Construction of a constant temperature enzyme-free system for detecting ctDNA and application thereof

By constructing an isothermal enzyme-free system and utilizing strand substitution reactions of hairpin sequences and reporter sequences, high-sensitivity detection of ctDNA was achieved, solving the problems of cumbersome operation, long time consumption, and high cost in existing ctDNA detection technologies, and supporting early cancer diagnosis.

CN114774543BActive Publication Date: 2026-02-13INST OF BIOLOGICAL & MEDICAL ENG GUANGDONG ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210388045.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-04-14
Publication Date
2026-02-13
Estimated Expiration
2042-04-14

AI Technical Summary

Technical Problem

Existing ctDNA detection methods are cumbersome, time-consuming, and costly, making them difficult to widely use in clinical testing, especially for tumor markers with low abundance in serum, where the detection sensitivity is insufficient.

Method used

A thermo-enzyme-free system was constructed to achieve highly sensitive detection of ctDNA by using hairpin sequence set and reporter sequence set through strand displacement reaction under thermo-condition. The system includes the hybridization of hairpin sequences H1 and H2 to form a stable double-stranded DNA complex, which undergoes strand displacement reaction with the reporter molecule complex to generate a fluorescent signal.

Benefits of technology

It enables rapid, convenient, and highly sensitive detection of ctDNA, with a detection limit of 7pM. It features high signal gain, low background, good selectivity and specificity, and is suitable for the detection of low-abundance tumor markers in serum, supporting early cancer diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114774543B_ABST
    Figure CN114774543B_ABST
Patent Text Reader

Abstract

The application discloses a construction of a constant-temperature enzyme-free system for detecting ctDNA and application thereof. The constant-temperature enzyme-free system is composed of a hairpin sequence H1, a hairpin sequence H2, a Reporter-F and a Reporter-Q. The hairpin sequence H1 and the hairpin sequence H2 are hybridized to each other to form a stable double-stranded DNA complex (H1-H2) under the initiation of target ctDNA. The Reporter-F is complementary to a sequence D part of the hairpin sequence H1, and the number of paired bases is greater than that of paired bases of the Reporter-Q. The detection limit of the constant-temperature enzyme-free system for the ctDNA can reach 7 pM, and the constant-temperature enzyme-free system has high signal gain, low background, good selectivity and specificity and good serum stability, thereby providing effective technical support for early screening of breast cancer.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of gene detection, and particularly relates to construction of a constant-temperature enzyme-free system for detecting ctDNA and application thereof. BACKGROUND

[0002] Circulating tumor DNA (ctDNA) is a genomic fragment released into the blood by tumor cells during the process of apoptosis or necrosis, carrying tumor-specific genetic information. The ctDNA is usually composed of 90-150 nucleotides. The ctDNA has tissue specificity and is abnormally expressed in the serum of breast cancer patients. In addition, the half-life of ctDNA in blood is short, generally less than 2h, while the half-life of most protein biomarkers can be several weeks. Therefore, ctDNA can provide more real-time state information of tumors. As an effective tumor marker for liquid biopsy, ctDNA detection can provide important, accurate and reliable theoretical and experimental evidence for early diagnosis and pathological typing of breast cancer. However, the abundance of ctDNA as a tumor marker in the serum of breast cancer patients is very low, which brings certain difficulties to the existing ctDNA detection. Therefore, it is necessary to develop a more accurate and lower limit of detection ctDNA detection method for actual ctDNA detection.

