Kit and analysis method for detecting the copy number of human motor neuron survival gene SMN1

Abstract

The present invention discloses a kit and an analysis method for detecting the copy number of the survival gene SMN1 of human motor neurons. The present invention establishes an inert multiplex PCR reaction system by controlling the concentration of the core raw material primers in the PCR reaction. Under the premise of the limit primer concentration, the primers are completely consumed after the PCR amplification is completed. The normalized melting curve analysis of the internal reference gene is combined to achieve accurate quantification of the copy number of the SMN1 gene in exons 7 and 8; at the same time, different pathogenic mutants existing in the SMN1 gene are detected by ARMS-PCR combined with the fluorescent dye melting curve method, and the corresponding gene mutation site can be realized by analyzing the ΔTm value. The detection method is simple to operate, has high detection accuracy, short time consumption and low detection cost, and is suitable for the detection of carriers of the SMA pathogenic gene SMN1 in a large population. While detecting the variation of the gene copy number, it can simultaneously realize the SMA patients caused by gene mutation, and the detection coverage is significantly improved, effectively avoiding missed detection.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a kit and an analysis method for detecting the copy number of human motor neuron survival gene SMN1. Background Art

[0002] Spinal muscular atrophy (SMA) is an autosomal recessive genetic disease that causes progressive, symmetrical proximal limb muscle weakness and atrophy due to degeneration of the motor neurons of the anterior horn cells of the spinal cord. The carrier rate and incidence rate are not much different among different populations. The incidence rate in newborns is about 1 / 10000 to 1 / 6000, and the carrier frequency is about 1 / 50 to 1 / 40. According to the age of onset, motor milestones and the degree of disease progression, SMA is divided into five types: type 0, type I (OMIM: 253300), type II (OMIM: 253550), type III (OMIM: 253400) and type IV (OMIM: 271150).

[0003] The main pathogenic gene of SMA is located in the 5q11.2-13.3 region of chromosome 5. The region as a whole presents a huge inverted repeat structure with a complex structure, which makes it easy for non-allelic homologous recombination to occur in the region, resulting in abnormalities such as gene deletion or duplication. Studies have found that there are two highly homologous genes in the SMN gene, named survival motor neuron (SMN), namely SMN1 on the telomeric side and SMN2 on the centromere side. The loss of the SMN1 gene is the main cause of spinal muscular atrophy, and the copy number of the SMN2 gene is related to the severity of the clinical manifestations of SMA. Although the SMN2 gene is highly homologous to the SMN1 gene, with only a difference of 5 bases, SMN1 can express stable and complete functional SMN protein, while most of the products of SMN2 transcription are not properly spliced, and only about 10% of the mRNA is correctly spliced ​​and translated into SMN protein with normal activity. Studies have shown that about 95% of SMA patients have homozygous deletion of SMN1 gene in exon 7, and another 5% of SMA patients have heterozygous deletion of SMN1 gene in exon 7, but pathogenic mutations or other unknown pathogenic causes appear on the only remaining SMN1 copy. Clinical symptoms and other technical means such as Sanger sequencing are required to confirm whether they have SMA. Due to the existence of the highly homologous and long SMN2 gene, conventional PCR combined with Sanger sequencing is difficult to avoid interference from the SMN2 gene, which brings many difficulties to the detection of point mutations in this gene.

[0004] At present, the main detection methods for SMN1 gene copy number detection in clinical practice are: polymerase chain reaction restriction fragment length polymorphism analysis (PCR-RFLP), denaturing high performance liquid chromatography (PCR-DHPLC), multiple ligation probe amplification (MLPA), real-time fluorescence quantitative PCR, digital PCR, etc. PCR-RFLP can only be used for qualitative analysis of patients with homozygous deletion of exon 7 of SMN1 gene (i.e., 0 copies), and cannot detect carriers of heterozygous deletion (i.e., single copy), and the technology itself has the problem of incomplete enzyme cutting leading to misjudgment; PCR-DHLPC method and MLPA method can be used to detect homozygous deletion patients and heterozygous deletion carriers, and MLPA method can realize quantitative analysis of 0 copies, single copies, two copies, three copies and four copies of the gene, but the operation is complicated, the throughput is low, the time is long, specific instruments are required and the price is expensive, so it is difficult to be widely promoted in actual application. In addition, approximately 5% of SMA patients or carriers have SMN1 gene point mutations, and quantitative analysis of gene copy number alone cannot effectively confirm the diagnosis of related diseases, leading to misdiagnosis or missed diagnosis.

[0005] Some prior public technologies limit the concentration of dNTPs and / or polymerase to a lower level to construct a competitive amplification mechanism between target genes and reference genes in a multiplex PCR reaction system. After the entire PCR amplification test is completed, the dNTPs in the reaction system are completely consumed, so that the initial concentration of the target gene and reference gene templates is consistent with the corresponding ratio of the concentration of the final reaction product after the PCR amplification is completed, and a competitive PCR reaction system with a consistent double amplification efficiency of the target gene and the reference gene is established, thereby achieving accurate quantification of the number of copies of the SMN1 gene in exons 7 and 8, overcoming the problems of low detection accuracy, complex operation, and high detection cost in the prior art. However, since dNTPs are difficult to detect quantitatively, in the actual production and quality control process, it is necessary to pay a high cost to detect and control the concentration of dNTPs, which brings many inconveniences to the production and quality control of enterprises. Summary of the invention

[0006] The purpose of the present invention is to provide a kit and an analysis method for detecting the copy number of the human motor neuron survival gene SMN1 in order to solve the deficiencies of the prior art.

