Cochlear outer hair cell-specific cis-regulatory element and its application

Abstract

The present invention discloses a cochlear outer hair cell-specific cis-regulatory element and its use. Specifically, the present invention discloses a cochlear outer hair cell-specific cis-regulatory element, the cis-regulatory element comprising a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, which can be used to drive effector genes to be specifically expressed in cochlear outer hair cells. The cochlear outer hair cell-specific cis-regulatory element of the present invention can drive Prestin to be specifically expressed in cochlear outer hair cells, thereby treating hearing loss caused by Prestin mutation. The AAV virus constructed using the cis-regulatory element of the present invention is expected to become a new method for clinical treatment of hearing loss.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a cochlear outer hair cell-specific cis-regulatory element and application thereof. Background Art

[0002] The cochlea is the mammalian hearing organ, located in the ventral part of the inner ear, and is responsible for the detection of sound. The sensory receptors of sound, hair cells (HC), are located in the auditory epithelium of the cochlea (also known as the Organ of Corti (OC)). There are two types of hair cells, inner hair cells (IHC) and outer hair cells (OHC). These two cell types share many HC markers, such as Myo6, but they also differ in many aspects, such as cell morphology, gene expression profiles, function, and susceptibility to otoxins.

[0003] Cochlear outer hair cells (OHCs) are essential for mammalian sound perception. OHCs function as sound amplifiers, dependent on the motor protein Prestin expressed on the lateral membrane. Prestin is expressed exclusively in OHCs throughout development and adulthood. However, how the temporal and spatial specificity of Prestin expression is achieved is unclear.

[0004] Gene mutations in outer hair cells can lead to hearing diseases such as deafness, which is closely related to the loss of Prestin expression. Therefore, there is an urgent need to develop a method for treating hearing diseases such as deafness caused by gene mutations in outer hair cells. Summary of the invention

[0005] The object of the present invention is to provide a cochlear outer hair cell-specific cis-regulatory element and use thereof in repairing and / or regenerating cochlear outer hair cells to treat hearing loss.

[0006] In a first aspect, the present invention provides a use of a combination of active ingredients for preparing a preparation or a medicine, wherein the preparation or medicine is used for: (i) repairing and / or regenerating cochlear outer hair cells; (ii) treating or preventing hearing loss; and / or (iii) specifically expressing effector genes in cochlear outer hair cells;

[0007] Wherein, the active ingredient combination comprises:

[0008] (a) Cochlear outer hair cell-specific cis-regulatory elements;

[0009] (b) a promoter; and

[0010] (c) an effector gene or its coding sequence.

[0011] In another preferred embodiment, the hearing loss is hearing loss associated with degeneration and / or damage of cochlear outer hair cells (OHC).

[0012] In another preferred embodiment, the cochlear outer hair cell (OHC) degeneration is caused by mutation of Prestin protein in OHC cells.

[0013] In another preferred embodiment, the cochlear outer hair cells are cochlear outer hair cells of humans or non-human mammals.

[0014] In another preferred embodiment, the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0015] In another preferred embodiment, the promoter is selected from the following group: Hsp68, L7, thy-1, recovery protein, calcium binding protein, human CMV, GAD-67, chicken actin, CAG or CBA.

[0016] In another preferred embodiment, the promoter is Hsp68.

[0017] In another preferred embodiment, the effector gene is a gene encoding Prestin protein.

[0018] In another preferred embodiment, the cis-regulatory element drives the effector gene to be expressed specifically in cochlear outer hair cells.

[0019] The second aspect of the present invention provides an active ingredient combination, the combination comprising:

[0020] (a) Cochlear outer hair cell-specific cis-regulatory elements;

[0021] (b) a promoter; and

[0022] (c) effector gene or its coding sequence;

[0023] Wherein, the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0024] In another preferred embodiment, the promoter is selected from the following group: Hsp68, L7, thy-1, recovery protein, calcium binding protein, human CMV, GAD-67, chicken actin, CAG or CBA.

[0025] In another preferred embodiment, the promoter is Hsp68.

[0026] In another preferred embodiment, the effector gene is a gene encoding Prestin protein.

[0027] In another preferred embodiment, the cis-regulatory element drives the effector gene to be expressed specifically in cochlear outer hair cells.

[0028] The third aspect of the present invention provides an expression vector, wherein the expression vector comprises an expression cassette, wherein the expression cassette has a structure of formula I from the 5' end to the 3' end:

[0029] Z0-Z1-Z2-Z3-Z0' (I)

[0030] In the formula,

[0031] Each "-" is independently a chemical bond or a nucleotide connection sequence;

[0032] Z0 is none or 5'UTR sequence;

[0033] Z1 is the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element;

[0034] Z2 is the promoter sequence;

[0035] Z3 is the nucleotide sequence of the effector gene; and

[0036] Z0' is none or 3'UTR sequence.

[0037] In another preferred embodiment, the length of each nucleotide linker sequence is 1-30 nt, preferably 1-15 nt, and more preferably 3-6 nt.

[0038] In another preferred embodiment, the nucleotide linker sequence is derived from a nucleotide linker sequence formed by restriction endonuclease cleavage.

[0039] In another preferred embodiment, the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0040] In another preferred embodiment, the promoter is selected from the following group: Hsp68, L7, thy-1, recovery protein, calcium binding protein, human CMV, GAD-67, chicken actin, CAG or CBA.

[0041] In another preferred embodiment, the promoter is Hsp68.

[0042] In another preferred embodiment, the effector gene is a gene encoding Prestin protein.

[0043] In another preferred embodiment, the expression vector is selected from the following group: plasmid, viral vector.

[0044] In another preferred embodiment, the expression vector is selected from the following group: a eukaryotic expression vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector (AAV), or a combination thereof.

[0045] In another preferred embodiment, the expression vector is an adeno-associated virus AAV vector.

[0046] In another preferred embodiment, the AAV vector is selected from the following group: AAV2.7m8, AAV-ie or AAV-Anc80.

[0047] In another preferred embodiment, the expression vector is used to express the effector gene.

[0048] In another preferred embodiment, the expression vector is used to express Prestin protein.

[0049] In another preferred embodiment, the expression vector is used to specifically express the effector gene in cochlear outer hair cells.

[0050] The fourth aspect of the present invention provides a host cell, wherein the host cell contains the expression vector described in the third aspect of the present invention.

[0051] In another preferred embodiment, the host cell is selected from the following group: eukaryotic cells or prokaryotic cells.

[0052] In another preferred embodiment, the host cell is a mammalian cell, and the mammal includes human and non-human mammals.

[0053] In another preferred embodiment, the host cell is a cochlear outer hair cell of a human or non-human mammal.

[0054] The fifth aspect of the present invention provides a pharmaceutical preparation, which contains: (a) the active ingredient combination described in the second aspect of the present invention, or the expression vector described in the third aspect of the present invention, or the cell described in the fourth aspect of the present invention, and (b) a pharmaceutically acceptable carrier or excipient.

[0055] In another preferred embodiment, the dosage form of the pharmaceutical preparation is selected from the following group: a lyophilized preparation, a liquid preparation, or a combination thereof.

[0056] In another preferred embodiment, the vector is selected from the following group: a lentiviral vector, an adenoviral vector, an adeno-associated viral vector (AAV), or a combination thereof; preferably, the vector is an AAV vector; more preferably, it is AAV2.7m8, AAV-ie or AAV-Anc80.

[0057] In another preferred embodiment, the content of the carrier in the pharmaceutical preparation is 1×10 11 -1×10 14 Viruses / ml, preferably 1×1012 -1×10 13 viruses / ml.

[0058] In another preferred embodiment, the therapeutically effective amount of the pharmaceutical preparation is 1×10 11 -1×10 14 viruses, preferably 1×10 12 -1×10 13 A virus.

[0059] In another preferred embodiment, the pharmaceutical preparation is used to treat or prevent hearing loss, preferably to treat degeneration and / or damage of cochlear outer hair cells.

[0060] The sixth aspect of the present invention provides the use of the active ingredient combination described in the second aspect of the present invention, or the expression vector described in the third aspect of the present invention, or the host cell described in the fourth aspect of the present invention, or the pharmaceutical preparation described in the fifth aspect of the present invention in the preparation of a drug for treating or preventing hearing loss.

[0061] In another preferred embodiment, the hearing loss is hearing loss associated with degeneration and / or damage of cochlear outer hair cells.

