Compositions and methods for increasing protein production in Bacillus licheniformis
By genetic modification of Bacillus licheniformis cells, especially the modification of rghR1, rghR2, yvzC and Bli3644 genes, the problem of insufficient protein production capacity in the prior art is solved, efficient protein production and red pigment reduction are achieved, and the needs of industrial biotechnology are met.
Patent Information
- Application Number
- CN202080072689.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-08-14
- Filing Date
- 2020-08-10
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2040-08-10
AI Technical Summary
The prior art is difficult to effectively improve the protein production capacity of Bacillus licheniformis cells, especially without increasing the production of harmful by-products such as red pigments.
Improve protein production capacity by genetic modification of Bacillus licheniformis cells, especially the rghR1, rghR2, yvzC and Bli3644 genes, including mutation, disruption or deletion of 5'-UTR and/or 3'-UTR sequences of these genes, to control protein expression and reduce red pigment production.
While Bacillus licheniformis cells have not increased the production of red pigments, they have significantly improved the protein production capacity and met the needs of high-yield proteins in industrial biotechnology.
Smart Images

Figure CN114630895B_ABST
Abstract
Description
Technical Field
[0001] This disclosure generally relates to the fields of bacteriology, microbiology, genetics, molecular biology, enzymology, and industrial protein production. More specifically, this disclosure relates to compositions and methods for obtaining Bacillus licheniformis strains with increased protein production capacity.
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This application claims priority to U.S. Provisional Patent Application No. 62 / 886,571, filed August 14, 2019, which is hereby incorporated by reference in its entirety.
[0004] References to sequence listings
[0005] The electronic submission of the text file sequence list named “NB41514-WO-PCT_SequenceListing.txt” was created on June 23, 2020, and is 316KB in size. It is hereby incorporated in its entirety by reference. Background Art
[0006] Gram-positive bacteria such as Bacillus subtilis, Bacillus licheniformis, and Bacillus amyloliquefaciens are frequently used as microbial factories to produce industrially relevant proteins due to their excellent fermentation properties and high yields (e.g., up to 25 g / L culture; Van Dijl and Hecker, 2013). For example, Bacillus subtilis is well-known for producing α-amylases (Jensen et al., 2000; Raul et al., 2014) and proteases (Brode et al., 1996) essential for the food, textile, laundry, medical device cleaning, and pharmaceutical industries (Westers et al., 2004). Because these non-pathogenic Gram-positive bacteria produce proteins that are completely free of toxic byproducts (such as lipopolysaccharide; LPS, also known as endotoxin), they have been granted Qualified for Safety (QPS) status by the European Food Safety Authority, and many of their products have been granted Generally Recognized As Safe (GRAS) status by the U.S. Food and Drug Administration (Olempska-Beer et al., 2006; Earl et al., 2008; Caspers et al., 2010).
[0007] Therefore, the production of proteins (e.g., enzymes, antibodies, receptors, etc.) in microbial host cells is of particular significance in the field of biotechnology. Similarly, the optimization of Bacillus host cells for the production and secretion of one or more target proteins is highly relevant, especially in industrial biotechnological environments where even small improvements in protein yield are significant when proteins are produced in large industrial quantities. More specifically, Bacillus licheniformis is a Bacillus species of high industrial importance as a host cell; therefore, for the construction of new and improved Bacillus licheniformis production strains, it is highly desirable to have modified and engineered Bacillus licheniformis host cells to obtain enhanced / increased protein expression / production capabilities. Therefore, this disclosure relates to the highly desired and unmet need for obtaining and constructing Bacillus licheniformis cells (e.g., protein production host cells) with increased protein production capabilities. Summary of the Invention
[0008] This disclosure generally relates to compositions and methods for constructing and obtaining Bacillus licheniformis cells (strains) with an increased protein production phenotype. More particularly, certain embodiments relate to modified Bacillus licheniformis cells derived from parental Bacillus licheniformis cells containing a natural rghR (chromosome) locus, wherein these modified cells contain at least one modification of the rghR locus selected from the group consisting of: (i) a modified rghR1 gene, (ii) a modified rghR2 gene, (iii) modified rghR1 and modified rghR2 genes, and (iv) modified rghR1, modified rghR2, modified yvzC, and modified Bli3644 genes, wherein the modified cells produce an increased amount of the target protein (relative to parental cells cultured under the same conditions).
[0009] In some embodiments, the modified rghR1 gene contains genetic modifications that mutate, disrupt, partially delete, or completely delete the encoded RghR1 protein, and / or the modified rghR1 gene contains genetic modifications that mutate, disrupt, partially delete, or completely delete the 5′-UTR sequence and / or 3′-UTR sequence of the rghR1 gene, wherein the modified rghR1 gene does not express or produce the encoded RghR1 protein.
[0010] In some embodiments, the modified rghR2 gene contains genetic modifications that mutate, disrupt, partially delete, or completely delete the encoded RghR2 protein, and / or the modified rghR2 gene contains genetic modifications that mutate, disrupt, partially delete, or completely delete the 5′-UTR sequence and / or 3′-UTR of the rghR2 gene, wherein the modified rghR2 gene does not express or produce the encoded RghR2 protein.
[0011] In some embodiments, the modified yvzC gene contains genetic modifications that mutate, disrupt, partially delete, or completely delete the encoded YvzC protein, and / or the modified yvzC gene contains genetic modifications that mutate, disrupt, partially delete, or completely delete the 5′-UTR sequence and / or 3′-UTR of the yvzC gene, wherein the modified yvzC gene does not express or produce the encoded YvzC protein.
[0012] In some embodiments, the modified Bli3644 gene includes genetic modifications that cause mutation, disruption, partial deletion, or complete deletion of the encoded Bli3644 protein, and / or the modified Bli3644 gene includes genetic modifications that cause mutation, disruption, partial deletion, or complete deletion of the 5′-UTR sequence and / or 3′-UTR of the Bli3644 gene, wherein the modified Bli3644 gene does not express or produce the encoded Bli3644 protein.
[0013] Therefore, in some embodiments, the modified *Bacillus licheniformis* cells containing at least one genetically modified rghR locus contain a modified rghR1 gene. In other embodiments, the modified *Bacillus licheniformis* cells containing at least one genetically modified rghR locus contain a modified rghR2 gene. In other embodiments, the modified *Bacillus licheniformis* cells containing at least one genetically modified rghR locus contain both modified rghR1 and modified rghR2 genes. In other embodiments, the modified *Bacillus licheniformis* cells containing at least one genetically modified rghR locus contain a modified rghR1 gene, a modified rghR2 gene, a modified yvzC gene, and a modified bli3644 gene. In some other embodiments, the modified *Bacillus licheniformis* cells contain a deletion of the rghR locus. In some other embodiments, the modified cells produce a reduced amount of red pigment (relative to parental cells cultured under the same conditions). In still other embodiments, the *Bacillus licheniformis* cells contain one or more expression cassettes encoding a target protein. In some embodiments, the one or more expression cassettes encode amylase proteins.
[0014] In other embodiments, this disclosure relates to modified Bacillus licheniformis cells derived from parental Bacillus licheniformis cells containing the natural rghR2 gene, wherein these modified cells contain at least one genetic modification that mutates, disrupts, partially deletes, or completely deletes the rghR2 gene, and wherein these modified cells produce a reduced amount of red pigment (relative to parental cells cultured under the same conditions). In some embodiments, these cells contain one or more expression cassettes encoding a target protein. In a particular embodiment, the one or more expression cassettes encode an amylase protein. In some other embodiments, the modified cells produce an increased amount of the target protein (relative to parental cells cultured under the same conditions).
[0015] Therefore, certain other embodiments of this disclosure relate to methods for producing an increased amount of a target protein in modified Bacillus licheniformis cells, the methods comprising: (a) obtaining Bacillus licheniformis cells and genetically modifying at least one gene selected from the group consisting of: (i) the rghR1 gene, (ii) the rghR2 gene, (iii) the yvzC gene and (iv) the Bli3644 gene, or combinations thereof, and (b) fermenting the modified cells of step (a) under conditions suitable for the production of the target protein, wherein the modified cells produce an increased amount of the target protein (relative to parental cells cultured under the same conditions).
[0016] In some embodiments of the method, the modified rghR1 gene contains genetic modifications that mutate, disrupt, partially delete, or completely delete the encoded RghR1 protein, and / or the modified rghR1 gene contains genetic modifications that mutate, disrupt, partially delete, or completely delete the 5′-UTR sequence and / or 3′-UTR sequence of the rghR1 gene, wherein the modified rghR1 gene does not express the encoded RghR1 protein.
[0017] In other embodiments, the modified rghR2 gene includes genetic modifications that mutate, disrupt, partially delete, or completely delete the encoded RghR2 protein, and / or the modified rghR2 gene includes genetic modifications that mutate, disrupt, partially delete, or completely delete the 5′-UTR sequence and / or 3′-UTR of the rghR2 gene, wherein the modified rghR2 gene does not express the encoded RghR2 protein.
[0018] In another embodiment, the modified yvzC gene includes genetic modifications that mutate, disrupt, partially delete, or completely delete the encoded YvzC protein, and / or the modified yvzC gene includes genetic modifications that mutate, disrupt, partially delete, or completely delete the 5′-UTR sequence and / or 3′-UTR of the yvzC gene, wherein the modified yvzC gene does not express the encoded YvzC protein.
[0019] In some other embodiments of the method, the modified Bli3644 gene includes genetic modifications that cause mutation, disruption, partial deletion, or complete deletion of the encoded Bli3644 protein, and / or the modified Bli3644 gene includes genetic modifications that cause mutation, disruption, partial deletion, or complete deletion of the 5′-UTR sequence and / or 3′-UTR of the Bli3644 gene, wherein the modified Bli3644 gene does not express the encoded Bli3644 protein.
[0020] In another embodiment of the method, these cells contain one or more expression cassettes encoding a target protein. In some embodiments, the one or more expression cassettes encode an amylase protein. In another embodiment of the method, the modified Bacillus licheniformis cells produce a reduced amount of red pigment.
[0021] In other embodiments, this disclosure relates to a method for producing a target protein in modified Bacillus licheniformis cells, wherein the modified cells produce a reduced amount of red pigment during fermentation, the method comprising (a) obtaining Bacillus licheniformis cells and genetically modifying the rghR2 gene therein, and (b) fermenting the modified cells under conditions suitable for producing the target protein, wherein the modified cells produce a reduced amount of red pigment (relative to parental cells cultured under the same conditions). In some embodiments, the modified rghR2 gene includes genetic modifications that mutate, disrupt, partially delete, or completely delete the RghR2 protein encoded. In other embodiments, the cells contain one or more expression cassettes encoding the target protein. In some embodiments, the one or more expression cassettes encode an amylase protein. In other embodiments, the modified cells produce an increased amount of the target protein (relative to parental cells cultured under the same conditions). Attached Figure Description
[0022] Figure 1 is a schematic diagram of the "rghR locus" on the Bacillus licheniformis chromosome, where the wild-type rghR locus ( Figure 1A This includes the rghR1 gene (white arrow), rghR2 gene (black arrow), yvzC gene (gray arrow), and Bli3644 gene (filled arrow). As further described in the Examples section below, Figure 1BThe modified rghR locus, which contains rghR2, is shown. 终止 Alleles (white arrows showing three (3) asterisks indicating the stop codon), native rghR1 gene (black arrow), native yvzC gene (gray arrow) and native Bli3644 gene (line-filled arrow); Figure 1C The modified rghR locus is shown, which contains the rghR1 allele deletion (ΔrghR1), the native rghR2 gene (white arrow), the native yvzC gene (gray arrow), and the native Bli3644 gene (line-filled arrow). Figure 1D The rghR locus is shown, which contains the rghR2 allele deletion (ΔrghR2), the native rghR1 gene (black arrow), the native yvzC gene (gray arrow), and the native Bli3644 gene (line-filled arrow). Figure 1E The modified rghR locus is shown, containing rghR2 allele deletion (ΔrghR2), rghR1 allele deletion (ΔrghR1), the native yvzC gene (gray arrow), and the native Bli3644 gene (filled arrow); and Figure 1F The modified (empty) rghR locus is shown, which contains the following deletions: rghR2, rghR1, yvzC, and Bli3644 alleles (ΔrghR2 / ΔrghR1 / ΔyvzC / Δ3644).
[0023] Biological Sequence Summary
[0024] SEQ ID NO:1 is the amino acid sequence of the Cas9 protein of Streptococcus pyogenes.
[0025] SEQ ID NO:2 is the nucleic acid sequence encoding the Cas9 protein of SEQ ID NO:1, wherein the nucleic acid sequence has been codon-optimized for expression in Bacillus host strains.
[0026] SEQ ID NO:3 is the N-terminal nuclear localization sequence (NLS) of an amino acid.
[0027] SEQ ID NO:4 is the C-terminal nuclear localization sequence (NLS) of an amino acid.
[0028] SEQ ID NO:5 is the dehistic (His) tagged amino acid sequence.
[0029] SEQ ID NO:6 is the nucleic acid sequence of the Bacillus subtilis aprE promoter.
[0030] SEQ ID NO:7 is the synthesized terminator nucleic acid sequence.
[0031] SEQ ID NO:8 is the forward primer nucleic acid sequence.
[0032] SEQ ID NO:9 is the reverse primer nucleic acid sequence.
[0033] SEQ ID NO:10 is the pKB320 main strand nucleic acid sequence.
[0034] SEQ ID NO:11 is the nucleic acid sequence of plasmid pKB320.
[0035] SEQ ID NO:12 is the forward primer nucleic acid sequence.
[0036] SEQ ID NO:13 is the reverse primer nucleic acid sequence.
[0037] SEQ ID NO:14 is a reverse sequencing primer.
[0038] SEQ ID NO:15 is a reverse sequencing primer.
[0039] SEQ ID NO:16 is the forward sequencing primer.
[0040] SEQ ID NO:17 is the forward sequencing primer.
[0041] SEQ ID NO:18 is the forward sequencing primer.
[0042] SEQ ID NO:19 is the forward sequencing primer.
[0043] SEQ ID NO:20 is the forward sequencing primer.
[0044] SEQ ID NO:21 is the forward sequencing primer.
[0045] SEQ ID NO:22 is the forward sequencing primer.
[0046] SEQ ID NO:23 is a reverse sequencing primer.
[0047] SEQ ID NO:24 is the forward sequencing primer.
[0048] SEQ ID NO:25 is the nucleic acid sequence of plasmid pRF694.
[0049] SEQ ID NO:26 is the nucleic acid sequence of plasmid pRF801.
[0050] SEQ ID NO:27 is the nucleic acid sequence of plasmid pRF806.
[0051] SEQ ID NO:28 is the nucleic acid sequence of Bacillus licheniformis target site 1 (TS1).
[0052] SEQ ID NO:29 is the nucleic acid sequence of Bacillus licheniformis target site 2 (TS2).
[0053] SEQ ID NO:30 is the nucleic acid sequence of the serA read frame of Bacillus licheniformis.
[0054] SEQ ID NO:31 is the PAM nucleic acid sequence of Bacillus licheniformis target site 1 (TS1).
[0055] SEQ ID NO:32 is a nucleic acid sequence encoding the variable target (VT) site 1 of Bacillus licheniformis.
[0056] SEQ ID NO:33 is a nucleic acid sequence encoding the Cas9 endonuclease recognition (CER) domain.
[0057] SEQ ID NO:34 is the target site 1 of the guide RNA (gRNA) nucleic acid sequence.
[0058] SEQ ID NO:35 is the spac promoter nucleic acid sequence.
[0059] SEQ ID NO:36 is the t0 terminator nucleic acid sequence.
[0060] SEQ ID NO:37 is the nucleic acid sequence of the homologous arm 1 of Bacillus licheniformis serA1.