[0003] In the related art, the signal amplification methods for ctDNA detection mainly include reverse transcription polymerase chain reaction (RT-PCR), DNA sequencing and enzyme-assisted signal amplification. Among them, the RT-PCR method is complicated to operate, and needs to strictly design primers and rely on precise cycle temperature control instruments. The DNA sequencing method is time-consuming to operate, usually takes 2-3 weeks, and has high cost. As for enzyme-assisted signal amplification, although the enzyme activity in enzyme-assisted signal amplification is relatively high, it needs to strictly control the activity of the enzyme, and the operating environment is relatively harsh. Moreover, the preparation process is complex and cumbersome, so its application is greatly limited. SUMMARY

[0004] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application proposes a construction of a constant-temperature enzyme-free system for detecting ctDNA and application thereof. The constant-temperature enzyme-free system for detecting ctDNA in the present application has short detection time, convenient operation and high sensitivity, and has high signal gain, low background, good selectivity and specificity, and good serum stability. Through the system, high-sensitivity detection of the tumor marker ctDNA with low abundance in serum can be effectively realized, so as to obtain the ctDNA expression profile characteristics of early cancer diagnosis, and provide solid technical support for early cancer diagnosis.

[0005] In a first aspect, the present application provides a ctDNA detection probe set, which comprises a hairpin sequence group and a reporter sequence group.

[0006] The hairpin sequence group comprises a hairpin sequence H1 and a hairpin sequence H2;

[0007] The hairpin sequence H1 comprises a sequence A, a sequence B, a sequence C and a sequence D;

[0008] The sequence A and the sequence B are targeted to bind target ctDNA;

[0009] The hairpin sequence H2 comprises a sequence E and a sequence F; the sequence E is complementary to the sequence B and the sequence C, and the base number of the sequence C is greater than that of the sequence A;

[0010] The hairpin sequence H1 and the hairpin sequence H2 are hybridized with each other to form a stable double-stranded DNA complex (H1-H2) under the priming of target ctDNA;

[0011] The reporter sequence group comprises Reporter-F and Reporter-Q;

[0012] The Reporter-F is complementary to the Reporter-Q;

[0013] The Reporter-F is complementary to the sequence D, and the base number of the pairing is greater than that of the pairing with the Reporter-Q.

[0014] In some embodiments of the present application, the ctDNA is breast cancer ctDNA.

[0015] In some embodiments of the present application, the nucleotide sequence of the ctDNA is 5'-CTCAGTGATTTTAGAGAGAGGAT-3'.

[0016] Of course, the skilled in the art can set a specific target ctDNA according to the actual situation, and adaptively adjust the specific nucleotide composition of the hairpin sequence H1, the hairpin sequence H2 and the reporter sequence according to the principle of complementary pairing.

[0017] In some embodiments of the present application, the nucleotide sequence of the hairpin sequence H1 is 5'-ATCCTCTCAGTGATTTTAGAGAGAGGAT-3'. ATCCTCTCTCT AAAATCACTGAG CCATGTGTAGACTCAGTGATTTTAGACCTTGTCATAGAGCAC-3'.

[0018] Wherein, the underlined part is the sequence A (ATCCTCTC) and the sequence B (AGAGAGAGGAT) of the hairpin sequence H1, and the sequence C (CAGTGATTTTAGACCTTGTCATAGAGCAC) is complementary to the sequence B. TCTAAAATCACTGAG) part, which is used to target the target ctDNA. CCATGTGTAGACTCAGTGA is the sequence C part of the hairpin sequence H1, and TTTTAGACCTTGTCATAGAGCAC is the sequence D part of the hairpin sequence H1.

[0019] In some embodiments of the present application, the nucleotide sequence of the hairpin sequence H2 is: 5'-CCATGTGTAGACTCAGTGA-3'. TCACTGAGTCTACAC ATGGCTCAGTGATTTTAGA CCATGTGTAGA-3'.

[0020] In some embodiments of the present application, the nucleotide sequence of the hairpin sequence H2 is: 5'-CCATGTGTAGACTCAGTGA-3'.

[0021] The above hairpin sequence H1 and hairpin sequence H2 form a stable double-stranded DNA complex (H1-H2) under the priming of the target ctDNA.

[0022] In some embodiments of the present application, the nucleotide sequence of the Reporter-F is: 5'-CGAGTGCTCTATGACAAGGTCTAAAA-3'.

[0023] In some embodiments of the present application, the nucleotide sequence of the Reporter-Q is: 5'-CCTTGTCATAGAGCACTCG-3'.