[0007] The first inventive object of the present invention is to provide a kit for detecting the copy number of human motor neuron survival gene SMN1, and the technical scheme adopted is as follows: a kit for detecting the copy number of human motor neuron survival gene SMN1, comprising SMN1-7 main reaction solution and SMN1-8 main reaction solution, wherein the SMN1-7 main reaction solution comprises SMN1-7FP primers with a concentration range of 10nM to 75nM, and SMN1-7RP primers with a concentration range of 10nM to 75nM, and the SMN1-8 main reaction solution comprises SMN1-8FP primers with a concentration range of 10nM to 75nM, and SMN1-8RP primers with a concentration range of 10nM to 75nM.

[0008] Furthermore, the SMN1-7 main reaction solution also contains CFTR-FP primers in the concentration range of 10nM to 75nM, and CFTR-RP primers in the concentration range of 10nM to 75nM; the SMN1-8 main reaction solution also contains TPGS2-FP primers in the concentration range of 10nM to 75nM, and TPGS2-RP primers in the concentration range of 10nM to 75nM.

[0009] Preferably, in the SMN1-7 main reaction solution, the concentration range of SMN1-7FP primer is 20nM to 30nM, and the concentration range of SMN1-7RP primer is 20nM to 30nM; in the SMN1-8 main reaction solution, the concentration range of SMN1-8FP primer is 20nM to 30nM, and the concentration range of SMN1-7RP primer is 20nM to 30nM.

[0010] Preferably, the SMN1-7 main reaction solution further comprises a CFTR-FP primer in a concentration range of 20nM to 30nM, and a CFTR-RP primer in a concentration range of 20nM to 30nM; the SMN1-8 main reaction solution further comprises a TPGS2-FP primer in a concentration range of 20nM to 30nM, and a TPGS2-RP primer in a concentration range of 20nM to 30nM.

[0011] Furthermore, the primer sequences contained in the above SMN1-7 main reaction solution are shown in Table 1:

[0012] Table 1 Primer sequences in the SMN1-7 main reaction solution

[0013] Primer name Sequence (5'-3') SEQ ID NO: SMN1-7FP TCCTTTATTTTCCTTACAGGGTTT 1 SMN1-7RP CTTCCTTCTTTTTGATTTTGTCTG 2 CFTR-FP TTGTGATTACCTCAGAAATGAT 3 CFTR-RP ATTGCTTCTTCCCAGCAGT 4

[0014] Furthermore, the primer sequences contained in the above SMN1-8 main reaction solution are shown in Table 2:

[0015] Table 2 Primer sequences in the SMN1-8 main reaction solution

[0016] Primer name Sequence (5'-3') SEQ ID NO: SMN1-8FP TAATAACCAAATGCAATGTGAA 5 SMN1-8RP CTCCCACCCCACCC 6 TPGS2-FP CATCATTCCACTGGGAAG 7 TPGS2-RP CAGAGTGGGTGCATTAGG 8

[0017] Furthermore, the SMN1-7 main reaction solution and / or the SMN1-8 main reaction solution further comprises 35-50 mM Tris, 2.5-3.0 mM MgCl2, 300-500 mg / L BSA, 100-200 μM dNTPs, 20-50×Syto 9 dye and purified water.

[0018] Further, the main components of the SMN1-7 reaction solution are 35-50 mM Tris, 2.5-3.0 mM MgCl2, 300-500 mg / L BSA, 100-200 μM dNTPs, 20-30 nM SMN1-7FP, 20-30 nM SMN1-7RP, 20-30 nM CFTR-FP, 20-30 nM CFTR-RP, 20-50×Syto 9 dye, and purified water. The present invention controls the concentration of primers to form a restricted unsaturated PCR amplification detection reaction system, thereby ensuring that the primers in the reaction system are completely consumed after the PCR amplification is completed.

[0019] Further, the main components of the SMN1-8 reaction solution are 35-50 mM Tris, 2.5-3.0 mM MgCl2, 300-500 mg / L BSA, 100-200 μM dNTPs, 20-30 nM SMN1-8 FP, 20-30 nM SMN1-8 RP, 20-30 nM TPGS2-FP, 20-30 nM TPGS2-RP, 20-50×Syto 9 dye, and purified water. Accordingly, the present invention controls the concentration of primers to form a restricted unsaturated PCR amplification detection reaction system, thereby ensuring that the primers in the reaction system are completely consumed after the PCR amplification is completed.

