protein having prothrombin activity, thereby releasing pNA. The release of pNA is detected by measuring the change in absorbance (A405nm). As a result, when all three recombinant proteins are present, the cleavage of the synthetic substrate ( Figure 3 ). It should be noted that Figure 3In the above, FC is the protein expressed by the cDNA obtained in (3-7), FB is the protein expressed by the cDNA obtained in (4), and PCE is the protein expressed by the cDNA obtained in (5). The final protein concentrations in the reaction solution (100 μL) mixed with the endotoxin test substance were 22.8 μg / mL for FC, 20.0 μg / mL for FB, and 23.5 μg / mL for PCE. Each analysis was performed with N=3, and the standard deviation was recorded in the figure as an error bar.

[0382] This figure shows for the first time that the expressed protein that may have factor C activity, the protein that may have factor B activity, and the protein that may have procoagulant activity have factor C activity, factor B activity, and procoagulant activity, respectively, and that a cascade reaction occurs when they come into contact with endotoxin. In addition, it is shown for the first time that endotoxin can be detected using these recombinant proteins.

[0383] Furthermore, the concentration dependence of endotoxin was studied under the same conditions and a standard curve was prepared. As a result, good linearity was shown in the concentration range of 0.001 to 0.1 EU / mL ( Figure 4 ) The analysis at each endotoxin concentration was performed with N=3, and the standard deviation was used as an error bar and recorded in the figure.

[0384] The above results show for the first time that the use of the three recombinant proteins can also perform quantitative detection of endotoxin with high sensitivity and high accuracy.

[0385] (8) Comparison of activity with recombinant Factor C from horseshoe crab

[0386] The activities of recombinant Factor C derived from Limulus polyphemus (hereinafter, "LFC") and recombinant Factor C derived from Tachypleus (hereinafter, "TFC") were compared.

[0387] The cDNA of sequence number 1 was expressed in the same manner as in (6) above, and LFC was obtained in the form of a culture supernatant fraction. The factor C gene of Chinese horseshoe crab (sequence number 1 of WO2014 / 092079) was expressed in the same manner as in (6) above using the method described in Example 1. (2) of the document, and TFC was obtained in the form of a culture supernatant fraction. Here, pCI-neo (Promega) was used as a protein expression vector.

[0388] Western blotting was performed on the LFC and TFC used in the experiment using a monoclonal antibody specific for factor C (2C12; Yoshiki Miura, et al., J. Biochem. 112: 476-481 (1992)). Equal volumes of samples (3 μL each) were injected, and the results of optical measurement of band intensity showed that LFC was 18036 and TFC was 24516. That is, the relative amount of recombinant factor C in the equal volume samples (TFC / LFC) was 1.4.

[0389] Next, the activity of each recombinant factor C in the cascade reaction system (a system containing factor C, factor B, and prothrombin) was compared. Both factor B and prothrombin used recombinant proteins derived from the genus Limulus. The former used the factor B gene of Chinese horseshoe crab (sequence number 5 of WO2014 / 092079) to express with the method described in the document (Example 2. Preparation of recombinant factor B and recombinant prothrombin) to obtain it in the form of culture supernatant components, and the latter used the prothrombin gene of the organism (sequence number 7 of the same document) to express with the method described in the document (Example 2. Preparation of recombinant factor B and recombinant prothrombin) to obtain it in the form of culture supernatant components.

[0390] The activity was measured by the method described in (7) above using samples of recombinant factor C (LFC or TFC) (all in equal volumes), the recombinant factor B (TFB) derived from Chinese horseshoe crab, and the recombinant procoagulant (TPCE) derived from Chinese horseshoe crab. The conditions other than the recombinant factor C used were kept the same.

[0391] The changes in absorbance (mAbs / min) at each endotoxin concentration of 0 EU / mL (blank) and 0.05 EU / mL in each cascade reaction system were 0.53 and 14.27 in the LFC system, and 0.51 and 9.15 in the TFC system. That is, in this system, LFC showed an activity of about 1.6 times (about 2.2 times if the above-mentioned difference in protein amount is taken into account) that of TFC.

[0392] The present invention includes the following aspects:

[0393] 1. A recombinant protein, which is any of the following:

[0394] (A) a recombinant protein comprising the amino acid sequence shown in SEQ ID NO: 2 or 4;

[0395] (B) a recombinant protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence of SEQ ID NO: 2 or 4 and having Factor C activity;

[0396] (C) a recombinant protein having Factor C activity, which is encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 1 or 3;

[0397] (D) A recombinant protein having Factor C activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence represented by SEQ ID NO: 1 or 3.

[0398] 2. Use of the recombinant protein described in item 1 for activating the following proteins:

[0399] (A) a protein comprising the amino acid sequence shown in SEQ ID NO: 6, 8, 10, or 12;

[0400] (B) a protein comprising an amino acid sequence having 95% or more homology to the amino acid sequence of SEQ ID NO: 6, 8, 10, or 12, and having factor B activity;

[0401] (C) a protein having factor B activity, which is encoded by a DNA comprising a base sequence having 95% or more homology to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11;

[0402] (D) A protein having factor B activity encoded by a DNA that hybridizes under stringent conditions with a DNA comprising a complementary sequence to the base sequence shown in SEQ ID NO: 5, 7, 9, or 11.

[0403] 3. A method for detecting endotoxin in a subject, comprising the step of bringing the recombinant protein according to item 1 into contact with the subject.

[0404] 4. An endotoxin detection agent comprising the recombinant protein described in item 1.

[0405] The disclosure of Japanese Patent Application No. 2016-204729 (filing date: October 18, 2016) is incorporated herein by reference in its entirety.

[0406] All documents, patent applications, and technical standards described in this specification are incorporated by reference. Each document, patent application, and technical standard is incorporated by reference into this specification to the same extent as if it were specifically and individually described.

[0407] Industrial Applicability

[0408] According to the present invention, all full-length recombinant proteins related to the coagulation mechanism of horseshoe crab, cDNA encoding these recombinant proteins, and uses of these recombinant proteins can be provided. The present invention is particularly useful for the detection of endotoxin.

[0409] [Description of Sequence Listing]