[0061] SEQ ID NO:38 is the sequence of the forward primer of the 1st homologous arm of serA1 synthesized.
[0062] SEQ ID NO:39 is the sequence of the reverse primer of the serA1 homologous arm 1.
[0063] SEQ ID NO:40 is the nucleic acid sequence of the homologous arm 2 of Bacillus licheniformis serA1.
[0064] SEQ ID NO:41 is the sequence of the forward primer of the 2nd homologous arm of serA1 synthesized.
[0065] SEQ ID NO:42 is the sequence of the reverse primer of the 2nd homologous arm of serA1 synthesized.
[0066] SEQ ID NO:43 is an expression cassette encoding target site 1 (TS1) gRNA.
[0067] SEQ ID NO:44 is a synthesized serA1 deletion edit template.
[0068] SEQ ID NO:45 is the nucleic acid sequence of the Bacillus licheniformis rghR1 read frame.
[0069] SEQ ID NO:46 is the nucleic acid sequence of target site 2 (TS2) PAM.
[0070] SEQ ID NO:47 is a nucleic acid sequence encoding variable target (VT) site 2.
[0071] SEQ ID NO:48 is gRNA nucleic acid sequence target site 2.
[0072] SEQ ID NO:49 is the nucleic acid sequence of the first homologous arm of Bacillus licheniformis rghR1.
[0073] SEQ ID NO:50 is the forward sequence of the synthesized rghR1 homologous arm 1.
[0074] SEQ ID NO:51 is the reverse sequence of the synthesized rghR1 homologous arm 1.
[0075] SEQ ID NO:52 is the nucleic acid sequence of the second homologous arm of Bacillus licheniformis rghR1.
[0076] SEQ ID NO:53 is the forward sequence of the synthesized rghR1 homologous arm 2.
[0077] SEQ ID NO:54 is the reverse sequence of the synthesized rghR1 homologous arm 2.
[0078] SEQ ID NO:55 is a synthetic nucleic acid expression cassette encoding target site 2 (TS2) gRNA.
[0079] SEQ ID NO:56 is a synthesized rghR1 deletion edit template sequence.
[0080] SEQ ID NO:57 is the amino acid sequence of the Cas9(Y155H) variant protein.
[0081] SEQ ID NO:58 is the forward primer sequence of Cas9(Y155H).
[0082] SEQ ID NO:59 is the reverse primer sequence of Cas9(Y155H).
[0083] SEQ ID NO:60 is the nucleic acid sequence of plasmid pRF827.
[0084] SEQ ID NO:61 is an expression cassette encoding the variant Cas9(Y155H) protein.
[0085] SEQ ID NO:62 is the nucleic acid sequence of plasmid pRF856.
[0086] SEQ ID NO:63 is the nucleic acid sequence of the synthesized Cas9(Y155H) fragment.
[0087] SEQ ID NO:64 is the forward primer sequence for the Cas9(Y155H) fragment.
[0088] SEQ ID NO:65 is the reverse primer sequence of the Cas9(Y155H) fragment.
[0089] SEQ ID NO:66 is the nucleic acid sequence of plasmid pRF694.
[0090] SEQ ID NO:67 is the nucleic acid sequence of the pRF694 fragment.
[0091] SEQ ID NO:68 is the forward primer sequence of the pRF694 fragment.
[0092] SEQ ID NO:69 is the reverse primer sequence of the pRF694 fragment.
[0093] SEQ ID NO:70 is the nucleic acid sequence of plasmid pRF869.
[0094] SEQ ID NO:71 is the nucleic acid sequence of the read frame of Bacillus licheniformis rghR2.
[0095] SEQ ID NO:72 is the synthesized rghR2 终止 Fragment nucleic acid sequence.
[0096] SEQ ID NO:73 is the synthesized rghR2 终止 Edit the template sequence.
[0097] SEQ ID NO:74 is the rghR2 gRNA expression cassette.
[0098] SEQ ID NO:75 is the forward primer of the synthesized fragment.
[0099] SEQ ID NO:76 is the reverse primer for the synthesized fragment.
[0100] SEQ ID NO:77 is the nucleic acid sequence of the pRF862 backbone.
[0101] SEQ ID NO:78 is the pRF862 main chain forward primer.
[0102] SEQ ID NO:79 is the pRF862 main-chain reverse primer.
[0103] SEQ ID NO:80 is the nucleic acid sequence of plasmid pRF874.
[0104] SEQ ID NO:81 is the pRF874 target site and PAM nucleic acid sequence.
[0105] SEQ ID NO:82 is the pRF874 editing template.
[0106] SEQ ID NO:83 is the nucleic acid sequence of plasmid pRF879.
[0107] SEQ ID NO:84 is the pRF879 target site and PAM nucleic acid sequence.
[0108] SEQ ID NO:85 is the pRF879 editing template.
[0109] SEQ ID NO:86 is the nucleic acid sequence of plasmid pRF899.
[0110] SEQ ID NO:87 is the pRF899 and pRF901 target sites and the PAM nucleic acid sequence.
[0111] SEQ ID NO:88 is the pRF899 editing template.
[0112] SEQ ID NO:89 is the nucleic acid sequence of plasmid pRF901.
[0113] SEQ ID NO:90 is the pRF901 editing template.
[0114] SEQ ID NO:91 is the nucleic acid sequence of the wild-type rghR2 locus.
[0115] SEQ ID NO:92 is the lysA read frame nucleic acid sequence.
[0116] SEQ ID NO:93 is the serA_α-amylase expression cassette.
[0117] SEQ ID NO:94 is the synthesized p3 promoter nucleic acid sequence.
[0118] SEQ ID NO:95 is the nucleic acid sequence of aprE 5'-untranslated region (UTR).
[0119] SEQ ID NO:96 is a nucleic acid sequence encoding the amyL signal sequence.
[0120] SEQ ID NO:97 is a nucleic acid sequence encoding α-amylase protein.
[0121] SEQ ID NO:98 is a nucleic acid sequence encoding the amyL terminator sequence.
[0122] SEQ ID NO:99 is the synthesized amyL_α-amylase expression cassette.
[0123] SEQ ID NO:100 is the Bacillus licheniformis amyL promoter sequence.
[0124] SEQ ID NO:101 is the pBl.comK nucleic acid sequence.
[0125] SEQ ID NO:102 is a nucleic acid sequence encoding a spectinomycin marker.
[0126] SEQ ID NO:103 is the read frame of Bacillus licheniformis xylR.
[0127] SEQ ID NO:104 is the xylA promoter sequence of Bacillus licheniformis.
[0128] SEQ ID NO:105 is a nucleic acid sequence encoding the ComK protein.
[0129] SEQ ID NO:106 is the forward primer sequence.
[0130] SEQ ID NO:107 is the reverse primer sequence.
[0131] SEQ ID NO:108 is the nucleic acid sequence of the target region of Bacillus licheniformis rghR2.
[0132] SEQ ID NO:109 is the synthesized rghR2 终止 Nucleic acid sequence.
[0133] SEQ ID NO:110 is the forward primer sequence.
[0134] SEQ ID NO:111 is the forward primer sequence.
[0135] SEQ ID NO:112 is the reverse primer sequence.
[0136] SEQ ID NO:113 is the natural rghR1 sequence of Bacillus licheniformis.
[0137] SEQ ID NO:114 is an rghR1 deletion PCR product.
[0138] SEQ ID NO:115 is the forward primer sequence.
[0139] SEQ ID NO:116 is the reverse primer sequence.
[0140] SEQ ID NO:117 is a natural rghR2 PCR product of Bacillus licheniformis.
[0141] SEQ ID NO:118 is an rghR2 deletion PCR product.
[0142] SEQ ID NO:119 is the forward primer sequence.
[0143] SEQ ID NO:120 is the reverse primer sequence.
[0144] SEQ ID NO:121 is a natural rghR1 rghR2 PCR product of Bacillus licheniformis.
[0145] SEQ ID NO:122 is a PCR product with rghR1 and rghR2 deletion.
[0146] SEQ ID NO:123 is the forward primer sequence.
[0147] SEQ ID NO:124 is the reverse primer sequence.
[0148] SEQ ID NO:125 is a PCR product of the natural locus of Bacillus licheniformis.
[0149] SEQ ID NO:126 is a synthesized locus deletion PCR product.
[0150] SEQ ID NO:127 is the nucleic acid sequence of the rghR2 locus of Bacillus licheniformis strain LDN143.
[0151] SEQ ID NO:128 is the nucleic acid sequence of the rghR2 locus of Bacillus licheniformis strain BF314.
[0152] SEQ ID NO:129 is the nucleic acid sequence of the rghR2 locus of Bacillus licheniformis strain BF324.
[0153] SEQ ID NO:130 is the nucleic acid sequence of the rghR2 locus of Bacillus licheniformis strain BF377.
[0154] SEQ ID NO:131 is the nucleic acid sequence of the rghR2 locus of Bacillus licheniformis strain BF389.
[0155] SEQ ID NO:132 is the nucleic acid sequence of the rghR2 locus of Bacillus licheniformis strain BF391. DETAILED DESCRIPTION
[0156] This disclosure generally relates to compositions and methods for constructing and obtaining *Bacillus licheniformis* cells (strains) with an increased protein production phenotype. Therefore, some embodiments relate to modified *Bacillus licheniformis* cells derived from parental *Bacillus licheniformis* cells. In some embodiments, the modified *Bacillus licheniformis* cells comprise a modified rghR locus, wherein the parental cell from which it is derived comprises a wild-type rghR locus. In some embodiments, modified *Bacillus licheniformis* cells having the modified rghR locus comprise an increased protein productivity phenotype. In some other embodiments, modified *Bacillus licheniformis* cells having the modified rghR locus produce a reduced amount of red pigment. In some other embodiments, modified *Bacillus licheniformis* cells comprise an increased protein productivity phenotype and produce a reduced amount of red pigment.
[0157] I. Definition
[0158] In view of the modified Bacillus cells and methods described herein, the following terms and phrases are defined. Terms not defined herein shall be interpreted according to their conventional meaning as used in the art.
[0159] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the compositions and methods of this invention pertain. While any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of the compositions and methods of this invention, representative exemplary methods and materials will now be described. All disclosures and patents referenced herein are incorporated herein by reference in their entirety.
[0160] It should also be noted that the claims can be drafted to exclude any optional elements. Therefore, this statement is intended as a premise (or condition) for the use of exclusive terms such as “solely,” “only,” “excluding,” “not including,” or the use of “negative” in relation to the description of the claim elements.
[0161] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features that can be readily separated from or combined with features of any of the other several embodiments without departing from the scope or spirit of the compositions and methods of the invention described herein. Any method of narration may be performed in the order of the events described or in any other logically feasible order.
[0162] As used herein, "host cell" refers to a cell capable of serving as a host or expression medium for a newly introduced DNA sequence. Therefore, in some embodiments of this disclosure, the host cell is, for example, a Bacillus species cell or an Escherichia coli cell.
[0163] As used herein, “modified cell” refers to a recombinant (host) cell containing at least one genetic modification that is not present in the “parent” host cell from which the modified cell is derived.
[0164] For example, in some embodiments, the “parent” cell is altered (e.g., via one or more genetic modifications introduced into the parent cell) to produce its “modified” (daughter) cells.
[0165] In some embodiments, parental cells may be referred to as “control cells,” particularly when compared to or relative to “modified” Bacillus species (daughter) cells. As used herein, when comparing the expression and / or production of a target protein (POI) in “unmodified” (parental) cells (e.g., control cells) with the expression and / or production of the same POI in “modified” (daughter) cells, it should be understood that “modified” and “unmodified” cells are grown / cultured / fermented under the same conditions (e.g., the same conditions such as culture medium, temperature, pH, etc.).
[0166] As used herein, “Bacillus” or “Bacillus species” includes all species within the genus “Bacillus” as known to those skilled in the art, including but not limited to: Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus clausii, Bacillus halodurans, Bacillus megaterium, Bacillus coagulans, Bacillus circulans, Bacillus lautus, and Bacillus thuringiensis. It should be recognized that the genus Bacillus is undergoing continuous taxonomic recombination. Therefore, this genus aims to include species that have been reclassified, including but not limited to organisms such as *Geobacillus stearothermophilus* (now known as *Geobacillus stearothermophilus*).
[0167] As used herein, the terms “wild-type” and “natural” are used interchangeably and refer to genes, promoters, proteins, protein mixtures, cells or strains found in nature.
[0168] As used herein, the “natural Bacillus licheniformis rghR2 gene” contains a nucleotide sequence encoding the “natural RghR2 protein”, and the “variant-18-BP Bacillus licheniformis rghR2 gene” contains a sequence encoding the “variant RghR2 protein” (RghR2). dup The nucleotide sequence of the variant 18-BP rghR2 gene (hereinafter referred to as "rghR2") is described in PCT Publication No. WO 2018 / 156705 (which is incorporated herein by reference in its entirety). dup The protein encodes the variant RghR2 (hereinafter referred to as "RghR2"). dup The nucleotide sequence of the variant RghR2 is given. dup It contains a repeating / repeating sequence of six (6) amino acid residues (i.e., the residue “AAASIR” is repeated).
[0169] As used in this article, the “natural rghR1 gene” encodes the natural RghR1 protein, the “natural rghR2 gene” encodes the natural RghR2 protein, the “natural yvzC gene” encodes the natural YvzC protein, and the “natural Bli3644 gene” encodes the natural Bli3644 protein.
[0170] As used in this article, the “natural Bacillus licheniformis (chromosome) rghR locus” (hereinafter referred to as the “natural rghR locus”) includes the “natural rghR1 gene”, the “natural rghR2 gene”, the “natural yvzC gene”, and the “natural Bli3644 gene”. Figure 1A The illustration shows the location.
[0171] As used in this article, the native Bacillus chrysogenus cell named "LDN143" contains the natural rghR locus.
[0172] As used herein, the “modified Bacillus licheniformis (chromosome) rghR locus” (hereinafter referred to as the “modified rghR locus”) comprises at least one genetic modification (relative to the native rghR locus) of a gene (or its read frame) selected from rghR1, rghR2, yvzC, and / or Bli3644. In some embodiments, the modified Bacillus licheniformis cell comprising the modified rghR locus is derived from a parent Bacillus licheniformis cell comprising the native rghR locus.
[0173] As used in this article, the modified Bacillus licheniformis (progeny) cells named "BF314" contain a modified rghR locus, which includes the native rghR1 gene and the modified rghR2 gene (named "rghR2"). 终止"; Contains three (3) early stop codons), the natural yvzC gene and the natural Bli3644 gene, such as Figure 1B The illustration shows the location.
[0174] As used in this article, the modified Bacillus licheniformis (progeny) cells named "BF324" contain a modified rghR locus containing the rghR1 gene deletion (ΔrghR1), the native rghR2 gene, the native yvzC gene, and the native Bli3644 gene. Figure 1C The illustration shows the location.
[0175] As used in this article, the modified Bacillus licheniformis (progeny) cells named "BF377" contain a modified rghR locus containing the native rghR1 gene, the rghR2 gene deletion (ΔrghR2), the native yvzC gene, and the native Bli3644 gene. Figure 1D The illustration shows the location.
[0176] As used in this article, the modified Bacillus licheniformis (progeny) cells named "BF389" contain a modified rghR locus containing the rghR1 gene deletion (ΔrghR1), the rghR2 gene deletion (ΔrghR2), the native yvzC gene, and the native Bli3644 gene. Figure 1E The illustration shows the location.
[0177] As used in this paper, the modified Bacillus licheniformis (progeny) cells named "BF391" contain a modified (empty) rghR locus containing deletions of the rghR1 gene (ΔrghR1), rghR2 gene (ΔrghR2), yvzC gene (ΔyvzC), and Bli3644 gene (ΔBli3644). Figure 1F The illustration shows the location.
[0178] As used herein, the term "equivalent position" refers to the position of an amino acid residue after alignment with a specific polypeptide sequence.