[0020] Furthermore, the kit of the present invention includes SMN1-7 main reaction solution, SMN1-8 main reaction solution, SMN1-SNP mutation site main reaction solution, SMN1 enzyme mixture, 0 copy number quality control, SMN1-7 single copy quality control, SMN1-7 two copy standard, SMN1-8 single copy quality control, SMN1-8 two copy standard, SMN1-SNP mutant control and SMN1-SNP wild type control.

[0021] The second invention object of the present invention is to provide a kit for detecting the copy number and gene base mutation of the human motor neuron survival gene SMN1 in response to the problem of missed diagnosis or misdiagnosis in the current gene copy number quantitative analysis method. The technical scheme adopted is as follows: comprising the above-mentioned kit, the kit also comprising an SMN1-SNP mutation site main reaction solution, and the mutation site main reaction solution comprises a mutation site primer with a concentration range of 50 to 100 nM.

[0022] Furthermore, the mutation site primers include c.863G>T-RP primer pair, c.400G>A primer pair, c.689C>T primer pair, c.683T>A primer pair and c.22dupA primer pair.

[0023] Further, the main reaction solution of the SMN1-SNP mutation site is mainly composed of 35-50mM Tris, 2.5-3.0mM MgCl2, 300-500mg / L BSA, 2-5% DMSO, 100-200μM dNTPs, 50-75nM c.400G>A-FP, 50-75nM c.400G>A-RP, 75-100nM c.22dupA-FP, 75-100nM c.22dupA-RP, 75-100nM c.863G>T-FP, 75-100nM c.863G>T-RP, 50-75nM c.683T>A-FP, 50-75nM c.683T>A-RP, 75-100nM c.689C>T-FP, 75~100nM c.689C>T-RP, 250~300nM CFTR-2FP, 250~300nM CFTR-2RP, 20~50×Syto 9 dye, purified water.

[0024] The primer sequences contained in the above SMN1-SNP mutation site main reaction solution are shown in Table 3:

[0025] Table 3 Primer sequences in the main reaction solution of SMN1-SNP mutation sites

[0026]

[0027]

[0028] The above-mentioned SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18 primers were designed using the ARMS-PCR primer design principle, and the difference between the Tm value of different target amplicon and the Tm value of the internal reference gene amplicon was used to determine the specific mutation site targeting sequence.

[0029] Furthermore, the above-mentioned kit includes SMN1-7 main reaction solution, SMN1-8 main reaction solution, SMN1-SNP mutation site main reaction solution, SMN1 enzyme mixture, 0 copy number quality control, SMN1-7 single copy quality control, SMN1-7 two copy standard, SMN1-8 single copy quality control, SMN1-8 two copy standard, SMN1-SNP mutant control and SMN1-SNP wild type control.

[0030] In the above:

[0031] The SMN1 enzyme mixture mainly consists of 0.8-1U / Test DNA polymerase and 0.2-0.25μL / Test DNA polymerase antibody, wherein the DNA polymerase concentration needs to be controlled within the range of 0.8-1U.

[0032] The 0-copy quality control product is an artificially synthesized plasmid containing CFTR and TPGS2 gene fragment sequences.

[0033] The SMN1-7 single copy quality control product is genomic DNA extracted from the GM03815 cell line, in which the exon 7 SMN1 gene is a single copy with a concentration of 15-25 ng / μL.

[0034] The SMN1-7 two-copy standard is genomic DNA extracted from the HG01701 cell line, which contains two copies of the exon 7 SMN1 gene at a concentration of 15 to 25 ng / μL.

[0035] The SMN1-8 single copy quality control product is genomic DNA extracted from the GM03815 cell line, which has two single copies of the exon 8 SMN1 gene with a concentration of 15-25 ng / μL.

[0036] The SMN1-8 two-copy standard is genomic DNA extracted from the HG01701 cell line, which contains two copies of the exon 8 SMN1 gene at a concentration of 15 to 25 ng / μL.

[0037] The SMN1-SNP mutant control is an artificially constructed plasmid containing five SNP site sequences: c.400G>A, c.22dupA, c.863G>T, c.683T>A, and c.689C>T.

[0038] The SMN1-SNP wild-type control was normal human genomic DNA with a concentration of 15-25 ng / μL.

[0039] The third inventive object of the present invention is to provide a method for quantitatively analyzing the copy number of the human motor neuron survival gene SMN1, and the technical scheme adopted is as follows: adding the solution to be analyzed to the above-mentioned kit, amplifying the nucleic acid fragments in the solution to be analyzed to obtain more target nucleic acid fragments and reference nucleic acid fragments; melting the results after a preset number of cycles of amplification to obtain the unprocessed fluorescence and temperature relationship, removing the background noise in the fluorescence and temperature, obtaining the melting peaks of each target nucleic acid and reference nucleic acid, normalizing the melting peaks of the reference nucleic acid, obtaining the peak height difference of the melting peak of each target nucleic acid relative to the reference nucleic acid, and using the differential height to distinguish different target nucleic acid sequences, thereby obtaining the corresponding copy number quantitative analysis results.