[0024] In some embodiments of the present application, the E part of the hairpin sequence H2 is in competition with the ctDNA.

[0025] In some embodiments of the present application, one of the Reporter-F and Reporter-Q is connected with a fluorescent group, and the other is connected with a quenching group.

[0026] In some preferred embodiments of the present application, the 5' end of the Reporter-F can be connected with a fluorescent group or a quenching group, and the 3' end of the Reporter-Q can be connected with a quenching group or a fluorescent group, wherein the reporter groups connected to the Reporter-F and Reporter-Q cannot be of the same type, i.e. when the Reporter-F is connected with a fluorescent group, the Reporter-Q is connected with a quenching group, and vice versa. The specific connection of the fluorescent group and the quenching group to which reporter sequence does not affect the generation of the effect.

[0027] The two reporter sequences (Reporter-F and Reporter-Q) can be complementary paired to form a reporter sequence double-stranded complex. After the formation of the reporter sequence double-stranded complex, no fluorescence signal is generated due to the proximity of the quencher and the fluorescent group.

[0028] In some preferred embodiments of the present application, the Reporter-F is connected with a fluorescent group at the 5' end, and the Reporter-Q is connected with a quencher at the 3' end.

[0029] In some embodiments of the present application, the fluorescent group and the quencher can be any conventional combination of fluorescent group and quencher in the art. In the embodiments of the present application, the fluorescent group is FAM, and the quencher is BHQ-1.

[0030] In the present application, the detection principle of the above-mentioned ctDNA detection probe set is as follows: when the detection sample contains the target ctDNA, the sequence A and the sequence B part of the hairpin sequence H1 will hybridize with the target ctDNA, thereby promoting the opening of the hairpin sequence H1. The sequence B and the sequence C part of the opened hairpin sequence H1 will further hybridize with the sequence E part of the hairpin sequence H2, and finally self-assemble to form a stable double-stranded DNA complex H1-H2 (the target ctDNA is displaced). The double-stranded DNA complex further forms a reporter molecule complex with Reporter-F and Reporter-Q, and generates a product H1-H2-Reporter-F. Since Reporter-F and Reporter-Q are separated, the fluorescent group and the quencher connected with them are separated, and a fluorescence signal is generated. At the same time, the displaced target ctDNA can participate in the next round of reaction cycle until the hairpin sequence H1 and the hairpin sequence H2 in the system are completely consumed, and finally the signal amplification detection of the ctDNA is realized.

[0031] When the detection sample does not contain the target ctDNA, the hairpin sequence H1 cannot be opened, and thus the subsequent reaction cannot be triggered, so that the fluorescence intensity does not change.

[0032] In a second aspect of the present application, a detection reagent is provided, which contains the ctDNA detection probe set of the first aspect of the present application.

[0033] In some embodiments of the present application, the detection reagent further contains other auxiliary agents, such as buffer or other solvents.

[0034] In a third aspect of the present application, the use of the ctDNA detection probe set of the first aspect of the present application in the preparation of a ctDNA detection product is provided.

[0035] In some embodiments of the present application, the product comprises a detection reagent, a detection kit, a detection chip.

[0036] Of course, the skilled in the art can independently package the ctDNA detection probe set in the product or adopt other combination forms according to the actual use requirements, but the above changes are all based on the conventional replacement of the present application and should belong to the scope protected by the present application.

[0037] In some embodiments of the present application, the use method of the ctDNA detection product is:

[0038] (1) respectively anneal the hairpin sequence H1, the hairpin sequence H2 and the reporter sequence group in claims 1-5 to obtain the hairpin sequence H1 and H2 with folded structure, and the reporter molecule complex;

[0039] (2) mix the hairpin sequence H1 and H2 with folded structure, and the reporter molecule complex, add the detection sample, react at 37±1℃ for at least 35min, compare the fluorescence intensity change before and after the reaction, and judge whether the target ctDNA is contained in the detection sample.