[0179] The terms “modification” and “genetic modification” are used interchangeably and include: (a) the introduction, substitution, or removal of one or more nucleotides in a gene (or its ORF), or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for transcription or translation of a gene or its ORF; (b) gene disruption; (c) gene conversion; (d) gene deletion; (e) gene downregulation; (f) specific mutagenesis; and / or (g) random mutagenesis of any one or more genes disclosed herein. For example, as used herein, genetic modification includes, but is not limited to, modifications of one or more genes selected from the group consisting of rghR1, rghR2, yvzC, BLi3644, etc.
[0180] As used herein, “gene disruption,” “gene inactivation,” and “gene inactivation” are used interchangeably and broadly refer to any genetic modification that substantially prevents host cells from producing a functional gene product (e.g., a protein). Exemplary methods of gene disruption include the complete or partial deletion of any part of a gene (including a polypeptide coding sequence, a promoter, an enhancer, or another regulatory element), or the mutagenesis thereof, wherein mutagenesis encompasses substitution, insertion, deletion, inversion, and any combination and variation thereof, which disrupts / inactivates one or more target genes and substantially reduces or prevents the production of a functional gene product (i.e., a protein).
[0181] As defined herein, the combined term “expression / production” (as used in phrases such as “the modified host cell expresses / produces an increased amount of the target protein relative to the parent (host) cell”) means any step involving the expression and production of the target protein in the host cell of this disclosure.
[0182] Therefore, as used herein, “increased” protein production or “enhanced” protein production means an increase in the amount of protein produced (e.g., endogenous and / or heterologous POIs). Proteins can be produced within host cells or secreted (or transported) into the culture medium. In some embodiments, the target protein is produced (secreted) into the culture medium. Increased protein production can be detected, for example, as a higher maximum level of protein or enzyme activity (e.g., like protease activity, amylase activity, cellulase activity, hemicellulase activity, etc.) or total extracellular protein production compared to parental host cells.
[0183] As used herein, “nucleic acid” refers to nucleotide or polynucleotide sequences and fragments or portions thereof, as well as DNA, cDNA, and RNA, which are genomes or origins of synthesis and may be double-stranded or single-stranded, representing either sense or antisense strands. It should be understood that, due to the degeneracy of the genetic code, many nucleotide sequences can encode a given protein.
[0184] It should be understood that the polynucleotides (or nucleic acid molecules) described in this article include “genes”, “vectors”, and “plasmids”.
[0185] Therefore, the term "gene" refers to a specific sequence of polynucleotides that encodes amino acids, contains all or part of the protein-coding sequence, and may include regulatory (non-transcribed) DNA sequences, such as promoter sequences, which determine, for example, the conditions under which the gene is expressed. The transcribed region of a gene may include the untranslated region (UTR) (which includes introns, the 5'-untranslated region (UTR), and the 3'-UTR), as well as the coding sequence.
[0186] As used herein, the term "coding sequence" refers to a nucleotide sequence that directly and explicitly identifies the amino acid sequence of the protein product it encodes. The boundaries of a coding sequence are generally defined by a reading frame (hereinafter referred to as "ORF") that typically begins with the ATG start codon. Coding sequences typically include DNA, cDNA, and recombinant nucleotide sequences.
[0187] As used herein, the term "promoter" refers to a nucleic acid sequence that controls the expression of a coding sequence or functional RNA. Typically, the coding sequence is located 3' downstream of the promoter sequence. Promoters can be entirely derived from natural genes, or composed of different elements derived from different promoters found in nature, or even contain synthetic nucleic acid segments. Those skilled in the art will understand that different promoters can direct gene expression in different cell types, at different developmental stages, or in response to different environmental or physiological conditions. Promoters that induce gene expression in most cell types are generally referred to as "constitutive promoters." It is further recognized that, because the exact boundaries of the regulatory sequence cannot be fully determined in most cases, DNA fragments of different lengths can have the same promoter activity.
[0188] As used herein, “efficient ligation” refers to the association of nucleic acid sequences on a single nucleic acid fragment, such that the function of one fragment is influenced by another. For example, when expression of a coding sequence is possible (i.e., the coding sequence is transcribed under the control of a promoter), the promoter is efficiently ligated to that coding sequence (e.g., an ORF). The coding sequence can be efficiently ligated to a regulatory sequence in either the sense or the antisense direction.
[0189] When a nucleic acid is placed in a functional relationship with another nucleic acid sequence, that nucleic acid is "effectively linked" to that sequence. For example, if the DNA encoding a secretory precursor (i.e., a signal peptide) is expressed as a preprotein involved in polypeptide secretion, then the DNA encoding the secretory precursor is effectively linked to the DNA of that polypeptide; if a promoter or enhancer affects the transcription of a coding sequence, then that promoter or enhancer is effectively linked to that sequence; or if a ribosome binding site is located to facilitate translation, then that ribosome binding site is effectively linked to the coding sequence. Generally, "effectively linked" means that the linked DNA sequences are contiguous, and in the case of a secretory precursor, they are contiguous and in the reading phase. However, enhancers do not need to be contiguous. Linkage is achieved by linking at a convenient restriction site. If such a site is not available, synthetic oligonucleotide adaptors or linkers are used according to conventional practice.
[0190] As used herein, a “functional promoter sequence that controls the expression of a target gene (or its read frame) linked to a protein-coding sequence of the target gene” refers to a promoter sequence that controls the transcription and translation of a coding sequence in Bacillus spp. For example, in some embodiments, this disclosure relates to a polynucleotide comprising a 5′ promoter (or a 5′ promoter region, or a tandem 5′ promoter, etc.), wherein the promoter region is effectively linked to a nucleic acid sequence encoding a protein of this disclosure. Thus, in some embodiments, a functional promoter sequence controls the expression of a gene encoding a protein of this disclosure. In other embodiments, a functional promoter sequence controls the expression of a heterologous gene (or endogenous gene) encoding a target protein in Bacillus spp. cells (more particularly Bacillus licheniformis host cells).
[0191] As defined in this paper, a “suitable regulatory sequence” is a nucleotide sequence located upstream (5' non-coding sequence), inside, or downstream (3' non-coding sequence) of a coding sequence that affects the transcription, RNA processing, or stability or translation of the relevant coding sequence. Regulatory sequences may include promoters, translation leader sequences, RNA processing sites, effector binding sites, and stem-loop structures.
[0192] As defined herein, the term “introduction”, as used in phrases such as “introduction into bacterial cells” or “introduction into Bacillus licheniformis cells”, refers to at least one polynucleotide open reading frame (ORF), or its gene, or its vector, including methods known in the art for introducing polynucleotides into cells, including but not limited to protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, transfection, conjugation, etc. (e.g., see Ferrari et al., 1989).
[0193] As used herein, “transformed” or “transformed” means a cell transformed using recombinant DNA technology. Transformation typically occurs by inserting one or more nucleotide sequences (e.g., polynucleotides, ORFs, or genes) into a cell. The inserted nucleotide sequence can be a heterologous nucleotide sequence (i.e., a sequence that is not naturally present in the cell to be transformed). For example, in some embodiments of this disclosure, parental Bacillus licheniformis cells are modified (e.g., transformed) by introducing a polynucleotide construct containing a promoter that is effectively linked to a nucleic acid sequence encoding a target protein into the parental cells, thereby generating modified Bacillus licheniformis (progeny) host cells derived from the parental cells.
[0194] As used herein, “transformation” refers to the introduction of exogenous DNA into a host cell, such that the DNA remains an integrative chromosome or a self-replicating extrachromosomal vector. As used herein, “transformed DNA,” “transformed sequence,” and “DNA construct” refer to DNA used to introduce a sequence into a host cell or organism. Transformed DNA is DNA used to introduce a sequence into a host cell or organism. DNA can be generated in vitro by PCR or any other suitable technique. In some embodiments, the transformed DNA contains an input sequence, while in other embodiments it also contains an input sequence flanking a homology cassette. In yet another embodiment, the transformed DNA contains other non-homologous sequences added to the ends (i.e., filler sequences or flanking sequences). The ends can be closed, such that the transformed DNA forms a closed loop, for example, as in an insert vector.
[0195] As used herein, in the context of introducing nucleic acid sequences into cells, the term “introduction” refers to any method suitable for transferring nucleic acid sequences into cells. Such methods for introduction include, but are not limited to, protoplast fusion, transfection, transformation, conjugation, and transduction (see, for example, Ferrari et al., 1989).
[0196] As used herein, “input sequence” refers to a DNA sequence introduced into the chromosome of a Bacillus genus. In some embodiments, the input sequence is part of a DNA construct. In other embodiments, the input sequence encodes one or more target proteins. In some embodiments, the input sequence comprises a sequence that may or may not be present in the genome of the cell to be transformed (i.e., it may be a homologous or heterologous sequence). In some embodiments, the input sequence encodes one or more target proteins, genes, and / or mutant or modified genes. In alternative embodiments, the input sequence encodes a functional wild-type gene or operon, a functionally mutated gene or operon, or a non-functional gene or operon. In some embodiments, a non-functional sequence may be inserted into a gene to disrupt its function. In another embodiment, the input sequence includes a selection marker. In a further embodiment, the input sequence includes two homology boxes.
[0197] As used herein, a "homology cassette" refers to a nucleic acid sequence homologous to a sequence in a Bacillus chromosome. More specifically, according to the invention, a homology cassette is an upstream or downstream region having approximately 80% to 100%, approximately 90% to 100%, or approximately 95% to 100% sequence identity with a directly flanking coding region of a deleted, disrupted, inactivated, downregulated, or otherwise deregulated gene or a portion of a gene. These sequences guide the integration of DNA constructs into the Bacillus chromosome and indicate which portion of the Bacillus chromosome is replaced by the input sequence. While not intended to limit the disclosure, a homology cassette may comprise from about 1 base pair (bp) to 200 kilobases (kb). Preferably, a homology cassette comprises between about 1 bp and 10.0 kb, 1 bp and 5.0 kb, 1 bp and 2.5 kb, 1 bp and 1.0 kb, and 0.25 kb and 2.5 kb. The homology cassette may also include approximately 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb, and 0.1 kb. In some embodiments, selectively labeled 5' and 3' ends are flanked by the homology cassette, wherein the homology cassette contains nucleic acid sequences located closely flanking the coding region of a gene.
[0198] As used herein, the term "nucleotide sequence encoding a selectable marker" refers to a nucleotide sequence that can be expressed in a host cell and wherein the expression of a selectable marker confers the ability of a cell containing the expressed gene to grow in the presence of a suitable selective agent or in the absence of essential nutrients.
[0199] As used herein, the terms "selective marker" and "selective marker" refer to nucleic acids (e.g., genes) that can be expressed in host cells, allowing for easy selection of those hosts containing the vector. Examples of such selective markers include, but are not limited to, antimicrobial agents. Thus, the term "selective marker" refers to a gene that provides an indication that the host cell has taken up the imported target DNA or that some other response has occurred. Typically, selective markers are genes that confer antimicrobial resistance or metabolic advantage to host cells, allowing for differentiation during transformation of cells containing foreign DNA from cells that have not received any foreign sequence.
[0200] A "residing selectable marker" is a marker located on the chromosome of the microorganism to be transformed. The residing selectable marker encodes a gene different from the selectable marker on the transforming DNA construct. Selective markers are well known to those skilled in the art. As mentioned above, the marker can be an antimicrobial resistance marker (e.g., AMP). Rphleo R spec R kan R ery R tet R ,cmp R and neo R (See, for example, Guerot-Fleury, 1995; Palmeros et al., 2000; and Trieu-Cuot et al., 1983). In some embodiments, the present invention provides chloramphenicol resistance genes (e.g., genes present on pC194, and resistance genes present in the Bacillus licheniformis genome). This resistance gene is particularly useful in the present invention and in embodiments involving chromosome amplification of cassettes and integrative plasmids (see, for example, Albertini and Galizzi, 1985; Stahl and Ferrari, 1984). Other markers useful according to the present invention include, but are not limited to, auxotrophic markers such as serine, lysine, and tryptophan; and detection markers such as β-galactosidase or fluorescent proteins.
[0201] As defined in this article, the host cell “genome,” the bacterial (host) cell “genome,” or the Bacillus licheniformis (host) cell “genome” includes chromosomal genes and extrachromosomal genes.
[0202] As used herein, the terms “plasmid,” “vector,” and “box” refer to extrachromosomal elements that typically carry genes that are not part of the cell’s central metabolism and are usually in the form of circular double-stranded DNA molecules. Such elements can be linear or circular autonomously replicating sequences, genome-integrated sequences, bacteriophages, or nucleotide sequences derived from any source of single-stranded or double-stranded DNA or RNA, many of which have been linked or recombined into a single structure capable of introducing a promoter fragment and DNA sequence targeting a selected gene product, along with an appropriate 3' untranslated sequence, into the cell.
[0203] As used in this article, a “transformation cassette” refers to a specific vector that contains a gene (or its ORF) and, in addition to the exogenous gene, has elements that promote the transformation of a specific host cell.
[0204] As used herein, the term "vector" refers to any nucleic acid that can replicate (spread) within a cell and carry new genes or DNA segments into the cell. Therefore, the term refers to a nucleic acid construct designed for transfer between different host cells. Vectors include viruses, bacteriophages, proviruses, plasmids, phage particles, transposons, and artificial chromosomes such as YAC (yeast artificial chromosome), BAC (bacterial artificial chromosome), and PLAC (plant artificial chromosome), which are "episiosomes" (i.e., those that replicate autonomously or can integrate into the chromosome of a host organism).
[0205] "Expression vector" refers to a vector that has the ability to incorporate and express heterologous DNA in a cell. Many prokaryotic and eukaryotic expression vectors are commercially available and are known to those skilled in the art. The selection of an appropriate expression vector is within the knowledge of those skilled in the art.
[0206] As used herein, the terms "expression cassette" and "expression vector" refer to a nucleic acid construct that is recombinantly or synthetically generated and has a specific set of nucleic acid elements (i.e., vectors or vector elements, as described above) that allow a specific nucleic acid to be transcribed in a target cell. Recombinant expression cassettes may be incorporated into plasmids, chromosomes, mitochondrial DNA, plasmid DNA, viruses, or nucleic acid fragments. Typically, the recombinant expression cassette portion of an expression vector includes (among other sequences) the nucleic acid sequence to be transcribed and a promoter. In some embodiments, the DNA construct further includes a specific set of nucleic acid elements that allow a specific nucleic acid to be transcribed in a target cell. In some embodiments, the DNA constructs of this disclosure contain selective markers and inactivated chromosomal or gene or DNA segments as defined herein.
[0207] As used herein, a “targeting vector” is a vector comprising a polynucleotide sequence homologous to a region in the chromosome of a host cell into which the targeting vector is transformed, and the vector can drive homologous recombination at that region. For example, a targeting vector can be used to introduce mutations into the chromosome of a host cell via homologous recombination. In some embodiments, the targeting vector contains other non-homologous sequences, such as those added to the ends (i.e., filler sequences or flanking sequences). In some embodiments, the targeting vector includes elements for increasing homologous recombination with the chromosome, including but not limited to RNA-directed endonucleases, DNA-directed endonucleases, and recombinases. The ends can be closed, such that the targeting vector forms a closed loop, for example, as an insert vector.
[0208] As used herein, the term "plasmid" refers to a circular double-stranded (ds) DNA construct used as a cloning vector, which forms an extrachromosomal self-replicating genetic element in many bacteria and some eukaryotes. In some embodiments, the plasmid is incorporated into the genome of the host cell.
