Electrochemiluminescent aptamer sensor for detecting synthetic cathinone MDPV and its preparation method and application

Abstract

The present invention provides an electrochemiluminescent aptamer sensor for detecting synthetic cathinone MDPV, and a preparation method and application thereof, which belong to the field of electrochemiluminescence detection. The electrochemiluminescent aptamer sensor is formed by loading an aptamer SF on the surface of a glassy carbon electrode modified by a composite material In‑MOF@Sn‑TCPP; the composite material In‑MOF@Sn‑TCPP is In‑MOF coated with Sn‑TCPP (5,10,15,20‑tetrakis(4‑carboxyphenyl)tinporphyrin). The detection method is to use a SF / In‑MOF@Sn‑TCPP / GCE modified electrode as a working electrode, an Ag / AgCl electrode as a reference electrode, and a platinum electrode as an auxiliary electrode to form a traditional three-electrode system. The preparation method of the modified electrode in the present invention is simple, and the sensitivity to MDPV detection is high, the selectivity is good, and the linear range is wide.

Description

Technical Field

[0001] The invention belongs to the field of electrochemiluminescence detection, and specifically relates to an electrochemiluminescence aptamer sensor for detecting synthetic cathinone MDPV, and a preparation method and application thereof. Background Art

[0002] Electronic cigarettes are electronic products that imitate cigarettes. Merchants have been promoting them as having no harmful ingredients such as tar and suspended particles, and even using the slogans of "smoking cessation tool" and "lung cleansing" in product introductions. The World Health Organization has conducted a special study on electronic cigarettes and has come to a clear conclusion: electronic cigarettes are harmful to public health and must be more strictly controlled, especially to prevent harm to teenagers and non-smokers.

[0003] Synthetic cathinone MDPV is a new psychoactive substance. It is a substance similar to "bath salts". Drug users usually take it by swallowing, smoking or injecting solutions. It acts on the human body and brain, causing a rapid heartbeat, irritability and even hallucinations in the short term. Long-term use can cause muscle weakness and even kidney and heart problems. The problem of drug adulteration in e-cigarettes has seriously affected the public's personal health and safety, so there is an urgent need for a method to detect psychoactive substances in e-cigarettes. At present, the main detection methods for MDPV include liquid chromatography (LC), gas chromatography / mass spectrometry (GC-MS), liquid chromatography / mass spectrometry (LC-MS), fluorescence spectroscopy (FL) and Raman spectroscopy (LRS), etc. These methods have high accuracy, but they often need to be used in conjunction with infrared (FT-IR) and nuclear magnetic resonance (NMR) methods, and there are a series of problems such as high price and high detection limit. These problems will limit their application in actual monitoring, so it is urgent to find a simple, fast and sensitive detection method.

[0004] Electrochemiluminescence (ECL) is a method developed by combining the advantages of chemiluminescence and electrochemistry. It is widely used in fields such as biological analysis and surface analysis due to its unique advantages. It has the advantages of high sensitivity, low background, easy control and short detection time, and does not require the introduction of external light sources. Compared with the photoluminescence method, it can effectively avoid the interference of background light sources and improve the detection sensitivity through a high signal-to-noise ratio, thereby achieving the purpose of trace detection of the target. At present, there are few reports on the electrochemiluminescence method for detecting MDPV using a three-electrode system. Summary of the invention

[0005] In view of the shortcomings of the prior art for detecting synthetic cathinone MDPV, the present invention provides an electrochemiluminescent aptamer sensor for detecting synthetic cathinone MDPV, and a preparation method and application thereof. The present invention uses In-MOF@Sn-TCPP nanocomposite to modify the surface of a glassy carbon electrode to obtain an In-MOF@Sn-TCPP / GCE modified electrode, so that the sensitivity and stability of electrochemiluminescence are significantly improved. The aptamer SF is loaded on the surface of a glassy carbon electrode modified by the composite material In-MOF@Sn-TCPP to obtain an electrochemiluminescent aptamer sensor. After adding the detection object synthetic cathinone MDPV, the ECL signal value of the SF / In-MOF@Sn-TCPP / GCE electrochemiluminescent aptamer sensor decreases significantly, and the detection of MDPV can be achieved. After adding other interfering substances, it is found that the aptamer sensor has good specificity.

[0006] An electrochemiluminescent aptamer sensor for detecting synthetic cathinone MDPV, wherein the electrochemiluminescent aptamer sensor is formed by loading an aptamer SF on the surface of a glassy carbon electrode modified by a composite material In-MOF@Sn-TCPP; the composite material In-MOF@Sn-TCPP is In-MOF coated with Sn-TCPP (5,10,15,20-tetrakis(4-carboxyphenyl)tinporphyrin; the aptamer SF is an aptamer containing a base sequence of 5'-GGGTAGGGCGGGAAGTTACTGTCTTACTGTCG TA-3'.

[0007] Furthermore, the preparation method of the composite material In-MOF@Sn-TCPP modified glassy carbon electrode comprises the following steps:

[0008] (1) Preparation of In-MOF;

[0009] Specifically, accurately weigh 0.4082g In(NO 3 ) 3 , 0.2g H 2 BDC and 5 mL DMF were placed in a beaker and dissolved by ultrasound to form a colorless transparent solution. The solution was transferred to a polytetrafluoroethylene-lined stainless steel autoclave and reacted at 100 °C for 24 h, then cooled to room temperature, centrifuged, washed with ethanol, and dried to obtain a white solid In-MOF.