[0410] SEQ ID NO. 1: Base sequence of the first cDNA

[0411] SEQ ID NO: 2: Amino acid sequence of protein 1

[0412] SEQ ID NO: 3: Base sequence of cDNA variant 1

[0413] SEQ ID NO: 4: Amino acid sequence of protein 1 - variant 1

[0414] SEQ ID NO: 5: Base sequence of the second cDNA

[0415] SEQ ID NO: 6: Amino acid sequence of protein No. 2

[0416] SEQ ID NO: 7: Base sequence of the second cDNA variant 1

[0417] SEQ ID NO: 8: Amino acid sequence of the second protein variant 1

[0418] SEQ ID NO: 9: Base sequence of the second cDNA variant 2

[0419] SEQ ID NO: 10: Amino acid sequence of protein 2 - variant 2

[0420] SEQ ID NO: 11: Base sequence of the second cDNA variant 3

[0421] SEQ ID NO: 12: Amino acid sequence of the second protein - variant 3

[0422] SEQ ID NO: 13: Base sequence of cDNA No. 3

[0423] SEQ ID NO: 14: Amino acid sequence of protein 3

[0424] SEQ ID NO: 15: Base sequence of cDNA variant 1 No. 3

[0425] SEQ ID NO: 16: Amino acid sequence of protein 3 - variant 1

[0426] SEQ ID NO: 17: Base sequence of cDNA variant 2 No. 3

[0427] SEQ ID NO: 18: Amino acid sequence of protein 3 - variant 2

[0428] SEQ ID NO: 19: Base sequence of cDNA variant 3

[0429] SEQ ID NO: 20: Amino acid sequence of protein 3 - variant 3

[0430] SEQ ID NO: 21: Base sequence of cDNA variant 4 No. 3

[0431] SEQ ID NO: 22: Amino acid sequence of protein 3 - variant 4

[0432] SEQ ID NO: 23: Synthetic substrate peptide IEGR

[0433] SEQ ID NOs: 24 to 34: Primers Sequence Listing <110> Seikagaku Corporation <120> Recombinant protein from horseshoe crab and DNA encoding the recombinant protein <130> FB190136JPDIV <150> JP2016-204729 <151> 2016-10-18 <160> 34 <170> PatentIn version 3.5 <210> 1 <211> 3063 <212> DNA <213> American horseshoe crab (Limulus polyphemus) <400> 1 atggtactag cgtcgttctt ggtgtctggt ttagttctag ggctattagc ccaacaaatg 60 cacccagttc agtccagagg agtagatctg ggcttgtgtg atgacacgag gtttgagtgt 120 aagtgtggag atccaggata cgtgttcaac gtccccgcga agcaatgtac gtacttctat 180 cgatggaggc cttattgtaa accatgtgac aaactggagg ctaaagatgt gtgtcccaag 240 tacaaacgat gtcaagagtg tagggctggt ctcgacagtt gtgtgagttg tccacctaac 300 aaatatggaa cttggtgtag cggtgagtgt cagtgtaaga atgggggtat ttgtgatcag 360 aggacaggag cttgtacatg tcgtgacaga tatgaggtg tgcattgtga aatccttcaa 420 ggttgtccctc ttctcaatc ggatccccag gttcaggag taaaaaatcc accaaatgat 480 ccacaaacta ttgactacag ctgttcacca ggcttcaagc ttaaggcgt ggcacgtatc 540 acctgtcttc caaatgggca gtggagtagc tttccacca aatgtattcg agaatgttcc 600 atggtttcat cttagaaca tggcaagta aactctccta gtgccgatct gatagaagga 660 gctactttaa gctactttaa gctactcatg tgagtccc tactacttga tggtcaaga aacattaacc 720 tgccaggggca acggtcagtg gagtggggcag ataccacagt gtcagaaatt ggtcttctgc 780 cctgaccttg accctgtaag ccatgctgaa caccaggtta aaattggcct agaacaaaa 840 tatggtcaat ttcctcagg cactgaagta acctatacgt gtactggtaa ttactcttg 900 atggttttgg acaccttaaa atgtaccct gatgggtcct ggtcgggaac acagccgtcc 960 tgtgttaaag tggcagacag agaggtcaac tgtgacagta aagctgtgga cttcttggat 1020 gatgttggcg aacctgtcag gatccactgt cctgctggct gttccttaac tgctgtact 1080 gtatggggta cagccatata tcacgaactt tcctcagtat gtcgtgcagc tattcatgct 1140 ggcaaggttc caaactctgg aggtgcagtg catgtagtga acaacggtcc gtactcagac 1200 tttctggcta gtgatctgaa tgggataaaa tcagacgagt tgaagtctct tgctcagagt 1260 ttccgattcg attatgtcag ttcatcaaca gcagggagaa agtcaggatg tcctgatgga 1320 tggttcgaga ttgaggagaa ctgtgtgtac gttacatcga aacagagagc ctgggaaaga 1380 gctcaaggtg tatgtaccaa tatggccgct cgtcttgctg tgttagacaa agatgtaatt 1440 ccaagttcct tgactgagac tctacgaggg aaagggttag caacgacgtg gattggacta 1500 cacagattag atgctgataa tcactttatt tgggagctaa tggatcgcag tagtgttgct 1560 ttgaatgaca gcctaacatt ctgggctcct ggagaacctg ggaatgaaac taactgtgta 1620 tatctggata tccaagatca gctacagcca gtgtggaaaa ccaagtcttg ttttcaaccc 1680 tcaagttttg tttgtatgat ggatttgtca gacaagaaca aagccaaatg caaagaccct 1740 ggacctttgg aaaacggaca cgccaagctt catggtcaaa gtattgatgg attttatgct 1800 gggtcttctg taagatacag ctgcgaggtc ctccactacc tcagtggaac tgagacagta 1860 tcttgtacat caaatggcac gtggagtgcc cctaaacctc gatgtattaa agtcatcacc 1920 tgccaaaccc ctcctgtacc atcctatggt tctgtggaca tcaaaccccc aagtagaaca 1980 aactcaatca gtcgtgttgg gtcgccattc ttgaggttgc cacggttacc cctcccttta 2040 gccagagcag ccggacctcc tccaaaacct agatccgcac caccctctac tgtggacctg 2100 tcttccaagg tcaaactgcc tgaaggtcat taccgggtgg ggtctcaagc catttacacg 2160 tgcgagtcaa gatactacga actgcttgga tctcaaggta gaagatgcga ctctaatgga 2220 aagtggagtg gtcgaccagc aagctgtata ccagtttgtg gacggtcaga ctctccccgt 2280 tctcctttca tcgtcaatgg aaattccacc gaaataggtc agtggccgtg gcaggcagga 2340 atctccagat ggcttgcaga tcataatatg tggtttcttc agtgtggagg agctctactg 2400 aatgagaaat ggatcattac tgcagcccac tgtgtcacct actctgctac tgccgagatc 2460 attgacccaa gtcagtttaa attctacctg ggcaaatact atcgagatga cagtaaggat 2520 gatgactacg tacaagtaag agaggctatc gagatccatg tgaatcctaa ctacgatcct 2580 ggaaatctca actttgacat agccctgatt caactgaaga cttctgttgc tctgaccaca 2640 cgagtgcaac caatatgtct gcctactgat ctcactacaa gagaaaacct gaaagaggga 2700 gcgttagcgg tggtgacagg atggggtttg aatgaaaaca acacatattc agagatgatt 2760 cagcaagccg ttctgcctgt tgttgcagca agcacctgtg aacaaggata tcaggactcg 2820 ggcttgccac tgacagtgac agagaacatg ttctgtgcag gttacaagca ggggcgctat 2880 gatgcctgca gtggagacag tggaggacca ttagtgtttg ctgatgattc ccgcaccgat 2940 aggcggtggg tcctggaagg gatcgtcagc tggggcagcc ccaatggatg tggcaagtct 3000 aaccagtatg ggggcttcac taaagttaac gtttttctat cgtggattcg gcagttcatt 3060 tga 3063 <210> 2 <211> 1020 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 2 Met Val Leu Ala Ser Phe Leu Val Ser Gly Leu Val Leu Gly Leu Leu 1 5 10 15 Ala Gln Gln Met His Pro Val Gln Ser Arg Gly Val Asp Leu Gly Leu 20 25 30 Cys Asp Asp Thr Arg Phe Glu Cys Lys Cys Gly Asp Pro Gly Tyr Val 35 40 45 Phe Asn Val Pro Ala Lys Gln Cys Thr Tyr Phe Tyr Arg Trp Arg Pro 50 55 60 Tyr Cys Lys Pro Cys Asp Lys Leu Glu Ala Lys Asp Val Cys Pro Lys 65 70 75 80 Tyr Lys Arg Cys Gln Glu Cys Arg Ala Gly Leu Asp Ser Cys Val Ser 85 90 95 Cys Pro Pro Asn Lys Tyr Gly Thr Trp Cys Ser Gly Glu Cys Gln Cys 100 105 110 Lys Asn Gly Gly Ile Cys Asp Gln Arg Thr Gly Ala Cys Thr Cys Arg 115 120 125 Asp Arg Tyr Glu Gly Val His Cys Glu Ile Leu Gln Gly Cys Pro Leu 130 135 140 Leu Gln Ser Asp Pro Gln Val Gln Glu Val Lys Asn Pro Pro Asn Asp 145 150 155 160 Pro Gln Thr Ile Asp Tyr Ser Cys Ser Pro Gly Phe Lys Leu Lys Gly 165 170 175 Val Ala Arg Ile Thr Cys Leu Pro Asn Gly Gln Trp Ser Ser Phe Pro 180 185 190 Pro Lys Cys Ile Arg Glu Cys Ser Met Val Ser Ser Leu Glu His Gly 195 200 205 Lys Val Asn Ser Pro Ser Ala Asp Leu Ile Glu Gly Ala Thr Leu Arg 210 215 220 Phe Ser Cys Asp Ser Pro Tyr Tyr Leu Ile Gly Gln Glu Thr Leu Thr 225 230 235 240 Cys Gln Gly Asn Gly Gln Trp Ser Gly Gln Ile Pro Gln Cys Gln Lys 245 250 255 Leu Val Phe Cys Pro Asp Leu Asp Pro Val Ser His Ala Glu His Gln 260 265 270 Val Lys Ile Gly Leu Glu Gln Lys Tyr Gly Gln Phe Pro Gln Gly Thr 275 280 285 Glu Val Thr Tyr Thr Cys Thr Gly Asn Tyr Phe Leu Met Gly Leu Asp 290 295 300 Thr Leu Lys Cys Asn Pro Asp Gly Ser Trp Ser Gly Thr Gln Pro Ser 305 310 315 320 Cys Val Lys Val Ala Asp Arg Glu Val Asn Cys Asp Ser Lys Ala Val 325 330 335 Asp Phe Leu Asp Asp Val Gly Glu Pro Val Arg Ile His Cys Pro Ala 340 345 350 Gly Cys Ser Leu Thr Ala Gly Thr Val Trp Gly Thr Ala Ile Tyr His 355 360 365 Glu Leu Ser Ser Val Cys Arg Ala Ala Ile His Ala Gly Lys Val Pro 370 375 380 Asn Ser Gly Gly Ala Val His Val Val Asn Asn Gly Pro Tyr Ser Asp 385 390 395 400 Phe Leu Ala Ser Asp Leu Asn Gly Ile Lys Ser Asp Glu Leu Lys Ser 405 410 415 Leu Ala Gln Ser Phe Arg Phe Asp Tyr Val Ser Ser Ser Thr Ala Gly 420 425 430 Arg Lys Ser Gly Cys Pro Asp Gly Trp Phe Glu Ile Glu Glu Asn Cys 435 440 445 Val Tyr Val Thr Ser Lys Gln Arg Ala Trp Glu Arg Ala Gln Gly Val 450 455 460 Cys Thr Asn Met Ala Ala Arg Leu Ala Val Leu Asp Lys Asp Val Ile 465 470 475 480 Pro Ser Ser Leu Thr Glu Thr Leu Arg Gly Lys Gly Leu Ala Thr Thr 485 490 495 Trp Ile Gly Leu His Arg Leu Asp Ala Asp Asn His Phe Ile Trp Glu 500 505 510 Leu Met Asp Arg Ser Ser Val Ala Leu Asn Asp Ser Leu Thr Phe Trp 515 520 525 Ala Pro Gly Glu Pro Gly Asn Glu Thr Asn Cys Val Tyr Leu Asp Ile 530 535 540 Gln Asp Gln Leu Gln Pro Val Trp Lys Thr Lys Ser Cys Phe Gln Pro 545 550 555 560 Ser Ser Phe Val Cys Met Met Asp Leu Ser Asp Lys Asn Lys Ala Lys 565 570 575 Cys Lys Asp Pro Gly Pro Leu Glu Asn Gly His Ala Lys Leu His Gly 580 585 590 Gln Ser Ile Asp Gly Phe Tyr Ala Gly Ser Ser Val Arg Tyr Ser Cys 595 600 605 Glu Val Leu His Tyr Leu Ser Gly Thr Glu Thr Val Ser Cys Thr Ser 610 615 620 Asn Gly Thr Trp Ser Ala Pro Lys Pro Arg Cys Ile Lys Val Ile Thr 625 630 635 640 Cys Gln Thr