[0209] As used herein, the term "target protein" or "POI" refers to a target polypeptide desired to be expressed in Bacillus host cells, wherein the POI is preferably expressed at an increased level. Therefore, as used herein, a POI can be an enzyme, substrate-binding protein, surfactant protein, structural protein, receptor protein, etc. In some embodiments, the modified cells of this disclosure produce an increased amount of heterologous POI or an increased amount of endogenous POI relative to parental cells. In specific embodiments, the increase in POI produced by the modified cells of this disclosure is at least 0.5%, at least 1.0%, at least 5.0%, or more than 5.0% relative to parental cells.
[0210] Similarly, as defined herein, a “target gene” or “GOI” refers to a nucleic acid sequence (e.g., a polynucleotide, gene, or ORF) that encodes a “target protein”. A “target gene” can be a naturally occurring gene, a mutant gene, or a synthetic gene.
[0211] As used herein, the terms “peptide” and “protein” are used interchangeably and refer to a polymer of any length containing amino acid residues linked by peptide bonds. Conventional single (1)-letter or three (3)-letter codes for amino acid residues are used herein. A peptide may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acid components. The term peptide also encompasses amino acid polymers that have been modified naturally or through intervention (e.g., by disulfide bond formation, glycosylation, esterification, acetylation, phosphorylation, or any other manipulation or modification (such as conjugation with a labeled component)). These definitions also include, for example, peptides containing one or more amino acid analogs (including, for example, non-natural amino acids) and other modifications known in the art.
[0212] In some embodiments, the genes disclosed herein encode commercially relevant industrial target proteins, such as enzymes (e.g., acetylesterase, aminopeptidase, amylase, arabinosease, arabinofuranase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, rennet, keratinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endoglucanase, glucosylamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucose...). Aldonase, glycosyl hydrolase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, laccase, lipase, lyase, mannosidase, oxidase, oxidoreductase, pectin lyase, pectin acetylesterase, pectin depolymerase, pectin methylesterase, pectin hydrolytic enzyme, perhydrolase, polyol oxidase, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, peptidase, rhamnose-galacturonase, ribonuclease, transferase, transport protein, transglutaminase, xylanase, hexose oxidase, and combinations thereof.
[0213] As used herein, a "variant" polypeptide is typically derived from a parent (or reference) polypeptide through recombinant DNA technology by substituting, adding, or deleting one or more amino acids. Variant polypeptides may differ from parent polypeptides by a small number of amino acid residues and can be defined by their level of primary amino acid sequence homology / identity with the parent (reference) polypeptide.
[0214] Preferably, the variant polypeptide has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99% amino acid sequence identity with the parent (reference) polypeptide sequence. As used herein, a “variant” polynucleotide refers to a polynucleotide encoding a variant polypeptide, wherein the “variant polynucleotide” has a specific degree of sequence homology / identity with the parent polynucleotide, or hybridizes with the parent polynucleotide (or its complementary sequence) under strict hybridization conditions. Preferably, the variant polynucleotide has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99% nucleotide sequence identity with the parent (reference) polynucleotide sequence.
[0215] As used herein, “mutation” refers to any change or alteration in a nucleic acid sequence. Several types of mutations exist, including point mutations, deletion mutations, silent mutations, frameshift mutations, splicing mutations, etc. Mutations can occur specifically (e.g., via site-directed mutagenesis) or randomly (e.g., via chemical reagents, through repair subtraction of bacterial strain passages).
[0216] As used herein, in the context of a polypeptide or its sequence, the term “substitution” means that one amino acid is replaced by another amino acid (i.e., substitution).
[0217] As defined in this article, an "endogenous gene" is a gene located in its natural position within the genome of an organism.
[0218] As defined herein, a "heterologous" gene, a "non-endogenous" gene, or a "foreign" gene is a gene (or ORF) that is not normally found in a host organism but is introduced into the host organism through gene transfer. As used herein, the term one or more "foreign" genes includes natural genes (or ORFs) inserted into non-natural organisms and / or chimeric genes inserted into natural or non-natural organisms.
[0219] As defined in this article, a "heterologous" nucleic acid construct or "heterologous" nucleic acid sequence is not part of the natural sequence of the cell in which it is expressed.
[0220] As defined in this article, a "heterologous control sequence" refers to a gene expression control sequence (e.g., a promoter or enhancer) that does not play a role in regulating (controlling) the expression of a target gene in nature. Typically, heterologous nucleic acid sequences are not endogenous (natural) to the cells or part of the genome in which they are present and have been added to cells through infection, transfection, transformation, microinjection, electroporation, etc. "Heterologous" nucleic acid constructs may contain control sequence / DNA-coding (ORF) sequence combinations that are the same as or different from those found in the natural host cell.
[0221] As used herein, the terms "signal sequence" and "signal peptide" refer to a sequence of amino acid residues that can participate in the secretion or directed transport of a mature protein or its precursor form. Typically, the signal sequence is located at the N-terminus of the precursor or mature protein sequence. The signal sequence can be endogenous or exogenous. Signal sequences are generally absent in mature proteins. Typically, after protein transport, the signal sequence is cleaved from the protein by a signal peptidase.
[0222] The term “derived” encompasses the terms “originating,” “acquired,” “available,” and “created,” and generally indicates that a specified material or composition finds its origin in another specified material or composition or has characteristics that can be described with reference to the other specified material or composition.
[0223] As used herein, the term “homology” refers to homologous polynucleotides or polypeptides. If two or more polynucleotides or two or more polypeptides are homologous, this means that the homologous polynucleotides or polypeptides have a degree of “identity” of at least 60%, more preferably at least 70%, even more preferably at least 85%, still more preferably at least 90%, more preferably at least 95%, and most preferably at least 98%. Whether two polynucleotide or polypeptide sequences have a sufficiently high degree of homology as defined herein can be suitably investigated by aligning the two sequences using a computer program known in the art, such as, for example, “GAP” provided in the GCG package (Program Manual for the Wisconsin Package, 8th edition, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman and Wunsch, (1970)). DNA sequence comparison was performed using a GAP with the following settings: GAP generates a penalty of 5.0 and GAP expansion penalty of 0.3.
[0224] As used herein, the term “percentage (%) identity” refers to the level of identity between nucleic acid or amino acid sequences encoding a polypeptide or polypeptide when aligned using a sequence alignment procedure.
[0225] As used in this article, "comparative productivity" refers to the total amount of protein produced per cell per time period.
[0226] As defined herein, the terms “purified,” “isolated,” or “enriched” mean that a biomolecule (e.g., a polypeptide or polynucleotide) has been altered from its native state by separating it from some or all of its naturally occurring components associated with it in nature. Such separation or purification can be performed using art-recognized separation techniques such as ion exchange chromatography, affinity chromatography, hydrophobic separation, dialysis, protease treatment, ammonium sulfate precipitation or other protein salt precipitation, centrifugation, size exclusion chromatography, filtration, microfiltration, gel electrophoresis, or gradient separation to remove unwanted whole cells, cell debris, impurities, foreign proteins, or enzymes from the final composition. Further additions providing additional benefits, such as activators, inhibitors, desired ions, pH-controlling compounds, or other enzymes or chemicals, can then be added to the purified or isolated biomolecule composition.
[0227] As used herein, the term “ComK polypeptide” is defined as the product of the comK gene, a transcription factor that acts as the final autoregulatory control switch prior to competent state development; involved in activating the expression of late-competent genes involved in DNA binding and uptake as well as recombination (Liu and Zuber, 1998; Hamoen et al., 1998).
[0228] As used herein, “homologous genes” refers to pairs of genes from different but generally related species that correspond to each other and are identical or very similar. The term encompasses genes that diverge through speciation (i.e., the development of new species) (e.g., orthologous genes) and genes that diverge through genetic duplication (e.g., paralogous genes).
[0229] As used in this article, "orthologs" and "orthologous genes" refer to genes in different species that evolved from a common ancestral gene (i.e., homologous genes) through speciation. Typically, orthologs retain the same function throughout evolution. Identification of orthologs can be used for reliable prediction of gene function in newly sequenced genomes.
[0230] As used herein, "paralog" and "paralogous gene" refer to genes that are repetitive within the genome. While orthologs retain the same function during evolution, paralogs develop new functions, even if some functions are typically related to the original function. Examples of paralogous genes include, but are not limited to, genes encoding trypsin, chymotrypsin, elastase, and thrombin, all of which are serine proteases and occur together within the same species.
[0231] As used herein, “homology” refers to sequence similarity or identity, with identity taking precedence. Such homology is determined using standard techniques known in the art (see, for example, Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; procedures such as GAP, BESTFIT, FASTA, and TFASTA (Genetics Computer Group, Madison, Wisconsin) and Devereux et al., 1984, in the Wisconsin Genetics Software Package).
[0232] As used herein, the term "hybridization" refers to the process of linking a nucleic acid strand to a complementary strand through base pairing, as is known in the art. A nucleic acid sequence is considered to "selectively hybridize" with a reference nucleic acid sequence if two sequences specifically hybridize with each other under medium to high stringent hybridization and washing conditions. Hybridization conditions are based on the melting temperature (T0) of the nucleic acid binding complex or probe. mFor example, "maximum strictness" typically occurs around T. m - 5℃ (compared to the probe's T) m (5° lower); "Highly stringent" occurs below T m Approximately 5℃-10℃; "moderately stringent" occurs at temperatures greater than the probe's T. m Approximately 10°C-20°C lower; and "low strictness" occurs below T. m Approximately 20℃-25℃.
[0233] Functionally, the most stringent conditions can be used to identify sequences with strict or near-strict identity to the hybridization probe; while medium or low stringent hybridization can be used to identify or detect polynucleotide sequence homologs. Medium and high stringent hybridization conditions are well known in the art. Examples of high stringent conditions include hybridization performed at approximately 42°C in 50% formamide, 5X SSC, 5X Denhardt's solution, 0.5% SDS, and 100 pg / ml denaturing carrier DNA, followed by washing twice at room temperature (RT) in 2X SSC and 0.5% SDS, and then washing twice more at 42°C in 0.1X SSC and 0.5% SDS. Examples of stringent conditions include overnight incubation at 37°C in a solution containing 20% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt solution, 10% dextran sulfate, and 20 mg / ml denatured and cleaved salmon sperm DNA, followed by washing with a 1x SSC filter at approximately 37°C–50°C. Those skilled in the art know how to adjust temperature, ionic strength, etc., to accommodate factors such as probe length, if necessary.
[0234] As used herein, "recombinant" includes references to cells or vectors that have been modified by introducing a heterologous nucleic acid sequence, or cells derived from cells that have been so modified. Thus, for example, recombinant cells express genes in the same form not found in the cell's native (non-recombinant) form, or express native genes that are otherwise abnormally expressed, poorly expressed, or not expressed at all (due to deliberate human intervention). "Recombination," "recombining," or the generation of "recombined" nucleic acids is the assembly of two or more nucleic acid fragments, wherein the assembly produces a chimeric gene.
[0235] As used herein, a "flanking sequence" refers to any sequence upstream or downstream of the sequence under discussion (e.g., for gene ABC, gene B is flanked by gene sequences A and C). In some embodiments, the input sequence has a homology cassette on each flanking side. In another embodiment, the input sequence and homology cassette are contained within units with padding sequences on each flanking side. In some embodiments, flanking sequences are present only on one side (3' or 5'), but in a preferred embodiment, flanking sequences are present on each side of the sequence. The sequence of each homology cassette is homologous to a sequence in the Bacillus chromosome. These sequences guide the integration location of the new construct in the Bacillus chromosome and which portion of the Bacillus chromosome will be replaced by the input sequence. In other embodiments, selectively labeled 5' and 3' flanking sides have polynucleotide sequences containing portions of inactivated chromosomal segments. In some embodiments, flanking sequences are present only on one side (3' or 5'), while in other embodiments, flanking sequences are present on each side of the sequence. In some embodiments, the homologous boxes are directly flanking each other and lack intercalation sequences (e.g., for gene DEF, the construct is DF), such that if the construct recombines within the genome, gene E will be removed from the genome.
[0236] II. Bacillus licheniformis RGHR locus
[0237] The *Bacillus subtilis* yvaN gene has been identified as a repressor of the rapG, rapH, and rapD genes and has been renamed “rghR” (i.e., rapG and rapH repressors; Hayashi et al., 2006; Ogura & Fujita, 2007). For example, the *Bacillus licheniformis* rghR locus encodes two (2) homologs of the *Bacillus subtilis* RghR / YvaO (transcriptional regulator), which have been named “RghR1” and “RghR2”. The upstream (5′) of the *Bacillus licheniformis* rghR1 gene (see, for example, [reference needed]). Figure 1A There are two other genes, yvzC(Bli3645) and Bli3644, which encode the transcriptional regulatory proteins YvzC and Bli3644, respectively. More specifically, as generally defined above, the native Bacillus licheniformis rghR (chromosome) locus contains the native rghR1 gene, the native rghR2 gene, the native yvzC gene, and the native Bli3644 gene, as shown above. Figure 1A As shown. For example, PCT Publication No. WO 2018 / 156705 discloses a mutant Bacillus licheniformis strain containing a mutated rghR2 gene, which has a nucleotide sequence encoding a variant RghR2 protein named "RghR2". dup(i.e., a six-amino acid repeat sequence containing "AAASIR"). As generally described in PCT Publication No. WO 2018 / 156705, it originates from rghR2 dup The deletion of these eighteen (18) bp repeats in the sequence (i.e., the production of the allele rghR2) 剩余 This leads to a reduction in biomass, accompanied by an increase in the production of heterologous proteins.
[0238] As described herein and in the Examples section below, the applicant further designed, constructed, and tested modified Bacillus licheniformis cells to evaluate the rghR locus and identify Bacillus licheniformis cells with enhanced protein production (or other beneficial) phenotypes. More specifically, in examples of the invention, a parental Bacillus licheniformis cell named LDN143 (containing the natural rghR locus with deletions of the serA and lysA genes) was used. Figure 1A The modified Bacillus licheniformis (daughter) cells (i.e. derived from the LDN143 parent) containing the modified rghR locus were evaluated. Therefore, the modified Bacillus licheniformis (daughter) cells described herein were constructed using a series of modified rghR locus alleles, and these alleles were introduced into the parental Bacillus licheniformis cells (LDN143).
[0239] More specifically, the following Bacillus licheniformis (progeny) cells derived from the parent LDN143 were constructed, containing one of the following modified rghR loci: Bacillus licheniformis cell BF314, which contains the native rghR1 gene and the modified rghR2 gene (rghR2... 终止 ), natural yvzC gene and natural Bli3644 gene ( Figure 1B Bacillus licheniformis cell BF324 contains the rghR1 gene deletion (ΔrghR1) and the native rghR2 gene (rghR2). 终止 ), natural yvzC gene and natural Bli3644 gene ( Figure 1C Bacillus licheniformis cell BF377 contains the natural rghR1 gene, the rghR2 gene deletion (ΔrghR2), the natural yvzC gene, and the natural Bli3644 gene. Figure 1D Bacillus licheniformis cell BF389 contains rghR1 gene deletion (ΔrghR1), rghR2 gene deletion (ΔrghR2), native yvzC gene, and native Bli3644 gene. Figure 1E); and Bacillus licheniformis cell BF391, which contains deletions of the rghR1 gene (ΔrghR1), rghR2 gene (ΔrghR2), yvzC gene (ΔyvzC), and Bli3644 gene (ΔBli3644). Figure 1F (empty rghR locus).
[0240] Therefore, as described in Example 4 below (e.g., see Table 20), modified Bacillus licheniformis cells with a mutation in the rghR locus exhibit an increased production phenotype, producing approximately 23%-62% more amylase protein compared to a comparable parental cell (LDN143) (which is wild-type of the rghR locus). Thus, certain embodiments of this disclosure relate to such modified Bacillus cells having a modified rghR locus and comprising an increased protein productivity phenotype. Certain other embodiments relate to compositions and methods for constructing and obtaining modified Bacillus cells. Therefore, certain other embodiments relate to the expression / production of endogenous and / or heterologous target proteins in the modified Bacillus cells of this disclosure.