[0010] (2) Preparation of In-MOF@Sn-TCPP composite material: The In-MOF prepared in step (1) was dispersed in a mixed solution of DMF and ethanol, and 5,10,15,20-tetrakis(4-carboxyphenyl)porphyrin (TCPP) and stannous chloride and / or stannous chloride hydrate were added. After being fully dissolved and dispersed, the mixture was transferred to a polytetrafluoroethylene-lined stainless steel autoclave to obtain the In-MOF@Sn-TCPP composite material at the reaction temperature.

[0011] Specifically, a certain amount of In-MOF (10 mg), stannous chloride dihydrate (SnCl 2 ·2H 2 O) (11 mg) and 5,10,15,20-tetrakis(4-carboxyphenyl)porphyrin (TCPP) (8 mg) were dissolved in a mixed solution of 12 mL DMF and ethanol. The solution was transferred to a polytetrafluoroethylene-lined stainless steel autoclave and reacted at 100 ° C for 24 h, then cooled to room temperature, and the brick-red precipitate was collected by centrifugation, washed with DMF and ethanol respectively, and dried to obtain a dark red solid, which was the In-MOF@Sn-TCPP composite material.

[0012] Further, in the mixed solution of DMF and ethanol, DMF and ethanol (V:V=1:2).

[0013] (3) In-MOF@Sn-TCPP was dispersed in DMF and evenly dispersed by ultrasound to obtain an In-MOF@Sn-TCPP dispersion, which was then primed on the surface of a clean glassy carbon electrode and naturally dried to obtain a composite material In-MOF@Sn-TCPP modified glassy carbon electrode.

[0014] Furthermore, the cleaning method of the cleaned glassy carbon electrode in step (3) includes: polishing the glassy carbon electrode, ultrasonically cleaning it with nitric acid solution, ethanol solution and ultrapure water in sequence, and blowing it dry at room temperature.

[0015] Furthermore, the concentration of the DMF dispersion of In-MOF@Sn-TCPP was 1 mg / mL, and the drop coating amount of the DMF dispersion of In-MOF@Sn-TCPP was 4 μL.

[0016] The present invention also provides a method for preparing the electrochemiluminescent aptamer sensor for detecting synthetic cathinones, comprising the following steps:

[0017] The aptamer SF was loaded on the surface of the glassy carbon electrode modified with the In-MOF@Sn-TCPP composite material by electrostatic adsorption and naturally dried to prepare an electrochemiluminescent aptamer sensor (SF / In-MOF@Sn-TCPP / GCE) for detecting synthetic cathinones.

[0018] Furthermore, the specific method for loading the aptamer SF on the surface of the glassy carbon electrode modified by the In-MOF@Sn-TCPP composite material is as follows: first, a solution containing KCl, NaCl, MgCl 2 The aptamer SF is added to a Tris-HCl buffer solution containing ethylenediaminetetraacetic acid to prepare an aptamer solution with a concentration of 0.5 to 5 μM of the aptamer SF, and then the aptamer solution is removed and drop-coated on the surface of the glassy carbon electrode modified with the In-MOF@Sn-TCPP composite material.

[0019] Furthermore, the concentration of the aptamer SF in the aptamer solution is 1 μM, which is convenient for ensuring a better electrochemiluminescence intensity.

[0020] The present invention also provides a method for detecting synthetic cathinone based on an electrochemiluminescent aptamer sensor, comprising the following steps:

[0021] The electrochemiluminescent aptamer sensor (SF / In-MOF@Sn-TCPP / GCE) described above was used as the working electrode, Ag / AgCl was used as the reference electrode, and the platinum wire electrode was used as the counter electrode to form a three-electrode system. The MDPV in the sample was quantitatively fixed to the surface of the sensor, and the generated electrochemiluminescence signal was used for detection.

[0022] Further, the specific steps are:

[0023] Step 1, with K 2 S 2 O 8 Preparation of PBS buffer solution:

[0024] A 0.05 mol / L K 2 S 2 O 8 PBS buffer solution;

[0025] Step 2, preparation of MDPV standard solutions containing aptamer LF at different concentrations:

[0026] MDPV solution was prepared, and then the MDPV solution was diluted with Tris-HCl buffer solution and the aptamer LF was added at the same concentration as SF (the concentration of the aptamer LF was controlled to bind to the aptamer SF at a molar ratio of 1:1), to obtain a series of MDPV standard solutions containing aptamer LF at different concentrations. The concentration range of MDPV in the standard solution was 1.0×10 -14 ~1.0×10 -5 g / L;

[0027] Step 3, drawing of standard curve:

[0028] Equal amounts of MDPV standard solutions containing aptamer LF of different concentrations prepared in step 2 were modified on the electrochemiluminescent aptamer sensor and reacted for the same time to allow the electrochemiluminescent aptamer sensor to bind to MDPV. Then, a three-electrode system was formed using LF / MDPV / SF / In-MOF@Sn-TCPP / GCE as the working electrode, Ag / AgCl as the reference electrode, and a platinum electrode as the counter electrode. 2 S 2 O 8 PBS buffer solution was used as electrolyte, and cyclic voltammetry was performed in the electrochemical window range of -1.7 to 0 V with a photomultiplier tube high voltage of 800 V and a scan rate of 0.1 V / s. The luminescence intensity-time curve was recorded, and a linear relationship between the luminescence intensity difference (ΔECL) before and after the electrochemiluminescence aptamer sensor was combined with MDPV and the logarithmic value of the MDPV concentration in the MDPV standard solution was established to obtain the corresponding linear regression equation.