[0040] In some embodiments of the present application, the annealing system of the hairpin sequence H1 and the hairpin sequence H2 is:

[0041] Component Amount TNaK buffer 1× Hairpin sequence H1 or Hairpin sequence H2 Final concentration 4 μM

[0042] The specific composition of the TNaK buffer is: the final concentration of Tris is 20mM, the final concentration of NaCl is 140mM, the final concentration of KCl is 5mM, and the pH is 7.5. The annealing procedure is: keeping at 95℃ for 5min, and keeping at 25℃ for 2h.

[0043] In some embodiments of the present application, the annealing system of the reporter sequence group is:

[0044] Component Amount TNaK buffer 1× Reporter-F Final concentration 10 μM Reporter-Q Final concentration 20 μM

[0045] The annealing procedure is: keeping at 95℃ for 1min, and then slowly reducing to 25℃ at a speed of 0.1℃ / s.

[0046] In some embodiments of the present application, the target ctDNA detection system

[0047] Component Amount TNaK buffer 1× Hairpin sequence H1 with folding structure Final concentration 50-100 nM H2 hairpin sequence with fold structure Final concentration 200-400 nM Reporter complex 50 nM Test sample -

[0048] The reaction procedure is: reacting at 37±1℃ for at least 35min, and quantitatively detecting the content of the target ctDNA in the sample by fluorescence intensity.

[0049] In some preferred embodiments of the present application, the target ctDNA detection system

[0050]

[0051]

[0052] Incubate at 37℃ for 40 min.

[0053] In some embodiments of the present application, the criterion for judging in step (2) is:

[0054] If there is no significant difference in fluorescence intensity before and after the reaction, the sample does not contain the target ctDNA.

[0055] If there is a significant difference in fluorescence intensity before and after the reaction, the sample contains the target ctDNA.

[0056] In some embodiments of the present application, the ctDNA detection product is used for early diagnosis of cancer.

[0057] In some embodiments of the present application, the cancer is breast cancer.

[0058] In the prior art, the detection method for ctDNA is complicated, time-consuming and high-cost, and it is difficult to be widely used in routine clinical detection in a true sense. In the present application, the inventors construct a rapid, convenient and high-sensitivity constant-temperature enzyme-free CHA reaction system, the detection time is only 40 min, and the detection limit can reach 7 pM. The system is composed of a hairpin sequence group and a reporter sequence group labeled with a fluorescent group and a quenching group. The system has high signal gain, low background, good selectivity and specificity, and good serum stability. Through the system, the ctDNA detection in serum samples can be effectively realized, and the inventors also optimize the component ratio and operation conditions, truly realize the rapid, convenient and high-sensitivity detection of low-abundance (trace amount) tumor marker ctDNA in serum, so as to obtain the ctDNA expression profile characteristics for early diagnosis of breast cancer, and provide a solid foundation for early diagnosis of breast cancer.

[0059] The beneficial effects of the present application are:

[0060] 1. The present application provides a ctDNA detection probe group, which is composed of a hairpin sequence group obtained by precise controllable design and a reporter sequence group labeled with a fluorescent group and a quenching group. The detection limit of the ctDNA can reach 7 pM, and it has high signal gain, low background, good selectivity and specificity, and good serum stability.

[0061] 2.The present application constructs a constant-temperature enzyme-free system for ctDNA detection, which can effectively overcome the problem of low detection sensitivity caused by low abundance of tumor marker ctDNA in the serum of cancer patients in the prior art, and has the advantages of short detection time, simple operation and low cost, thereby providing an intelligent small molecule diagnostic tool integrating "input-amplification-output" for early diagnosis of cancer, especially breast cancer-related diseases. BRIEF DESCRIPTION OF DRAWINGS

[0062] Figure 1 The simulation of the report sequence double-stranded complex formed by the hairpin sequence H1, the hairpin sequence H2 and the two report sequences in the NUPACK software in the embodiment of the present application.

[0063] Figure 2 The principle diagram of the constant-temperature enzyme-free system for detecting ctDNA in the embodiment of the present application.