[0062] The seventh aspect of the present invention provides a method for repairing and / or regenerating cochlear outer hair cells, comprising transducing the active ingredient combination described in the second aspect of the present invention, or the expression vector described in the third aspect of the present invention, into degenerated or damaged cochlear outer hair cells.

[0063] In another preferred embodiment, the Prestin protein in the degenerated or damaged cochlear outer hair cells is mutated.

[0064] In another preferred embodiment, the mutation includes an inactivating mutation caused by the deletion, insertion or substitution of a single base or multiple bases in the coding sequence.

[0065] The eighth aspect of the present invention provides a method for treating or preventing hearing loss, comprising administering the pharmaceutical preparation according to the fifth aspect of the present invention to a subject in need thereof.

[0066] In another preferred embodiment, the hearing loss is hearing loss associated with degeneration and / or damage of cochlear outer hair cells.

[0067] In another preferred embodiment, the method is a method for reducing degeneration and / or damage of cochlear outer hair cells in a patient suffering from or at risk of developing hearing loss.

[0068] In another preferred embodiment, the subject in need includes human and non-human mammals.

[0069] In another preferred embodiment, the subject in need suffers from hearing loss associated with degeneration and / or damage of cochlear outer hair cells.

[0070] In another preferred embodiment, the method comprises directly administering the expression vector to the ear of a subject in need thereof.

[0071] In another preferred embodiment, the method comprises directly implanting the host cell into the cochlea of ​​a subject in need.

[0072] In another preferred embodiment, the method can repair cochlear outer hair cells in a subject in need thereof who suffers from hearing loss associated with cochlear outer hair cell degeneration and / or damage.

[0073] In another preferred embodiment, the method results in substantial restoration or maintenance of hearing function in the treated ear.

[0074] The ninth aspect of the present invention provides a use of a cochlear outer hair cell-specific cis-regulatory element, wherein the cis-regulatory element comprises a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, and is used to drive the expression of effector genes specifically in cochlear outer hair cells.

[0075] In another preferred embodiment, the effector gene is a gene encoding Prestin protein.

[0076] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1:Deletion of the 13kb fragment inhibits the expression of Prestin at P6. (A) The distribution of the 13kb fragment in the second intron of Prestin. (B) Sanger sequencing results of the mouse tail DNA of Prestin-13k / + mice. (C) Schematic diagram of gel electrophoresis of PCR amplification products of mouse tail DNA of wild-type (Prestin+ / +), heterozygous (Prestin-13k / +) and homozygous (Prestin-13k / Prestin-13k) mice. (D-E) Whole-mount in situ RNA hybridization staining of P6 cochlear tissue samples of Prestin+ / + (D) and Prestin-13k / Prestin-13k (E). Prestin mRNA is specifically expressed in wild-type outer hair cells (D), but cannot be detected in homozygous mutants (E). (F-G) Immunohistofluorescence detection of Prestin using cochlear tissue samples of Prestin+ / + (F) and Prestin-13k / Prestin-13k (G) at P5. Prestin protein is specifically expressed in wild-type outer hair cells (F), but no signal of prestin protein can be detected in homozygous mutants (G). The inset in (F) is the same figure, but only the signal of the Prestin channel is presented. (H) Schematic diagram of the process of manually picking tdTomato-positive cells from P5 wild-type, heterozygous and homozygous mice. (IJ) The content of Pretsin and Myo6 in cells from mice of different genotypes in (H) was detected by qPCR. The deletion of the 13kb fragment affects the mRNA of Prestin and there is a dose effect, but it does not affect the mRNA of Myo6. The enrichment of Myo6 in hair cells proves the high purity of hair cells (J). *p<0.05, ***p<0.001. Scale bar: 20μm (E, G).

[0078] Figure 2: Deletion of a 4kb fragment proximal to the 5' end of intron 2 can reproduce the phenotype of the Prestin-13k mutant. (A) Schematic diagram of the distribution of the 4k fragment (blue line, #1) on the intron 2 of Prestin. No phenotype was observed in mice in which the other two fragments (#2 and #3) were deleted. (B) Sanger sequencing results of the tail DNA of Prestin 4k-1 / + mice. (C) Schematic diagram of gel electrophoresis of PCR amplification products of tail DNA of wild-type (Prestin+ / +), heterozygous (Prestin-4k / +) and homozygous (Prestin-4k-1 / Prestin-4k-1) mice. (D-E') Immunofluorescence co-staining of Prestin and Myo6 in cochlear tissue samples of Prestin (+ / +) and Prestin-4k-1 / Prestin-4k-1 at P5. Prestin protein is specifically expressed in wild-type outer hair cells (D-D'), but the signal of Prestin protein cannot be detected in homozygous mutants (E-E'). (FI) NLC measurements were performed on OHCs of five different genotypes at P14.5 (F) and P60 (G). The NLC curves of the Prestin-4k-1 mutant overlapped with those of the Prestin-13k mutant. Notably, no difference in total Prestin content was found between Prestin-13k / + and Prestin-4k-1 / + at P14.5 and P60 (H). Similarly, no difference was found between Prestin-13k / Prestin-13k and Prestin-4k-1 / Prestin-4k-1 at P14.5 and P60 (I).

[0079] Figure 3:The timely expression of Prestin requires a 1.4k fragment. (AC) Schematic illustration of how to use multiple sgRNAs to induce random deletions in the 4k fragment (blue line), among which 7 more effective sgRNAs have been pre-tested for efficiency. The sgRNAs were divided into two subgroups: Group 1 at the 5' end, including sg1, 5, 6, 7 and 8; Group 2 at the 3' end, including sgRNA8, 9, 10, 11 and 12. Cas9 mRNA was injected into one-cell stage zygotes together with the five sgRNAs from Group 1 (B) and Group 2 (C), and 32 and 43 F0 mice were obtained, respectively. (D) Illustration of Sanger sequencing of mouse tail DNA from 1 / 32 F0 mice from Group 1 sgRNAs (B). The sequencing results showed that the mutant was probably a homozygous mutant for the 1429bp (1.4k) fragment deletion between sgRNA-1 and sgRNA-7. (E-F') Immunofluorescence co-staining of Prestin and Myo6 in P9 mouse cochlear specimens (D). Images were acquired at low resolution (E-E') and high resolution (F-F'). The heterogeneous expression pattern of Prestin can be observed. Outer hair cells with high Prestin should be wild-type genotype (arrows in F-F'), and outer hair cells with very low or undetectable Prestin should be homozygous deletion 1.4k (asterisks in F-F'). In summary, the mice should be mosaics. Most of the cells in the tail are homozygous mutations, resulting in the inability to amplify wild-type PCR products. Scale bars: 100μm (E'); 20μm (F').

[0080] Figure 4 :A 1.4 kb fragment of mouse Presin and a 398 bp fragment of human Prestin are sufficient to drive the expression of green fluorescent protein specifically in cochlear OHCs. (A) Illustration of transgenic mice obtained by the piggybac method using the 1.4 kb fragment (as an enhancer) and the Hsp68 promoter to control EGFP. Each F0 has a unique transgene insertion pattern, but all can be directly analyzed without further breeding. (B-B') Cochlear tissue samples of F0 mice at P14 were immunofluorescently co-stained for EGFP and Myo6. The images of the insertion in (B-B') were observed under a high-power microscope. EGFP expression is specific to outer hair cells, but not all outer hair cells are EGFP positive, indicating that the transgene insertion in F0 mice is mosaic. (C-C') Cochlear tissue samples of another F0 mouse were immunofluorescently co-stained for EGFP and Myo6 at P21. The EGFP signal is expressed in all outer hair cells, indicating that the transgene insertion is not mosaic in this mouse. (D-F”) Human Prestin and mouse Prestin have a highly homologous sequence of 398 bp. Using this 398 bp sequence, EGFP can also be specifically expressed in mouse cochlear OHC. Scale bars: 200 μm (B”) and 20 μm (C”, F”).

[0081] Figure 5 :Detailed similarity comparison between the 1.4kb fragment of mouse Presin and the 398bp fragment of human Prestin.