[0029] Step 4, Detection of MDPV in samples

[0030] The sample is first pretreated, diluted with Tris-HCl buffer solution, and then modified on the surface of the electrochemiluminescent aptamer sensor for the same reaction time according to step 3, so that the electrochemiluminescent aptamer sensor binds to MDPV, and then the luminescence intensity is detected by the method in step 3, and then the concentration of MDPV in the sample is calculated according to the linear regression equation.

[0031] Furthermore, the aptamer LF described in step 2 is an aptamer containing a base sequence of 5'-TACGACTCAGGCTTTGCC GGGTATGACTCAGGCTTTGCCGGGTAACAGGG-3', the amount of MDPV described in step 3 is 4 μL, and the reaction time is 30 min.

[0032] The beneficial effects of the present invention are:

[0033] The present invention designs an electrochemiluminescent aptamer sensor based on a composite material of porphyrin derivative Sn-TCPP and indium-based metal organic framework In-MOF. The two materials are combined through electrostatic interaction during synthesis to obtain efficient and stable electrochemiluminescence performance. The invention makes full use of the unique advantages of aptamers and electrochemiluminescence sensors, and successfully realizes sensitive detection of MDPV through the quenching effect of MDPV on the ECL signal intensity of the system. Experiments have proved that the sensing platform can specifically identify the detection object MDPV. The detection range of the present invention is 1.0×10 -12 ~1.0×10 -6 g / L, the minimum detection limit is 1.7×10 -13The present invention has simple operation for detecting MDPV, good selectivity, high sensitivity and wide detection range, and is of great significance for promoting the application of aptamer sensors in practical detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The present invention provides a brief flow chart for the preparation of the electrochemiluminescent aptamer sensor and the detection of MDPV.

[0035] Figure 2 The ECL response diagram of the electrochemiluminescent aptamer sensor constructed in Example 1 after binding with different concentrations of MDPV, wherein the concentrations of MDPV from a to g are as follows: (a) 1.0×10 -12 g / L; (b)1.0×10 -11 g / L; (c)1.0×10 -10 g / L; (d)1.0×10 -9 g / L; (e)1.0×10 -8 g / L; (f)1.0×10 -7 g / L; (g)1.0×10 -6 g / L;

[0036] Figure 3 The standard curve of the difference in luminescence intensity before and after adding MDPV (ΔECL) and the logarithm of MDPV concentration in Example 1;

[0037] Figure 4 This is a scanning electron microscope image of the In-MOF@Sn-TCPP composite material prepared in Example 1.

[0038] Figure 5 This is a graph showing the ECL response of the In-MOF@Sn-TCPP modified glassy carbon electrode changing with time.

[0039] Figure 6 This is a graph showing the ECL response of the NiCoP-MOF@Sn-TCPP modified glassy carbon electrode changing with time.

[0040] Figure 7 This is a graph showing the ECL response of the In-MOF modified glassy carbon electrode changing with time.

[0041] Figure 8 This is a graph showing the ECL response of the NiCoP-MOF modified glassy carbon electrode changing with time.

[0042] Fig. 9 This is a comparison chart of the ECL responses of the In-MOF@Sn-TCPP modified glassy carbon electrode at different In-MOF and TCPP masses in the embodiment of the present invention. DETAILED DESCRIPTION

[0043] The present invention is not limited to the following specific embodiments. A person skilled in the art can implement the present invention in various other specific embodiments according to the contents disclosed in the present invention, or any simple changes or modifications made to the design structure and ideas of the present invention fall within the protection scope of the present invention. It should be noted that the embodiments and features in the embodiments of the present invention can be combined with each other without conflict.

[0044] The present invention will be further described in detail with reference to the embodiments: In the following embodiments, the aptamer (SF) containing the 5'-AGATGGGGGTTGAGGCTAAGCCGA-3' base sequence and the aptamer (LF) containing the 5'-TACGACTCAGGCTTTGCCGGGTATGACTCAGGCTTTGCCGGGTAACAGG G-3' base sequence were purchased from Sangon Biotech (Shanghai) Co., Ltd. The method for loading the aptamer SF on the surface of the glassy carbon electrode modified with the In-MOF@Sn-TCPP composite material is as follows: first, KCl, NaCl, MgCl 2 The aptamer is added to a Tris-HCl buffer solution containing ethylenediaminetetraacetic acid to prepare an aptamer solution, and then the aptamer solution is removed and drop-coated on the surface of the glassy carbon electrode modified with the In-MOF@Sn-TCPP composite material. Specifically:

[0045] Step 1: vortex the purchased aptamers for 5 min before opening the lid, and then centrifuge at 4000 rpm for 15 min;

[0046] Step 2: Open the tube cap and add 735 μL and 535 μL of 0.2 mol / L KCl, 0.1 mol / L NaCl, and 5.0 mmol / L MgCl to the aptamers SF and LF, respectively. 2 and a stock solution of 1.0 mmol / L EDTA in 0.05 M Tris-HCl buffer;

[0047] Step 3: Shake thoroughly and dilute the aptamer to a concentration of 10 μM and store in a 4°C refrigerator until use.