[0064] Figure 3 The polyacrylamide gel electrophoresis diagram of the constant-temperature enzyme-free system in the embodiment of the present application; the lanes are respectively: (1) H1; (2) H2; (3) mixture of H1+H2; (4) mixture of ctDNA+H1; (5) mixture of ctDNA+H1+H2.

[0065] Figure 4 The fluorescence comparison diagram of the hairpin sequence concentration optimization test in the embodiment of the present application.

[0066] Figure 5 The fluorescence comparison diagram of the reaction time optimization test in the embodiment of the present application.

[0067] Figure 6 The detection results of the constant-temperature enzyme-free system for detection samples containing different concentrations of target ctDNA in the embodiment of the present application, wherein A is a fluorescence kinetic curve diagram, and B is a fluorescence intensity ratio linear diagram of the constant-temperature enzyme-free system for detecting corresponding concentration of target ctDNA when the reaction time is 40 min.

[0068] Figure 7 The fluorescence comparison diagram of the hairpin sequence deletion test in the embodiment of the present application.

[0069] Figure 8 The fluorescence comparison diagram of the base mismatch experiment in the embodiment of the present application.

[0070] Figure 9 The fluorescence comparison diagram of the selective detection test in the embodiment of the present application.

[0071] Figure 10 The fluorescence comparison diagram of the serum stability experiment in the embodiment of the present application. DETAILED DESCRIPTION

[0072] In order to make the invention purposes, technical solutions and technical effects of the present application clearer, the present application will be further described in detail in combination with specific embodiments. It should be understood that the specific embodiments described in the specification are only for the purpose of explaining the present application, and are not intended to limit the present application.

[0073] The experimental materials and reagents used are conventional consumables and reagents available from commercial channels, unless otherwise specified.

[0074] Construction of a constant-temperature enzyme-free system for detecting ctDNA

[0075] In the embodiments of the present application, the constant-temperature enzyme-free system for detecting ctDNA is composed of a hairpin sequence H1, a hairpin sequence H2, and two reporter sequences (Reporter-F and Reporter-Q) each connected with a fluorescent group and a quenching group.

[0076] The nucleotide sequence of the hairpin sequence H1 is: 5’- ATCCTCTCTCTAAAATCACTGAG CCATGTGTAGACTCAGTGATTTTAGACCTTGTCATAGAGCAC-3’ (SEQ ID NO: 1).

[0077] Among them, the underlined part is sequence A (5’-CCATGTGTAGACTCAGTGA-3’) and sequence B (3’-TTTTAGACCTTGTCATAGAGCAC-5’) of the hairpin sequence H1, which is used to target the target ctDNA. ATCCTCTC TCTAAAATCACTGAG

[0078] The nucleotide sequence of the hairpin sequence H2 is: 5’- TCACTGAGTCTACACATGGCTCAGTGATTTTAGA CCATGTGTAGA-3’ (SEQ ID NO: 2).

[0079] Among them, the underlined part is sequence E (5’-CCATGTGTAGA-3’) of the hairpin sequence H2, which is used to bind sequence B and sequence C of the hairpin sequence H1, and displace the target ctDNA through a strand displacement reaction to form an H1-H2 complex. CCATGTGTAGA is sequence F of the hairpin sequence H2.

[0080] The hairpin sequence H1 and the hairpin sequence H2 form a stable double-stranded DNA complex (H1-H2) under the initiation of the target ctDNA.

[0081] The nucleotide sequence of the reporter sequence is:

[0082] Reporter-F: 5’-CGAGTGCTCTATGACAAGGTCTAAAA-3’ (SEQ ID NO: 3).​​

[0083] Reporter-Q: 5'-CCTTGTCATAGAGCACTCG-3' (SEQ ID NO: 4).

[0084] The 5' end of the reporter sequence Reporter-F can be connected with a fluorescent group or a quenching group, and the 3' end of Reporter-Q can be connected with a quenching group or a fluorescent group, wherein the reporter groups connected by Reporter-F and Reporter-Q cannot be of the same type, that is, when Reporter-F is connected with a fluorescent group, Reporter-Q is connected with a quenching group, and vice versa. The specific connection of the fluorescent group and the quenching group to which reporter sequence does not affect the generation of the effect.