[0040] Furthermore, the present invention also provides an analysis method associated with competitive amplification, amplifying SMN1-7 genes, SMN1-8 genes and a reference gene contained in a sample in a solution, wherein the solution comprises: a primer pair for amplifying the SMN1-7 genes and SMN1-8 genes, the SMN1-7 primer pair having a concentration range of 10nM to 75nM, and the SMN1-8 primer pair having a concentration range of 10nM to 75nM; performing amplification for a predetermined number of cycles, performing melting curve analysis after completion of amplification, comparing the melting curves of the amplified SMN1-7 genes and SMN1-8 genes with the melting curves of the reference genes, and obtaining quantitative results of the original copy numbers of the SMN1-7 genes and SMN1-8 genes.

[0041] Furthermore, the concentration range of the SMN1-7 primer pair is 20nM to 30nM, and the concentration range of the SMN1-8 primer pair is 20nM to 30nM.

[0042] The present invention establishes an inert multiplex PCR reaction system by controlling the concentration of the core raw material primers in the PCR reaction. Under the premise of the extreme primer concentration, the primers are completely consumed after the PCR amplification is completed. Combined with the normalized melting curve analysis of the internal reference gene, the accurate quantification of the SMN1 gene copy number of exons 7 and 8 is achieved; at the same time, different pathogenic mutants of the SMN1 gene are detected by ARMS-PCR combined with the fluorescent dye melting curve method, and the corresponding gene mutation site can be realized by analyzing the ΔTm value. The detection method is simple to operate, has high detection accuracy, short time consumption and low detection cost, and is suitable for the detection of carriers of the SMA pathogenic gene SMN1 in a large population. While detecting the variation of the gene copy number, it can simultaneously realize the SMA patients caused by gene mutation, and the detection coverage is significantly improved, effectively avoiding missed detection.

[0043] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0044] 1. The prior art utilizes conventional PCR melting curve methods, which can only realize the detection and analysis of specific amplicons, but cannot realize the analysis of gene copy number variation. The present invention utilizes the construction of a multiplex PCR detection system, and limits the concentration of PCR primers used, so that after the PCR amplification is completed, the primers in the reaction system are completely consumed, so as to achieve the consistency between the relative concentration ratio of the target gene and the internal reference gene amplicon final product and the initial concentration ratio; wherein the internal reference gene selects a housekeeping gene with two copies in human genomic DNA, and the melting peaks of the internal reference gene of different test samples are normalized to a uniform height by analysis software, and the melting peaks of target genes of different samples to be tested are proportionally adjusted, and samples of target genes with different copy numbers will form melting peaks of different heights, thereby realizing the quantitative analysis of the SMN1 gene copy number of different samples;

[0045] 2. The present invention controls the concentration of the core material primers in the PCR reaction to 10-75 nM (the concentration of the primers in the conventional PCR reaction system is 200-500 nM), so that an unsaturated competitive relationship is formed in the constructed multiple PCR detection system, the amplification efficiency of the target gene and the internal reference gene primer pairs are designed to be close, and the entire PCR detection system is in an inert amplification state, which can not only ensure the specificity of the detection, but also maintain a dynamic equilibrium amplification process of the target gene and the internal reference gene;

[0046] 3. Compared with the existing method of controlling the concentration of dNTPs, the method of controlling the concentration of core material primers of the present invention has the technical advantage that, while achieving similar technical effects, the core material primers and their concentrations can be quantitatively analyzed by simple detection methods, which is helpful for the production and quality control process of enterprises, and thus facilitates the production of enterprise products and the implementation of quality control, effectively reducing the operating costs of enterprises and increasing the product profits of enterprises;

[0047] 4. For the detection of SNP sites in the SMN1 gene, the present invention designs ARMS-PCR primers and establishes an inert PCR amplification reaction system, which can effectively realize that mutants can be amplified by PCR, while wild types cannot be amplified. Then, by designing the difference between the Tm value of different mutant amplicons and the Tm value of the corresponding internal reference gene amplicon, a ΔTm value is obtained. The size of the ΔTm value can be used to detect different mutation sites in the SMN1 gene. This method can significantly shorten the cycle of detecting mutation sites by first-generation sequencing after nested PCR and avoid cumbersome detection procedures;

[0048] 5. The present invention provides a detection method and kit with high specificity, convenient operation, high accuracy, simplicity and economy, which are used for the combined detection of SMN1 copy number quantification and gene base mutation. The present invention constructs a multiplex PCR detection system based on limiting primer concentration, and establishes a new copy number variation detection method in combination with melting curve analysis. The method integrates unsaturated PCR, saturated dye, ARMS primers, and can achieve the distinction between different copy numbers by optimizing conditions such as primer concentration and PCR amplification cycle number; at the same time, the distinction between single base differences can be achieved by the Tm value of the amplified product. ; The present invention has developed a single-tube combined detection method for quantifying 5 common SMN1 gene hotspot mutations in the Chinese population (c.863G>T, c.400G>A, c.689C>T, c.683T>A, c.22dupA) and SMN1 gene copy number. The ARMS primer combined with the Tm value of the melting curve can quickly eliminate the interference of the SMN2 gene, thereby realizing the rapid and effective genetic diagnosis of SMA disease, avoiding the tedious work and easy cross-contamination caused by repeated testing, and requiring an extremely low sample amount, with simple and economical operation and rapid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 It is a schematic diagram of the basic process of realizing copy number analysis using the kit of the present invention;