[0048] The preparation method of the MDPV standard solution containing the aptamer LF at different concentrations in the following examples is as follows: prepare the MDPV solution, then dilute it with Tris-HCl buffer solution and add the aptamer LF at the same concentration as SF to obtain a series of MDPV standard solutions containing the aptamer LF at different concentrations. The concentrations of MDPV in the MDPV standard solution containing the aptamer LF in this example are: (a) 1.0×10 -12 g / L; (b)1.0 ×10-11 g / L; (c)1.0×10 -10 g / L; (d)1.0×10 -9 g / L; (e)1.0×10 -8 g / L; (f)1.0×10 -7 g / L; (g)1.0×10 -6 g / L;

[0049] Embodiment 1:

[0050] (I) Assembly of SF / In-MOF@Sn-TCPP / GCE sensor

[0051] (1) Preparation of In-MOF and In-MOF@Sn-TCPP materials:

[0052] Accurately weigh 0.4082g In(NO 3 ) 3 , 0.2g H 2 BDC and 5 mL DMF were placed in a beaker and dissolved by ultrasound to form a colorless transparent solution. The solution was transferred to a polytetrafluoroethylene-lined stainless steel autoclave and reacted at 100 °C for 24 h, then cooled to room temperature, centrifuged, washed with ethanol, and dried to obtain a white solid In-MOF. It was stored at 4 °C.

[0053] Accurately weigh a certain amount of In-MOF (10 mg), stannous chloride dihydrate (SnCl 2 ·2H 2 O) (11 mg) and 5,10,15,20-tetrakis(4-carboxyphenyl)porphyrin (TCPP) (8 mg) were dissolved in a mixed solution of 12 mL DMF and ethanol. The solution was transferred to a polytetrafluoroethylene-lined stainless steel autoclave and reacted at 100 ° C for 24 hours, then cooled to room temperature, and the brick-red precipitate was collected by centrifugation, washed with DMF and ethanol respectively and dried. The dark red solid obtained was the In-MOF@Sn-TCPP composite material. In-MOF@Sn-TCPP was dispersed in DMF and ultrasonically dispersed to obtain an In-MOF@Sn-TCPP dispersion with a concentration of 1 mg / mL.

[0054] (2) Preparation of electrochemiluminescent aptasensor for detecting MDPV

[0055] First, the glassy carbon electrode was polished with a polishing powder (Al 2 O 3) After being polished into a mirror surface on suede, it was ultrasonically cleaned with nitric acid solution, ethanol solution and ultrapure water in turn, and dried at room temperature to obtain a pretreated glassy carbon electrode. Use a microsyringe to transfer 4 μL of 1 mg / mL DMF dispersion of In-MOF@Sn-TCPP prepared in step (1), and after it is naturally dried, it is modified with 4 μL of the prepared Tris-HCl buffer solution containing the aptamer SF. After naturally drying, the SF / In-MOF@Sn-TCPP / GCE sensor is obtained as the sensing element for electrochemiluminescence test.

[0056] The concentration of the aptamer SF in the aptamer solution was 1 μM.

[0057] (II) Method for detecting MDPV based on electrochemiluminescent aptamer sensor

[0058] (1) Drawing of standard curve

[0059] Equal amounts of MDPV standard solutions containing aptamer LF at different concentrations were modified on the electrochemiluminescent aptamer sensor as described in (I) and reacted for the same time to allow the electrochemiluminescent aptamer sensor to bind to MDPV. Then, a three-electrode system was formed using LF / MDPV / SF / In-MOF@Sn-TCPP / GCE as the working electrode, Ag / AgCl as the reference electrode, and a platinum electrode as the counter electrode. The pH value was 7.4 and the solution contained 0.05 mol / L K 2 S 2 O 8 PBS buffer solution was used as the electrolyte, and cyclic voltammetry was performed in the electrochemical window range of -1.7 to 0 V with a photomultiplier tube high voltage of 800 V and a scan rate of 0.1 V / s. The luminescence intensity-time curve was recorded, and a linear relationship between the luminescence intensity difference (ΔECL) before and after the electrochemiluminescence aptamer sensor was combined with MDPV and the logarithmic value of the MDPV concentration in the MDPV standard solution was established to obtain the corresponding linear regression equation;

[0060] ΔECL=3980.50887+1006.6002lg C(ng / L), detection range is 1.0×10 -12 ~1.0×10 -6 g / L, the detection limit is 1.7×10 -13 g / L.

[0061] (2) Sample testing

[0062] 100 μL of a certain brand of electronic cigarette liquid was added to 100 μL of Tris-HCl buffer solution to obtain a dilution and the dilution was divided into several equal parts. Different concentrations of MDPV standard solution containing aptamer LF were added to the above dilution, and after sufficient reaction, the solution was centrifuged at 3000 rpm for 5 min and the supernatant was collected. 4 μL of the supernatant was modified on the surface of the prepared electrochemiluminescent aptamer sensor, and the concentration of MDPV in the sample to be detected was calculated according to the linear regression equation obtained in step (1). The results are listed in Table 1.