Pro Pro Val Pro Ser Tyr Gly Ser Val Asp Ile Lys Pro 645 650 655 Pro Ser Arg Thr Asn Ser Ile Ser Arg Val Gly Ser Pro Phe Leu Arg 660 665 670 Leu Pro Arg Leu Pro Leu Pro Leu Ala Arg Ala Ala Gly Pro Pro Pro 675 680 685 Lys Pro Arg Ser Ala Pro Pro Ser Thr Val Asp Leu Ser Ser Lys Val 690 695 700 Lys Leu Pro Glu Gly His Tyr Arg Val Gly Ser Gln Ala Ile Tyr Thr 705 710 715 720 Cys Glu Ser Arg Tyr Tyr Glu Leu Leu Gly Ser Gln Gly Arg Arg Cys 725 730 735 Asp Ser Asn Gly Lys Trp Ser Gly Arg Pro Ala Ser Cys Ile Pro Val 740 745 750 Cys Gly Arg Ser Asp Ser Pro Arg Ser Pro Phe Ile Val Asn Gly Asn 755 760 765 Ser Thr Glu Ile Gly Gln Trp Pro Trp Gln Ala Gly Ile Ser Arg Trp 770 775 780 Leu Ala Asp His Asn Met Trp Phe Leu Gln Cys Gly Gly Ala Leu Leu 785 790 795 800 Asn Glu Lys Trp Ile Ile Thr Ala Ala His Cys Val Thr Tyr Ser Ala 805 810 815 Thr Ala Glu Ile Ile Asp Pro Ser Gln Phe Lys Phe Tyr Leu Gly Lys 820 825 830 Tyr Tyr Arg Asp Asp Ser Lys Asp Asp Asp Tyr Val Gln Val Arg Glu 835 840 845 Ala Ile Glu Ile His Val Asn Pro Asn Tyr Asp Pro Gly Asn Leu Asn 850 855 860 Phe Asp Ile Ala Leu Ile Gln Leu Lys Thr Ser Val Ala Leu Thr Thr 865 870 875 880 Arg Val Gln Pro Ile Cys Leu Pro Thr Asp Leu Thr Thr Arg Glu Asn 885 890 895 Leu Lys Glu Gly Ala Leu Ala Val Val Thr Gly Trp Gly Leu Asn Glu 900 905 910 Asn Asn Thr Tyr Ser Glu Met Ile Gln Gln Ala Val Leu Pro Val Val 915 920 925 Ala Ala Ser Thr Cys Glu Gln Gly Tyr Gln Asp Ser Gly Leu Pro Leu 930 935 940 Thr Val Thr Glu Asn Met Phe Cys Ala Gly Tyr Lys Gln Gly Arg Tyr 945 950 955 960 Asp Ala Cys Ser Gly Asp Ser Gly Gly Pro Leu Val Phe Ala Asp Asp 965 970 975 Ser Arg Thr Asp Arg Arg Trp Val Leu Glu Gly Ile Val Ser Trp Gly 980 985 990 Ser Pro Asn Gly Cys Gly Lys Ser Asn Gln Tyr Gly Gly Phe Thr Lys 995 1000 1005 Click Download to save Val Asn Val Phe Leu Ser Trp Ile Arg Gln Phe Ile mp3 youtube com 1010 1015 1020 <210> 3 <211> 3063 <212> DNA <213> Limulus polyphemus <400> 3 atggtactag cgtcgttctt ggtgtctggt ttagttctag ggctattagc ccaacaaatg cacccagttc agtccagagg agtagatctg ggcttgtgtg atgacacgag gtttgagtgt 120 aagtgtggag atccaggata cgtgttcaac gtccccgcga agcaatgtac gtacttctat 240. cgatggaggc cttattgtaa accatgtgac aaactggagg ctaaagatgt gtgtcccaag 300. tacaaacgat gtcaagagtg tagggctggt ctcgacagtt gtgtgagttg tccacctaac aaatatggaa cttggtgtag cggtgagtgt cagtgtaaga atggggtat tgtgatcag 360 aggacaggag cttgtacatg tcgtgacaga tatgaggtg tgcattgtga aatccttcaa 420 ggttgtccctc ttctcaatc ggatccccag gttcaggag taaaaaatcc accaaatgat 480 ccacaaacta ttgactacag ctgttcacca ggcttcaagc ttaaggcgt ggcacgtatc 540 acctgtcttc caaatgggca gtggagtagc tttccacca aatgtattcg agaatgttcc 600 atggtttcat cttagaaca tggcaagta aactctccta gtgccgatct gatagaagga 660 gctactttaa gctactttaa gctactcatg tgagtccc tactacttga tggtcaaga aacattaacc 720 tgccaggggca acggtcagtg gagtggggcag ataccacagt gtcagaaatt ggtcttctgc 780 cctgaccttg accctgcaag ccatgctgaa caccaggtta aaattggcct agaacaaaaa 840 tatggtcaat ttcctcagg cactgaagta acctatacgt gtactggtaa ttactcttg 900 atggttttgg acaccttaaa atgtaccct gatgggtcct ggtcgggaac acagccgtcc 960 tgtgttaaag tggcagacag agaggtcaac tgtgacagta aagctgtgga cttcttggat 1020 gatgttggcg aacctgtcag gatccactgt cctgctggct gttccttaac tgctggtact 1080 gtatggggta cagccatata tcacgaactt tcctcagtat gtcgtgcagc tattcatgct 1140 ggcaaggttc caaactctgg aggtgcagtg catgtagtga acaacggtcc gtactcagac 1200 tttctggcta gtgatctgaa tgggataaaa tcagacgagt tgaagtctct tgctcagagt 1260 ttccgattcg attatgtcag ttcatcaaca gcagggagaa agtcaggatg tcctgatgga 1320 tggttcgaga ttgaggagaa ctgtgtgtac gttacatcga aacagagagc ctgggaaaga 1380 gctcaaggtg tatgtaccaa tatggccgct cgtcttgctg tgttagacaa agatgtaatt 1440 ccaagttcct tgactgagac tctacgaggg aaagggttag caacgacgtg gattggacta 1500 cacagattag atgctgataa tcactttatt tgggagctaa tggatcgcag tagtgttgct 1560 ttgaatgaca gcctaacatt ctgggctcct ggagaacctg ggaatgaaac taactgtgta 1620 tatctggata tccaagatca gctacagcca gtgtggaaaa ccaagtcttg ttttcaaccc 1680 tcaagttttg tttgtatgat ggatttgtca gacaagaaca aagccaaatg caaagaccct 1740 ggacctttgg aaaacggaca cgccaagctt catggtcaaa gtattgatgg attttatgct 1800 gggtcttctg taagatacag ctgcgaggtc ctccactacc tcagtggaac tgagacagta 1860 tcttgtacat caaatggcac gtggagtgcc cctaaaacctc gatgtattaa agtcatcacc 1920 tgccaaaccc ctcctgtacc atcctatggt tctgtggaca tcaaaccccc aagtagaaca 1980 aactcaatca gtcgtgttgg gtcgccattc ttgaggttgc cacggttacc cctcccttta 2040 gccagagcag ccggacctcc tccaaaacct agatccgcac caccctctac tgtggacctg 2100 tcttccaagg tcaaactgcc tgaaggtcat taccgggtgg ggtctcaagc catttacacg 2160 tgcgagtcaa gatactacga actgcttgga tctcaaggta gaagatgcga ctctaatgga 2220 aagtggagtg gtcgaccagc aagctgtata ccagtttgtg gacggtcaga ctctccccgt 2280 tctcctttca tcgtcaatgg aaattccacc gaaataggtc agtggccgtg gcaggcagga 2340 atctccagat ggcttgcaga tcataatatg tggtttcttc agtgtggagg agctctactg 2400 aatgagaaat ggatcattac tgcagcccac tgtgtcacct actctgctac tgccgagatc 2460 attgacccaa gtcagtttaa attctacctg ggcaaatact atcgagatga cagtaaggat 2520 gatgactacg tacaagtaag agaggctatc gagatccatg tgaatcctaa ctacgatcct 2580 ggaaatctca actttgacat agccctgatt caactgaaga cttctgttgc tctgaccaca 2640 cgagtgcaac caatatgtct gcctactgat ctcactacaa gagaaaacct gaaagaggga 2700 gcgttagcgg tggtgacagg atggggtttg aatgaaaaca acacatattc agagatgatt 2760 cagcaagccg ttctgcctgt tgttgcagca agcacctgtg aacaaggata tcaggactcg 2820 ggcttgccac tgacagtgac agagaacatg ttctgtgcag gttacaagca ggggcgctat 2880 gatgcctgca gtggagacag tggaggacca ttagtgtttg ctgatgattc ccgcaccgat 2940 aggcggtggg tcctggaagg gatcgtcagc tggggcagcc ccaatggatg tggcaagtct 3000 aaccagtatg ggggcttcac taaagttaac gtttttctat cgtggattcg gcagttcatt 3060 tga 3063 <210> 4 <211> 1020 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 4 Met Val Leu Ala Ser Phe Leu Val Ser Gly Leu Val Leu Gly Leu Leu 1 5 10 15 Ala Gln Gln Met His Pro Val Gln Ser Arg Gly Val Asp Leu Gly Leu 20 25 30 Cys Asp Asp Thr Arg Phe Glu Cys Lys Cys Gly Asp Pro Gly Tyr Val 35 40 45 Phe Asn Val Pro Ala Lys Gln Cys Thr Tyr Phe Tyr Arg Trp Arg Pro 50 55 60 Tyr Cys Lys Pro Cys Asp Lys Leu Glu Ala Lys Asp Val Cys Pro Lys 65 70 75 80 Tyr Lys Arg Cys Gln Glu Cys Arg Ala Gly Leu Asp Ser Cys Val Ser 85 90 95 Cys Pro Pro Asn Lys Tyr Gly Thr Trp Cys Ser Gly Glu Cys Gln Cys 100 105 110 Lys Asn Gly Gly Ile Cys Asp Gln Arg Thr Gly Ala Cys Thr Cys Arg 115 120 125 Asp Arg Tyr Glu Gly Val His Cys Glu Ile Leu Gln Gly Cys Pro Leu 130 135 140 Leu Gln Ser Asp Pro Gln Val Gln Glu Val Lys Asn Pro Pro Asn Asp 145 150 155 160 Pro Gln Thr Ile Asp Tyr Ser Cys Ser Pro Gly Phe Lys Leu Lys Gly 165 170 175 Val Ala Arg Ile Thr Cys Leu Pro Asn Gly Gln Trp Ser Ser Phe Pro 180 185 190 Pro Lys Cys Ile Arg Glu Cys Ser Met Val Ser Ser Leu Glu His Gly 195 200 205 Lys Val Asn Ser Pro Ser Ala Asp Leu Ile Glu Gly Ala Thr Leu Arg 210 215 220 Phe Ser Cys Asp Ser Pro Tyr Tyr Leu Ile Gly Gln Glu Thr Leu Thr 225 230 235 240 Cys Gln Gly Asn Gly Gln Trp Ser Gly Gln Ile Pro Gln Cys Gln Lys 245 250 255 Leu Val Phe Cys Pro Asp Leu Asp Pro Ala Ser His Ala Glu His Gln 260 265 270 Val Lys Ile Gly Leu Glu Gln Lys Tyr Gly Gln Phe Pro Gln Gly Thr 275 280 285 Glu Val Thr Tyr Thr Cys Thr Gly Asn Tyr Phe Leu Met Gly Leu Asp 290 295 300 Thr Leu Lys Cys Asn Pro Asp Gly Ser Trp Ser Gly Thr Gln Pro Ser 305 310 315 320 Cys Val Lys Val Ala Asp Arg Glu Val Asn Cys Asp Ser Lys Ala Val 325 330 335 Asp Phe Leu Asp Asp Val Gly Glu Pro Val Arg Ile His Cys Pro Ala 340 345 350 Gly Cys Ser Leu Thr Ala Gly Thr Val Trp Gly Thr Ala Ile Tyr His 355 360 365 Glu Leu Ser Ser Val Cys Arg Ala Ala Ile His Ala Gly Lys Val Pro 370 375 380 Asn Ser Gly Gly Ala Val His Val Val Asn Asn Gly Pro Tyr Ser Asp 385 390 395 400 Phe Leu Ala Ser Asp Leu Asn Gly Ile Lys Ser Asp Glu Leu Lys Ser 405 410 415 Leu Ala Gln Ser Phe Arg Phe Asp Tyr Val Ser Ser Ser Thr Ala Gly 420 425 430 Arg Lys Ser Gly Cys Pro Asp Gly Trp Phe Glu Ile Glu Glu Asn Cys 435 440 445 Val Tyr Val Thr Ser Lys Gln Arg Ala Trp Glu Arg Ala Gln Gly Val 450 455 460 Cys Thr Asn Met Ala Ala Arg Leu Ala Val Leu Asp Lys Asp Val Ile 465 470 475 480 Pro Ser Ser Leu Thr Glu Thr Leu Arg Gly Lys Gly Leu Ala Thr Thr 485 490 495 Trp Ile Gly Leu His Arg Leu Asp Ala Asp Asn His Phe Ile Trp Glu 500 505 510 Leu Met Asp Arg Ser Ser Val Ala Leu Asn Asp Ser Leu Thr Phe Trp 515 520 525 Ala Pro Gly Glu Pro Gly Asn Glu Thr Asn Cys Val Tyr Leu Asp Ile 530 535 540 Gln Asp Gln Leu Gln Pro Val Trp Lys Thr Lys Ser Cys Phe Gln Pro 545 550 555 560 Ser Ser Phe Val Cys Met Met Asp Leu Ser Asp Lys Asn Lys Ala Lys 565 570 575 Cys Lys Asp Pro Gly Pro Leu Glu Asn Gly His Ala Lys Leu His Gly 580 585 590 Gln Ser Ile Asp Gly Phe Tyr Ala Gly Ser Ser Val Arg Tyr Ser Cys 595 600 605 Glu Val Leu His Tyr Leu Ser Gly Thr