[0241] III. Bacillus licheniformis cells producing reduced amounts of red pigment
[0242] As is generally understood by those skilled in the art, Bacillus has been well established as a host system for the production of both natural and recombinant proteins. However, certain Bacillus species (e.g., Bacillus subtilis, Bacillus cereus, Bacillus licheniformis, etc.) are known to synthesize pulcherriminic acid, derived from cyclo-L-leucyl-L-leucyl, which is secreted into the growth medium and chelates iron ions (via a non-enzymatic reaction) to form an extracellular red pigment called pulcherrimin (MacDonald, 1965; Uffen and Canale-Parola, 1972). Therefore, the production of pulcherrimin by Bacillus (host) cells in sufficient quantities to form a visible red pigment (i.e., during fermentation / culture) generally requires one or more pulcherrimin removal steps during the recovery and / or purification of the target protein, or the pulcherriminic acid (red pigment) can be co-purified with the target protein.
[0243] For example, a Bacillus host cell with a desired phenotype (e.g., increased protein production) may not necessarily possess the most desirable characteristics (e.g., a red pigment phenotype) for successful fermentation, recovery, and / or purification of the target protein produced by the host cell. Therefore, certain genetic methods for reducing prochloramine production in Bacillus cells have been described in prior art literature, such as International PCT Publication No. WO 2004 / 011609, which describes the deletion of the cypX and / or yvmC genes in Bacillus as a means of reducing prochloramine production.
[0244] As described herein and in the Examples section below, the applicant has identified a novel method for reducing the production of the red pigment (procermin) in Bacillus licheniformis cells. More specifically, as shown and described in Example 5 below, the identified rghR locus is characterized by transcriptional control of an operon responsible for producing the iron-scavenging pigment procermin. As shown in this example, Bacillus licheniformis cell BF314 (i.e., containing modified (rghR2)) 终止 Both the rghR gene and BF377 (which includes the gene deletion ΔrghR2) indicate a reduction of approximately 30%–50% in the production of red pigment, while several other mutations increase the production of prochlorazine by approximately 10%–20% (see Table 21 for example). This suggests that mutations in the rghR locus control the biosynthesis of prochlorazine.
[0245] Therefore, some embodiments of this disclosure relate to modified Bacillus cells having a modified rghR locus, which produce reduced amounts of red pigment. Some other embodiments relate to compositions and methods for constructing and obtaining modified Bacillus cells that produce reduced amounts of red pigment. Therefore, some other embodiments relate to the expression / production of endogenous and / or heterologous target proteins in the modified Bacillus cells of this disclosure.
[0246] IV. Molecular Biology
[0247] As described above, certain embodiments of this disclosure relate to modified Bacillus licheniformis cells derived from parent Bacillus licheniformis cells containing the natural rghR locus. In specific embodiments, the modified Bacillus licheniformis cells contain a modified rghR locus. Therefore, certain other embodiments relate to compositions and methods for genetically modifying parent Bacillus licheniformis cells to generate modified Bacillus licheniformis (progeny) cells.
[0248] Therefore, some embodiments relate to methods for genetically modifying Bacillus cells, including but not limited to (a) introducing, substituting, or removing one or more nucleotides in a gene (or its ORF), or introducing, substituting, or removing one or more nucleotides in a regulatory element required for transcription or translation of a gene (or its ORF), (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) gene downregulation, (f) site-specific mutagenesis, and / or (g) random mutagenesis. For example, as used herein, genetic modification includes, but is not limited to, modification of one or more genes selected from the group consisting of: Bacillus licheniformis rghR1 gene, rghR2 gene, yvzC gene, and Bli3644 gene.
[0249] Therefore, in some embodiments, the modified Bacillus cells of this disclosure are constructed by reducing or eliminating the expression of the aforementioned genes using methods well known in the art (e.g., insertion, disruption, substitution, or deletion). The portion of the gene to be modified or inactivated may be, for example, a coding region or a regulatory element required for coding region expression.
[0250] Examples of such regulatory or control sequences can be promoter sequences or their functional portions (i.e., portions sufficient to affect the expression of nucleic acid sequences). Other control sequences used for modification include, but are not limited to, leader sequences, propeptide sequences, signal sequences, transcription terminators, transcription activators, etc.
[0251] In some other embodiments, modified Bacillus cells are constructed by gene deletion to eliminate or reduce the expression of at least one of the aforementioned genes of this disclosure. Gene deletion techniques are capable of partially or completely removing one or more genes, thereby eliminating their expression or expressing nonfunctional (or reduced-activity) protein products. In such methods, the deletion of one or more genes can be accomplished by homologous recombination using a plasmid constructed with consecutive 5' and 3' regions flanking the gene. The consecutive 5' and 3' regions can be introduced into Bacillus cells, for example, on a temperature-sensitive plasmid (such as pE194), associated with a second selectable marker at an allowable temperature to allow plasmid establishment in the cell. The cells are then moved to a non-allowable temperature to select cells with a plasmid that integrates into the chromosome at one of the homologous flanking regions. Selection for plasmid integration is achieved by selecting the second selectable marker. After integration, recombination events at the second homologous flanking region are stimulated by moving the cells to an allowable temperature for several generations without selection. Cells are plated to obtain single colonies, and the colonies are examined for loss of both optional markers (see, for example, Perego, 1993). Thus, those skilled in the art (e.g., by referring to the rghR1, rghR2, yvzC, bli3644 (nucleic acid) sequences and the protein sequences they encode) can readily identify nucleotide regions in the coding sequences and / or non-coding sequences of genes suitable for complete or partial deletion.
[0252] In other embodiments, the modified Bacillus cells of this disclosure are constructed by introducing, substituting, or removing one or more nucleotides into the gene or its regulatory elements required for transcription or translation. For example, nucleotides may be inserted or removed to result in the introduction of a stop codon, the removal of a start codon, or a frameshift of the reading frame. Such modifications can be accomplished by site-directed mutagenesis or PCR-induced mutagenesis according to methods known in the art (e.g., see Botstein and Shortle, 1985; Lo et al., 1985; Higuchi et al., 1988; Shimada, 1996; Ho et al., 1989; Horton et al., 1989; and Sarkar and Sommer, 1990). Therefore, in some embodiments, the gene of this disclosure is inactivated by complete or partial deletion.
[0253] In another embodiment, modified Bacillus cells are constructed via a gene conversion process (e.g., see Iglesias and Trautner, 1983). For example, in gene conversion methods, nucleic acid sequences corresponding to one or more genes are mutagenized in vitro to produce defective nucleic acid sequences, which are then transformed into parental Bacillus cells to produce defective genes. Through homologous recombination, the defective nucleic acid sequence replaces the endogenous gene. It may be desirable that the defective gene or gene fragment also encodes a marker that can be used to select transformants containing the defective gene. For example, the defective gene can be associated with a selectable marker and introduced onto a non-replicating or temperature-sensitive plasmid. Selection of plasmid integration is achieved by selecting the marker under conditions that disallow plasmid replication. Selection of a second recombination event leading to gene substitution is achieved by examining colony loss of the selectable marker and obtaining the mutant gene (Perego, 1993). Alternatively, the defective nucleic acid sequence may contain the insertion, substitution, or deletion of one or more nucleotides of the gene, as described below.
[0254] In other embodiments, modified Bacillus cells are constructed using an established antisense technique that employs a nucleotide sequence complementary to the nucleic acid sequence of the gene (Parish and Stoker, 1997). More specifically, gene expression in Bacillus cells can be reduced (downregulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the gene, which can be transcribed in the cell and hybridizes with mRNA produced in the cell. Under conditions that allow the complementary antisense nucleotide sequence to hybridize with the mRNA, the amount of translated protein is thereby reduced or eliminated. Such antisense methods include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, etc., all of which are well known to those skilled in the art.
[0255] In other embodiments, modified Bacillus cells are generated / constructed via CRISPR-Cas9 editing. For example, genes encoding rghR1, rghR2, yvzC, and / or Bli3644 can be disrupted (or deleted or downregulated) via a nucleic acid-guided endonuclease, which finds its target DNA by binding a guide RNA (e.g., Cas9) and Cpfl or guide DNA (e.g., NgAgo). This recruits the endonuclease to a target sequence on the DNA, where the endonuclease can generate single-strand or double-strand breaks in the DNA. This targeted DNA break becomes a substrate for DNA repair and can be recombinated with a provided editing template to disrupt or delete the gene. For example, a gene encoding a nucleic acid-guided endonuclease (Cas9 from Streptococcus pyogenes for this purpose) or a codon-optimized gene encoding the Cas9 nuclease is efficiently linked to an active promoter and an active terminator in Bacillus cells, thereby generating a Bacillus Cas9 expression cassette. Similarly, those skilled in the art can readily identify one or more target sites specific to the target gene. For example, to construct a DNA construct encoding gRNA targeting a target site within a target gene using *Streptococcus pyogenes* Cas9, a variable targeting (VT) domain would contain a nucleotide at the target site of the (PAM) protospacer adjacent motif (NGG) 5', which is fused with DNA encoding the Cas9 endonuclease recognition domain (CER) of *Streptococcus pyogenes* Cas9. Combining the DNA encoding the VT domain and the DNA encoding the CER domain produces DNA encoding gRNA. Thus, a *Bacillus* expression cassette of gRNA is generated by efficiently linking the DNA encoding gRNA to a promoter and a terminator active in *Bacillus* cells.
[0256] In some embodiments, DNA breaks induced by nucleases are repaired / replaced with an input sequence. For example, to precisely repair DNA breaks generated by the Cas9 expression cassette and gRNA expression cassette described above, a nucleotide editing template is provided, allowing the cell's DNA repair mechanisms to utilize the editing template. For example, approximately 500-bp 5' of the target gene can be fused with approximately 500-bp 3' of the target gene to generate an editing template that is used by the Bacillus host's machinery to repair DNA breaks generated by RGEN.
[0257] Many different methods can be used to co-deliver the Cas9 expression cassette, gRNA expression cassette, and editing template into cells. Transformed cells are screened by amplifying the target locus using PCR with forward and reverse primers. These primers can amplify wild-type loci or modified loci that have already been edited by RGEN. These fragments are then sequenced using sequencing primers to identify the edited colonies (see, for example, the Examples section below).
[0258] In other embodiments, modified Bacillus cells are constructed by random or specific mutagenesis using methods well known in the art, including but not limited to chemical mutagenesis (see, for example, Hopwood, 1970) and transposition (see, for example, Youngman et al., 1983)). Gene modification can be performed by mutagenesis of parental cells and screening for mutant cells in which gene expression has been reduced or eliminated. Mutagenesis can be specific or random and can be performed, for example, by using suitable physical or chemical mutagens, by using suitable oligonucleotides, or by subjecting the DNA sequence to PCR-induced mutagenesis. Furthermore, mutagenesis can be performed by any combination of these mutagenesis methods.
[0259] Examples of physical or chemical mutagens suitable for the purposes of this invention include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), o-methylhydroxylamine, nitrous acid, ethyl methanesulfonate (EMS), sodium bisulfite, formic acid, and nucleotide analogs. When using such agents, mutagenesis is typically induced by incubating parental cells to be mutagenized under suitable conditions in the presence of a selected mutagen, and selecting cells exhibiting mutations that result in reduced or absent gene expression.
[0260] International PCT publication WO 2003 / 083125 discloses methods for modifying Bacillus cells, such as using PCR fusion to generate Bacillus deletion strains and DNA constructs to bypass Escherichia coli. PCT publication WO 2002 / 14490 discloses methods for modifying Bacillus cells, including (1) constructing and transforming integrated plasmids (pComK), (2) randomly mutagenesis of coding, signal, and propeptide sequences, (3) homologous recombination, (4) improving transformation efficiency by adding non-homologous flanking to the transformed DNA, (5) optimizing double cross-integration, (6) directed mutagenesis, and (7) label-free deletion.
[0261] Those skilled in the art are well aware of suitable methods for introducing polynucleotide sequences into bacterial cells (e.g., *Escherichia coli* and *Bacillus* species) (e.g., Ferrari et al., 1989; Saunders et al., 1984; Hoch et al., 1967; Mann et al., 1986; Holubova, 1985; Chang et al., 1979; Vorobjeva et al., 1980; Smith et al., 1986; Fisher et al., 1981 and McDonald, 1984). In fact, such methods, including protoplast transformation and midplate assembly, transduction, and protoplast fusion, are known and suitable for use in this disclosure. Transformation methods are particularly preferred for introducing the DNA constructs of this disclosure into host cells.
[0262] In addition to commonly used methods, in some embodiments, host cells are directly transformed (i.e., intermediate cells are not used for amplification or otherwise processed before introduction into host cells). Introducing the DNA construct into host cells includes those physical and chemical methods known in the art that introduce DNA into host cells without insertion into plasmids or vectors. Such methods include, but are not limited to, calcium chloride precipitation, electroporation, naked DNA, liposomes, etc. In additional embodiments, the DNA construct is co-transformed with a plasmid without insertion into that plasmid. In further embodiments, selective markers are deleted or substantially excised from the modified Bacillus strain using methods known in the art (e.g., Stahl et al., 1984; Palmeros et al., 2000). In some embodiments, the vector is dissociated from the host chromosome, leaving flanking regions on the chromosome while removing the intrinsic chromosomal regions.
[0263] Promoters and promoter sequence regions used for expressing genes, their open reading frames (ORFs), and / or variant sequences in Bacillus cells are generally known to those skilled in the art. Promoter sequences of this disclosure are typically selected such that they function in Bacillus cells. Certain exemplary Bacillus promoter sequences include, but are not limited to, the Bacillus subtilis alkaline protease (aprE) promoter, the Bacillus subtilis α-amylase promoter, the Bacillus amylolyticus α-amylase promoter, the Bacillus subtilis neutral protease (nprE) promoter, the mutant aprE promoter (e.g., PCT Publication WO 2001 / 51643), or any other promoters from Bacillus licheniformis or other related Bacillus genera. Methods for screening and generating promoter libraries with a range of activities (promoter strengths) in Bacillus cells are described in PCT Publication WO 2003 / 089604.
[0264] V. Culturing modified cells for the production of the target protein.
[0265] As generally described above, some embodiments relate to compositions and methods for constructing and obtaining Bacillus cells / strains with an increased protein production phenotype. Therefore, some embodiments relate to methods for producing target proteins in Bacillus cells by fermenting / culturing cells in a suitable culture medium. Fermentation methods well known in the art can be used to ferment the parental and modified (daughter) Bacillus cells disclosed herein.
[0266] In some embodiments, cells are cultured under batch or continuous fermentation conditions. Classical batch fermentation is a closed system in which the composition of the culture medium is set at the start of fermentation and remains unchanged during fermentation. At the start of fermentation, the medium is inoculated with one or more desired organisms. In this method, fermentation is allowed to occur without adding any components to the system. Typically, batch fermentation meets the criteria for "batch" with regard to the addition of a carbon source and often involves experimentation with control factors such as pH and oxygen concentration. The metabolite and biomass composition of a batch system changes continuously until fermentation stops. In typical batch culture, cells can progress from a static lag phase to a high logarithmic growth phase, and finally to a stationary phase where the growth rate decreases or stops. Cells in the stationary phase eventually die if left untreated. Typically, cells in the logarithmic phase are responsible for the large-scale production of products.
[0267] A suitable variant of the standard batch system is the "feed-batch" fermentation system. In this variant of the typical batch system, the substrate is added incrementally as fermentation progresses. Feed-batch systems are useful when catabolite repression might inhibit cellular metabolism and when a limited amount of substrate is desired in the culture medium. Measuring the actual substrate concentration in a feed-batch system is difficult and is therefore estimated based on changes in measurable factors such as pH, dissolved oxygen, and the partial pressure of exhaust gases (e.g., CO2). Batch and feed-batch fermentation are commonly used and are known in the art.