[0063] In this example, In-MOF@Sn-TCPP is used as the substrate material (morphology as Figure 4 ), the electrostatic interaction between In-MOF and Sn-TCPP is used to stably combine them, which can greatly improve the electrochemical luminescence intensity of the individual materials, and has good conductivity, stability, and sensor selectivity.

[0064] Comparative Example 1:

[0065] (1) Preparation of SF / In-MOF / GCE sensor

[0066] 4 μL of 1 mg / mL In-MOF DMF dispersion was transferred with a micro-sample syringe and applied to the surface of the pre-treated glassy carbon electrode (pre-treatment method was the same as in Example 1) to obtain an In-MOF / GCE chemically modified electrode, which was naturally dried for standby use. 4 μL of 1 μM aptamer SF was then applied to the surface of the In-MOF / GCE chemically modified electrode, which was naturally dried to obtain an SF / In-MOF / GCE sensor as a sensing element for electrochemiluminescence testing. (The amount of modification in the monomer test and the sample concentration remained the same as in the example)

[0067] (2) Drawing of standard curve

[0068] The SF / In-MOF / GCE sensor prepared in step (1) was used as the sensing element. The same amount of MDPV standard solution containing aptamer LF at different concentrations was modified on the sensor surface and reacted for 30 min. Then, it was used as the working electrode, Ag / AgCl as the reference electrode, and the platinum electrode as the counter electrode to form a three-electrode system. 2 S 2 O 8The luminescence intensity was determined using 0.1 mol / L PBS buffer with a pH of 7.4 as the electrolyte. In the electrochemical window range of -1.7 to 0 V, the photomultiplier tube high voltage was 800 V, and the scan rate was 0.1 V / s. Cyclic voltammetry was performed and the luminescence intensity-time curve was recorded. A linear relationship was established between the luminescence intensity difference before and after the electrochemiluminescence aptamer sensor was bound to MDPV and the logarithm of the MDPV concentration in the MDPV standard solution, and the corresponding linear regression equation was obtained.

[0069] (3) Sample testing

[0070] 100 μL of a certain brand of electronic cigarette liquid was added to 100 μL of Tris-HCl buffer solution to obtain a dilution and the dilution was divided into several equal parts. Different concentrations of MDPV standard solution containing aptamer LF were added to the above dilution, and after sufficient reaction, the solution was centrifuged at 3000 rpm for 5 min and the supernatant was collected. 4 μL of the supernatant was modified on the surface of the prepared electrochemiluminescent aptamer sensor, and the concentration of MDPV in the sample to be detected was calculated according to the linear regression equation obtained in step (1). The results are listed in Table 1.

[0071] Comparative Example 2:

[0072] (1) Preparation of SF / Sn-TCPP / GCE sensor

[0073] 4 μL of 1 mg / mL Sn-TCPP DMF dispersion was transferred with a microsyringe and applied to the surface of the pre-treated glassy carbon electrode (pre-treatment method was the same as in Example 1) to obtain the Sn-TCPP / GCE chemically modified electrode, which was naturally dried for standby use. 4 μL of 1 μM aptamer SF was then applied to the surface of the Sn-TCPP / GCE chemically modified electrode, which was naturally dried to obtain the SF / Sn-TCPP / GCE sensor as the sensing element for the electrochemiluminescence test. (The monomer test modification amount and sample concentration remained single variables as in the example)

[0074] (2) Drawing of standard curve

[0075] The SF / Sn-TCPP / GCE sensor prepared in step (1) was used as the sensing element. Equal amounts of MDPV standard solutions of different concentrations were modified on the sensor surface and reacted for 30 min. Then, it was used as the working electrode, Ag / AgCl as the reference electrode, and the platinum electrode as the counter electrode to form a three-electrode system. 2 S 2 O 8The luminescence intensity was determined using 0.1 mol / L PBS buffer with a pH of 7.4 as the electrolyte. In the electrochemical window range of -1.7 to 0 V, the photomultiplier tube high voltage was 800 V, and the scan rate was 0.1 V / s. Cyclic voltammetry was performed and the luminescence intensity-time curve was recorded. A linear relationship was established between the difference in luminescence intensity before and after the electrochemiluminescence aptamer sensor was bound to MDPV and the logarithm of the MDPV concentration in the MDPV standard solution, and the corresponding linear regression equation was obtained.

[0076] (3) Sample testing

[0077] 100 μL of a certain brand of electronic cigarette liquid was added to 100 μL of Tris-HCl buffer solution to obtain a dilution and the dilution was divided into several equal parts. Different concentrations of MDPV standard solution containing aptamer LF were added to the above dilution, and after sufficient reaction, the solution was centrifuged at 3000 rpm for 5 min and the supernatant was collected. 4 μL of the supernatant was modified on the surface of the prepared electrochemiluminescent aptamer sensor, and the concentration of MDPV in the sample to be detected was calculated according to the linear regression equation obtained in step (1). The results are listed in Table 1.