Glu Thr Val Ser Cys Thr Ser 610 615 620 Asn Gly Thr Trp Ser Ala Pro Lys Pro Arg Cys Ile Lys Val Ile Thr 625 630 635 640 Cys Gln Thr Pro Pro Val Pro Ser Tyr Gly Ser Val Asp Ile Lys Pro 645 650 655 Pro Ser Arg Thr Asn Ser Ile Ser Arg Val Gly Ser Pro Phe Leu Arg 660 665 670 Leu Pro Arg Leu Pro Leu Pro Leu Ala Arg Ala Ala Gly Pro Pro Pro 675 680 685 Lys Pro Arg Ser Ala Pro Pro Ser Thr Val Asp Leu Ser Ser Lys Val 690 695 700 Lys Leu Pro Glu Gly His Tyr Arg Val Gly Ser Gln Ala Ile Tyr Thr 705 710 715 720 Cys Glu Ser Arg Tyr Tyr Glu Leu Leu Gly Ser Gln Gly Arg Arg Cys 725 730 735 Asp Ser Asn Gly Lys Trp Ser Gly Arg Pro Ala Ser Cys Ile Pro Val 740 745 750 Cys Gly Arg Ser Asp Ser Pro Arg Ser Pro Phe Ile Val Asn Gly Asn 755 760 765 Ser Thr Glu Ile Gly Gln Trp Pro Trp Gln Ala Gly Ile Ser Arg Trp 770 775 780 Leu Ala Asp His Asn Met Trp Phe Leu Gln Cys Gly Gly Ala Leu Leu 785 790 795 800 Asn Glu Lys Trp Ile Ile Thr Ala Ala His Cys Val Thr Tyr Ser Ala 805 810 815 Thr Ala Glu Ile Ile Asp Pro Ser Gln Phe Lys Phe Tyr Leu Gly Lys 820 825 830 Tyr Tyr Arg Asp Asp Ser Lys Asp Asp Asp Tyr Val Gln Val Arg Glu 835 840 845 Ala Ile Glu Ile His Val Asn Pro Asn Tyr Asp Pro Gly Asn Leu Asn 850 855 860 Phe Asp Ile Ala Leu Ile Gln Leu Lys Thr Ser Val Ala Leu Thr Thr 865 870 875 880 Arg Val Gln Pro Ile Cys Leu Pro Thr Asp Leu Thr Thr Arg Glu Asn 885 890 895 Leu Lys Glu Gly Ala Leu Ala Val Val Thr Gly Trp Gly Leu Asn Glu 900 905 910 Asn Asn Thr Tyr Ser Glu Met Ile Gln Gln Ala Val Leu Pro Val Val 915 920 925 Ala Ala Ser Thr Cys Glu Gln Gly Tyr Gln Asp Ser Gly Leu Pro Leu 930 935 940 Thr Val Thr Glu Asn Met Phe Cys Ala Gly Tyr Lys Gln Gly Arg Tyr 945 950 955 960 Asp Ala Cys Ser Gly Asp Ser Gly Gly Pro Leu Val Phe Ala Asp Asp 965 970 975 Ser Arg Thr Asp Arg Arg Trp Val Leu Glu Gly Ile Val Ser Trp Gly 980 985 990 Ser Pro Asn Gly Cys Gly Lys Ser Asn Gln Tyr Gly Gly Phe Thr Lys 995 1000 1005 Val Asn Val Phe Leu Ser Trp Ile Arg Gln Phe Ile 1010 1015 1020 <210> 5 <211> 1203 <212> DNA <213> Horseshoe crab (Limulus polyphemus) <400> 5 atggcgtgga tttgtgtgat aacgttgttt gctttggctt ctagtacgtt gagtaataaa 60 gttagtagag tggggatcat ctttcctaag acacagaacg ataataaaca gtgtacagca 120 aaaggtggat taaaagggtc ctgcaagtcc ctcacagact gtcctgctgt cttggctacg 180 ttgaaggata gtttccctgt cgtttgctct tggaatggtc ggtttcagcc tattgtatgt 240 tgtcctgatg cagcagcacc aagtgtaacc acacagtta caactattgt ccctacaaaa 300 gaaaaaaga ttccagatt acatatacca ggttgtgaa aaagaaagt aaatgtagat 360 attackacacta ttggacgttc ggggtcacca atactcctc ccatactac ttctcagat 420 ttgaagggtg ggagaggaat cattgctgga ggtgtagaag ctaaaattgg cgcctggcct 480 tggatggcag ctgttttgt gaaaaattttt ggcattggca gattccattg tgctggtagc 540 ataatcagta gcaagtacat ttgtctgct gcccacgctt tcctcattgg aggtcgaaag 600 ctgaccccaa ctcgcttagc tgtccgcgta ggaggccact acgtaagat gggtcaagaa 660 tatcatgtgg aagatgtgat tatccatcct gactacgtag aaagggagaa ttacaatgat 720 attgctatca ttgtgttaaa agaggaactg aattttactg atttggtccg tccaatctgt 780 ctccctgacc cagaggcagt aacagattca ttaaaaggca gaagggtgac agtagctgga 840 tggggtgatc tggattcgc cggtccacga agtcaagttc tgcgcgaggt tagtatcccc 900 gttgttccaa tcggtgactg taacaagcc tatcagaagc tcacacct tgctttaaa 960 aatgggataa cgaaaaagtt tatttgtgct ggattggaag aaggtgggaa agatgcttgt 1020 caaggcgatt ctggtggacc gttgatgcta gtgaacaata gtagttggat agtgacggga 1080 gtggtgtcgt tcggacacaa gtgtgccgag gagggatttc ctggtgtgta cacgcgtgta 1140 gtgagttacc tagagtggat cgcgaaggtt acgaactcgt tagaccaggc agtcactaac 1200 tga 1203 <210> 6 <211> 400 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 6 Met Ala Trp Ile Cys Val Ile Thr Leu Phe Ala Leu Ala Ser Ser Thr 1 5 10 15 Leu Ser Asn Lys Val Ser Arg Val Gly Ile Ile Phe Pro Lys Thr Gln 20 25 30 Asn Asp Asn Lys Gln Cys Thr Ala Lys Gly Gly Leu Lys Gly Ser Cys 35 40 45 Lys Ser Leu Thr Asp Cys Pro Ala Val Leu Ala Thr Leu Lys Asp Ser 50 55 60 Phe Pro Val Val Cys Ser Trp Asn Gly Arg Phe Gln Pro Ile Val Cys 65 70 75 80 Cys Pro Asp Ala Ala Ala Pro Ser Val Thr Thr Thr Val Thr Thr Ile 85 90 95 Val Pro Thr Lys Glu Thr Lys Ile Pro Arg Leu His Ile Pro Gly Cys 100 105 110 Gly Lys Arg Lys Val Asn Val Asp Ile Thr Thr Ile Gly Arg Ser Gly 115 120 125 Ser Pro Ile Leu Pro Pro Ile Ser Thr Ser Gln Asp Leu Lys Gly Gly 130 135 140 Arg Gly Ile Ile Ala Gly Gly Val Glu Ala Lys Ile Gly Ala Trp Pro 145 150 155 160 Trp Met Ala Ala Val Phe Val Lys Asn Phe Gly Ile Gly Arg Phe His 165 170 175 Cys Ala Gly Ser Ile Ile Ser Ser Lys Tyr Ile Leu Ser Ala Ala His 180 185 190 Ala Phe Leu Ile Gly Gly Arg Lys Leu Thr Pro Thr Arg Leu Ala Val 195 200 205 Arg Val Gly Gly His Tyr Val Lys Met Gly Gln Glu Tyr His Val Glu 210 215 220 Asp Val Ile Ile His Pro Asp Tyr Val Glu Arg Glu Asn Tyr Asn Asp 225 230 235 240 Ile Ala Ile Ile Val Leu Lys Glu Glu Leu Asn Phe Thr Asp Leu Val 245 250 255 Arg Pro Ile Cys Leu Pro Asp Pro Glu Ala Val Thr Asp Ser Leu Lys 260 265 270 Gly Arg Arg Val Thr Val Ala Gly Trp Gly Asp Leu Asp Phe Ala Gly 275 280 285 Pro Arg Ser Gln Val Leu Arg Glu Val Ser Ile Pro Val Val Pro Ile 290 295 300 Gly Asp Cys Asn Lys Ala Tyr Gln Lys Leu Asn Thr Leu Ala Leu Lys 305 310 315 320 Asn Gly Ile Thr Lys Lys Phe Ile Cys Ala Gly Leu Glu Glu Gly Gly 325 330 335 Lys Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Met Leu Val Asn 340 345 350 Asn Ser Ser Trp Ile Val Thr Gly Val Val Ser Phe Gly His Lys Cys 355 360 365 Ala Glu Glu Gly Phe Pro Gly Val Tyr Thr Arg Val Val Ser Tyr Leu 370 375 380 Glu Trp Ile Ala Lys Val Thr Asn Ser Leu Asp Gln Ala Val Thr Asn 385 390 395 400 <210> 7 <211> 1203 <212> DNA <213> Horseshoe crab (Limulus polyphemus) <400> 7 atggcgtgga tttgtgtgat aacgttgttt gctttggctt ctagtacgtt gagtaataaa 60 gttagtagag tggggatcat ctttcctaag acacagaacg ataataaaca gtgtacagca 120 aaaggtggat taaaagggtc ctgcaagtcc ctcacagact gtcctgctgt cttggctacg 180 ttgaaggata gtttccctgt cgtttgctct tggaatggtc ggtttcagcc tattgtatgt 240 tgtcctgatg cagcagcacc aagtgtaacc acaacagtta caactattgt ccctacaaaa 300 gaaacaaaga ttccaagatt acatatacca ggttgtggaa aaagaaaagt aaatgtagat 360 attacaacta ttggacgttc ggggtcacca atacttcctc ccatatctac ttctcaagat 420 ttgaagggtg ggagaggaat cattgctgga ggtgtagaag ctaaaattgg cgcctggcct 480 tggatggcag ctgtttttgt gaaaaatttt ggcattggca gattccattg tgctggtagc 540 ataatcagta gcaagtacat tttgtctgct gcccacgctt tcctcattgg aggtcgaaag 600 ctgaccccaa ctcgcttagc tgtccgcgta ggaggccact acgtaaagat gggtcaagaa 660 tatcatgtgg aagatgtgat tatccatcct gactacgtag aaagggagaa ttacaatgat 720 attgctatca ttgtgttaaa agaggaactg aattttactg atttggtccg tccaatctgt 780 ctccctgacc cagaggcagt aacagattca ttaaaaggca gaagggtgac agtagctgga 840 tggggtgatc tggatttcgc cggtccacga agtcaagttc tgcgcgaggt tagtatcccc 900 gttgttccaa tcagtgattg taacaaagcc tatcagaatc tcaacaccct tgctcttaaa 960 aatgggataa cgaaaaagtt tatttgtgct ggattggaag aaggtgggaa agatgcttgt 1020 caaggcgatt ctggtggacc gttgatgcta gtgaacaata gtagttggat agtgacggga 1080 gtggtgtcgt tcggacacaa gtgtgccgag gagggatttc ctggtgtgta cacgcgtgta 1140 gtgagttacc tagagtggat cgcgaaggtt acgaactcgt tagaccaggc agtcactaac 1200 tga 1203 <210> 8 <211> 400 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 8 Met Ala Trp Ile Cys Val Ile Thr Leu Phe Ala Leu Ala Ser Ser Thr 1 5 10 15 Leu Ser Asn Lys Val Ser Arg Val Gly Ile Ile Phe Pro Lys Thr Gln 20 25 30 Asn Asp Asn Lys Gln Cys Thr Ala Lys Gly Gly Leu Lys Gly Ser Cys 35 40 45 Lys Ser Leu Thr Asp Cys Pro Ala Val Leu Ala Thr Leu Lys Asp Ser 50 55 60 Phe Pro Val Val Cys Ser Trp Asn Gly Arg Phe Gln Pro Ile Val Cys 65 70 75 80 Cys Pro Asp Ala Ala Ala Pro Ser Val Thr Thr Thr Val Thr Thr Ile 85 90 95 Val Pro Thr Lys Glu Thr Lys Ile Pro Arg Leu His Ile Pro Gly Cys 100 105 110 Gly Lys Arg Lys Val Asn Val Asp Ile Thr Thr Ile Gly Arg Ser Gly 115 120 125 Ser Pro Ile Leu Pro Pro Ile Ser Thr Ser Gln Asp Leu Lys Gly Gly 130 135 140 Arg Gly Ile Ile Ala Gly Gly Val Glu Ala Lys Ile Gly Ala Trp Pro 145 150 155 160 Trp Met Ala Ala Val Phe Val Lys Asn Phe Gly Ile Gly Arg Phe His 165 170 175 Cys Ala Gly Ser Ile Ile Ser Ser Lys Tyr Ile Leu Ser Ala Ala His 180 185 190 Ala Phe Leu Ile Gly Gly Arg Lys Leu Thr Pro Thr Arg Leu Ala Val 195 200 205 Arg Val Gly Gly His Tyr Val Lys Met Gly Gln Glu Tyr His Val Glu 210 215 220 Asp Val Ile Ile His Pro Asp Tyr Val Glu Arg Glu Asn Tyr Asn Asp 225 230 235 240 Ile Ala Ile Ile Val Leu Lys Glu Glu Leu Asn Phe Thr Asp Leu Val 245 250 255 Arg Pro Ile Cys Leu Pro Asp Pro Glu Ala Val Thr Asp Ser Leu Lys 260 265 270 Gly Arg Arg Val Thr Val Ala Gly Trp Gly Asp Leu Asp Phe Ala Gly 275 280 285 Pro Arg Ser Gln Val Leu Arg Glu Val Ser Ile Pro Val Val Pro Ile 290 295 300 Ser Asp Cys Asn Lys Ala Tyr Gln Asn Leu Asn Thr Leu Ala Leu Lys 305 310 315 320 Asn Gly Ile Thr Lys Lys Phe Ile Cys Ala Gly