[0050] Figure 2 is a schematic diagram of a process for copy number analysis using the kit of the present invention;

[0051] Figure 3 This is the result of the SMN1 gene copy number test in exon 7 of 45 samples;

[0052] Figure 4 This is the result of the SMN1 gene copy number test in exon 8 of 45 samples;

[0053] Figure 5 This is a graph showing the results of detecting the copy number of the SMN1 gene in exon 7 when the core material primer concentration is 10 nM in Example 3;

[0054] Figure 6 This is a graph showing the results of detecting the copy number of the SMN1 gene in exon 7 when the core material primer concentration is 20 nM in Example 3;

[0055] Figure 7 This is a graph showing the results of detecting the copy number of the SMN1 gene in exon 7 when the core material primer concentration is 30 nM in Example 3;

[0056] Figure 8 This is a graph showing the results of detecting the copy number of the SMN1 gene in exon 7 when the core material primer concentration is 50 nM in Example 3;

[0057] Fig. 9 This is a graph showing the results of detecting the copy number of the SMN1 gene in exon 7 when the core material primer concentration is 75 nM in Example 3;

[0058] Fig.10 This is a graph showing the results of detecting the copy number of the SMN1 gene in exon 7 when the core material primer concentration in Example 3 is 100 nM. DETAILED DESCRIPTION

[0059] The present invention will be described in detail below in conjunction with the accompanying drawings.

[0060] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0061] Example 1

[0062] Combination Figure 1 The steps are described below. The method for detecting the copy number of the SMN1 gene causing spinal muscular atrophy based on the unsaturated PCR melting curve analysis technology constructed based on the limiting primer concentration includes the following steps:

[0063] Extract human genomic DNA, and the final concentration measured by ultraviolet spectrophotometer is 10-120 ng / μL (here, the solution containing the DNA template to be amplified can be obtained by traditional extraction, or the solution containing the DNA template can be obtained by direct extraction of blood or the like using a direct extraction reagent);

[0064] The PCR reaction system is 20 μL, and the components are prepared as follows:

[0065] SMN1 gene exon 7 detection system:

[0066] SMN1-7 main reaction solution 17.75 μL

[0067] SMN1 enzyme mixture 0.25μL

[0068] DNA 2 μL

[0069] SMN1 gene exon 8 detection system:

[0070] SMN1-8 main reaction solution 17.75 μL

[0071] SMN1 enzyme mixture 0.25μL

[0072] DNA 2 μL

[0073] The above-mentioned PCR reaction system is configured into the kit of the present invention, the extracted sample or the template to be amplified is mixed with the reagents in the kit, and then a PCR amplification step such as temperature cycling is performed. During the PCR detection process, the sample DNA, quality control products, and standard products need to be tested on the machine simultaneously.

[0074] The PCR reaction conditions are shown in Table 4 below:

[0075] Table 4 PCR reaction conditions

[0076]

[0077]

[0078] Select SYBR Green I detection channel as the fluorescence detection channel.

[0079] After the PCR test is completed, the original data is imported into the multiple melting curve data analysis software (here it can be the processing system of the PCR instrument itself or an independent terminal device capable of data processing and analysis) to analyze the test results. The analysis of the gene copy number of exons 7 and 8 of the SMN1 gene adopts the melting peak normalization processing technology. By quantifying the peak height value of the melting curve, the peak height P value and the peak height ratio R value of the target gene melting peak are calculated. The original copy number of the SMN1 gene is determined according to the size of the P value and the R value. See Table 5 below:

[0080] Table 5 Copy number quantitative data analysis results judgment table

[0081]

[0082]

[0083] Among them, the P value is the peak height of the melting peak after normalization processing by the melting curve analysis software, and the R value is the peak height of the melting peak of the sample to be tested / the peak height of the melting peak of the two copies of the standard, so that the accuracy of the copy number results can be obtained.

[0084] Example 2

[0085] Example 2 is the same as Example 1, except that a combined detection of the copy number of the human motor neuron survival gene SMN1 and the gene base mutation is performed, which comprises the following steps:

[0086] Human genomic DNA was extracted, and the final concentration was 10-120 ng / μL as measured by UV spectrophotometer;

[0087] The PCR reaction system is 20 μL, and the components are prepared as follows:

[0088] SMN1 gene exon 7 detection system:

[0089] SMN1-7 main reaction solution 17.75 μL

[0090] SMN1 enzyme mixture 0.25μL

[0091] DNA 2 μL

[0092] SMN1 gene exon 8 detection system:

[0093] SMN1-8 main reaction solution 17.75 μL

[0094] SMN1 enzyme mixture 0.25μL

[0095] DNA 2 μL

[0096] SMN1 gene SNP mutation site detection system:

[0097] SMN1-SNP mutation site master reaction solution 17.75 μL

[0098] SMN1 enzyme mixture 0.25μL

[0099] DNA 2 μL

[0100] During the PCR test, sample DNA, quality control products, standard products, SMN1-SNP mutant control products and SMN1-SNP wild-type control products need to be tested simultaneously on the machine. The PCR reaction conditions are shown in Table 4 above.