[0078] Comparative Example 3:

[0079] (1) Preparation of SF / Sn-TCPP / In-MOF / GCE sensor

[0080] Use a microsyringe to transfer 4 μL of 1 mg / mL In-MOF DMF dispersion and apply it to the surface of the pre-treated glassy carbon electrode (pre-treatment method is the same as in Example 1) to obtain the In-MOF / GCE chemically modified electrode. After natural drying, apply 4 μL of 1 mg / mL Sn-TCPP DMF dispersion and dry it naturally for use. Apply 4 μL of 1 μM aptamer SF to the surface of the Sn-TCPP / In-MOF / GCE chemically modified electrode and dry it naturally to obtain the SF / Sn-TCPP / In-MOF / GCE sensor as the sensing element for the electrochemiluminescence test. (The monomer test modification amount and sample concentration remain single variables as in the example)

[0081] (2) Drawing of standard curve

[0082] The SF / Sn-TCPP / In-MOF / GCE sensor prepared in step (1) was used as the sensing element. The same amount of MDPV standard solution of different concentrations was modified on the sensor surface and reacted for 30 min. Then, it was used as the working electrode, Ag / AgCl as the reference electrode, and the platinum electrode as the counter electrode to form a three-electrode system. 2 S 2 O 8The luminescence intensity was determined using 0.1 mol / L PBS buffer with a pH of 7.4 as the electrolyte. In the electrochemical window range of -1.7 to 0 V, the photomultiplier tube high voltage was 800 V, and the scan rate was 0.1 V / s. Cyclic voltammetry was performed and the luminescence intensity-time curve was recorded. A linear relationship was established between the luminescence intensity difference before and after the electrochemiluminescence aptamer sensor was bound to MDPV and the logarithm of the MDPV concentration in the MDPV standard solution, and the corresponding linear regression equation was obtained.

[0083] (3) Sample testing

[0084] 100 μL of a certain brand of electronic cigarette liquid was added to 100 μL of Tris-HCl buffer solution to obtain a dilution and the dilution was divided into several equal parts. Different concentrations of MDPV standard solution containing aptamer LF were added to the above dilution, and after sufficient reaction, the solution was centrifuged at 3000 rpm for 5 min and the supernatant was collected. 4 μL of the supernatant was modified on the surface of the prepared electrochemiluminescent aptamer sensor, and the concentration of MDPV in the sample to be detected was calculated according to the linear regression equation obtained in step (1). The results are listed in Table 1.

[0085] Table 1 Test results of an electronic cigarette sample

[0086]

[0087] Remark: a The average value of three measurements

[0088] As shown in Table 1, the sample was measured three times in parallel, and the spike recovery rate was between 98% and 105%, and the relative standard deviation was less than 5%, indicating that the recovery effect was good. The above experimental results show that MDPV cannot be detected by further assembling the sensor element after modifying the glassy carbon electrode with In-MOF, Sn-TCPP or Sn-TCPP / In-MOF without modification of the In-MOF@Sn-TCPP composite material. Therefore, the sensor of the present invention can be used to detect MDPV in electronic cigarettes.

[0089] Based on the above verification, it can be seen that the present invention constructs a new method for rapid and sensitive detection of MDPV based on the electrochemiluminescence quenching effect of MDPV on the SF / In-MOF@Sn-TCPP / GCE system. Since In-MOF and Sn-TCPP have good electrostatic interactions, they can form In-MOF@Sn-TCPP composite materials with high electrochemiluminescence intensity and good stability. When there is a trace amount of MDPV, In-MOF in the SF / In-MOF@Sn-TCPP / GCE system will enrich the detection object MDPV. At the same time, the aptamer LF in the solution will base pair with the aptamer SF in the sensor, and MDPV and the aptamer LF will be simultaneously fixed on the electrochemiluminescence aptamer sensor, so that the ECL signal of SF / In-MOF@Sn-TCPP / GCE is significantly reduced. Through research, it is found that the enhancement value (ΔECL) of the ECL signal of the SF / In-MOF@Sn-TCPP / GCE sensor system shows a good linear relationship with the concentration of MDPV. The electrochemiluminescence method used in the present invention not only has the advantages of high sensitivity, fast detection speed, good selectivity and wide linear range, but also has great application potential for the quantitative analysis of MDPV in electronic cigarettes.

[0090] In addition, regarding the selection of metal organic frameworks, the present invention also conducted the following experiments: First, the electrochemical luminescence stability of glassy carbon electrodes modified with NiCoP-MOF and In-MOF respectively under the same conditions was compared, and the results showed that the two had comparable stability. However, when compounded with Sn-TCPP, the stability of the former was significantly deteriorated, as follows:

[0091] Preparation of NiCoP-MOF@Sn-TCPP composites:

[0092] (1) Preparation of NiCo-MOF: Accurately weigh 0.291 g Co(NO 3 ) 3 6H 2 O, 0.66 g 2-methylimidazole and 30 mL methanol were placed in a beaker, stirred at room temperature for 24 h (at least 24 h), centrifuged, washed with methanol, and dried to obtain blue-purple solid ZIF-67.

[0093] 50 mg ZIF-67 and 15 mL ethanol were accurately weighed and placed in a beaker, which was recorded as solution a. Then 200 mg Ni(NO 3 ) 3 6H 2O and 15 mL of ethanol were placed in a beaker, recorded as solution b. Solution a was slowly poured into solution b and the mixed solution was transferred to a polytetrafluoroethylene-lined stainless steel autoclave for reaction at 120 °C for 1 h, then cooled to room temperature, centrifuged, washed with ethanol, and dried to obtain green powder NiCo-MOF.