[0268] Continuous fermentation is an open system in which a defined fermentation medium is continuously added to a bioreactor while an equal volume of conditioned medium is removed for further processing. Continuous fermentation typically maintains the culture at a constant high density, with cells primarily in the logarithmic growth phase. Continuous fermentation allows for the regulation of one or more factors affecting cell growth and / or product concentration. For example, in one embodiment, a limiting nutrient (e.g., a carbon or nitrogen source) is maintained at a fixed rate, allowing all other parameters to be kept moderate. In other systems, many factors affecting growth can change continuously while cell concentration, as measured by the turbidity of the medium, remains constant. Continuous systems strive to maintain steady-state growth conditions. Therefore, cell loss due to medium transfer should be balanced against the cell growth rate during fermentation. Methods for regulating nutrients and growth factors used in continuous fermentation processes, as well as techniques for maximizing product formation rates, are well known in the field of industrial microbiology.
[0269] In some embodiments, the target protein expressed / produced by the Bacillus cells of this disclosure can be recovered from the culture medium via routine procedures, including separating the host cells from the culture medium by centrifugation or filtration, or, if necessary, destroying the cells and removing the supernatant from cell portions and debris. Typically, after clarification, the protein components of the supernatant or filtrate are precipitated with a salt (e.g., ammonium sulfate). The precipitated protein is then dissolved and can be purified using various chromatographic procedures (e.g., ion exchange chromatography, gel filtration).
[0270] VI. Target protein
[0271] The target protein (POI) of this disclosure can be any endogenous or heterologous protein, and it can be a variant of such a POI. The protein may contain one or more disulfide bridges, or it may be a protein whose functional form is monomeric or polymeric, i.e., the protein has a quaternary structure and is composed of multiple identical (homologous) or dissimilar (heterologous) subunits, wherein the POI or its variants are preferably POIs with the desired properties. For example, in some embodiments, the modified Bacillus cells of this disclosure produce at least about 0.1%, at least about 0.5%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more of POIs relative to their unmodified (parental) cells.
[0272] In some embodiments, the modified Bacillus cells of this disclosure exhibit increased specific productivity (Qp) of POI relative to (unmodified) parental cells. For example, the detection of specific productivity (Qp) is a suitable method for assessing protein production. Specific productivity (Qp) can be determined using the following equation:
[0273] "Qp = gP / gDCW·hr"
[0274] Wherein, “gP” is the number of grams of protein produced in the tank; “gDCW” is the number of grams of stem cell weight (DCW) in the tank; and “hr” is the fermentation time in hours from the inoculation time, including production time and growth time.
[0275] Therefore, in some other embodiments, the modified Bacillus cells of this disclosure contain at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more of a specific productivity (Qp) increase relative to unmodified (parental) cells.
[0276] In some embodiments, the POI or its variants are selected from the group consisting of: acetylesterase, aminopeptidase, amylase, arabinosease, arabinofuranase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, rennet, keratinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endoglucanase, glucosylamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, and sugars. Basic hydrolases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, ligases, lipases, lyases, mannosidases, oxidases, oxidoreductases, pectin lyases, pectin acetylesterases, pectin depolymerases, pectin methylesterases, pectin hydrolysates, perhydrolases, polyol oxidases, peroxidases, phenol oxidases, phytases, polygalacturonases, proteases, peptidases, rhamnose-galacturonases, ribonucleases, transferases, transport proteins, transglutaminases, xylanases, hexose oxidases, and combinations thereof.
[0277] Therefore, in some embodiments, the POI or a variant thereof is an enzyme selected from the Enzyme Committee (EC) numbers EC 1, EC 2, EC 3, EC 4, EC 5 or EC 6.
[0278] In some other embodiments, the modified Bacillus cells of this disclosure contain an expression construct encoding an amylase. Various amylases and their variants are known to those skilled in the art. For example, international PCT publications WO 2006 / 037484 and WO 2006 / 037483 describe variant α-amylases with improved solvent stability; PCT publication WO1994 / 18314 discloses oxidically stable α-amylase variants; PCT publications WO 1999 / 19467, WO 2000 / 29560, and WO 2000 / 60059 disclose Termamyl-like α-amylase variants; PCT publication WO 2008 / 112459 discloses an α-amylase variant derived from Bacillus species number 707; PCT publication WO 1999 / 43794 discloses an α-amylase variant of raw malt; PCT publication WO 1990 / 11352 discloses a hyperthermically stable α-amylase variant; and PCT publication WO... 2006 / 089107 disclosed an α-amylase variant with granular starch hydrolysis activity, etc.
[0279] Those skilled in the art are aware of various assays for detecting and measuring the activity of proteins expressed intracellularly and extracellularly.
[0280] PCT Publication No. WO 2014 / 164777 discloses a Ceralpha α-amylase activity assay that can be used to detect the amylase activity described herein.
[0281] Examples
[0282] Certain aspects of the invention can be further understood from the following examples, which should not be construed as limiting. Modifications to the materials and methods will be apparent to those skilled in the art.
[0283] Example 1
[0284] Construction of CAS9 vector targeting RGHR locus
[0285] The Cas9 protein (SEQ ID NO:1) from *Streptococcus pyogenes* was codon-optimized for use with *Bacillus* (SEQ ID NO:2) by adding an N-terminal nuclear localization sequence (NLS; "APKKKRKV"; SEQ ID NO:3), a C-terminal NLS ("KKKKLK"; SEQ ID NO:4), a decahistidine tag ("HHHHHHHHHH"; SEQ ID NO:5), an aprE promoter sequence (SEQ ID NO:6) and a terminator sequence (SEQ ID NO:7) from *Bacillus subtilis*, and amplified using the forward (SEQ ID NO:8) and reverse (SEQ ID NO:9) primer pairs listed in Table 1 below using Q5 DNA polymerase (NEB) (according to the manufacturer's instructions).
[0286] Table 1
[0287] Forward and reverse primer pairs
[0288] Forward ATATATGAGTAAACTTGGTCTGACAGAATTCCTCCATTTTCTTTCTGCTAT SEQ ID NO:8 Reverse TGCGGCCGCGAATTCGATTACGAATGCCGTCTCCC SEQ ID NO:9
[0289] The backbone (SEQ ID NO: 10) of plasmid pKB320 (SEQ ID NO: 11) was amplified using the forward (SEQ ID NO: 12) and reverse (SEQ ID NO: 13) primer pairs listed in Table 2 below with Q5 DNA polymerase (NEB) (according to the manufacturer's instructions).
[0290] Table 2
[0291] Forward and reverse primer pairs
[0292] Forward GGGAGACGGCATTCGTAATCGAATTCGCGGCCGCA SEQ ID NO:12 Reverse ATAGCAGAAGAAAATGGAGGAATTCTGTCAGACCAAGTTTACTCATATAT SEQ ID NO:13
[0293] The PCR products were purified using a Zymo clean and concentrate 5 column according to the manufacturer's instructions. Subsequently, the PCR products were assembled using extended overlap PCR (POE-PCR) with two (2) fragments mixed in equimolar ratios with Q5 polymerase (NEB). The POE-PCR reaction was cycled as follows: 98°C for 5 (5) seconds, 64°C for 10 (10) seconds, and 72°C for 4 (4) minutes (15) and 15 seconds, for 30 cycles. Five (5) μl of POE-PCR (DNA) was transformed into Top10 Escherichia coli (Invitrogen) according to the manufacturer's instructions and cultured in lysogenic (L) medium (Miller formulation; 1% (w / v) tryptone, 0.5% yeast extract (w / v), 1% NaCl (w / v)) containing 50 (50) μg / ml kanamycin sulfate and solidified with 1.5% agar. Colonies were allowed to grow at 37°C for 18 (18) hours. Colonies were picked and plasmid DNA was prepared using the Qiaprep DNA Mini Preparation Kit (according to the manufacturer's instructions), and eluted with 55 μl ddH2O. The plasmid DNA was then sequenced using Sanger sequencing with the sequencing primers listed in Table 3 below to verify correct assembly.
[0294] Sequencing primers
[0295] Table 3
[0296]
[0297]
[0298] The correctly assembled plasmid pRF694 (SEQ ID NO:25) was used to construct plasmids pRF801 (SEQ ID NO:26) and pRF806 (SEQ ID NO:27) for editing target site 1 (TS1; SEQ ID NO:28) and target site 2 (TS2; SEQ ID NO:29) of the Bacillus licheniformis genome, as described below.
[0299] The serA1 read frame (SEQ ID NO:30) of Bacillus licheniformis contains a unique target site (TS), namely the reverse-oriented target site 1 (TS1; SEQ ID NO:28). TS1 is adjacent to the reverse-oriented protospacer neighbor motif (PAM; SEQ ID NO:31). The target site can be converted into DNA encoding a variable targeting (VT) domain (SEQ ID NO:32). The DNA sequence encoding the VT domain (SEQ ID NO:32) is efficiently fused to the DNA sequence encoding the Cas9 endonuclease recognition domain (CER, SEQ ID NO:33), so that when transcribed by the RNA polymerase of the bacterial cell, it produces a functional guide RNA (gRNA) targeting target site 1 (SEQ ID NO:34). The DNA encoding gRNA is efficiently linked to a promoter (e.g., the spac promoter; SEQ ID NO:35) that is effective in Bacillus species cells and a terminator sequence (e.g., the t0 terminator sequence of bacteriophage λ; SEQ ID NO:36) that is effective in Bacillus species cells, such that the promoter is located at the 5' of the DNA encoding gRNA (SEQ ID NO:33) and the terminator is located at the 3' of the DNA encoding gRNA (SEQ ID NO:33).
[0300] An editing template was created by amplifying two homologous arms of the Bacillus licheniformis genomic DNA (gDNA) to delete the serA1 gene in response to Cas9 / gRNA cleavage. The first fragment (homologous arm 1) corresponds to 500 (500) nucleotides directly upstream (5′) of the serA1 ORF (SEQ ID NO:37). This fragment was amplified using Q5 DNA polymerase (according to the manufacturer’s instructions) and the forward (SEQ ID NO:38) and reverse (SEQ ID NO:39) primers listed in Table 4 below. These primers incorporated 18 (18) nucleotides homologous to the 5′ end of the second fragment at the 3′ end of the first fragment and 20 (20) nucleotides homologous to pRF694 at the 5′ end of the first fragment.
[0301] Table 4
[0302] Forward and reverse primer pairs
[0303] Forward TGAGTAAACTTGGTCTGACAAATGGTTCTTTCCCCTGTCC SEQ ID NO:38 Reverse AGGTTCCGCAGCTTCTGTGTAAGATTTCCTCCTAAATAAGCGTCAT SEQ ID NO:39
[0304] The second fragment (homologous arm 2) corresponds to 500 (500) nucleotides directly downstream of the 3' end of the serA1 ORF (SEQ ID NO:40). This fragment was amplified using Q5 DNA polymerase (according to the manufacturer's instructions) and the forward (SEQ ID NO:41) and reverse (SEQ ID NO:42) primers listed in Table 5 below. These primers incorporated 28 (28) nucleotides homologous to the 3' end of the first fragment at the 5' end and 21 (21) nucleotides homologous to pRF694 at the 3' end of the second fragment.
[0305] Table 5
[0306] Forward and reverse primer pairs
[0307] Forward ATGACGCTATTTAGGAGGAAATCTTACACAGAAGCTGCGGAACCT SEQ ID NO:41 Reverse CAGAAGAAAATGGAGGAATTCGAATATCGACCGGAACCCAC SEQ ID NO:42
[0308] DNA encoding a target site 1 gRNA expression cassette (SEQ ID NO:43), a first homologous arm (SEQ ID NO:37), and a second homologous arm (SEQ ID NO:40) was assembled into pRF694 (SEQ ID NO:25) using standard molecular biology techniques, resulting in plasmid pRF801 (SEQ ID NO:26), which is an E. coli-Bacillus licheniformis shuttle plasmid containing the following: a Cas9 expression cassette (SEQ ID NO:2), a gRNA expression cassette (SEQ ID NO:43) encoding gRNA targeting TS1 within the serA1 ORF, and an editing template (SEQ ID NO:44) composed of the first homologous arm (SEQ ID NO:37) and the second homologous arm (SEQ ID NO:40). The plasmid was validated by Sanger sequencing using the oligonucleotides (primers) listed in Table 3 above.
[0309] The rghR1 read frame (SEQ ID NO:45) of Bacillus licheniformis contains a unique target site (TS) on the reverse strand, namely target site 2 (TS2; SEQ ID NO:28). The target site is adjacent to a protospacer neighbor motif (PAM; SEQ ID NO:46) on the reverse strand. The target site can be converted into DNA encoding a variable target (VT) domain (SEQ ID NO:47). The DNA sequence encoding the VT domain (SEQ ID NO:47) is efficiently fused to the DNA sequence encoding the Cas9 endonuclease recognition domain (CER; SEQ ID NO:33), so that when transcribed by the bacterial cell's RNA polymerase, it produces a functional gRNA (SEQ ID NO:48) targeting target site 2. The DNA encoding gRNA is efficiently linked to a promoter effective in Bacillus species cells (e.g., the spac promoter from Bacillus subtilis; SEQ ID NO:35) and a terminator effective in Bacillus species cells (e.g., the t0 terminator of bacteriophage λ; SEQ ID NO:36), such that the promoter is located at the 5' of the DNA encoding gRNA (SEQ ID NO:48) and the terminator is located at the 3' of the DNA encoding gRNA (SEQ ID NO:48).
[0310] An editing template was constructed by amplifying two homologous arms of the Bacillus licheniformis genomic DNA (gDNA) to modify the rghR1 gene in response to Cas9 / gRNA cleavage. The first fragment corresponds to 500 nucleotides directly upstream (5′) of the rghR1 ORF (homological arm 1; SEQ ID NO:49). This fragment was amplified using Q5 DNA polymerase (according to the manufacturer's instructions) and the forward (SEQ ID NO:50) and reverse (SEQ ID NO:51) primers listed in Table 6 below. These primers incorporated 23 (23) nucleotides homologous to the 5′ end of the second fragment at the 3′ end of the first fragment and 20 (20) nucleotides homologous to pRF694 at the 5′ end of the first fragment.
[0311] Table 6
[0312] Forward and reverse primer pairs
[0313]
[0314]
[0315] The second fragment corresponds to 500 nucleotides directly downstream of the 3' end of the rghR1 ORF (homological arm 2; SEQ ID NO: 52). This fragment was amplified using Q5 DNA polymerase (according to the manufacturer's instructions) and the forward (SEQ ID NO: 53) and reverse (SEQ ID NO: 54) primers listed in Table 7 below. These primers incorporated twenty (20) nucleotides homologous to the 3' end of the first fragment at the 5' end and twenty-one (21) nucleotides homologous to pRF694 at the 3' end of the second fragment.
[0316] Table 7
[0317] Forward and reverse primer pairs
[0318] Forward GAGATTGCGAGGTTTTGGCCATACTTCTCCGCGGCACA SEQ ID NO:53 Reverse CAGAAGAAAATGGAGGAATTCATTTCTCGGGTTTAAACAGCCAC SEQ ID NO:54
[0319] DNA encoding the target site 2 gRNA expression cassette (SEQ ID NO:55), the first homologous arm (SEQ ID NO:49), and the second homologous arm (SEQ ID NO:52) was assembled into pRF694 (SEQ ID NO:25) using standard molecular biology techniques, generating pRF806 (SEQ ID NO:27), which is an E. coli-Bacillus licheniformis shuttle plasmid containing the following: a Cas9 expression cassette (SEQ ID NO:2), a gRNA expression cassette (SEQ ID NO:55) encoding the gRNA targeting the target site 2 within the rghR1 ORF, and an editing template (SEQ ID NO:56) composed of the first homologous arm (SEQ ID NO:49) and the second homologous arm (SEQ ID NO:52). The plasmid was verified by Sanger sequencing using the oligonucleotides (primers) listed in Table 3 above.