[0082] Figure 6 :AAV virus prepared using mouse 1.4kb sequence and human 398bp sequence specifically infects cochlear OHC. (A) AAV virus was prepared using the 1.4k bp sequence of mouse Prestin gene and injected into the cochlea of ​​mice. (B-B') P17 analysis of mouse cochlea, EGFP is mainly expressed in cochlear outer hair cells. (C) AAV virus was prepared using the 398bp sequence of human Prestin gene and injected into the cochlea of ​​mice. (D-D') P17 analysis of mouse cochlea, EGFP is also mainly expressed in cochlear outer hair cells. DETAILED DESCRIPTION

[0083] After extensive and in-depth research, the inventors unexpectedly screened out a cochlear outer hair cell-specific cis-regulatory element for the first time, which can drive the expression of effector genes specifically in cochlear outer hair cells. Experiments have shown that the cochlear outer hair cell-specific cis-regulatory element regulates the expression of Prestin in cochlear outer hair cells, which is a necessary condition for starting Prestin expression in OHC on time. In addition, the AAV expression vector constructed using the cochlear outer hair cell-specific cis-regulatory element can drive the specific expression of the effector gene in the expression vector in cochlear outer hair cells.

[0084] On this basis, the present invention has been completed.

[0085] the term

[0086] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0087] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0088] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0089] Sequence identity (homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0090] As used herein, the term "subject", "subject in need" refers to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cows, horses, dogs, cats, pigs, sheep, goats.

[0091] As used herein, the terms "hearing loss," "hearing disorder," and "hearing impairment" refer to abnormal hearing function due to degeneration and / or damage of the cochlear outer hair cells.

[0092] cis-regulatory element

[0093] The expression of genes depends on two key parts: one is the cis-regulatory element (CRE), which consists of transcription factor (TF) binding sites and other non-coding DNA, which is sufficient to drive gene expression in a controlled temporal and spatial manner; the other is a trans-acting factor, such as TF that binds to CRE. Promoters and enhancers are the two main types of CRE. Promoters are usually close to the transcription start site, but a single promoter can only produce the lowest level of mRNA expression (Brown and Feder, 2005). Enhancers are widely distributed upstream, downstream, introns or distal ends of individual genes and are key to CRE differentiation. For example, one of the enhancers of the Atoh1 gene is located about 2k bp downstream of its 3'-UTR and is believed to be involved in determining the expression level of Atoh1. Only cochlear sensory precursor cells that express high levels of Atoh1 eventually develop into HCs. In addition, the expression of genes is often controlled by multiple enhancers. Each enhancer may affect the expression pattern of a gene in a specific cell type or at a specific developmental stage.

[0094] Thyroid hormone (TH) is a trans-acting factor, and the TH response element (TRE) plays a crucial role in regulating the expression of rat Prestin. It is speculated that the TH response element is distributed in the long intron 2 (~20k bp) between exon 2 and exon 3 of rat Prestin. However, genetic evidence in vivo has not yet proved the importance of the intron 2 sequence. In addition, it is not clear which part is the key CRE, because 20k bp is too long to act as a driver to activate the ectopic expression of specific genes in OHCs. Finding a key and short CRE provides a deeper understanding of the molecular mechanism of the specific Prestin expression pattern in OHCs, and finding an outer hair cell-specific CRE has important clinical significance for gene therapy of deafness.

[0095] The present invention provides a cochlear outer hair cell-specific cis-regulatory element, the cis-regulatory element comprising a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, for driving effector genes to be specifically expressed in cochlear outer hair cells. The cis-regulatory element is a 1.4kb sequence (SEQ ID NO: 1) located in mouse Prestin intron 2, which has about 80% sequence identity with a 398bp sequence (SEQ ID NO: 2) in human Prestin intron after sequence alignment. In an embodiment of the present invention, AAV viruses constructed using the mouse 1.4kb sequence and the human 398bp sequence can both express effector genes specifically in cochlear outer hair cells.

[0096] Effector gene

[0097] As used herein, the term "effector gene" refers to any gene that can be expressed in cochlear outer hair cells. The sequence of the effector gene can be a sequence derived from a coding region (CDS) or an open reading frame, or a sequence having at least 85% sequence identity with a sequence of a coding region (CDS) or an open reading frame.

[0098] In another preferred embodiment, the "effector gene" refers to a gene that can be expressed in cochlear outer hair cells and exerts an effect. The effect includes but is not limited to effects related to the morphology and function of cochlear outer hair cells. For example, the effect of maintaining the sound sensitivity of cochlear outer hair cells. In a preferred embodiment of the present invention, the effector gene is a gene encoding Prestin protein.

[0099] Prestin

[0100] Prestin is a motor membrane protein encoded by the Slc26a5 gene and is specifically and continuously expressed in the outer hair cells of the cochlea. The main function of the Prestin protein is to help the outer hair cells to stretch their own length when sound is heard, thereby increasing the sensitivity of humans or animals to sound. Prestin- / - mice and people with Prestin point mutations have a significant decline in hearing ability, and the outer hair cells of Prestin- / - mice show progressive cell death from high-frequency to low-frequency regions as they age.

[0101] The information of Prestin is shown in https: / / www.ncbi.nlm.nih.gov / protein / ?term=Prestin, and the information of Slc26a5 gene is shown in https: / / www.ncbi.nlm.nih.gov / gene / ?term=Slc26a5. As used herein, the term "gene encoding Prestin protein" refers to the Slc26a5 gene. In the preferred example herein, the Prestin protein is preferably a human or mouse Prestin protein.

[0102] Adeno-associated virus

[0103] Adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus Dependinovirus of the family Parvoviridae. It is the simplest type of single-stranded DNA defective virus discovered so far, and requires a helper virus (usually adenovirus) to participate in replication. It encodes the cap and rep genes in the inverted repeat sequences (ITR) at both ends. ITR plays a decisive role in the replication and packaging of the virus. The cap gene encodes the viral capsid protein, and the rep gene is involved in the replication and integration of the virus. AAV can infect a variety of cells.

[0104] Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. Due to its good safety, wide range of host cells (dividing and non-dividing cells), low immunogenicity, and long-term expression of foreign genes in vivo, it is regarded as one of the most promising gene transfer vectors and has been widely used in gene therapy and vaccine research worldwide. After more than 10 years of research, the biological characteristics of recombinant adeno-associated virus have been deeply understood, especially its application effects in various cells, tissues and in vivo experiments have been accumulated. In medical research, rAAV has been used in the study of gene therapy for a variety of diseases (including in vivo and in vitro experiments); at the same time, as a characteristic gene transfer vector, it is also widely used in gene function research, construction of disease models, preparation of gene knockout mice, etc.

[0105] Expression vectors and host cells

[0106] The present invention provides an expression vector, wherein the expression vector comprises an expression cassette, wherein the expression cassette has a structure of formula I from the 5' end to the 3' end:

[0107] Z0-Z1-Z2-Z3-Z0' (I)

[0108] In the formula,

[0109] Each "-" is independently a chemical bond or a nucleotide connection sequence;

[0110] Z0 is none or 5'UTR sequence;

[0111] Z1 is the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element;

[0112] Z2 is the promoter sequence;

[0113] Z3 is the nucleotide sequence of the effector gene; and

[0114] Z0' is none or 3'UTR sequence.

[0115] Given the sequence information, a skilled artisan can use available cloning techniques to generate nucleic acid sequences or vectors suitable for transduction into cells.

[0116] Preferably, the nucleic acid sequence comprising the coding Prestin protein is provided as a vector, preferably as an expression vector. Preferably, it can be provided as a gene therapy vector preferably suitable for transduction and expression in target cells (e.g., cochlear supporting cells). The vector can be viral or non-viral (e.g., plasmid). Viral vectors include those derived from the following viral vectors: adenovirus, adeno-associated virus (AAV) including a mutated form, retrovirus, slow virus, herpes virus, vaccinia virus, MMLV, GaLV, simian immunodeficiency virus (SIV), HIV, poxvirus, and SV40. Preferably, the viral vector is replication defective, or can be replication deficient, capable of replication or conditional replication. The viral vector can generally maintain an extrachromosomal state without integration into the genome of the target cell. The preferred viral vector for introducing the expression cassette of the present invention into the target cell is an AAV vector. Selective targeting can be achieved using a modified version of a specific AAV serotype (AAV serotype 2 to AAV serotype 12) or any one of these serotypes. In a preferred example of the present invention, the AAV vector is preferably AAV2.7m8, AAV-ie or AAV-Anc80.