[0101] After the PCR test is completed, the original data is imported into the multiple melting curve data analysis software (here it can be the processing system of the PCR instrument itself or an independent terminal device capable of data processing and analysis) to analyze the test results. The melting peak normalization processing technology is used to analyze the gene copy number of exons 7 and 8 of the SMN1 gene. By quantifying the peak height value of the melting curve, the peak height P value and the peak height ratio R value of the target gene melting peak are calculated. The original copy number of the SMN1 gene is determined according to the size of the P value and the R value, see Table 5 above.

[0102] The detection results of the mutation sites of the SMN1 gene were interpreted using the difference ΔTm value between the Tm value of the internal reference gene and the SNP site melting curve. The specific interpretation criteria are shown in Table 6:

[0103] Table 6 SMN1 gene mutation site result judgment criteria

[0104] SNP loci ΔTm value c.863G>T 3.82±0.5℃ c.400G>A 5.57±0.5℃ c.689C>T 8.63±0.5℃ c.683T>A 11.46±0.5℃ c.22dupA 14.01±0.5℃

[0105] Other parameter conditions and analysis process of Example 1 and Example 2

[0106] 1. Preparation and concentration determination of sample genomic DNA

[0107] Sample sources: human blood samples, dried blood spots, oral swabs and amniotic fluid; genomic DNA was prepared using nucleic acid extraction or purification reagents (magnetic bead method), and the extracted DNA was measured using Nanodrop2000C to determine the concentration and purity of the extracted DNA. The concentration was required to be no less than 10 ng / μL, and the purity OD260 / OD280 was within the range of 1.7 to 2.0.

[0108] 2. Primer screening and concentration determination

[0109] 2.1. When constructing the quantitative analysis detection system for the copy number of exons 7 and 8 of the SMN1 gene, the orthogonal test method was used to simultaneously amplify the target gene sequence and the internal reference gene sequence in the same tube. The primers were screened through a large number of experimental comparisons. The experimental results showed that the left and right translation or length change of the primer sequence would produce a large difference in the amplification efficiency of the two. If the primer is too long, non-specific products will occur. If it is too short, the primer annealing temperature will be low and the amplification sensitivity will be reduced, or the amplification efficiency of the target gene and the internal reference gene will be greatly different. After a large number of experimental optimizations, the primer combination was finally determined as shown in Tables 1 and 2, among which SEQ ID NO: 1 and SEQ ID NO: 5 are locked nucleic acid modified primers, and the primers have good amplification efficiency and good specificity.

[0110] 2.2. When constructing the SMN1-SNP mutation site detection system, the ARMS-PCR method was used to design specific primers, and the detection specificity was improved by introducing mismatched bases. At the same time, the differences in the Tm values ​​of different amplicons were designed to ensure that the difference in the Tm values ​​of adjacent amplicons was above 1.5°C. Different amplicons could effectively form specific melting peaks through melting analysis, thereby realizing the detection of multiple targets in a one-tube PCR system.

[0111] 3. Construction of PCR reaction system

[0112] 3.1. When constructing the quantitative analysis detection system for the copy number of exon 7 and 8 of the SMN1 gene, the concentration of the target gene amplification primer and the internal reference gene was selected to be 20-30 nM, the final concentration of dNTPs was selected to be 100-200 μM, the final concentration of Tris was selected to be 35-50 mM, the final concentration of MgCl2 was selected to be 2.5-3 mM, and the final concentration of BSA was selected to be 300-500 mg / L. The final concentration of Syto9 dye was selected to be 20-50×, and the final concentration of DNA polymerase was selected to be 0.8-1 U / Test. Using the orthogonal test method, after a large number of experimental tests and comparisons, the optimal PCR reaction system was finally determined as shown in Table 7.

[0113] 3.2. When constructing the SMN1-SNP mutation site detection system, a relatively low concentration of 50-100 nM was used for the target gene primers to ensure the specificity of PCR amplification. 2+ Concentration and adding DMSO can establish an inert PCR reaction system, which can further improve the specificity of primer amplification. After a large number of experimental tests and comparisons, the optimal PCR reaction system was finally determined and shown in Table 8.

[0114] Table 7 Formula of PCR reaction system for exons 7 and 8 of SMN1 gene

[0115]

[0116]

[0117] Table 8 SMN1-SNP mutation site PCR reaction system formula

[0118]

[0119]

[0120] Note: The amount of genomic DNA added is 2 μL and the total reaction volume is 20 μL.

[0121] 4. PCR amplification reaction conditions

[0122] In order to ensure the PCR amplification efficiency and improve the detection specificity, the present invention divides the PCR amplification into two rounds. In the first round, the initial annealing temperature of the touchdown PCR is increased to 64°C, and 10 pre-cycles are performed with the temperature reduced by 0.4°C per cycle. The initial annealing temperature is significantly higher than the primer Tm value to improve the detection specificity. In the second round, a normal annealing temperature is used to ensure high-sensitivity amplification detection. After the amplification is completed, a continuous melting process is added. While forming melting peaks for distinguishing different copy numbers, the specificity of the amplified product can be further determined by the Tm value of the melting peak. The determined PCR reaction conditions are shown in Table 4.