[0094] Take the above 20 mg NiCo-MOF and 120 mg NaH 2 PO 2 After being mixed evenly, the mixture was placed in a tube furnace and heated to 300°C under an argon atmosphere at a heating rate of 1-5°C / min for 1 h to obtain a gray solid NiCoP-MOF.

[0095] (2) Preparation of NiCoP-MOF@Sn-TCPP composite material: Accurately weigh a certain amount of NiCoP-MOF (10 mg), stannous chloride dihydrate (SnCl 2 ·2H 2 O) (11 mg) and 5,10,15,20-tetrakis(4-carboxyphenyl)porphyrin (TCPP) (8 mg) were dissolved in a mixed solution of 12 mL DMF and ethanol. The solution was transferred to a polytetrafluoroethylene-lined stainless steel autoclave and reacted at 100 ° C for 24 h, then cooled to room temperature, and the brick-red precipitate was collected by centrifugation, washed with DMF and ethanol respectively, and dried to obtain a dark red solid, which was the NiCoP-MOF@Sn-TCPP composite material.

[0096] The electrochemiluminescence stability test method is as follows: NiCoP-MOF, In-MOF, NiCoP-MOF@Sn-TCPP are prepared according to the preparation method of glassy carbon electrode modified with In-MOF@Sn-TCPP composite material to obtain NiCoP-MOF modified glassy carbon electrode, In-MOF modified glassy carbon electrode, NiCoP-MOF@Sn-TCPP modified glassy carbon electrode, and then each is used as a working electrode, and Ag / AgCl is used as the reference electrode, and a platinum electrode is used as the counter electrode to form a three-electrode system, and a 0.05 mol / L K 2 S 2 O 8 The luminescence intensity was measured using 0.1 mol / L PBS buffer at pH 7.4 as the electrolyte. For specific test conditions, see Example 1. The ECL response of the glassy carbon electrode modified with In-MOF@Sn-TCPP and the glassy carbon electrode modified with NiCoP-MOF@Sn-TCPP over time are shown in Figure 5 and Figure 6 The ECL response of NiCoP-MOF modified glassy carbon electrode and In-MOF modified glassy carbon electrode over time is shown in Figure 7 and Figure 8 .

[0097] Fig. 9 This is a comparison diagram of the ECL responses of the In-MOF@Sn-TCPP modified glassy carbon electrode at different In-MOF and TCPP masses in the embodiment of the present invention. It can be seen from the figure that when the mass ratio of In-MOF to TCPP is 8:8-16, the ECL response effect is better, which is suitable for preparing the sensor of the present invention, but 8:10-16 is more preferred.

[0098] The above embodiments are only used to illustrate the present invention and are not intended to limit the present invention. Technicians in the relevant fields may make various corresponding changes without departing from the scope of the present invention. Therefore, all technical solutions formed by equivalent replacements or equivalent modifications belong to the protection scope of the present invention.

Claims

1. An electrochemiluminescent aptamer sensor for detecting synthetic cathinone MDPV, characterized in that: The electrochemiluminescent aptamer sensor is formed by loading the aptamer SF on the surface of the glassy carbon electrode modified by the composite material In-MOF@Sn-TCPP; the composite material In-MOF@Sn-TCPP is In-MOF coated with Sn-TCPP (5,10,15,20,-tetrakis(4-carboxyphenyl)tinporphyrin; the aptamer SF is an aptamer containing the base sequence of 5'-GGGTAGGGCGGGAAGTTACTGTCTTACTGTCGTA-3'; The preparation method of the glassy carbon electrode modified by the composite material In-MOF@Sn-TCPP comprises the following steps: (1) Preparation of In-MOF; (2) Preparation of In-MOF@Sn-TCPP composite material: The In-MOF prepared in step (1) is dispersed in a mixed solution of DMF and ethanol, and 5,10,15,20-tetrakis(4-carboxyphenyl)porphyrin (TCPP) and stannous chloride and / or stannous chloride hydrate are added. After being fully dissolved and dispersed, the mixture is transferred to a polytetrafluoroethylene-lined stainless steel autoclave to obtain an In-MOF@Sn-TCPP composite material at a reaction temperature, wherein the mass ratio of In-MOF to TCPP is 1:1 to 2; (3) In-MOF@Sn-TCPP was dispersed in DMF and evenly dispersed by ultrasound to obtain an In-MOF@Sn-TCPP dispersion, which was then primed on the surface of a clean glassy carbon electrode and naturally dried to obtain a composite material In-MOF@Sn-TCPP modified glassy carbon electrode.

2. The electrochemiluminescent aptasensor for detecting synthetic cathinone MDPV according to claim 1, characterized in that: The preparation steps of In-MOF in step (1) include: accurately weighing 0.4082 g In(NO3)3, 0.2 g H2BDC and 5 mL DMF into a beaker, and ultrasonically dissolving to form a colorless transparent solution; transferring the solution into a polytetrafluoroethylene-lined stainless steel autoclave and reacting at 100 °C for 24 h, then cooling to room temperature, centrifuging, washing with ethanol, and drying to obtain a white solid In-MOF; And / or, in the preparation method of step (2), the reaction temperature is 100 °C, the reaction time is 24 h, and after the reaction is completed, the reaction is cooled to room temperature, and the brick red precipitate is collected by centrifugation, washed with DMF and ethanol respectively, and dried, and the obtained dark red solid is the composite material In-MOF@Sn-TCPP; And / or, in the mixed solution of DMF and ethanol in step (2), the volume ratio of DMF to ethanol is 1:

2.