[0320] Example 2
[0321] Construction of the CAS9 Y155H variant and related target plasmids
[0322] In this example, the Y155H variant of Streptococcus pyogenes Cas9 (SEQ ID NO:57) was constructed in pRF801 (SEQ ID NO:26) and pRF806 (SEQ ID NO:27) plasmids. To introduce the (Cas9) Y155H variant into either pRF801 (SEQ ID NO:26) or pRF806 (SEQ ID NO:27) plasmid, site-directed mutagenesis was performed using either pRF801 (SEQ ID NO:26) or pRF806 (SEQ ID NO:27) plasmid as template DNA, with the Quikchange mutagenesis kit (according to the manufacturer's instructions) and the forward (SEQ ID NO:58) and reverse (SEQ ID NO:59) primers shown in Table 8 below.
[0323] Table 8. Forward and Reverse Primer Pairs
[0324] Forward GATCTGCGTTTAATCCATCTTGCGTTAGCGCAC SEQ ID NO:58 Reverse GTGCGCTAACGCAAGATGGATTAAACGCAGATC SEQ ID NO:59
[0325] The resulting reaction products, pRF827 (SEQ ID NO:60), comprise a (Cas9)Y155H variant expression cassette (SEQ ID NO:61), a gRNA expression cassette (SEQ ID NO:43) (encoding a gRNA targeting site 1 (TS1) within the serA1 ORF), and an editing template (SEQ ID NO:44) consisting of the first (SEQ ID NO:37) and second (SEQ ID NO:40) homologous arms; or pRF856 (SEQ ID NO:62), comprised of a (Cas9)Y155H variant expression cassette (SEQ ID NO:61), a gRNA expression cassette targeting site 2 (TS2) within the rghR1 ORF (SEQ ID NO:55), and an editing template (SEQ ID NO:56) consisting of the first (SEQ ID NO:49) and second (SEQ ID NO:52) homologous arms. Sanger sequencing was performed on the plasmid DNA using the sequencing oligonucleotides (primers) listed in Table 3 above to verify correct assembly.
[0326] Construction of plasmid pRF862
[0327] Plasmid pRF862 (SEQ ID NO:77) was constructed by removing a fragment containing Y155H (variant) substitution from pRF827 (SEQ ID NO:60) and amplifying the fragment using the forward (SEQ ID NO:64) and reverse (SEQ ID NO:65) primers shown in Table 9 below.
[0328] Table 9
[0329] Forward and reverse primer pairs
[0330] Forward CACGTCGTAAAAATCGTATT SEQ ID NO:64 Reverse CAAACAGACCATTTTTCTTT SEQ ID NO:65
[0331] A second fragment (SEQ ID NO: 67) was amplified from pRF694 (SEQ ID NO: 66) so that it encompasses the entire plasmid except for the fragment contained in the pRF827 fragment (SEQ ID NO: 60) described above. This fragment shares homology with the 5′ and 3′ ends of the pRF827 fragment (SEQ ID NO: 60) for assembly and was amplified using the forward (SEQ ID NO: 68) and reverse (SEQ ID NO: 69) primers listed in Table 10 below.
[0332] Table 10
[0333] Forward and reverse primer pairs
[0334] Forward AAAGAAAAATGGTCTGTTTG SEQ ID NO:68 Reverse AATACGATTTTTACGACGTG SEQ ID NO:69
[0335] Two (2) fragments were assembled using NEBuilder according to the manufacturer's instructions and transformed into E. coli competent cells. The plasmid sequence was verified using the Sanger method with oligonucleotides (primers) listed in Table 3 above. The sequence-verified isolates were stored as plasmid pRF862 (SEQ ID NO:77).
[0336] pRF869 (SEQ ID NO:70) was constructed using two (2) parts. It is a plasmid that targets rghR2 ORF (SEQ ID NO:71) and inserts three (3) in-frame stop codons. The first part (SEQ ID NO:72) was synthesized by IDT. It contains an editing template (SEQ ID NO:73) for modifying rghR2 ORF (SEQ ID NO:71) and a gRNA expression cassette (SEQ ID NO:74) targeting rghR2 ORF (SEQ ID NO:71). The first part was amplified using the forward (SEQ ID NO:75) and reverse (SEQ ID NO:76) primers listed in Table 11 below.
[0337] Table 11
[0338] Forward and reverse primer pairs
[0339] Forward CGTGCGGCCGCGAATTC SEQ ID NO:75 Reverse CCTGATACCGGGAGACGGCATTCGTAATC SEQ ID NO:76
[0340] The second part (SEQ ID NO:77) of pRF862 (SEQ ID NO:77), containing the Cas9 expression cassette and all plasmid components, was amplified using the forward (SEQ ID NO:78) and reverse (SEQ ID NO:79) primers listed in Table 12 below.
[0341] Table 12
[0342] Forward and reverse primer pairs
[0343] Forward GAATTCGCGGCCGCACG SEQ ID NO:78 Reverse GATTACGAATGCCGTCTCCCGGTATCAGG SEQ ID NO:79
[0344] Following the manufacturer's instructions, the two parts were assembled using NEBuilder and transformed into *E. coli*. The plasmid sequence was verified using the Sanger method with the oligonucleotides (primers) listed in Table 3 above. The sequence-verified isolate was stored as pRF869 (SEQ ID NO: 70).
[0345] Assemble several additional Cas9 plasmids as described in Examples 1 and 2 above. Table 13 below lists those plasmids, along with the target site (TS) sequence and editing template effect. As used in Table 13 below, the term "SID" is an abbreviation for "SEQ ID" number.
[0346] Table 13
[0347] Additional CAS9 plasmids used for editing Bacillus licheniformis cells
[0348]
[0349] Example 3
[0350] Construction of Bacillus strains containing alleles of various RGHR loci expressing amylases
[0351] In an example of the invention, a series of rghR locus alleles were introduced into a native *C. chrysogenum* strain containing an expression cassette encoding a variant *C. chrysogenum* species α-amylase (e.g., a variant *C. chrysogenum* species α-amylase described in PCT Publication No. WO 2017 / 100720, which is incorporated herein by reference in its entirety). More specifically, the native *C. chrysogenum* named LDN143 contains (a) a native rghR locus, (b) a deletion of the serA gene (SEQ ID NO:30), a deletion of the lysA gene (SEQ ID NO:92), and two (2) α-amylase expression cassettes.
[0352] For example, a first expression cassette (SEQ ID NO:93) integrated into the serA locus contains a serA ORF (SEQ ID NO:30) and a synthetic p3 promoter (SEQ ID NO:94; described in PCT Publication No. WO 2017 / 152169), which is effectively linked to DNA encoding Bacillus subtilis aprE 5′-UTR (SEQ ID NO:95), which is effectively linked to DNA encoding Bacillus licheniformis amyL signal sequence (SEQ ID NO:96), which is effectively linked to DNA sequence encoding a variant of α-amylase in the genus Bacillus (SEQ ID NO:97), which is effectively linked to the Bacillus licheniformis amyL transcription terminator (SEQ ID NO:98). The second expression cassette (SEQ ID NO:99) integrated into the amyL locus contains a lysA auxotrophic marker (SEQ ID NO:92) and a Bacillus licheniformis amyL promoter (SEQ ID NO:100), which is effectively linked to DNA encoding Bacillus subtilis aprE 5′-UTR (SEQ ID NO:95), which is effectively linked to DNA encoding an amyL signal sequence (SEQ ID NO:96), which is effectively linked to a DNA sequence encoding a variant of α-amylase in the genus Bacillus (SEQ ID NO:97), which is effectively linked to the Bacillus licheniformis amyL transcription terminator (SEQ ID NO:98).
[0353] A version of LDN143 cells / strain containing the pBl.comK plasmid (SEQ ID NO:101) (which contains a spectinomycin marker (SEQ ID NO:102), DNA encoding an XylR repressor (SEQ ID NO:103), and an xylA promoter (SEQ ID NO:104) that is effectively linked to DNA encoding the Bacillus licheniformis ComK protein (SEQ ID NO:105) (see, for example, Liu and Zuber, 1998; Hamoen et al., 1998; US Patent Publication No. 2006 / 0199222)) was transformed with pRF869 (SEQ ID NO:70), pRF874 (SEQ ID NO:80), pRF879 (SEQ ID NO:83), pRF899 (SEQ ID NO:86), or pRF901 (SEQ ID NO:89) plasmids amplified using rolling circle amplification (TruePrime RCA, Lucigen).
[0354] In short, LDN143 / pBl.comK competent cells were generated. The LDN143 / pBl.comK strain was grown overnight in L medium containing 100 ppm spectinomycin at 37°C and 250 RPM with shaking. The culture was diluted to 0.7 OD in fresh L medium containing 100 ppm spectinomycin. 600 The new culture was grown at 37°C and 250 RPM for one (1) hour. D-xylose was added to a concentration of 0.1% w·v. -1 The culture was then regrowth for four (4) hours. Cells were harvested at 1700 g for seven (7) minutes. The culture was then refluxed with a solution containing 10% v / v. -1 Cells were resuspended in DMSO at one-quarter (1 / 4) of the used culture volume. One hundred (100) μl of cells were mixed with ten (10) μl of RCA amplification products of plasmids pRF869 (SEQ ID NO:70), pRF874 (SEQ ID NO:80), pRF879 (SEQ ID NO:83), pRF899 (SEQ ID NO:86), or pRF901 (SEQ ID NO:89). The cell / DNA mixture was incubated at 37°C and 1400 RPM for one and a half (1.5) hours. The mixture was then plated onto L agar plates containing twenty (20) ppm kanamycin. The inoculated plates were incubated at 37°C for forty-eight to seventy-two (48–72) hours. Colony formation on L agar plates containing twenty (20) ppm kanamycin was screened by colony PCR to confirm modifications at the loci as described below.
[0355] For cells transformed with pRF869 (SEQ ID NO:70), the rghR2 gene was amplified using standard PCR techniques with the forward (SEQ ID NO:106) and reverse (SEQ ID NO:107) primers listed in Table 14 below.
[0356] Table 14
[0357] Forward and reverse primer pairs
[0358] positive GCGAATCGAAAACGGAAAGC SEQ ID NO:106 Reverse TCATCGCGATCGGCATTACG SEQ ID NO:107
[0359] This PCR product is a 1,164-nucleotide fragment containing the target region of rghR2 (SEQ ID NO: 108); using Sanger's method, the product was sequenced using the forward primers (SEQ ID NO: 110) listed in Table 15 below to confirm rghR2. 终止 The introduction of an allele (SEQ ID NO:109) containing three (3) in-frame nonsense mutations. This will allow for the inclusion of rghR2. 终止The isolate of the allele (SEQ ID NO:109) was stored as strain BF314.
[0360] Table 15
[0361] RGHR2 终止 Sequencing primers
[0362] positive TTTCGACTTTCTCGTGCAGG SEQ ID NO:110
[0363] For cells transformed with pRF874 (SEQ ID NO:80), the rghR1 gene region was amplified using the forward (SEQ ID NO:111) and reverse (SEQ ID NO:112) primers listed in Table 16 below.
[0364] Table 16
[0365] Forward and reverse primer pairs
[0366] positive ATCAAACATGCCATGTTTGC SEQ ID NO:111 Reverse AGGTTGAGCAGGTCTTCG SEQ ID NO:112
[0367] The natural rghR1 fragment (SEQ ID NO: 113) generated by the primers in Table 16 is 1,499 nucleotides in length. When the rghR1 gene is deleted (ΔrghR1), the fragment generated by the primers in Table 16 (SEQ ID NO: 114) is 1,097 nucleotides in length and is significantly smaller on electrophoresis. The isolate of LDN143 containing the rghR1 allele deletion (ΔrghR1; SEQ ID NO: 114) was stored as strain BF324.
[0368] For cells transformed with pRF879 (SEQ ID NO:83), the rghR2 gene locus was amplified using the forward (SEQ ID NO:115) and reverse (SEQ ID NO:116) primers listed in Table 17 below.
[0369] Table 17
[0370] Forward and reverse primer pairs
[0371] positive GAGATTGCGAGGTTTTGGCC SEQ ID NO:115 Reverse GGCATACGGCGTATTGTTCG SEQ ID NO:116
[0372] The natural rghR2 fragment (SEQ ID NO: 117) generated by the primers in Table 17 is 1,629 nucleotides in length. When the rghR2 gene is deleted (ΔrghR2), the fragment generated by the primers in Table 17 (SEQ ID NO: 118) is 1,248 nucleotides in length and is significantly smaller on electrophoresis. The isolate of LDN143 containing the ΔrghR2 locus allele (SEQ ID NO: 118) was stored as strain BF377.
[0373] For cells transformed with pRF899 (SEQ ID NO:86), the rghR2rghR1 region was amplified using the forward (SEQ ID NO:119) and reverse (SEQ ID NO:120) primers listed in Table 18 below.
[0374] Table 18
[0375] Forward and reverse primer pairs
[0376] positive ATGATATTTTCGCCGTCGGT SEQ ID NO:119 Reverse AACGATGCAGGAGCTCAATT SEQ ID NO:120
[0377] The natural rghR2-rghR1 fragment (SEQ ID NO: 121) generated from the parental strain LDN143 using the primers in Table 18 is 2,353 nucleotides in length. When the rghR2 and rghR1 genes are deleted (ΔrghR2ΔrghR1), the fragment generated by the primers in Table 18 (SEQ ID NO: 122) is 1,401 nucleotides in length and is significantly smaller on electrophoresis. Isolates of LDN143 containing the ΔrghR2ΔrghR1 allele (SEQ ID NO: 122) are stored as BF389.
[0378] For cells transformed with pRF901 (SEQ ID NO:89), the rghR2 locus was amplified using the forward (SEQ ID NO:123) and reverse (SEQ ID NO:124) primers listed in Table 19 below.
[0379] Table 19
[0380] Forward and reverse primer pairs
[0381] positive CATGACGTCTTTCCACCAGT SEQ ID NO:123 Reverse AACGATGCAGGAGCTCAATT SEQ ID NO:124
[0382] The natural rghR2 fragment (SEQ ID NO: 125) generated from the parental strain LDN143 using the primers in Table 19 was 3,265 nucleotides in length. When the rghR2, rghR1, yvzC, and 3644 genes were deleted (ΔrghR2, ΔrghR1, ΔyvzC, and Δ3644), the fragment generated by the primers in Table 19 (SEQ ID NO: 126) was 1,596 nucleotides in length and was significantly shorter on electrophoresis. Isolates of LDN143 containing the ΔrghR2, ΔrghR1, ΔyvzC, and Δ3644 alleles were stored as BF391.
[0383] Example 4
[0384] Amylase production in Bacillus strains with modified RGHR loci
[0385] To determine the effect of various rghR locus alleles on α-amylase production, the strains were grown in triplicate under standard small-scale assay conditions, as generally described in PCT Publication No. WO2018 / 156705 (which is incorporated herein by reference in its entirety). The α-amylase yield of the variants (Cytophaga species) was determined using the Bradford protein assay (Pierce) according to the manufacturer's instructions. The mean α-amylase production for each strain was thus determined and normalized to the parental strain LDN143, as shown in Table 20 below.
[0386] Table 20
[0387] Relative yield of amylase production from different RGHR locus alleles
[0388] strain relative genotype rghR locus SEQ ID Relative yield ± SEM LDN143 SEQ ID NO:127 1.00±0.10 BF314 <![CDATA[rghR2 终止 ]]> SEQ ID NO:128 1.23±0.07 BF324 ΔrghR1 SEQ ID NO:129 1.26±0.13 BF377 ΔrghR2 SEQ ID NO:130 1.62±0.08 BF389 ΔrghR2ΔrghR1 SEQ ID NO:131 1.35±0.02 BF391 ΔrghR2ΔrghR1ΔyvzCΔ3644 SEQ ID NO:132 1.30±0.02
[0389] As shown in Table 20 above, Bacillus licheniformis cells / strains with mutations in the rghR locus exhibited increased heterologous α-amylase protein production, producing approximately 23%–62% more amylase protein compared to the comparable parental cell (LDN143) (which has a wild-type rghR locus).