[0123] 5. Quantitative analysis of SMN1 gene copy number and mutation site detection analysis

[0124] 5.1. Quantitative analysis of the copy number of exons 7 and 8 of the SMN1 gene. The peak graph of the target gene melting peak was analyzed by normalized melting curve. The target gene melting peaks of samples with different copy numbers of the SMN1 gene formed obvious distinctions, and the melting peaks of samples with the same copy number were gathered together. In order to achieve accurate quantification of the SMN1 gene melting peak, two parameters that can be quantified were introduced: P value and R value. The P value is the peak height of the target gene melting peak, and the R value is the P value of the peak height of the melting peak of the sample to be tested divided by the P value of the peak height of the melting peak of the two copies of the standard. Because the P value of the peak height of the target gene melting peak will fluctuate greatly due to differences in different detection instruments, different operators, and different batches of reagents, the introduction of the R value can eliminate the influence of errors caused by such factors on the test results. The percentile method P99 was used to determine the judgment table of the copy number quantitative data analysis results in Table 5 through a large number of sample test data.

[0125] 5.2. For the detection of SMN1 gene mutation sites, the difference ΔTm between the melting Tm values ​​of the target gene and the reference gene was used for calculation and analysis to identify different mutation sites. The relative melting Tm difference can effectively avoid the disadvantage of inconsistent Tm values ​​caused by temperature differences between different instruments and different detection wells. The results of different SMN1 gene mutation sites in Table 6 were determined through verification tests.

[0126] In the present invention, after PCR amplification is completed, different melting peaks are formed according to the difference in the Tm value of the amplicon through melting curve analysis. Since the internal reference genes selected for different samples are all two-copy standards, the melting peaks of the internal reference genes of different test samples are normalized by multiple melting curve analysis software, so that samples with different SMN1 gene copy numbers can form melting peaks of different heights, and the peak height of the melting peak is directly proportional to the SMN1 gene copy number. Since the copy number of the SMN1 gene in the sample is an integer, the melting peaks of samples with different SMN1 gene copy numbers will show a very obvious degree of distinction, and samples with different SMN1 gene copy numbers can be clearly distinguished through the melting peak diagram. Further, by using two-copy standards and introducing quantifiable parameters P value and R value, it is possible to avoid the difference in results caused by the difference in the peak height of the melting peak due to errors in different experimental operations, thereby achieving accurate and clear judgment of the copy number of the SMN1 gene in the test sample.

[0127] The whole analysis method is similar to Figure 2As shown, first, S10 is executed to add a solution to be analyzed to the kit of the present invention, and the solution is subjected to thermal cycle amplification of a preset number of cycles to amplify the nucleic acid fragments in the solution to be analyzed; the solution to be analyzed added here may include an extraction solution containing nucleic acid fragments obtained by a conventional magnetic bead extraction method, or an extraction solution obtained by a direct extraction method, which may be a sample solution or a template DNA solution, etc., which is not limited here, and of course, the solution to be analyzed may be directly added to a solution containing primer pairs of SMN1-7 and SMN1-8 genes (the concentration range of the SMN1-7 primer pair is 10-75 nM, and the concentration range of the SMN1-8 primer pair is 10-75 nM) to form an amplification reaction system, and the nucleic acid fragments in the solution to be analyzed are amplified at a preset number of cycles (which may be 30, 35, 40, etc.) to obtain more target nucleic acid fragments and reference nucleic acid fragments.

[0128] S20 melts the result after a preset number of cycles of amplification to obtain the unprocessed fluorescence versus temperature relationship; steps similar to the traditional melting curve analysis method can be used here.

[0129] S30 removes background noise in fluorescence and temperature, obtains melting peaks of each target nucleic acid and reference nucleic acid, and normalizes the melting peak of the reference nucleic acid; the background noise can be removed by existing background interference elimination methods, which are not limited here. Since the internal reference genes selected for different samples in the present invention are all two-copy standards, the normalized melting peaks of the reference nucleic acid can form a unified comparison benchmark, so that accurate analysis of different copy numbers to be analyzed in the sample can be achieved, which will not be repeated here.

[0130] S40 obtains the peak height difference of the melting peak of each target nucleic acid relative to the reference nucleic acid, and uses the differential height to distinguish different target nucleic acid sequences; of course, the distinction between different target nucleic acid sequences described here also means that the quantitative results of the original copy numbers of the SMN1-7 and SMN1-8 genes can be obtained.

[0131] 6. Sample testing

[0132] The kit of Example 2 of the present invention was used to analyze 45 clinical samples with different copy numbers of the SMN1 gene (sample numbers S1 to S45), and the detection results of the MLPA kit of MRC Company of the Netherlands and Sanger sequencing were used as controls to evaluate the detection performance of the kit of the present invention. The comparison table of the detection results is shown in Table 9 and Figure 3 , Figure 4 shown.