[0117] The viral vector can be modified to delete any non-essential sequence. For example, in AAV, the virus can be modified to delete all or part of the IX gene, Ela and / or Elb gene. For wild-type AAV, without the presence of a helper virus such as adenovirus, replication is very inefficient. For recombinant adeno-associated viruses, preferably, replication genes and capsid genes are provided in trans (in pRep / Cap plasmids), and only the 2ITR of the AAV genome is retained and packaged into the virion, while the required adenoviral genes are provided by adenovirus or another plasmid. Similar modifications can also be made to lentiviral vectors.

[0118] Viral vectors have the ability to enter cells. However, non-viral vectors such as plasmids can be compounded with reagents to facilitate the uptake of viral vectors by target cells. Such reagents include polycationic agents. Alternatively, delivery systems such as liposome-based delivery systems can be used. The carrier used in the present invention is preferably suitable for use in vivo or in vitro, and is preferably suitable for use in humans.

[0119] The vector will preferably comprise one or more regulatory sequences to direct the expression of the nucleic acid sequence in the target cell. The regulatory sequence may comprise a promoter, an enhancer, a transcription termination signal, a polyadenylation sequence, a replication origin, a nucleic acid restriction site, and a homologous recombination site operably connected to the nucleic acid sequence. The vector may also comprise a selective marker, for example to determine the expression of the vector in a growth system (e.g., a bacterial cell) or in a target cell.

[0120] "Operably linked" means that a nucleic acid sequence is functionally related to the sequence to which it is operably linked, linked in a manner that allows them to affect the expression or function of each other. For example, a nucleic acid sequence operably linked to a promoter will have an expression pattern affected by the promoter.

[0121] The promoter mediates the expression of the nucleic acid sequence connected thereto. The promoter may be constitutive or inducible. The promoter may direct the universal expression of the gene in cochlear cells, or the specific expression of cochlear cells. In the latter case, the promoter may direct the specific expression of cell types, such as cochlear outer hair cells. Suitable promoters will be known to those skilled in the art. For example, suitable promoters may be selected from the group consisting of: Hsp68, L7, thy-1, recovery protein, calcium binding protein, human CMV, GAD-67, chicken actin, CAG and CBA, etc., but are not limited to the group. In addition, gene expression targeting specific cells may also be achieved using cell-specific promoters.

[0122] In a preferred embodiment of the present invention, an example of a suitable promoter is the Hsp68 promoter. In addition, an example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence that can drive any polynucleotide sequence operably connected thereto to express at a high level. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences may also be used, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr (Epstein-Barr) virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters, such as but not limited to actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, the present invention should not be limited to the application of constitutive promoters. Inducible promoters are also considered to be part of the present invention. The use of an inducible promoter provides a molecular switch that can turn on the expression of a polynucleotide sequence operably connected to the inducible promoter when expression is desired, or turn off expression when expression is desired to be turned off. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0123] The present invention also provides a host cell for expressing Prestin protein. Preferably, the host cell is a mammalian cell (preferably a human cell, more preferably a human cochlear outer hair cell).

[0124] Pharmaceutical preparations and compositions

[0125] The present invention provides a pharmaceutical preparation or composition, which contains (a) the active ingredient combination described in the second aspect of the present invention, or the expression vector described in the third aspect of the present invention, or the host cell described in the fourth aspect of the present invention, and (b) a pharmaceutically acceptable carrier or excipient.

[0126] In another preferred embodiment, the pharmaceutical preparation is used to treat hearing loss.

[0127] In another preferred embodiment, the pharmaceutical preparation is used to treat degeneration and / or damage of cochlear outer hair cells.

[0128] The "active ingredient" in the pharmaceutical preparation described in the present invention refers to the vector described in the present invention, such as a viral vector (including an adeno-associated viral vector). The "active ingredient", preparation and / or composition described in the present invention can be used to treat hearing loss. "Safe and effective amount" means: the amount of active ingredient is sufficient to significantly improve the condition or symptoms without causing serious side effects. "Pharmaceutically acceptable carrier or excipient" refers to: one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the active ingredient of the present invention and with each other without significantly reducing the efficacy of the active ingredient.

[0129] The composition may be a liquid or solid, such as a powder, gel or paste. Preferably, the composition is a liquid, preferably an injectable liquid. Suitable excipients will be known to those skilled in the art.

[0130] In the present invention, the carrier can be administered to the subject by directly to the ear or cochlea. In either mode of administration, preferably, the carrier is provided as an injectable liquid. Preferably, the injectable liquid is provided as a capsule or a syringe.

[0131] In the present invention, the host cells of the present invention can be implanted into the cochlea of ​​a subject for administration. Preferably, the host cells are provided as an injectable liquid.

[0132] Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween ), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0133] The composition may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0134] Treatment

[0135] The present invention provides a method for repairing and / or regenerating cochlear outer hair cells, the method comprising transducing the active ingredient combination described in the second aspect of the present invention, or the expression vector described in the third aspect of the present invention, into degenerated or damaged cochlear outer hair cells.

[0136] The present invention provides a pharmaceutical preparation or composition for use in a method for treating hearing loss by repairing and / or regenerating cochlear outer hair cells, the pharmaceutical preparation or composition comprising the active ingredient combination of claim 3, or the expression vector of claim 4, or a host cell containing the expression vector, and a pharmaceutically acceptable carrier or excipient. The pharmaceutical preparation or composition of the present invention can be administered alone or in combination with other therapeutic drugs (such as formulated in the same pharmaceutical composition).

[0137] The present invention also provides a method for treating hearing loss, the method comprising administering the pharmaceutical preparation or composition of the present invention to a subject. The hearing loss is hearing loss associated with degeneration and / or damage of cochlear outer hair cells. The method comprises directly administering the expression vector of the present invention to the ear (cochlea) of a subject in need. The method also comprises directly implanting the host cell of the present invention into the cochlea of ​​a subject in need.

[0138] As used herein, repairing and / or regenerating cochlear outer hair cells means that cells that previously did not have cochlear outer hair cell ability or whose cochlear outer hair cell ability has been completely or partially degenerated, after expressing a foreign nucleic acid sequence using the expression vector described in the present invention, become cells with cochlear outer hair cell characteristics and functions.

[0139] The main advantages of the present invention are:

[0140] (1) The cis-regulatory element provided by the present invention specifically drives the expression of Prestin in cochlear outer hair cells, and the AAV virus constructed using the cis-regulatory element of the present invention only makes the effector gene contained in the viral vector specifically expressed only in cochlear outer hair cells.

[0141] (2) The cis-regulatory element of the present invention has a short sequence of only 1.4 kb, or even only 398 bp, which is easy to construct into a vector and is compatible with vectors with small molecular weight.

[0142] (3) The cis-regulatory element of the present invention has application value in clinical gene therapy for hearing diseases such as deafness caused by mutations in cochlear outer hair cells.

[0143] The present invention will be further described below in conjunction with specific implementation. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0144] Methods and Materials

[0145] Animal husbandry

[0146] All mice were housed in animal rooms on a regular 12-h light / dark schedule. Both male and female mice were used in the experiments. All animal husbandry operations were performed in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and approved by the IACUC guidelines of the Institute of Neuroscience, Chinese Academy of Sciences (NA-032-2019).

[0147] Selection of efficient sgRNA

[0148] All sgRNAs used in this article were pre-tested in mouse one-cell stage fertilized eggs. During the test, each sgRNA was injected into mouse fertilized eggs at a concentration of 50ng / ul and Cas9 mRNA (100ng / ul) at the same time, cultured for 3 days until the blastocyst development stage, and DNA was extracted for PCR amplification and Sanger sequencing. Each sgRNA was tested with 6 fertilized eggs, and the standard for considering an effective sgRNA was that at least 3 / 6 fertilized eggs had cuts at the position targeted by the sgRNA.