Leu Glu Glu Gly Gly 325 330 335 Lys Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Met Leu Val Asn 340 345 350 Asn Ser Ser Trp Ile Val Thr Gly Val Val Ser Phe Gly His Lys Cys 355 360 365 Ala Glu Glu Gly Phe Pro Gly Val Tyr Thr Arg Val Val Ser Tyr Leu 370 375 380 Glu Trp Ile Ala Lys Val Thr Asn Ser Leu Asp Gln Ala Val Thr Asn 385 390 395 400 <210> 9 <211> 1203 <212> DNA <213> Horseshoe crab (Limulus polyphemus) <400> 9 atggcgtgga tttgtgtgat aacgttgttt gctttggctt ctagtacgtt gagtaataaa 60 gttagtagag tggggatcat ctttcctaag acacagaacg ataataaaca gtgtacagca 120 aaaggtggat taaaagggtc ctgcaagtcc ctcacagact gtcctgctgt cttggctacg 180 ttgaaggata gtttccctgt cgtttgctct tggaatggtc ggtttcagcc tattgtatgt 240 tgtcctgatg cagcagcacc aagtgtaacc acacagtta caactattgt ccctacaaaa 300 gaaaaaaga ttccagatt acatatacca ggttgtgaa aaagaaagt aaatgtagat 360 attackacacta ttggacgttc ggggtcacca atactcctc ccatactac ttctcagat 420 ttgaagggtg ggagaggaat cattgctgga ggtgtagaag ctaaaattgg cgcctggcct 480 tggatggcag ctgttttgt gaaaaattttt ggcattggca gattccattg tgctggtagc 540 ataatcagta gcaagtacat ttgtctgct gcccacgctt tcctcattgg aggtcgaaag 600 ctgaccccaa ctcgcttagc tgtccgcgta ggaggccact acgtaagat gggtcaagaa 660 tatcatgtgg aagatgtgat tatccatcct gactacgtag aaagggagaa ttacaatgat 720 attgctatca ttgtgttaaa agaggaactg aattttactg atttggtccg tccaatctgt 780 ctccctgacc cagaggcagt aacagattca ttaaaaggca gaagggtgac agtagctgga 840 tggggtgatc tggattcgc cggtccacga agtcaagttc tgcgcgaggt tagtatcccc 900 gttgttccaa tcagtgatg taacaagcc tatcagaatc tcacaccct tgctcttaaa 960 aatgggataa cgaacaagtt tatttgtgct ggattggaag aaggcgggaa agatgcttgt 1020 caaggcgatt ctggtggacc gttgatgcta gtgaacaata gtagttggat agtgacggga 1080 gtggtgtcgt tcggacacaa gtgtgccgag gagggatttc ctggtgtgta cacgcgtgta 1140 gtgagttacc tagagtggat cgcgaaggtt acgaactcgt tagaccaggc agtcactaac 1200 tga 1203 <210> 10 <211> 400 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 10 Met Ala Trp Ile Cys Val Ile Thr Leu Phe Ala Leu Ala Ser Ser Thr 1 5 10 15 Leu Ser Asn Lys Val Ser Arg Val Gly Ile Ile Phe Pro Lys Thr Gln 20 25 30 Asn Asp Asn Lys Gln Cys Thr Ala Lys Gly Gly Leu Lys Gly Ser Cys 35 40 45 Lys Ser Leu Thr Asp Cys Pro Ala Val Leu Ala Thr Leu Lys Asp Ser 50 55 60 Phe Pro Val Val Cys Ser Trp Asn Gly Arg Phe Gln Pro Ile Val Cys 65 70 75 80 Cys Pro Asp Ala Ala Ala Pro Ser Val Thr Thr Thr Val Thr Thr Ile 85 90 95 Val Pro Thr Lys Glu Thr Lys Ile Pro Arg Leu His Ile Pro Gly Cys 100 105 110 Gly Lys Arg Lys Val Asn Val Asp Ile Thr Thr Ile Gly Arg Ser Gly 115 120 125 Ser Pro Ile Leu Pro Pro Ile Ser Thr Ser Gln Asp Leu Lys Gly Gly 130 135 140 Arg Gly Ile Ile Ala Gly Gly Val Glu Ala Lys Ile Gly Ala Trp Pro 145 150 155 160 Trp Met Ala Ala Val Phe Val Lys Asn Phe Gly Ile Gly Arg Phe His 165 170 175 Cys Ala Gly Ser Ile Ile Ser Ser Lys Tyr Ile Leu Ser Ala Ala His 180 185 190 Ala Phe Leu Ile Gly Gly Arg Lys Leu Thr Pro Thr Arg Leu Ala Val 195 200 205 Arg Val Gly Gly His Tyr Val Lys Met Gly Gln Glu Tyr His Val Glu 210 215 220 Asp Val Ile Ile His Pro Asp Tyr Val Glu Arg Glu Asn Tyr Asn Asp 225 230 235 240 Ile Ala Ile Ile Val Leu Lys Glu Glu Leu Asn Phe Thr Asp Leu Val 245 250 255 Arg Pro Ile Cys Leu Pro Asp Pro Glu Ala Val Thr Asp Ser Leu Lys 260 265 270 Gly Arg Arg Val Thr Val Ala Gly Trp Gly Asp Leu Asp Phe Ala Gly 275 280 285 Pro Arg Ser Gln Val Leu Arg Glu Val Ser Ile Pro Val Val Pro Ile 290 295 300 Ser Asp Cys Asn Lys Ala Tyr Gln Asn Leu Asn Thr Leu Ala Leu Lys 305 310 315 320 Asn Gly Ile Thr Asn Lys Phe Ile Cys Ala Gly Leu Glu Glu Gly Gly 325 330 335 Lys Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Met Leu Val Asn 340 345 350 Asn Ser Ser Trp Ile Val Thr Gly Val Val Ser Phe Gly His Lys Cys 355 360 365 Ala Glu Glu Gly Phe Pro Gly Val Tyr Thr Arg Val Val Ser Tyr Leu 370 375 380 Glu Trp Ile Ala Lys Val Thr Asn Ser Leu Asp Gln Ala Val Thr Asn 385 390 395 400 <210> 11 <211> 1203 <212> DNA <213> Horseshoe crab (Limulus polyphemus) <400> 11 atggcgtgga tttgtgtgat aacgttgttt gctttggctt ctagtacgtt gagtaataaa 60 gttagtagag tggggatcat ctttcctaag acacagaacg ataataaaca gtgtacagca 120 aaaggtggat taaaagggtc ctgcaagtcc ctcacagact gtcctgctgt cttggctacg 180 ttgaaggata gtttccctgt cgtttgctct tggaatggtc ggtttcagcc tattgtatgt 240 tgtcctgatg cagcagcacc aagtgtaacc acaacagtta caactattgt ccctacaaaa 300 gaaacaaaga ttccaagatt acatatacca ggttgtggaa aaagaaaagt aaatgtagat 360 attacaacta ttggacgttc ggggtcacca atacttcctc ccatatctac ttctcaagat 420 ttgaagggtg ggagaggaat cattgctgga ggtgtagaag ctaaaattgg cgcctggcct 480 tggatggcag ctgtttttgt gaaaaatttt ggcattggca gatttcattg tgctggtagc 540 ataatcagta gcaagtacat tttgtctgct gcccacgctt tcctcattgg aggtcgaaag 600 ctgaccccaa ctcgcttagc tgtccgcgta ggaggccact acgtaaagat gggtcaagaa 660 ctgaccccaa ctcgcttagc tgtccgcgta ggaggccact acgtaaagat gggtcaagaa 660 tatcatgtgg aagatgtgat tatccatcct gactacgtag aaagggagaa ttacaatgat 720 tatcatgtgg aagatgtgat tatccatcct gactacgtag aaagggagaa ttacaatgat 720 attgctatca ttgtgttaaa agaggaactg aattttactg atttggtccg tccaatctgt 780 attgctatca ttgtgttaaa agaggaactg aattttactg atttggtccg tccaatctgt 780 ctccctgacc cagaggcagt aacagattca ttaaaaggca gaagggtgac agtagctgga 840 ctccctgacc cagaggcagt aacagattca ttaaaaggca gaagggtgac agtagctgga 840 tggggtgatc tggatttcgc cggtccacga agtcaagttc tgcgcgaggt tagtatcccc 900 tggggtgatc tggatttcgc cggtccacga agtcaagttc tgcgcgaggt tagtatcccc 900 gttgttccaa tcagtgattg taacaaagcc tatcagaatc tcaacaccct tgctcttaaa 960 gttgttccaa tcagtgattg taacaaagcc tatcagaatc tcaacaccct tgctcttaaa 960 aatgggataa cgaacaagtt tatttgtgct ggattggaag aaggcgggaa agatgcttgt 1020 aatgggataa cgaacaagtt tatttgtgct ggattggaag aaggcgggaa agatgcttgt 1020 caaggcgatt ctggtggacc gttgatgcta gtgaacaata gtagttggat agtgacggga 1080 caaggcgatt ctggtggacc gttgatgcta gtgaacaata gtagttggat agtgacggga 1080 gtggtgtcgt tcggacacaa gtgtgccgag gagggatttc ctggtgtgta cacgcgtgta 1140 gtggtgtcgt tcggacacaa gtgtgccgag gagggatttc ctggtgtgta cacgcgtgta 1140 gtgagttacc tagagtggat cgcgaaggtt acgaactcgt tagaccaggc agtcactaag 1200 gtgagttacc tagagtggat cgcgaaggtt acgaactcgt tagaccaggc agtcactaag 1200 tga 1203 tga 1203 <210> 12 <210> 12 <211> 400 <211> 400 <212> PRT <212> PRT <213> 美洲鲎(Limulus polyphemus) <213> Horseshoe crab (Limulus polyphemus) <400> 12 <400> 12 Met Ala Trp Ile Cys Val Ile Thr Leu Phe Ala Leu Ala Ser Ser Thr 1 5 10 15 Leu Ser Asn Lys Val Ser Arg Val Gly Ile Ile Phe Pro Lys Thr Gln 20 25 30 Asn Asp Asn Lys Gln Cys Thr Ala Lys Gly Gly Leu Lys Gly Ser Cys 35 40 45 Lys Ser Leu Thr Asp Cys Pro Ala Val Leu Ala Thr Leu Lys Asp Ser 50 55 60 Phe Pro Val Val Cys Ser Trp Asn Gly Arg Phe Gln Pro Ile Val Cys 65 70 75 80 Cys Pro Asp Ala Ala Ala Pro Ser Val Thr Thr Thr Val Thr Thr Ile 85 90 95 Val Pro Thr Lys Glu Thr Lys Ile Pro Arg Leu His Ile Pro Gly Cys 100 105 110 Gly Lys Arg Lys Val Asn Val Asp Ile Thr Thr Ile Gly Arg Ser Gly 115 120 125 Ser Pro Ile Leu Pro Pro Ile Ser Thr Ser Gln Asp Leu Lys Gly Gly 130 135 140 Arg Gly Ile Ile Ala Gly Gly Val Glu Ala Lys Ile Gly Ala Trp Pro 145 150 155 160 Trp Met Ala Ala Val Phe Val Lys Asn Phe Gly Ile Gly Arg Phe His 165 170 175 Cys Ala Gly Ser Ile Ile Ser Ser Lys Tyr Ile Leu Ser Ala Ala His 180 185 190 Ala Phe Leu Ile Gly Gly Arg Lys Leu Thr Pro Thr Arg Leu Ala Val 195 200 205 Arg Val Gly Gly His Tyr Val Lys Met Gly Gln Glu Tyr His Val Glu 210 215 220 Asp Val Ile Ile His Pro Asp Tyr Val Glu Arg Glu Asn Tyr Asn Asp 225 230 235 240 Ile Ala Ile Ile Val Leu Lys Glu Glu Leu Asn Phe Thr Asp Leu Val 245 250 255 Arg Pro Ile Cys Leu Pro Asp Pro Glu Ala Val Thr Asp Ser Leu Lys 260 265 270 Gly Arg Arg Val Thr Val Ala Gly Trp Gly Asp Leu Asp Phe Ala Gly 275 280 285 Pro Arg Ser Gln Val Leu Arg Glu Val Ser Ile Pro Val Val Pro Ile 290 295 300 Ser Asp Cys Asn Lys Ala Tyr Gln Asn Leu Asn Thr Leu Ala Leu Lys 305 310 315 320 Asn Gly Ile Thr Asn Lys Phe Ile Cys Ala Gly Leu Glu Glu Gly Gly 325 330 335 Lys Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Met Leu Val Asn 340 345 350 Asn Ser Ser Trp Ile Val Thr Gly Val Val Ser Phe Gly His Lys Cys 355 360 365 Ala Glu Glu Gly Phe Pro Gly Val Tyr Thr Arg Val Val Ser Tyr Leu 370 375 380 Glu Trp Ile Ala Lys Val Thr Asn Ser Leu Asp Gln Ala Val Thr Lys 385 390 395 400 <210> 13 <211> 1128 <212> DNA <213> Horseshoe crab (Limulus polyphemus) <400> 13 atgttggtga ataacatgtt ttcattgctg tgtttcccac tcctgatgtc tatgtttagc 60 tgcagtagtc tcggcagaca gcgtagacag tttgttttcc ccgatgatga agaatcatgc 120 tcaaaccgat ttactaacga tggaatatgt aaagatgttt tgaattgtag agatctttta 180 caaaaaaatg attataattt actgaaagaa tcaatatgcg gttttgaagg cataacaccc 240 aaagtttgtt gtccgaaaca aagtattgta aatccaataa cagaagcacc tccaaaaacc 300 actacaactg aacgaccgcc atacggata