[0133] Table 9 Detection results of 45 clinical samples with different SMN1 gene copy numbers

[0134]

[0135]

[0136] According to Table 9, 45 clinical samples were tested using the kit of the present invention, and the results of the SMN1 gene copy number detection in exons 7 and 8 were completely consistent with the results of the MLPA method, with an accuracy of 100%. At the same time, the samples were sequenced by Sanger sequencing to determine whether there were mutation sites. The results showed that 5 of the 45 samples had SNP sites, and the sequencing results were consistent with the PCR test results.

[0137] Example 3

[0138] Example 3 is the same as Example 1, except that the concentrations of the core material primers (i.e., SMN1-7FP primer, SMN1-7RP primer, SMN1-8FP primer, SMN1-8RP primer, CFTR-FP primer, CFTR-RP primer, TPGS2-FP primer, TPGS2-RP primer, and the concentrations of these core material primers are the same) are 10 nM, 20 nM, 30 nM, 50 nM, 75 nM, and 100 nM, respectively, and the detection results are as follows: Figure 5-10 As shown (wherein, one sample each with different copy numbers was repeated three times, and 0 copy was repeated once).

[0139] Depend on Figure 5-10 It can be seen that when the concentration of the core material primer is 10nM, although 2 copies, 3 copies and 4 copies can be distinguished, 1 copy is difficult to distinguish. As the concentration of the core material primer increases, the melting peaks of different copy numbers are more and more clearly distinguished. When the concentration reaches 75nM, although the melting peaks of different copy numbers can still be distinguished, the distance between each other is very close. When the concentration reaches 100nM, the melting peaks of different copy numbers are not easy to distinguish. It can be obtained that when the concentration of the core material primer is 10-75nM, the melting peaks of different copy numbers can be well obtained, thereby achieving accurate and clear judgment of the copy number of the SMN1 gene in the test sample, and this effect cannot be achieved when the concentration exceeds this range.

[0140] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A kit for detecting the copy number of the human motor neuron survival gene SMN1, comprising SMN1-7 main reaction solution and SMN1-8 main reaction solution, characterized in that: The SMN1-7 main reaction solution comprises SMN1-7FP primers in a concentration range of 20nM to 30nM, SMN1-7RP primers in a concentration range of 20nM to 30nM, CFTR-FP primers in a concentration range of 20nM to 30nM, CFTR-RP primers in a concentration range of 20nM to 30nM, and 35-50mM Tris, 1.5-2.5mM MgCl2, 35mg / L BSA, 100-200μM dNTPs, 20-50×Syto 9 dye, Taq DNA polymerase, DNA polymerase antibody, and purified water; The SMN1-8 main reaction solution comprises SMN1-8FP primers in a concentration range of 20nM to 30nM, SMN1-8RP primers in a concentration range of 20nM to 30nM, TPGS2-FP primers in a concentration range of 20nM to 30nM, TPGS2-RP primers in a concentration range of 20nM to 30nM, 35-50mM Tris, 1.5-2.5mM MgCl2, 35mg / L BSA, 100-200μM dNTPs, 20-50×Syto 9 dye, Taq DNA polymerase, DNA polymerase antibody and purified water; The SMN1-7FP primer sequence is TCCTTTATTTTCCTTACAGGGTTT, the SMN1-7RP primer sequence is CTTCCTTCTTTTTGATTTTGTCTG, the SMN1-8FP primer sequence is TAATAACCAAATGCAATGTGAA, and the SMN1-8RP primer sequence is CTCCCACCCCCACCC; The CFTR-FP primer sequence is TTGTGATTACCTCAGAAATGAT, the CFTR-RP primer sequence is ATTGCTTCTTCCCAGCAGT, the TPGS2-FP primer sequence is CATCATTCCACTGGGAAG, and the TPGS2-RP primer sequence is CAGAGTGGGTGCATTAGG.

2. A kit for detecting the copy number and gene base mutation of the human motor neuron survival gene SMN1, characterized in that: The kit comprises the kit described in claim 1, and further comprises an SMN1-SNP mutation site main reaction solution, wherein the mutation site main reaction solution comprises a mutation site primer pair with a concentration range of 50-100 nM; the mutation site primers comprise a c.863G>T primer pair, a c.400 G>A primer pair, a c.689C>T primer pair, a c.683T>A primer pair and a c.22dupA primer pair.

3. A method for non-diagnostic quantitative analysis of the copy number of the human motor neuron survival gene SMN1, characterized in that: A solution to be analyzed is added to the kit described in claim 1 or 2, and the nucleic acid fragments in the solution to be analyzed are amplified to obtain more target nucleic acid fragments and reference nucleic acid fragments; the results after a preset number of amplifications are melted to obtain the unprocessed fluorescence and temperature relationship, the background noise in the fluorescence and temperature is removed, the melting peaks of each target nucleic acid and reference nucleic acid are obtained, the melting peaks of the reference nucleic acid are normalized, and the peak height difference of the melting peak of each target nucleic acid relative to the reference nucleic acid is obtained, and the peak height difference is used as a parameter for quantitative analysis calculation.

Images