[0149] The sgRNA sequences used in this article are shown in the following table:

[0150] name Sequence 5'-3' SEQ ID NO: sgRNA-1 ACAATAGAAATCTCCATACG 3 sgRNA-2 GGTCTTGCTATGTTGAACAG 4 sgRNA-3 AAAGGATTAATTAGCTACCC 5 sgRNA-4 GGATATATAAGAATACTCAT 6 sgRNA-5 AGAAGTGCTCAGCAATTGTG 7 sgRNA-6 TAAAAATGTACCTGTGACTC 8 sgRNA-7 CTTTATCATCATAACTTTAT 9 sgRNA-8 AACAATATACAAGATTTCCC 10 sgRNA-9 GAACCAAGAACTAGTGTCAG 11 sgRNA-10 GTGAACTCCAGTTTCTCATA 12 sgRNA-11 CATGAAACTAGCTGCCCACA 13

[0151] Construction of different Prestin intron mutant mice using CRISPR / Cas9 system

[0152] Prestin-13k intron knockout mice were constructed using sgRNA-1 and sgRNA-4, Prestin-4k-1 intron knockout mice were constructed using sgRNA-1 and sgRNA-2, Prestin-5k intron knockout mice were constructed using sgRNA-2 and sgRNA-3, and Prestin-4k-2 intron knockout mice were constructed using sgRNA-3 and sgRNA-4. Cas9 mRNA (100 ng / μl) and two different combinations of sgRNAs (50 ng / μl each) were co-injected into one-cell stage fertilized eggs of mice and then implanted into pseudo-pregnant female mice. F0 mice were identified by tail PCR, and positive mice were hybridized with wild-type mice and then passaged.

[0153] In addition, 7 effective sgRNAs were screened every 500 bases in the Prestin-4k-1 intron, and random DNA deletions were generated in the left segment of the Prestin-4k intron by co-injecting Cas9 mRNA (100ng / μl) and the first group of sgRNAs (sgRNA-1, 5, 6, 7, 8, 50ng / μl) into one-cell stage mouse fertilized eggs; random DNA deletions were generated in the right segment of the Prestin-4k intron by co-injecting Cas9 mRNA (100ng / μl) and the second group of sgRNAs (sgRNA-8, 9, 10, 11, 2, 50ng / μl) into one-cell stage mouse fertilized eggs. All F0 mice were screened by mouse tail DNA PCR and Sanger sequencing analysis, and the F0 generation homozygotes were analyzed, and the obtained F0 generation heterozygotes were hybridized with wild mice.

[0154] Construction of Prestin 1.4k-hsp68-EGFP+ transgenic mice and virus preparation

[0155] Using mouse genomic DNA as a template, a 1.4k bp fragment of Prestin was obtained by PCR and subcloned into a vector containing the PiggyBac 5' homology arm and 3' homology arm sequences, the heat shock protein 68 (hsp68) mini promoter, and EGFP. TMT7 super transcription kit (Cat#: AM1345, Thermo Fisher Scientific) was used to transcribe PiggyBac transposase mRNA in vitro. Purified Prestin 1.4k-hsp68-EGFP+ vector (50ng / μl) and PiggyBac transposase mRNA (100ng / μl) were co-injected into one-cell stage fertilized eggs of mice, and then the fertilized eggs were implanted into pseudo-pregnant female mice. F0 mice were first screened by tail PCR, and the transgenic insertion-positive mice identified were directly analyzed for phenotype or crossed with wild-type mice to establish a stable mouse strain. AAV virus production was completed at the gene editing platform of the Institute of Neuroscience, Chinese Academy of Sciences.

[0156] Sample preparation and immunofluorescence staining

[0157] The inner ear tissues of P5 mice were collected and fixed in 4% PFA overnight at 4°C. The inner ears of P14, P21, P30 and P60 mice were perfused with 1xPBS and 4% PFA, respectively, and the inner ears were removed and fixed in 4% PFA overnight at 4°C. The fixed tissues were washed 3 times with 1xPBS and then decalcified with EDTA (120mM) (P14 and P21 tissues were decalcified overnight, and P30 and P60 tissues were decalcified for 2-3 days). For whole-mount staining, the cochlear tissues were first incubated with a blocking solution containing 1% Triton X-100 (X-100, Sigma) and 5% BSA (Cat#: BP1605, Fisher Scientific) at room temperature for 1 hour, and then incubated with primary antibodies in an antibody incubation solution containing 0.1% Triton X-100 and 5% BSA at 4°C overnight.

[0158] The primary antibodies used in this study are: anti-Prestin (goat, 1:500, Cat#: sc-22692, Santa Cruz Biotechnology), anti-Prestin (rabbit, 1:50000, ab242128, Abcam, produced in cooperation between our laboratory and Abcam), anti-Myosin-VI (rabbit, 1:500, Cat#: 25-6791, Proteus Bioscience), and anti-GFP (chicken, 1:1000, Cat#: ab13970, Abcam).

[0159] The next day, the samples were washed three times with 1xPBS containing 0.1% Triton X-100, and then incubated with the following secondary antibodies at room temperature for 2 hours: Alexa 488 Donkey anti-goat IgG (Cat#:#A11055, Molecular Probes); Alexa568 donkey anti-rabbit IgG (Molecular Probes, #A10042); Alexa 488 donkey anti-chicken IgG (Cat#:703-545-155, Jackson ImmunoResearch). After the secondary antibody incubation, the samples were washed three times with 1xPBS containing 0.1% Triton X-100, and the samples were counterstained with Hoechst33342 (1:1000, Cat#:62249, Thermo Scientific) to show the nucleus. The stained samples were sealed with Prolong gold mounting medium (Cat#:P36930, Thermo Scientific). The specimens were scanned and photographed using a Nikon C2 confocal microscope, and the images were analyzed using Image-J (NIH) software.

[0160] Whole-tissue RNA in situ hybridization

[0161] Prestin-specific RNA probe covers Prestin exons 4-6 and is 384 bases long. The RNA probe was subcloned into the pBlueScript-II vector containing the T3 promoter. The final vector was linearized with NotI (Cat#: R3189s, New England BioLabs) and transcribed using T7 RNA polymerase (Cat#: P2075, Promega). The nucleic acid probe was labeled using the digoxigenin (DIG) kit (Cat#: 11277073910, Roche).

[0162] P5 mouse inner ear tissues were dissected and fixed in 4% DEPC-PFA at 4°C overnight. In order to allow the RNA probe to better bind to the sensory epithelium, the cochlear shell was partially broken. On the first day of the experiment, the tissues were washed three times with DEPC-PBS and DEPC-PBS containing 0.1% Tween-20 (P1379, Sigma), then incubated with 5μg / ml proteinase K (Cat#: 25530049, Thermofisher) at room temperature for 10 minutes, followed by secondary fixation with DEPC-4% PFA at room temperature for 10 minutes, followed by incubation with 0.1M RNase-free triethanolamine (Cat#: V900257, Sigma) at room temperature for 10 minutes. Then, the tissue was pre-hybridized for 2 hours with 1 ml of hybridization solution containing 50% formamide (Cat#:15515026, Thermo fisher), 250 μg / ml yeast RNA (Cat#:10109495001, Roche) and 500 μg / ml herring sperm DNA (Cat#:15634017, Thermo fisher). After the pre-hybridization, the tissue was hybridized overnight at 65°C with a hybridization solution containing 0.5 ng / μl digoxigenin-labeled Prestin antisense RNA probe. The next day, the tissue was rinsed with 1xTBST, further electrophoresed at 60V in TAE buffer for 2 hours, and then incubated with anti-DIG-AP antibody (Cat#:11093274910, Roche) at 4°C overnight. On the third day, the color development reaction was performed using the NBT / BCIP kit (Cat#: 11681451001, Roche), and the samples after color development were sealed with Prolong gold sealing medium (Cat#: P36930, ThermoScientific). The samples were photographed with an Olympus VS120 microscope, and subsequent data analysis was performed using ImageJ (NIH) software.

[0163] Manual cell picking and qPCR analysis

[0164] The following three genotypes of mouse models were used in the experiment:

[0165] 1) Atoh1-CreER+; Ai9 / +

[0166] 2)Atoh1-CreER+; Ai9 / +; Prestin-13k / +

[0167] 3)Atoh1-CreER+; Ai9 / +; Prestin-13k / Prestin-13k,

[0168] These three models were used to select wild-type hair cells, Prestin-13k intron sequence heterozygous knockout hair cells, and Prestin-13k intron sequence homozygous knockout hair cells, respectively. All mice were induced with tamoxifen (Cat#: T5648, Sigma) at P0 and P1 at 3 mg / 40 g mouse weight. Tamoxifen was dissolved in corn oil (Cat#: C8267, Sigma). Inner and outer hair cells were labeled red with tdTomato, and tdTomato-positive cells were manually selected at P5. The experiment was repeated three times, and each group of experiments included three genotypes, and approximately 20-25 hair cells were selected for each genotype. The inner ear dissection, manual cell selection, and qPCR experimental procedures were described in previous articles (Li et al., 2020a; Li et al., 2018; Li et al., 2020b). The cDNA of total RNA from P11 cochlear tissue was used as a normalization reference, and primers for Prestin, Myosin-VI and GAPDH (internal reference gene) were selected by calculating the amplification efficiency through the standard curve.