ccatccaatc ttcctaaaca gtgtggaaat 360 cgtaatatta caactaccag gattattgga gggcaggaag caacacctgg agcctggccc 420 tggatggctg ctgtctatat caaacaagga ggaatcagaa gtgttcagtg tggaggtgcg 480 cttgtcacca acaggcacgt gattacagca tcgcactgtg ttgtaaacag tttaggaaca 540 gatgtgatgc gagctgacgt attctcggtt cgcctaggtg aacacaattt atatagcacc 600 aatgacagtt cagatccaat tgatttgca gttacgtcag tgaaacatca tgaaaacttt 660 gtgctcgcga cgtatttgaa tgatatcgca attctgaagt taaacgacac tgttacgttt 720 acgcacaaaa ttaaaccaat ttgtctacct tatgaaagct taaggtatga ggatctagca 780 atgagaaacc cattgtcgc cggatgggga acaacagcat ttaatggccc atctagtgca 840 gtattacgag aagtgcagtt accaatatg ggacacgagc cctgcaggca ggcctacgag 900 aaggatttaa atattacaaa cgtgtatatg tgtgctgggt atgcagatgg cggtaaagat 960 gcttgccagg gtgattctgg aggtccaatg atgttgcctg ataaaagcgg gaacttttat 1020 ctcgttggaa ttgtgtcttt cggaaagaaa tgcgcgttgc ctggatttcc tggggtttac 1080 acaaaagtga ccgaattttt agattggatt gcagtaaata tggtgtag 1128 <210> 14 <211> 375 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 14 Met Leu Val Asn Asn Met Phe Ser Leu Leu Cys Phe Pro Leu Leu Met 1 5 10 15 Ser Met Phe Ser Cys Ser Ser Leu Gly Arg Gln Arg Arg Gln Phe Val 20 25 30 Phe Pro Asp Asp Glu Glu Ser Cys Ser Asn Arg Phe Thr Asn Asp Gly 35 40 45 Ile Cys Lys Asp Val Leu Asn Cys Arg Asp Leu Leu Gln Lys Asn Asp 50 55 60 Tyr Asn Leu Leu Lys Glu Ser Ile Cys Gly Phe Glu Gly Ile Thr Pro 65 70 75 80 Lys Val Cys Cys Pro Lys Gln Ser Ile Val Asn Pro Ile Thr Glu Ala 85 90 95 Pro Pro Lys Thr Thr Thr Thr Glu Arg Pro Pro Ile Arg Ile Pro Ser 100 105 110 Asn Leu Pro Lys Gln Cys Gly Asn Arg Asn Ile Thr Thr Thr Arg Ile 115 120 125 Ile Gly Gly Gln Glu Ala Thr Pro Gly Ala Trp Pro Trp Met Ala Ala 130 135 140 Val Tyr Ile Lys Gln Gly Gly Ile Arg Ser Val Gln Cys Gly Gly Ala 145 150 155 160 Leu Val Thr Asn Arg His Val Ile Thr Ala Ser His Cys Val Val Asn 165 170 175 Ser Leu Gly Thr Asp Val Met Arg Ala Asp Val Phe Ser Val Arg Leu 180 185 190 Gly Glu His Asn Leu Tyr Ser Thr Asn Asp Ser Ser Asp Pro Ile Asp 195 200 205 Phe Ala Val Thr Ser Val Lys His His Glu Asn Phe Val Leu Ala Thr 210 215 220 Tyr Leu Asn Asp Ile Ala Ile Leu Lys Leu Asn Asp Thr Val Thr Phe 225 230 235 240 Thr His Lys Ile Lys Pro Ile Cys Leu Pro Tyr Glu Ser Leu Arg Tyr 245 250 255 Glu Asp Leu Ala Met Arg Asn Pro Phe Val Ala Gly Trp Gly Thr Thr 260 265 270 Ala Phe Asn Gly Pro Ser Ser Ala Val Leu Arg Glu Val Gln Leu Pro 275 280 285 Ile Trp Gly His Glu Pro Cys Arg Gln Ala Tyr Glu Lys Asp Leu Asn 290 295 300 Ile Thr Asn Val Tyr Met Cys Ala Gly Tyr Ala Asp Gly Gly Lys Asp 305 310 315 320 Ala Cys Gln Gly Asp Ser Gly Gly Pro Met Met Leu Pro Asp Lys Ser 325 330 335 Gly Asn Phe Tyr Leu Val Gly Ile Val Ser Phe Gly Lys Lys Cys Ala 340 345 350 Leu Pro Gly Phe Pro Gly Val Tyr Thr Lys Val Thr Glu Phe Leu Asp 355 360 365 Trp Ile Ala Val Asn Met Val 370 375 <210> 15 <211> 1128 <212> DNA <213> Horseshoe crab (Limulus polyphemus) <400> 15 atgttggtga ataacatgtt ttcattgctg tgtttcccac tcctgatgtc tatgtttagc 60 tgcagtagtc tcggcagaca gcgtagacag tttgttttcc ccgatgatga agaatcatgc 120 tcaaaccgat ttactaacga tggaatatgt aaagatgttt tgaattgtag agatctttta 180 caaaaaaatg attataattt actgaaagaa tcaatatgcg gttttgaagg cataacaccc 240 aaagtttgtt gtccgaaaca aagtattgta aatccaataa cagaagcacc tccaaaaacc 300 actacaactg aacgaccgcc aatacggata ccatccaatc ttcctaaaca gtgtggaaat 360 cgtaatatta caactaccag gattattgga gggcaggaag caacacctgg agcctggccc 420 tggatggctg ctgtctatat caaacaagga ggaatcagaa gtgctcagtg tggaggtgcg 480 cttgtcacca acaggcacgt gattacagca tcgcactgtg ttgtaaacag tttaggaaca 540 gatgtgatgc gagctgatgt attctcggtt cgcctaggtg aacacaattt atatagcacc 600 aatgacagtt cagatccaat tgattttgca gttacgtcag tgaaacatca tgaaaacttt 660 gtgctcgcga cgtatttgaa tgatatcgca attctgaagt taaacgacac tgttacgttt 720 acgcacaaaa ttaaaccaat ttgtctacct tatgaaagct taaggtatga ggatctagca 780 atgagaaacc catttgtcgc cggatgggga acaacagcat ttaatggccc atctagtgca 840 gtattacgag aagtgcagtt accaatatgg ggacacgagc cctgcaggca ggcctacgag 900 aaggatttaa atattacaaa cgtgtatatg tgtgctgggt atgcagatgg cggtaaagat 960 gcttgccagg gtgattctgg aggtccaatg atgttgcctg ataaaagcgg gaacttttat 1020 ctcgttggaa ttgtgtcttt cggaaagaaa tgcgcgttgc ctggatttcc tggggtttac 1080 acaaaagtga ccgaattttt agattggatt gcagtaaata tggtgtag 1128 <210> 16 <211> 375 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 16 Met Leu Val Asn Asn Met Phe Ser Leu Leu Cys Phe Pro Leu Leu Met 1 5 10 15 Ser Met Phe Ser Cys Ser Ser Leu Gly Arg Gln Arg Arg Gln Phe Val 20 25 30 Phe Pro Asp Asp Glu Glu Ser Cys Ser Asn Arg Phe Thr Asn Asp Gly 35 40 45 Ile Cys Lys Asp Val Leu Asn Cys Arg Asp Leu Leu Gln Lys Asn Asp 50 55 60 Tyr Asn Leu Leu Lys Glu Ser Ile Cys Gly Phe Glu Gly Ile Thr Pro 65 70 75 80 Lys Val Cys Cys Pro Lys Gln Ser Ile Val Asn Pro Ile Thr Glu Ala 85 90 95 Pro Pro Lys Thr Thr Thr Thr Glu Arg Pro Pro Ile Arg Ile Pro Ser 100 105 110 Asn Leu Pro Lys Gln Cys Gly Asn Arg Asn Ile Thr Thr Thr Arg Ile 115 120 125 Ile Gly Gly Gln Glu Ala Thr Pro Gly Ala Trp Pro Trp Met Ala Ala 130 135 140 Val Tyr Ile Lys Gln Gly Gly Ile Arg Ser Ala Gln Cys Gly Gly Ala 145 150 155 160 Leu Val Thr Asn Arg His Val Ile Thr Ala Ser His Cys Val Val Asn 165 170 175 Ser Leu Gly Thr Asp Val Met Arg Ala Asp Val Phe Ser Val Arg Leu 180 185 190 Gly Glu His Asn Leu Tyr Ser Thr Asn Asp Ser Ser Asp Pro Ile Asp 195 200 205 Phe Ala Val Thr Ser Val Lys His His Glu Asn Phe Val Leu Ala Thr 210 215 220 Tyr Leu Asn Asp Ile Ala Ile Leu Lys Leu Asn Asp Thr Val Thr Phe 225 230 235 240 Thr His Lys Ile Lys Pro Ile Cys Leu Pro Tyr Glu Ser Leu Arg Tyr 245 250 255 Glu Asp Leu Ala Met Arg Asn Pro Phe Val Ala Gly Trp Gly Thr Thr 260 265 270 Ala Phe Asn Gly Pro Ser Ser Ala Val Leu Arg Glu Val Gln Leu Pro 275 280 285 Ile Trp Gly His Glu Pro Cys Arg Gln Ala Tyr Glu Lys Asp Leu Asn 290 295 300 Ile Thr Asn Val Tyr Met Cys Ala Gly Tyr Ala Asp Gly Gly Lys Asp 305 310 315 320 Ala Cys Gln Gly Asp Ser Gly Gly Pro Met Met Leu Pro Asp Lys Ser 325 330 335 Gly Asn Phe Tyr Leu Val Gly Ile Val Ser Phe Gly Lys Lys Cys Ala 340 345 350 Leu Pro Gly Phe Pro Gly Val Tyr Thr Lys Val Thr Glu Phe Leu Asp 355 360 365 Trp Ile Ala Val Asn Met Val 370 375 <210> 17 <211> 1128 <212> DNA <213> Horseshoe Crab (Limulus polyphemus) <400> 17 atgttggtga ataacatgtt ttcattgctg tgtttcccac tcctgatgtc tatgtttagc 60 tgcagtagtc tcggcagaca gcgtagacaa tttgttttcc ccgatgatga agaatcatgc 120 tcaaaccgat ttactaacga aggaatatgt aaagatgttt tgaattgtag agaactttta 180 caaaaaaatg attataattt actgaaagaa tcaatatgcg gttttgaagg cataacaccc 240 aaagtttgtt gtccgaaaca aagtattgta aatccaataa cagaagcacc tccaaaaact 300 actacaactg aacgaccgcc aatccgtata ccatccaatc ttcctaaaca gtgtggaaat 360 cgtaatatta caactaccag gattattgga gggcaggaag caacacctgg agcctggccc 420 tggatggctg ctgtctatat caaacaagga ggaatcagaa gtgttcagtg tggaggtgcg 480 cttgtcacca acaggcacgt gattacagca tcgcactgtg ttgtaaacag tttaggaaca 540 gatgtgatgc gagctgacgt attctcggtt cgcctaggtg aacacaattt atatagcacc 600 aatgacagtt cagatccaat tgattttgca gttacgtcag tgaaacatca tgaaaacttt 660 gtgctcgcga cgtatttgaa tgatatcgca attctgaagt taaacgacac tgttacgttt 720 acgcacaaaa ttaaaccaat ttgtctacct tatgaaagct taaggtatga ggatctagca 780 atgagaaacc catttgtcgc cggatgggga acaacagcat ttaatggccc atctagtgca 840 gtattacgag aagtgcagtt accaatatgg ggacacgagc cctgcaggca ggcctacgag 900 aaggatttaa atattacaaa cgtgtatatg tgtgctgggt atgcagatgg cggtaaagat 960 gcttgccagg gtgattctgg aggtccaatg atgttgcctg ataaaagcgg gaacttttat 1020 ctcgttggaa ttgtgtcttt cggaaagaaa tgcgcgttgc ctggatttcc tggggtttac 1080 acaaaagtga ccgaattttt agattggatt gcagtaaata tggtgtag 1128 <210> 18 <211> 375 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 18 Met Leu Val Asn Asn Met Phe Ser Leu Leu Cys Phe Pro Leu Leu Met 1 5 10 15 Ser Met Phe Ser Cys Ser Ser Leu Gly Arg Gln Arg Arg Gln Phe Val 20 25 30 Phe Pro Asp Asp Glu Glu Ser Cys Ser Asn Arg Phe Thr Asn Glu Gly 35 40 45 Ile Cys Lys Asp Val Leu Asn Cys Arg Glu Leu Leu Gln Lys Asn Asp 50 55 60 Tyr Asn Leu Leu Lys Glu Ser Ile Cys Gly Phe Glu Gly Ile Thr Pro 65 70 75 80 Lys Val Cys Cys Pro Lys Gln Ser Ile Val Asn Pro Ile Thr Glu Ala 85 90 95 Pro Pro Lys Thr Thr Thr Thr Glu Arg Pro Pro Ile Arg Ile Pro Ser 100 105 110 Asn Leu Pro Lys Gln Cys Gly Asn Arg Asn Ile Thr Thr Thr Arg Ile 115 120 125 Ile Gly Gly Gln Glu Ala Thr Pro Gly Ala Trp Pro Trp Met Ala Ala 130 135 140 Val Tyr Ile Lys Gln Gly Gly Ile Arg Ser Val Gln Cys Gly Gly Ala 145 150 155 160 Leu Val Thr Asn Arg His Val Ile Thr Ala Ser His Cys Val Val Asn 165 170 175 Ser Leu Gly Thr Asp Val Met Arg Ala Asp Val Phe Ser Val Arg Leu 180 185 190 Gly Glu His Asn Leu Tyr Ser Thr Asn Asp Ser Ser Asp Pro Ile Asp 195 200 205 Phe Ala Val Thr Ser Val Lys