[0390] Example 5
[0391] Prochemin production in Bacillus strains with modified RGHR loci
[0392] As briefly stated above in Part III, the rghR locus is uniquely characterized by transcriptional control of an operon responsible for the production of the iron-scavenging pigment pulcherrimate. Pulcherrimate is known to react with extracellular iron ions to form an insoluble red pigment. This red pigment can be redissolved as a sodium salt and quantified using absorbance at 410 nm (Uffen and Canale-Parola, 1972). Briefly, ten (10) ml of culture supernatant is harvested at 4000 RPM for ten (10) minutes. The precipitate is washed twice with water. The precipitate is resuspended in one (1) ml of 1N NaOH and incubated at room temperature for ten (10) minutes to allow the insoluble pulcherrimate to be converted to soluble sodium pulcherrimate. Residual debris is removed by brief centrifugation at 14000 RPM. The absorbance at 410 nm is measured against a 1N NaOH blank control.
[0393] Table 21
[0394] Quantitative analysis of purchemin acid
[0395] strain relative genotype rghR2 locus SEQ ID NO <![CDATA[Relative to A 410 > LDN143 SEQ ID NO:127 1.0 BF314 <![CDATA[rghR2 终止 ]]> SEQ ID NO:128 0.7 BF324 ΔrghR1 SEQ ID NO:129 1.1 BF377 ΔrghR2 SEQ ID NO:130 0.5 BF389 ΔrghR2ΔrghR1 SEQ ID NO:131 1.2 BF391 ΔrghR2ΔrghR1ΔyvzCΔ3644 SEQ ID NO:132 1.1
[0396] Therefore, as shown in Table 21 above, several mutations in the rghR locus significantly reduced pramine production by about 30%-50% relative to the parent (e.g., BF314 and BF377), while several other mutations increased pramine production by about 10%-20% relative to the parent (e.g., BF324, BF389, and BF391). This indicates that mutations in the rghR locus control the biosynthesis of pramine acid.
[0397] In the production of heterologous amylase protein, the optical density (OD) of 200 μl of culture was measured at 600 nm to measure the relative biomass yield of various strains, as shown in Table 22 below.
[0398] Table 22
[0399] relative optical density
[0400]
[0401]
[0402] References
[0403] PCT Publication No. WO 1994 / 18314
[0404] PCT Publication No. WO 1999 / 19467
[0405] PCT Publication Number WO 1999 / 43794
[0406] PCT Publication No. WO 2000 / 29560
[0407] PCT Publication Number WO 2000 / 60059
[0408] PCT Publication No. WO 2004 / 011609
[0409] PCT Publication No. WO 2006 / 037483
[0410] PCT Publication No. WO 2006 / 037484
[0411] PCT Publication No. WO 2006 / 089107
[0412] PCT Publication No. WO 2008 / 112459
[0413] PCT Publication Number WO 2014 / 164777
[0414] PCT Publication Number WO 2018 / 156705
[0415] Albertini and Galizzi,Bacteriol.,162:1203-1211,1985.
[0416] Bergmeyer et al.,"Methods of Enzymatic Analysis"vol.5,Peptidases,Proteinases and their Inhibitors,Verlag Chemie,Weinheim,1984.
[0417] Botstein and Shortle,Science 229:4719,1985.
[0418] Brode et al.,“Subtilisin BPN'variants:increased hydrolytic activityon surface-bound substrates via decreased surface activity”,Biochemistry,35(10):3162-3169,1996.
[0419] Caspers et al.,“Improvement of Sec-dependent secretion of aheterologous model protein in Bacillus subtilis by saturation mutagenesis ofthe N-domain of the AmyE signal peptide”,Appl.Microbiol.Biotechnol.,86(6):1877-1885,2010.
[0420] Chang et al.,Mol.Gen.Genet.,168:11-115,1979.
[0421] Christianson et al.,Anal.Biochem.,223:119-129,1994.
[0422] Devereux et a / .,Nucl.Acid Res.,12:387-395,1984.
[0423] Earl et al.,“Ecology and genomics of Bacillus subtilis”,Trends inMicrobiology.,16(6):269-275,2008.
[0424] Ferrari et al.,"Genetics,"in Harwood et al.(ed.),Bacillus,PlenumPublishing Corp.,1989.
[0425] Fisher et.al.,Arch.Microbiol.,139:213-217,1981.
[0426] Guerot-Fleury,Gene,167:335-337,1995.
[0427] Hamoen et al.,“Controlling competence in Bacillus subtilis:sharedused of regulators”,Microbiology,149:9-17,2003.
[0428] Hamoen et al.,Genes Dev.12:1539-1550,1998.
[0429] Hampton et al.,Seroloαical Methods,A Laboratory Manual,APS Press,St.Paul,MN,1990.
[0430] Hardwood and Cutting(eds.)Molecular Biological Methods for Bacillus,John Wiley&Sons,1990.
[0431] Hayashi et al.,2006
[0432] Hayashi et al.,Mol.Microbiol.,59(6):1714-1729,2006
[0433] Higuchi et al.,Nucleic Acids Research 16:7351,1988.
[0434] Ho et al.,Gene 77:61,1989.
[0435] Hoch et al.,J.Bacteriol.,93:1925-1937,1967.
[0436] Holubova,Folia Microbiol.,30:97,1985.
[0437] Hopwood,The Isolation of Mutants in Methods in Microbiology(J.R.Norris and D.W.Ribbons,eds.)pp 363-433,Academic Press,New York,1970.
[0438] Horton et al.,Gene 77:61,1989.
[0439] Hsia et al.,Anal Biochem.,242:221-227,1999.
[0440] Iglesias and Trautner,Molecular General Genetics 189:73-76,1983.
[0441] Jensen et al.,“Cell-associated degradation affects the yield ofsecreted engineered and heterologous proteins in the Bacillus subtilisexpression system”Microbiology,146(Pt 10:2583-2594,2000.
[0442] Liu and Zuber,1998,
[0443] Lo et al.,Proceedings of the National Academy of Sciences USA 81:2285,1985.
[0444] Maddox et al.,J.Exp.Med.,158:1211,1983.
[0445] Mann et al.,Current Microbiol.,13:131-135,1986.
[0446] McDonald,J.Gen.Microbiol.,130:203,1984.
[0447] MacDonald,“Biosynthesis of pulcherriminic acid”,Biochem.J.,96:533-538,1965.
[0448] Needleman and Wunsch,J.Mol.Biol.,48:443,1970.
[0449] Ogura&Fujita,FEMS Microbiol Lett.,268(1):73-80.2007.
[0450] Olempska-Beer et al.,“Food-processing enzymes from recombinantmicroorganisms--a review”’Regul.Toxicol.Pharmacol.,45(2):144-158,2006.
[0451] Palmeros et al.,Gene 247:255-264,2000.
[0452] Parish and Stoker,FEMS Microbiology Letters 154:151-157,1997.
[0453] Pearson and Lipman,Proc.Natl.Acad.Sci.USA 85:2444,1988.
[0454] Perego,1993,In A.L.Sonneshein,J.A.Hoch,and R.Losick,editors,Bacillussubtilis and Other Gram-Positive Bacteria,Chapter 42,American Society ofMicrobiology,Washington,D.C.
[0455] Raul et al.,“Production and partial purification of alpha amylasefrom Bacillus subtilis(MTCC 121)using solid state fermentation”,BiochemistryResearch International,2014.
[0456] Sarkar and Sommer,BioTechniques 8:404,1990.
[0457] Saunders et al.,J.Bacteriol.,157:718-726,1984.
[0458] Shimada,Meth.Mol.Biol.57:157;1996
[0459] Smith and Waterman,Adv.Appl.Math.,2:482,1981.
[0460] Smith et al.,Appl.Env.Microbiol.,51:634 1986.
[0461] Stahl and Ferrari,J.Bacteriol.,158:411-418,1984.
[0462] Stahl et al,J.Bacteriol.,158:411-418,1984.
[0463] Tarkinen,et al,J.Biol.Chem.258:1007-1013,1983.
[0464] Trieu-Cuot et al.,Gene,23:331-341,1983.
[0465] Uffen and Canale-Parola,“Synthesis of pulcherriminic acid by Bacillussubtilis”,J.Bacteriol 111(1):86-93,1972.
[0466] Van Dijl and Hecker,“Bacillus subtilis:from soil bacterium to super-secreting cell factory”,Microbial Cell Factories,12(3).2013.
[0467] Vorobjeva et al.,FEMS Microbiol.Lett.,7:261-263,1980.
[0468] Ward,"Proteinases,"in Fogarty(ed.).,Microbial Enzymes andBiotechnology.Applied Science,London,pp 251-317,1983.
[0469] Wells et al.,Nucleic Acids Res.11:7911-7925,1983.
[0470] Westers et al.,“Bacillus subtilis as cell factory for pharmaceuticalproteins:a biotechnological approach to optimize the host organism”,Biochimica et Biophysica Acta.,1694:299-310,2004.
[0471] Yang et al,J.Bacteriol.,160:15-21,1984.
[0472] Yang et al.,Nucleic Acids Res.11:237-249,1983.
[0473] Youngman et al.,Proc.Natl.Acad.Sci.USA 80:2305-2309,1983.
Claims
1. A modified Bacillus licheniformis cell derived from a parent Bacillus licheniformis cell comprising a native rghR2 chromosomal locus, wherein the modified cell comprises a genetically modified rghR2 gene, wherein the modified cell produces a reduced amount of pulcherriminic acid relative to the parent cell cultured under the same conditions, wherein the nucleotide sequence of the genetically modified rghR2 gene is as shown in SEQ ID NO: 128 or SEQ ID NO:
130.
2. The modified Bacillus licheniformis cell of claim 1, further comprising at least one modification selected from the group consisting of: (a) a modified rghR1 gene, (b) a modified rghR1 gene, a modified yvzC gene, and a modified Bli3644 gene, wherein the modified cell produces an increased amount of a protein of interest relative to a parent cell cultured under the same conditions.
3. The modified Bacillus licheniformis cell of claim 2, wherein the modified rghR1 gene comprises a genetic modification that causes a mutation, disruption, partial deletion, or complete deletion of the encoded RghR1 protein.
4. The modified Bacillus licheniformis cell of claim 2, wherein the modified rghR1 gene comprises a genetic modification that mutates, disrupts, partially deletes, or completely deletes the 5′-UTR sequence and / or the 3′-UTR sequence of the rghR1 gene, wherein the modified rghR1 gene does not express the encoded RghR1 protein.
5. The modified Bacillus licheniformis cell of claim 2, wherein the modified rghR1, yvzC, and Bli3644 genes comprise genetic modifications that cause mutation, disruption, partial deletion, or complete deletion of the encoded RghR1 protein, the encoded YvzC protein, and the encoded Bli3644 protein, respectively.
6. The modified Bacillus licheniformis cell of claim 2, wherein the modified rghR1, yvzC, and Bli3644 genes comprise genetic modifications that cause the 5′-UTR sequence and / or 3′-UTR of the rghR1 gene, the 5′-UTR sequence and / or 3′-UTR of the yvzC gene, and the 5′-UTR sequence and / or 3′-UTR of the Bli3644 gene to be mutated, disrupted, partially deleted, or completely deleted, wherein, respectively, the modified rghR1 gene does not express the encoded RghR1 protein, the modified yvzC gene does not express the encoded YvzC protein, and the modified Bli3644 gene does not express the encoded Bli3644 protein.
7. The modified Bacillus licheniformis cell of claim 1 or 2, comprising one or more expression cassettes encoding a protein of interest.
8. The modified Bacillus licheniformis cell of claim 7, wherein the one or more expression cassettes encode an amylase protein.
9. The modified Bacillus licheniformis cell of claim 1 or 2, wherein the modified cell produces an increased amount of a protein of interest relative to a parent cell.
10. A method for producing increased amounts of a protein of interest in a modified Bacillus licheniformis cell, the method comprising: (a) obtaining a parent Bacillus licheniformis cell and genetically modifying at least one gene of the rghR locus selected from the group consisting of: (i) the rghR1 gene, (ii) the rghR2 gene, (iii) the yvzC gene, and (iv) the Bli3644 gene, or a combination thereof, and (b) fermenting the modified cells under conditions suitable for production of the protein of interest, wherein the modified cell comprises a genetically modified rghR2 gene, the nucleotide sequence of the genetically modified rghR2 gene being as shown in SEQ ID NO: 128 or SEQ ID NO: 130, The modified cells produce an increased amount of the protein of interest relative to parent cells cultured under the same conditions.
11. The method of claim 10, wherein the modified rghR1 gene comprises a genetic modification that causes a mutation, disruption, partial deletion, or complete deletion of the encoded RghR1 protein, and / or the modified rghR1 gene comprises a genetic modification that causes a mutation, disruption, partial deletion, or complete deletion of the 5′-UTR sequence and / or the 3′-UTR sequence of the rghR1 gene, wherein the modified rghR1 gene does not express the encoded RghR1 protein.
12. The method of claim 10, wherein the modified yvzC gene comprises a genetic modification that causes the encoded YvzC protein to mutate, disrupt, partially delete, or completely delete, and / or the modified yvzC gene comprises a genetic modification that causes the 5′-UTR sequence and / or 3′-UTR of the yvzC gene to mutate, disrupt, partially delete, or completely delete, wherein the modified yvzC gene does not express the encoded YvzC protein.
13. The method of claim 10, wherein the modified Bli3644 gene comprises a genetic modification that causes the encoded Bli3644 protein to mutate, disrupt, partially delete, or completely delete, and / or the modified Bli3644 gene comprises a genetic modification that causes the 5′-UTR sequence and / or 3′-UTR of the Bli3644 gene to mutate, disrupt, partially delete, or completely delete, wherein the modified Bli3644 gene does not express the encoded Bli3644 protein.
14. The method of claim 10, wherein the cells comprise one or more expression cassettes encoding a protein of interest.
15. The method of claim 14, wherein the one or more expression cassettes encode an amylase protein.
16. The method of claim 10, wherein the modified cells produce reduced amounts of pulcherriminic acid.
17. A method for producing a protein of interest in a modified Bacillus licheniformis cell, wherein the modified cell produces reduced amounts of pulcherriminic acid during fermentation, the method comprising: (a) obtaining a parent Bacillus licheniformis cell and genetically modifying the rghR2 gene of the rghR locus, and (b) fermenting the modified cells under conditions suitable for production of the protein of interest, wherein the modified cell comprises a genetically modified rghR2 gene, the nucleotide sequence of the genetically modified rghR2 gene being as shown in SEQ ID NO: 128 or SEQ ID NO: 130, wherein the modified cells produce reduced pulcherrimonic acid relative to parent cells cultured under the same conditions.
18. The method of claim 17, wherein the cells comprise one or more expression cassettes encoding a protein of interest.
19. The method of claim 18, wherein the one or more expression cassettes encode an amylase protein.
20. The method of claim 18, wherein the modified cell produces an increased amount of the protein of interest relative to a parent cell cultured under the same conditions.
Citation Information
Patent Citations
Bacillus transformation, transformants and mutant libraries
US20060199222A1
NOVEL HYPERTHERMOSTABLE $g(a)-AMYLASE
WO1990011352A1
Oxidatively stable alpha-amylase
WO1994018314A1
$g(a)-AMYLASE MUTANTS
WO1999019467A1
Maltogenic alpha-amylase variants
WO1999043794A1