[0169] Auditory Brainstem Response (ABR) test

[0170] Mice aged 14.5 days, 21 days, 30 days and 60 days after birth were divided into homozygous group, heterozygous group and wild type group, with at least 6 mice in each group, and auditory brainstem response (ABR) test was performed, with a total of 7 frequencies detected: 4kHz, 5.6kHz, 8kHz, 11.3kHz, 16kHz, 22.6kHz and 32kHz. The hearing data were analyzed using Excel and Graphpad prism 8 software.

[0171] The specific steps of ABR testing are as follows:

[0172] 1) The mice were weighed using an electronic balance and anesthetized by intraperitoneal injection of chloral hydrate (Cat#: 23100, Sigma, 480 mg / kg).

[0173] 2) Place the anesthetized mouse in a soundproof room, turn on the temperature controller (Cat#: 55-7020, Harvard Apparatus), place the temperature probe under the mouse body, and set the constant temperature to 37°C.

[0174] 3) Place electrodes: Insert electrodes subcutaneously at the top of the skull (recording electrode), right mastoid (reference electrode), and left shoulder (ground electrode). Turn on the preamplifier and make sure the resistance does not exceed 1k.

[0175] 4) Perform ABR testing in an open sound field using BioSigRZ software.

[0176] A speaker (MF1, Tucker-Davis Technologies, Inc, Alachua, FL, USA) was placed 10 cm away from the ears of the mouse. A 3ms long Toneburst short pure tone signal was used as the stimulus, in which the duration of the voltage rise and fall was 1ms, the short pure tone stimulation frequency was 20 times / second, the recording time was 15ms, and the average superposition was 400 times. The maximum stimulus intensity was 90dB SPL, and the short pure tone intensity ranged from 0 to 90dB SPL, decreasing by 5dB steps. The lowest stimulus intensity that could distinguish the ABR waveform was determined as the threshold, and repeated twice. The detection was carried out in the order of 32kHz, 22.6kHz, 16kHz, 11.3kHz, 8kHz, 5.6kHz, and 4kHz.

[0177] 5) After the test, the mice were kept at a constant temperature of 37°C until they fully woke up.

[0178] Whole Cell Patch Clamp Recording of Outer Hair Cells

[0179] The temporal bones of mice were placed in extracellular fluid, and the apical basal membrane was dissected out for further patch clamp experiments. All patch ranges corresponded to the hearing range of about 8kHz-11kHz. The experiment used an AXON patch clamp system, including an Axon200B patch clamp amplifier and a Digidata 1440B digital-to-analog converter. The glass microelectrode with an inner core (Cat#: 1B150F-4, World Precision Instruments) was pulled to a tip impedance between 4-6M using a PC-100 (Narige) glass microelectrode puller. All patch clamp recordings and data analysis were performed using jClamp software. When recording the nonlinear capacitance (NLC) of outer hair cells, the composition of the extracellular solution was as follows: 136 mM NaCl (Cat#: S7653, Sigma), 1 mM CaCl2 (Cat#: C5080, Sigma), 1 mM MgCl2 (Cat#: M2670, Sigma), and 10 mM HEPES (Cat#: H3375, Sigma). The pH was adjusted to 7.2-7.4 using NaOH (Cat#: S8045, Sigma) solution, and the osmotic pressure was adjusted to 300 mOsm using D-Glucose (Cat#: G8270, Sigma). The composition of the intracellular solution was the same as that of the extracellular solution, but 10 mM EGTA (Cat#: E4378, Sigma) was added. A 10 mV continuous high-resolution double-sine stimulus (frequency 390.6 Hz and 781.2 Hz, respectively) was superimposed on a 300 ms ramp voltage ranging from +150 mV to -150 mV. The first-order derivative of the two-state Boltzmann function was used to fit the resulting data:

[0180]

[0181] in

[0182]

[0183] In the above formula, Qmax is the maximum value of nonlinear charge transfer, Vpkcm is the voltage value corresponding to the peak value of membrane capacitance, which is also equal to half of the maximum charge transfer, Vm is the membrane potential, z is the ion valence, Clin is the linear membrane capacitance, e is the electron charge, k is the Boltzmann constant, and T is the absolute temperature value. The parameters are reported in the form of Mean ± SEM, and the one-way analysis of variance was performed using GraphPad Prism8.0 software (GraphPad, San Diego, US).

[0184] Example 1

[0185] Deletion of a 13 kbp fragment of Prestin intron 2 inhibits Prestin expression

[0186] The DNA sequence similarity of intron 2 of rat (~20kbp) and mouse (~14.5kbp) is 82.9%. Intron 2 of rat Prestin is considered to be the key to the specific expression of Prestin. First, the 14.5k bp DNA fragment was deleted by CRISPR / Cas9 method to determine its importance in mouse Prestin expression ( Figure 1 AC). Two pre-tested effective sgRNAs (sgRNA-1 and sgRNA-4) were located at the 5' and 3' ends of intron 2, respectively ( Figure 1 A). The mouse strain lacking DNA fragment 6 (13503 bp, ~13 kbp) between sgRNA-1 and sgRNA-4 was named Prestin intron 2 mutant lacking 13k bp (abbreviated as Prestin-13k / +). Both Prestin-13k / + heterozygous and Prestin-13k / Prestin-13k homozygous mutant mice were healthy and fertile mice. RNA in situ hybridization analysis showed that Prestin was specifically detected in OHC of wild-type P6 (n=3), but Prestin was not detected in OHC of Prestin-13k / Prestin-13k mutant mice (n=3) at P6. Figure 1 DE). Similarly, Prestin protein was clearly detected in all OHCs of wild-type (n=3), but Prestin was completely absent in OHCs of Prestin-13k / Prestin-13k mice (n=3) at P5 ( Figure 1 FG). Therefore, it is believed that the 13 k bp DNA fragment within intron 2 is required for the timely initiation of Prestin.

[0187] We next determined whether the transcription of Prestin was affected in the cochlea of ​​heterozygous Prestin-13k / + at P5, because previous results showed that Prestin mRNA in heterozygous Prestin+ / - was approximately half of that in wild-type cochlea. However, the above immunostaining and RNA in situ analysis did not show obvious differences between wild-type and heterozygous, partly due to their lower sensitivity. Therefore, more sensitive qPCR analysis was applied to Tdtomato gene-marked HCs (IHC and OHC) in three different models: 1) Atoh1-CreER+; Rosa26-CAG-LSL-Tdtomato(Ai9) / + (wild-type HC); 2) Atoh1-CreER+; Ai9 / +; Prestin-13k / + (heterozygous mutant HC); 3) Atoh1-CreER+; Ai9 / +; Prestin-13k / Prestin-13k (homozygous mutant HC). All mice were given tamoxifen at P0 and P1. The cochlea was digested and Tdtomato+HC was manually selected, followed by RNA extraction and q-PCR analysis at P5 ( Figure 1 H). Three replicates were performed in each model, each containing approximately 20 HCs.

[0188] q-PCR analysis showed that Prestin mRNA in heterozygous mutant HCs was statistically lower than that in wild-type HCs ( Figure 1 I). As expected, Prestin was further differentiated between wild-type and homozygous mutant HCs (***p<0.001)( Figure 1 I). In contrast, no statistical difference was detected in Myo6 mRNA among HCs of the three genotypes ( Figure 1 J). Note that qPCR analysis should underestimate the differences in Prestin mRNA between different models, because it is currently technically impossible to ensure that all Tdtomato+ cells are OHCs. Nevertheless, consistent with previous reports, q-PCR data showed that the 13k bp deletion reduced Prestin mRNA expression in a dose-dependent manner, but did not affect the expression of other HC genes (e.g. Myo6).