His His Glu Asn Phe Val Leu Ala Thr 210 215 220 Tyr Leu Asn Asp Ile Ala Ile Leu Lys Leu Asn Asp Thr Val Thr Phe 225 230 235 240 Thr His Lys Ile Lys Pro Ile Cys Leu Pro Tyr Glu Ser Leu Arg Tyr 245 250 255 Glu Asp Leu Ala Met Arg Asn Pro Phe Val Ala Gly Trp Gly Thr Thr 260 265 270 Ala Phe Asn Gly Pro Ser Ser Ala Val Leu Arg Glu Val Gln Leu Pro 275 280 285 Ile Trp Gly His Glu Pro Cys Arg Gln Ala Tyr Glu Lys Asp Leu Asn 290 295 300 Ile Thr Asn Val Tyr Met Cys Ala Gly Tyr Ala Asp Gly Gly Lys Asp 305 310 315 320 Ala Cys Gln Gly Asp Ser Gly Gly Pro Met Met Leu Pro Asp Lys Ser 325 330 335 Gly Asn Phe Tyr Leu Val Gly Ile Val Ser Phe Gly Lys Lys Cys Ala 340 345 350 Leu Pro Gly Phe Pro Gly Val Tyr Thr Lys Val Thr Glu Phe Leu Asp 355 360 365 Trp Ile Ala Val Asn Met Val 370 375 <210> 19 <211> 1128 <212> DNA <213> Horseshoe crab (Limulus polyphemus) <400> 19 atgttggtga ataacatgtt ttcattgctg tgtttcccac tcctgatgtc tatgtttagc 60 tgcagtagtc tcggcagaca gcgtagacaa tttgttttcc ccgatgatga agaatcatgc 120 tcaaaccgat ttactaacga tggaatatgt aaagatgttt tgaattgtag agatctttta 180 caaaaaaatg attataattt actgaaagaa tcaatatgcg gttttgaagg cataacaccc 240 aaagtttgtt gtccgaaaca aagtattgta aatccaataa cagaagcacc tccaaaaaat 300 actacaactg aacgaccgcc aatccgtata ccatccaatc ttcctaaaca gtgtggaaat 360 cgtaatatta caactaccag gattattgga gggcaggaag caacacctgg agcctggccc 420 tggatggctg ctgtctatat caaacaagga ggaatcagaa gtgttcagtg tggaggtgcg 480 cttgtcacca acaggcacgt gattacagca tcgcactgtg ttgtaaacag tttaggaaca 540 gatgtgatgc gagctgacgt attctcggtt cgcctaggtg aacacaattt atatagcacc 600 aatgacagtt cagatccaat tgattttgca gttacgtcag tgaaacatca tgaaaacttt 660 gtgctcgcga cgtatttgaa tgatatcgca attctgaagt taaacgacac tgttacgttt 720 acgcacaaaa ttaaaccaat ttgtctacct tatgaaagct taaggtatga ggatctagca 780 atgagaaacc catttgtcgc cggatgggga acaacagcat ttaatggccc atctagtgca 840 gtattacgag aagtgcagtt accaatatgg ggacacgagc cctgcaggca ggcctacgag 900 aaggatttaa atattacaaa cgtgtatatg tgtgctgggt atgcagatgg cggtaaagat 960 gcttgccagg gtgattctgg aggtccaatg atgttgcctg ataaaagcgg gaacttttat 1020 ctcgttggaa ttgtgtcttt cggaaagaaa tgcgcgttgc ctggatttcc tggggtttac 1080 acaaaagtga ccgaattttt agattggatt gcagtaaata tggtgtag 1128 <210> 20 <211> 375 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 20 Met Leu Val Asn Asn Met Phe Ser Leu Leu Cys Phe Pro Leu Leu Met 1 5 10 15 Ser Met Phe Ser Cys Ser Ser Leu Gly Arg Gln Arg Arg Gln Phe Val 20 25 30 Phe Pro Asp Asp Glu Glu Ser Cys Ser Asn Arg Phe Thr Asn Asp Gly 35 40 45 Ile Cys Lys Asp Val Leu Asn Cys Arg Asp Leu Leu Gln Lys Asn Asp 50 55 60 Tyr Asn Leu Leu Lys Glu Ser Ile Cys Gly Phe Glu Gly Ile Thr Pro 65 70 75 80 Lys Val Cys Cys Pro Lys Gln Ser Ile Val Asn Pro Ile Thr Glu Ala 85 90 95 Pro Pro Lys Asn Thr Thr Thr Glu Arg Pro Pro Ile Arg Ile Pro Ser 100 105 110 Asn Leu Pro Lys Gln Cys Gly Asn Arg Asn Ile Thr Thr Thr Arg Ile 115 120 125 Ile Gly Gly Gln Glu Ala Thr Pro Gly Ala Trp Pro Trp Met Ala Ala 130 135 140 Val Tyr Ile Lys Gln Gly Gly Ile Arg Ser Val Gln Cys Gly Gly Ala 145 150 155 160 Leu Val Thr Asn Arg His Val Ile Thr Ala Ser His Cys Val Val Asn 165 170 175 Ser Leu Gly Thr Asp Val Met Arg Ala Asp Val Phe Ser Val Arg Leu 180 185 190 Gly Glu His Asn Leu Tyr Ser Thr Asn Asp Ser Ser Asp Pro Ile Asp 195 200 205 Phe Ala Val Thr Ser Val Lys His His Glu Asn Phe Val Leu Ala Thr 210 215 220 Tyr Leu Asn Asp Ile Ala Ile Leu Lys Leu Asn Asp Thr Val Thr Phe 225 230 235 240 Thr His Lys Ile Lys Pro Ile Cys Leu Pro Tyr Glu Ser Leu Arg Tyr 245 250 255 Glu Asp Leu Ala Met Arg Asn Pro Phe Val Ala Gly Trp Gly Thr Thr 260 265 270 Ala Phe Asn Gly Pro Ser Ser Ala Val Leu Arg Glu Val Gln Leu Pro 275 280 285 Ile Trp Gly His Glu Pro Cys Arg Gln Ala Tyr Glu Lys Asp Leu Asn 290 295 300 Ile Thr Asn Val Tyr Met Cys Ala Gly Tyr Ala Asp Gly Gly Lys Asp 305 310 315 320 Ala Cys Gln Gly Asp Ser Gly Gly Pro Met Met Leu Pro Asp Lys Ser 325 330 335 Gly Asn Phe Tyr Leu Val Gly Ile Val Ser Phe Gly Lys Lys Cys Ala 340 345 350 Leu Pro Gly Phe Pro Gly Val Tyr Thr Lys Val Thr Glu Phe Leu Asp 355 360 365 Trp Ile Ala Val Asn Met Val 370 375 <210> 21 <211> 1128 <212> DNA <213> Horseshoe crab (Limulus polyphemus) <400> 21 atgttggtga ataacatgtt ttcattgctg tgtttctcac tcctgatgtc tatgtttagc 60 tgcagtagtc tcggcagaca gcgtagacag tttgttttcc ccgatgatga agaatcatgc 120 tcaaaccgat ttactaacga tggaatatgt aaagatgttt tgaattgtag agatctttta 180 caaaaaaatg attataattt actgaaagaa tcaatatgcg gttttgaagg cataacaccc 240 aaagtttgtt gtccgaaaca aagtattgta aatccaataa cagaagcacc tccaaaaact 300 actacaactg aacgaccgcc aatacggata ccatccaatc ttcctaaaca gtgtggaaat 360 cgtaatatta caactaccag gattattgga gggcaggaag caacacctgg agcctggccc 420 tggatggctg ctgtctatat caaacaagga ggaatcagaa gtgttcagtg tggaggtgcg 480 cttgtcacca acaggcacgt gattacagca tcgcactgtg ttgtaaacag tttaggaaca 540 gatgtgatgc gagctgacgt attctcggtt cgcctaggtg aacacaattt atatagcacc 600 aatgacagtt cagatccaat tgatttgca gttacgtcag tgaaacatca tgaaaacttt 660 gtgctcgcga cgtatttgaa tgatatcgca attctgaagt taaacgacac tgttacgttt 720 acgcacaaaa ttaaaccaat ttgtctacct tatgaaagct taaggtatga ggatctagca 780 atgagaaacc cattgtcgc cggatgggga acaacagcat ttaatggccc atctagtgca 840 gtattacgag aagtgcagtt accaatatg ggacacgagc cctgcaggca ggcctacgag 900 aaggatttaa atattacaaa cgtgtgtatg tgtgctgggt atgcagatgg cggtaaagat 960 gcttgccagg gtgattctgg aggtccaatg atgttgcctg ataaaagcgg gaacttttat 1020 ctcgttggaa ttgtgtcttt cggaaagaaa tgcgcgttgc ctggatttcc tggggtttac 1080 acgaaagtga ccgaattttt agattggatt gcagtaaata tggtgtag 1128 <210> 22 <211> 375 <212> PRT <213> Horseshoe crab (Limulus polyphemus) <400> 22 Met Leu Val Asn Asn Met Phe Ser Leu Leu Cys Phe Ser Leu Leu Met 1 5 10 15 Ser Met Phe Ser Cys Ser Ser Leu Gly Arg Gln Arg Arg Gln Phe Val 20 25 30 Phe Pro Asp Asp Glu Glu Ser Cys Ser Asn Arg Phe Thr Asn Asp Gly 35 40 45 Ile Cys Lys Asp Val Leu Asn Cys Arg Asp Leu Leu Gln Lys Asn Asp 50 55 60 Tyr Asn Leu Leu Lys Glu Ser Ile Cys Gly Phe Glu Gly Ile Thr Pro 65 70 75 80 Lys Val Cys Cys Pro Lys Gln Ser Ile Val Asn Pro Ile Thr Glu Ala 85 90 95 Pro Pro Lys Thr Thr Thr Thr Glu Arg Pro Pro Ile Arg Ile Pro Ser 100 105 110 Asn Leu Pro Lys Gln Cys Gly Asn Arg Asn Ile Thr Thr Thr Arg Ile 115 120 125 Ile Gly Gly Gln Glu Ala Thr Pro Gly Ala Trp Pro Trp Met Ala Ala 130 135 140 Val Tyr Ile Lys Gln Gly Gly Ile Arg Ser Val Gln Cys Gly Gly Ala 145 150 155 160 Leu Val Thr Asn Arg His Val Ile Thr Ala Ser His Cys Val Val Asn 165 170 175 Ser Leu Gly Thr Asp Val Met Arg Ala Asp Val Phe Ser Val Arg Leu 180 185 190 Gly Glu His Asn Leu Tyr Ser Thr Asn Asp Ser Ser Asp Pro Ile Asp 195 200 205 Phe Ala Val Thr Ser Val Lys His His Glu Asn Phe Val Leu Ala Thr 210 215 220 Tyr Leu Asn Asp Ile Ala Ile Leu Lys Leu Asn Asp Thr Val Thr Phe 225 230 235 240 Thr His Lys Ile Lys Pro Ile Cys Leu Pro Tyr Glu Ser Leu Arg Tyr 245 250 255 Glu Asp Leu Ala Met Arg Asn Pro Phe Val Ala Gly Trp Gly Thr Thr 260 265 270 Ala Phe Asn Gly Pro Ser Ser Ala Val Leu Arg Glu Val Gln Leu Pro 275 280 285 Ile Trp Gly His Glu Pro Cys Arg Gln Ala Tyr Glu Lys Asp Leu Asn 290 295 300 Ile Thr Asn Val Cys Met Cys Ala Gly Tyr Ala Asp Gly Gly Lys Asp 305 310 315 320 Ala Cys Gln Gly Asp Ser Gly Gly Pro Met Met Leu Pro Asp Lys Ser 325 330 335 Gly Asn Phe Tyr Leu Val Gly Ile Val Ser Phe Gly Lys Lys Cys Ala 340 345 350 Leu Pro Gly Phe Pro Gly Val Tyr Thr Lys Val Thr Glu Phe Leu Asp 355 360 365 Trp Ile Ala Val Asn Met Val 370 375 <210> 23 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Peptide <400> 23 Ile Glu Gly Arg 1 <210> 24 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 24 ctgcaggaat tcgatttttt tttttttttt ttttt 35 <210> 25 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 25 atcgataagc ttgatgatct gggcttgtgt gatga 35 <210> 26 <211> 15 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 26 ctgcaggaat tcgaat 15 <210> 27 <211> 15 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 27 ctacaccaag ttcca 15 <210> 28 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 28 gtaaaccatg tgacaaactg gaggc 25 <210> 29 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 29 aataaggcct ccatcgatag aagta 25 <210> 30 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 30 ggggaattca agcttgccac catggtacta gcgtcgttc 39 <210> 31 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 31 gggctcgagt caaatgaact gccgaatcca cgata 35 <210> 32 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 32 atcgataagc ttgatcacat gcaaggaaaa gttct 35 <210> 33 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 33 ctgcaggaat tcgatcactg tttaaacaaa ctgaa 35 <210> 34 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 34 atcgataagc ttgatagacc agagtggtct ttctg 35