3. The electrochemiluminescent aptasensor for detecting synthetic cathinone MDPV according to claim 1, characterized in that: The cleaning method of the cleaned glassy carbon electrode in step (3) comprises: polishing the glassy carbon electrode, ultrasonically cleaning it with nitric acid solution, ethanol solution and ultrapure water in sequence, and drying it at room temperature; And / or, in step (3), the concentration of the DMF dispersion of In-MOF@Sn-TCPP is 1 mg / mL, and the drop coating amount of the DMF dispersion of In-MOF@Sn-TCPP is 4 μL.

4. The method for preparing an electrochemiluminescent aptamer sensor for detecting synthetic cathinone MDPV according to any one of claims 1 to 3, characterized in that: The method comprises the following steps: loading the aptamer SF on the surface of the glassy carbon electrode modified by the composite material In-MOF@Sn-TCPP through electrostatic adsorption, and drying naturally to obtain an electrochemiluminescent aptamer sensor.

5. The method for preparing an electrochemiluminescent aptamer sensor for detecting synthetic cathinone MDPV according to claim 4, characterized in that: The specific method for loading the aptamer SF on the surface of the glassy carbon electrode modified by the In-MOF@Sn-TCPP nanocomposite material is as follows: first, the aptamer SF is added to a Tris-HCl buffer solution containing KCl, NaCl, MgCl2 and ethylenediaminetetraacetic acid to prepare an aptamer solution with an aptamer SF concentration of 0.5~5 μM, and then the aptamer solution is transferred and drop-coated on the surface of the glassy carbon electrode modified by the composite material In-MOF@Sn-TCPP.

6. The method for preparing an electrochemiluminescent aptamer sensor for detecting synthetic cathinone MDPV according to claim 5, characterized in that: The concentration of aptamer SF in the aptamer solution was 1 μM.

7. An electrochemiluminescence detection method for synthetic cathinone MDPV, characterized in that: The method comprises the following steps: using the electrochemiluminescent aptamer sensor for detecting synthetic cathinones as described in any one of claims 1 to 3 as a working electrode, Ag / AgCl as a reference electrode, and a platinum wire electrode as a counter electrode to form a three-electrode system; the synthetic cathinone MDPV in the sample is quantitatively captured on the surface of the sensor, and the detection of the synthetic cathinone is achieved through the generated luminescent signal.

8. The electrochemiluminescence detection method of synthetic cathinone MDPV according to claim 7, characterized in that: The following steps are also included: Step 1, preparation of PBS buffer solution containing K2S2O8: Prepare a PBS buffer solution containing 0.05 mol / L K2S2O8 using a 0.1 mol / L PBS buffer solution at pH 7.4; Step 2, preparation of synthetic cathinone MDPV standard solutions containing aptamer LF at different concentrations: A synthetic cathinone MDPV solution was prepared, and then the synthetic cathinone MDPV solution was diluted with a Tris-HCl buffer solution and the aptamer LF was added to obtain a series of synthetic cathinone MDPV standard solutions containing the aptamer LF at different concentrations. The concentration range of the synthetic cathinone MDPV in the standard solution was 1.0×10 -14 ~1.0×10 -5 g / L; Step 3, drawing of standard curve: Equal amounts of synthetic cathinone MDPV standard solutions containing aptamer LF of different concentrations prepared according to step 2 are modified on the electrochemiluminescent aptamer sensor and reacted for the same time, so that the electrochemiluminescent aptamer sensor is combined with the synthetic cathinone MDPV to obtain LF / MDPV / SF / In-MOF@Sn-TCPP / GCE, which is then used as a working electrode, Ag / AgCl as a reference electrode, and a platinum electrode as a counter electrode to form a three-electrode system, and the PBS buffer solution containing K2S2O8 in step 1 is used as an electrolyte. In the electrochemical window range of -1.7~0 V, a photomultiplier tube high voltage of 800 V and a scan rate of 0.1 V / s are used to perform cyclic voltammetry scanning, and the luminescence intensity-time curve is recorded. A linear relationship between the luminescence intensity difference (ΔECL) before and after the electrochemiluminescence aptamer sensor is combined with the synthetic cathinone MDPV and the logarithmic value of the synthetic cathinone concentration in the synthetic cathinone standard solution is established to obtain the corresponding linear regression equation; Step 4: Detection of synthetic cathinone MDPV in samples The sample is first pretreated, diluted with a Tris-HCl buffer solution, and then modified on the surface of an electrochemiluminescent aptamer sensor for the same reaction time according to step 3, so that the electrochemiluminescent aptamer sensor is combined with the synthetic cathinone MDPV, and then used as a working electrode, and the luminescence intensity is detected by the method in step 3, and then the concentration of the synthetic cathinone MDPV in the sample is calculated according to a linear regression equation; The aptamer LF described in step 2 is an aptamer containing the base sequence of 5'-TACGACT CAGGCTTTGCCGGGTATGACTCAGGCTTTGCCGGGTAACAGGG-3'.

9. The electrochemiluminescence detection method of synthetic cathinone MDPV according to claim 8, characterized in that: In step 3, the reaction time was 30 min, and the concentration of aptamer LF was controlled to bind to aptamer SF at a molar ratio of 1:1.

Images