[0189] Example 2

[0190] Deletion of a 4k bp fragment proximal to the 5' end of Prestin intron 2 reproduces the phenotype of the Prestin-13k mutant

[0191] We further determined which of the 13k bp fragments was necessary for Prestin expression. Using two other pre-tested effective sgRNAs, sgRNA-2 and sgRNA-3, the 13k bp was successfully divided into three parts of approximately equal length ( Figure 2 A). Three new mutant mice were generated by the combination of sgRNA-1 and 2 (4254 bp), sgRNA-2 and 3 (5177 bp), and sgRNA-3 and 4 (4080 bp), which were named Prestin-4k-1 ( Figure 2 #1 in A), Prestin-5k( Figure 2 #2 in A) and Prestin-4k-2( Figure 2 #3 in A). Experiments have shown that the Prestin-4k-1 mutant, but not the Prestin-5k and Prestin-4k-2 mutants, can reproduce the phenotype of the Prestin-13k mutant described above. Therefore, only the characteristics of the Prestin-4k-1 mutant are reported here ( Figure 2 B). Both heterozygous Prestin-4k-1 / + and homozygous Prestin-4k-1 / Prestin-4k-1 mutant mice are healthy and fertile and can be easily identified by tail PCR ( Figure 2 C).

[0192] Prestin is specifically expressed in wild-type OHC ( Figure 2 D-D'), but not detectable in OHCs of homozygous Prestin-4k-1 / Prestin-4k-1 mutants ( Figure 2 E-E'). Prestin expression in OHC of Prestin-4k-1 / Prestin-4k-1 mice gradually recovered at P14 and P60. NLC was further measured in OHC of wild-type, heterozygous and homozygous Prestin-4k-1 mutants at P14.5 and P60 ( Figure 2 F and G). The OHCs of the Prestin-4k-1 mutant and the Prestin-13k mutant were similar or overlapping. More importantly, no statistical difference was detected between Prestin-4k-1 / + and Prestin-13k / +, and between Prestin-4k-1 / Prestin-4k-1 and Prestin-13k / Prestin 13k at P14.5 and P60 ( Figure 2H and I). In addition, there was no statistical difference in cell size and prestin density. In summary, the loss of the 4 k bp fragment near the 5' end of intron 2 has a very similar phenotype to the loss of the entire 13 k bp fragment.

[0193] Example 3

[0194] Timely expression of Prestin requires a 1.4 kbp fragment of intron 2

[0195] The next step was to identify a CRE fragment smaller than 1.5 k bp within the 4 k bp range that met two criteria: 1) it was required for timely expression of Prestin; 2) when combined with a mini-promoter, it could effectively drive EGFP expression in OHCs, but not in IHCs or other cell types. Seven more potent sgRNAs (from #5 to #11) were pre-selected, and they were distributed approximately every 500 bp between sgRNA-1 and 2 ( Figure 3 A). Multiple sgRNAs and Cas9 may produce homozygous mutant F0 mice in one-cell stage fertilized eggs because of random homozygous DNA deletions between sgRNAs. Therefore, these sgRNAs were divided into two subgroups: 1) Group 1 includes 5 sgRNAs on the left (sgRNA-1, 5, 6, 7, and 8); 2) Group 2 includes 5 sgRNAs on the right (sgRNA-8, 9, 10, 11, and 2). Group 1 sgRNA ( Figure 3 B) or group 2 sgRNA ( Figure 3 C) injected into one-cell stage fertilized eggs along with Cas9 mRNA. 32 founder0 (F0) mice from group 1 were subjected to mouse tail DNA PCR and Sanger sequencing. 12 / 32 mice clearly showed 7 different types of DNA deletions. The failure to produce clean PCR amplicons in other mice may be due to random insertion of large DNA fragments. More importantly, 1 / 32 mice appeared to be homozygous for a deletion of 1429 bp (1.4k bp in simple terms) between sgRNA-1 and 7 ( Figure 3 D). The cochlear samples of the F0 mice were immediately co-stained for Prestin and Myo6 ( Figure 3 E-F'). OHC expressing higher Prestin is the wild-type genotype ( Figure 3 F-F'), while OHC expressing lower or undetectable Prestin is a genotype with homozygous deletion of 1.4k bp ( Figure 3 Asterisks in F-F'). The mosaic expression pattern of Prestin indicates that this 1.4 k bp mosaic homozygous deletion occurs in the cochlea, while caudal tissues show much less mosaic patterns.

[0196] In addition to the chimeric homozygous F0 mice analyzed above, other F0 mutant mice were mated with wild-type mice to breed germ cell stable mutant mice. The heterozygous deletion mice from the first group of sgRNA were analyzed intensively: 522bp (Prestin-522 / +) and 910bp (Prestin-910 / +). The 522bp and 910bp fragments jointly occupied the 1.4k bp region. In short, Prestin was absent in the OHC of homozygous Prestin-910 / Prestin-910 mice at P5. Prestin was also not detected in the OHC of homozygous Prestin-522 / Prestin-522 P5 mice. Among the 43 F0 mice from the second group of sgRNA, only 2 / 43 mice clearly showed heterozygous DNA deletions of 2329bp and 2013bp, respectively. F0 mice with a deletion of 2329bp were selected for germ cell passage. The 2329bp homologous deletion had no effect on the expression of Prestin. In general, deletion of 1.4k bp or part of it (522bp or 910bp) inhibited the expression of Prestin in OHC at P5. Therefore, the 1.4k bp between sgRNA-1 and sgRNA-7 is considered to be a key CRE element for Prestin expression. Whether the 1.4k bp fragment is a potential key Prestin enhancer will be verified by transgenic mice.

[0197] Example 4

[0198] The 1.4k fragment of mouse Presin and the 398bp fragment of human Prestin can drive the expression of green fluorescent protein specifically in cochlear OHCs

[0199] By using the piggyBac method, a transgenic mouse strain (abbreviated as Prestin-1.4k-EGFP+) was constructed in which EGFP was driven by a mini-promoter and a 1.4 k bp fragment from mouse heat shock protein 68 kDa (Hsp68) ( Figure 4 A). If 1.4k bp acts as a Prestin enhancer, then EGFP expression will be unique in OHC. A total of 21 positive transgenic mice were obtained. First, 4 / 21 mice were randomly selected for direct analysis at P6, P14, P21, and P30. EGFP was strongly and specifically expressed in the cochlear OHCs of all 4 F0 mice, but not in IHCs of all ages. In addition, mosaicism ( Figure 4 BB”) or homogeneous type ( Figure 4 CC”) EGFP expression characteristics.

[0200] 6 / 21 mice were randomly selected for germ cell stable passage, and 4 / 6 mice produced stable Prestin-1.4k-EGFP+ offspring. 2 / 6 mice failed to produce stable Prestin-1.4k-EGFP+ offspring, probably due to the transgene not being inserted into germ cells. As expected, EGFP was expressed in all cochlear OHCs, but not in IHCs or vestibular HCs in P6 stable Prestin-1.4k-EGFP+ mice. Specific EGFP expression in OHCs was maintained at P21. In summary, the 1.4k bp fragment is an enhancer of Prestin.

[0201] At the same time, a homologous sequence comparison was performed on the mouse 1.4k bp fragment, and it was found that a 398bp fragment could be found in the human Prestin genome, which was homologous to the 1.4k bp fragment of mouse Prestin, with a total similarity of 77% ( Figure 4 D and Figure 5 Similarly, a transgenic mouse line was constructed in which the expression of EGFP was driven by the human Prestin 398 bp and Hsp68 mini-promoters ( Figure 4 E). As expected, EGFP was specifically expressed in the cochlear OHCs of F0 mice ( Figure 4 FF”). Therefore, both the mouse 1.4 kbp and human 398 bp Prestin intronic fragments are sufficient to drive EGFP expression specifically in cochlear OHCs.

[0202] Example 5

[0203] AAV virus produced using mouse 1.4k bp sequence and human 398bp sequence specifically infects cochlear OHC

[0204] Next, we planned to generate AAV virus for specific transfection of OHC. We selected AAV2.7m8 as the viral expression vector. AAV2.7m8 is similar to Anc80L65 and is a powerful viral vector that can effectively infect a variety of cell types, including cochlear IHC, OHC, and SC. In order to give the virus the ability to specifically transfect OHC, the original CAG promoter in AAV2.7m8 was replaced with the mouse 1.4k bp Prestin enhancer ( Figure 6 A) or human Prestin 398 bp ( Figure 6 C) and the Hsp68 mini-promoter that together control the expression pattern of the reporter gene EGFP.