Claims

1. A method for preparing an endotoxin detection agent, comprising the following steps: Transforming cells with a DNA construct containing the cDNA; and By culturing the transformed cells, the cells are artificially made to express the protein encoded by the cDNA, The cDNA is a cDNA consisting of the base sequence shown in sequence number 1 or 3.

2. The manufacturing method according to claim 1, wherein: The cells are mammalian cells or insect cells.

3. The manufacturing method according to claim 2, wherein: The mammalian cells are rodent or primate cells.

4. The manufacturing method according to claim 3, wherein: The rodent or primate cells are cell lines derived from Chinese hamster ovary or human fetal kidney cells.

5. The production method according to any one of claims 1 to 4, wherein The production method comprises the following steps: recovering the culture fluid, culture supernatant, cell-disrupted extract, or a mixture thereof of the cells.

6. A method for preparing an endotoxin detection agent, comprising the following steps: Transforming cells with a DNA construct containing the cDNA; and By culturing the transformed cells, the cells are artificially made to express the protein encoded by the cDNA, The cDNA is a cDNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 or 4.

7. The manufacturing method according to claim 6, wherein: The cells are mammalian cells or insect cells.

8. The manufacturing method according to claim 7, wherein: The mammalian cells are rodent or primate cells.

9. The manufacturing method according to claim 8, wherein: The rodent or primate cells are cell lines derived from Chinese hamster ovary or human fetal kidney cells.

10. The production method according to any one of claims 6 to 9, wherein The production method comprises the following steps: recovering the culture fluid, culture supernatant, cell-disrupted extract, or a mixture thereof of the cells.

Images