[0205] AAV2.7m8-1.4k (mouse) and AAV2.7m8-398bp (human) viruses were injected into the cochlea of ​​newborn mice (P3) through the round window and analyzed 14 days later. Figure 6 B-B') or AAV2.7m8-398bp virus ( Figure 6 D-D'), EGFP is highly expressed in the OHC of the cochlea of ​​P17 mice. Therefore, both AAV2.7m8-1.4k and AAV2.7m8-398bp viruses can specifically and effectively target OHC.

[0206] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences <120> Cochlear outer hair cell-specific cis-regulatory element and its application <130> P2020-2885 <160> 13 <170> PatentIn version 3.5 <210> 1 <211> 1429 <212> DNA <213> Mouse (Mus musculus) <400> 1 accacgtatg gagatttcta ttgtgcttgt attacctagg attctacctt aaaataaaag 60 cattagtttt aaagcaaata tttttagctc attggcttgg taacccagat atctctagtt 120 ttgaaaagtt ccttgaagaa agactagtgt tcggtcaaaa tagattacca agaactgacc 180 tgagaccctg tccttgtgaa cagaaacaaa gtcctcaaaa cttccctcat acacagccag 240 cagcagcccc acgctcacca aaggctcaca tgatgcacac gcatctctca gcagtggtcc 300 aggccgggct tcagtgtatc caggcacagg actgtgctgt gcctcctctc tactcccaca 360 atgctttgct gcgttctcag cttcccatct cctttgatgg gtgaaactct cgcctatctg 420 tgttgatcag ctgttctgaa aggccccagg agatgatagc atctcttctc tgggtatcca 480 tgccagtgtt taatagcctc ttgaaactgc cgagaagtgc tcagcaattg tgtggtgggg 540 aaggacggtg tcagcaagga ataaagatga tctctcgcct cgacggtagc tgaaatgtga 600 gtttctgtgt ccaggctcag ataaaaagtg atcctcacac ctttctcaag tagccagaga 660 cgattgaatt tctggaccag ggcaggaaaa caagagcatg ttgctaacct tgcttagtgc 720 tggggacctg atcttcttgc cattacattg tcatttctat cattctcatt cttgaaaaat 780 tatcctttga tttagagata acttatgaca atgtgactct ttatcttcat tttctttact 840 cctgtcttca tatcctaaat tacctataat atttaaaaaa aaagtgtaga tagtagactg 900 tcaggttagt acaagaatga aagacttgag ctgagaaaga aagaggtggt gagcgagtgg 960 caaggagcca tatttaattt cttcccccca cccccctttg gttcatcctc cagcttccca 1020 tcccacctgt attggtaaaa atgtacctgt gactcaggat ccttgtgttt tttgtggact 1080 tccatacagt gtgtagagca gcagctccat gggtgacctg gtgacctaga ttcacctgat 1140 ctgacccaga tggccaaccc cagggtctta gttaattctc gagaatgtct tgagctaggg 1200 gattctgaga ccagaaacct aagacccaca ggacctgttc tcctccaccc ttccagccac 1260 cattaaagac aactctaata ctggactcat ttgacaagct tattgctaat cataagatgt 1320 cacgcttttg agcataagta tacgaaagta aatgattctt taccaactgc ttacagtgaa 1380 tcaagagttg aacaaaggca ctagaaagat ggctttatca tcataactt 1429 <210> 2 <211> 398 <212> DNA <213> Homo sapiens <400> 2 ggtgtaattc tgcctatcca ggatgatcag ctgttcctaa aggtccccag agacgataac 60 atctctgctc tgagtatcca tgccagtgtt taatagcctc ttgaaatttt ctccttgaag 120 tgatctgtga cttgttgagg tggggaagaa ggtgtcagca ggggataagc atgatcaact 180 tgatcgtagc tgaaatgtga actttagtgg ccaaactgag ataaaaaatg atcctcacac 240 cttctcaagt agttgaagac tattgagtta ccagaactgg gagaggagaa aaagagcaca 300 ttgtttacct taattatttc ttgggaccta atcatgttgc cattacattg taaattctgt 360 agattttcac acttggaaaa ttcttcttaa atttagag 398 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 acaatagaaa tctccatacg 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 ggtcttgcta tgttgaacag 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 aaaggattaa ttagctaccc 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 ggatatataa gaatactcat 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <400> 7 agaagtgctc agcaattgtg 20 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <400> 8 taaaaatgta cctgtgactc 20 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <400> 9 ctttatcatc ataactttat 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <400> 10 aacaatatac aagatttccc 20 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <400> 11 gaaccaagaa ctagtgtcag 20 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 12 gtgaactcca gtttctcata 20 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <400> 13 catgaaacta gctgcccaca 20

Claims

1. Use of an active ingredient combination in the preparation of a preparation or a medicine for specifically expressing an effector gene in cochlear outer hair cells; in, The active ingredient combination comprises: (a) Cochlear outer hair cell-specific cis-regulatory elements; (b) a promoter; and (c) effector gene or its coding sequence; Wherein, the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is as shown in SEQ ID NO: 1 or SEQ ID NO: 2; and the (c) effector gene or its coding sequence is operably connected to the (a) cochlear outer hair cell-specific cis-regulatory element and (b) promoter, and the connected structure from 5' end to 3' end is as shown in Formula I: Z0-Z1-Z2-Z3-Z0'(I) In the formula, Each "-" is independently a chemical bond or a nucleotide connection sequence; Z0 is none or 5′UTR sequence; Z1 is the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element; Z2 is the promoter sequence; Z3 is the nucleotide sequence of the effector gene; and Z0' is none or 3'UTR sequence.

2. The use according to claim 1, characterized in that The effector gene is a gene encoding Prestin protein.

3. The use according to claim 1, characterized in that The promoter is selected from the group consisting of Hsp68, L7, thy-1, recovery protein, calcium binding protein, human CMV, GAD-67, chicken actin, CAG or CBA.

4. An active ingredient combination, characterized in that The combination includes: (a) Cochlear outer hair cell-specific cis-regulatory elements; (b) a promoter; and (c) effector gene or its coding sequence; Wherein, the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is as shown in SEQ ID NO: 1 or SEQ ID NO: 2; and the (c) effector gene or its coding sequence is operably connected to the (a) cochlear outer hair cell-specific cis-regulatory element and (b) promoter, and the connected structure from 5' end to 3' end is as shown in Formula I: Z0-Z1-Z2-Z3-Z0'(I) In the formula, Each "-" is independently a chemical bond or a nucleotide connection sequence; Z0 is none or 5′UTR sequence; Z1 is the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element; Z2 is the promoter sequence; Z3 is the nucleotide sequence of the effector gene; and Z0' is none or 3'UTR sequence.

5. The active ingredient combination according to claim 4, characterized in that The effector gene is a gene encoding Prestin protein.

6. An expression vector, characterized in that: The expression vector comprises an expression cassette, wherein the expression cassette has a structure of formula I from the 5' end to the 3' end: Z0-Z1-Z2-Z3-Z0'(I) In the formula, Each "-" is independently a chemical bond or a nucleotide connection sequence; Z0 is none or 5′UTR sequence; Z1 is the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element; Z2 is the promoter sequence; Z3 is the nucleotide sequence of the effector gene; and Z0' is no or 3'UTR sequence; Wherein, the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is shown as SEQ ID NO: 1 or SEQ ID NO:

2.

7. The expression vector according to claim 6, characterized in that The nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is shown in SEQ ID NO:

1.

8. The expression vector according to claim 6, characterized in that The promoter is selected from the group consisting of Hsp68, L7, thy-1, recovery protein, calcium binding protein, human CMV, GAD-67, chicken actin, CAG or CBA.

9. The expression vector according to claim 6, characterized in that The effector gene is a gene encoding Prestin protein.

10. The expression vector according to claim 6, characterized in that The expression vector is selected from the following group: a eukaryotic expression vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a combination thereof.

11. A host cell, characterized in that The host cell contains the expression vector as claimed in claim 6.

12. The host cell according to claim 11, characterized in that The host cell is a cochlear outer hair cell of a human or non-human mammal.

13. A pharmaceutical preparation, characterized in that The preparation contains: (a) the active ingredient combination as claimed in claim 4, or the expression vector as claimed in claim 6, or the host cell as claimed in claim 11, and (b) a pharmaceutically acceptable carrier or excipient.

14. A cochlear outer hair cell-specific cis-regulatory element, characterized in that: The cis-regulatory element comprises a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, and is used to drive the effector gene to be expressed specifically in cochlear outer hair cells.

Images