[0085] The two reporter sequences can be complementary to each other to form a reporter sequence double-stranded complex. After forming the reporter sequence double-stranded complex, the quenching group and the fluorescent group are close, so that no fluorescent signal is generated.

[0086] In the embodiment of the present application, Reporter-F is connected with a fluorescent group at the 5' end, and Reporter-Q is connected with a quenching group at the 3' end.

[0087] The fluorescent group and the quenching group can be any conventional fluorescent group and quenching group in the art. In the embodiment of the present application, the fluorescent group is FAM, and the quenching group is BHQ-1.

[0088] In the embodiment of the present application, the simulation of the reporter sequence double-stranded complex formed by the hairpin sequence H1, the hairpin sequence H2 and the two reporter sequences in the NUPACK software is as shown in Figure 1 .

[0089] The principle of the isothermal enzyme-free system for detecting ctDNA in the embodiment of the present application is as shown in Figure 2 .

[0090] When the sample contains the target ctDNA (in this embodiment, the target ctDNA is set as PIK3CA E545K, the nucleotide sequence of which is 5'-CTCAGTGATTTTAGAGAGAGGAT-3' (SEQ ID NO: 5), and of course, the target ctDNA in the embodiment of the present application can also be set as a specific ctDNA according to the actual situation, and the specific nucleotide composition of the hairpin sequence H1, the hairpin sequence H2 and the reporter sequence is adaptively adjusted according to the principle of complementary pairing), the sequence A and the sequence B part of the hairpin sequence H1 will hybridize with the target ctDNA, so as to promote the opening of the hairpin sequence H1. The sequence B and the sequence C part of the opened hairpin sequence H1 will further hybridize with the sequence E part of the hairpin sequence H2, and finally self-assemble to form a stable double-stranded DNA complex H1-H2 (the target ctDNA is replaced). The double-stranded DNA complex further undergoes strand displacement reaction with the reporter molecule complex formed by the Reporter-F and the Reporter-Q to generate the product H1-H2-Reporter-F. Since the Reporter-F and the Reporter-Q are separated, the fluorescent group and the quencher group connected to the two are separated, and a fluorescent signal is generated. At the same time, the replaced target ctDNA can participate in the next round of reaction cycle until the hairpin sequence H1 and the hairpin sequence H2 in the system are completely consumed, and finally the signal amplification detection of the ctDNA is realized.

[0091] When the sample does not contain the target ctDNA, the hairpin sequence H1 cannot be opened, and therefore the subsequent reaction cannot be triggered, so that the fluorescence intensity does not change.

[0092] In the embodiment of the present application, the specific detection method of the above-mentioned constant-temperature enzyme-free system is as follows:

[0093] (1) Preparation of the hairpin sequence H1 and the hairpin sequence H2:

[0094] The hairpin sequence H1 and the hairpin sequence H2 are synthesized according to the nucleotide sequences of the hairpin sequence H1 and the hairpin sequence H2, and then are respectively placed in the system shown in Table 1 for annealing treatment to form a folded structure.

[0095] Table 1 Annealing system of hairpin sequence

[0096] Component Amount TNaK buffer 1× Hairpin sequence H1 or Hairpin sequence H2 Final concentration 4 μM

[0097] The specific composition of the TNaK buffer is as follows: the final concentration of Tris is 20 mM, the final concentration of NaCl is 140 mM, the final concentration of KCl is 5 mM, and the pH is 7.5.

[0098] The annealing procedure is as follows: keeping at 95℃ for 5 min, and keeping at 25℃ for 2 h. The hairpin sequence H1 and the hairpin sequence H2 with folded structure are obtained respectively.

[0099] (2) The reporter sequence and the construction of the reporter molecular complex:

[0100] Reporter-F and Reporter-Q are synthesized according to the nucleotide sequence of the reporter sequence, and then annealing treatment is performed according to the system shown in Table 2 to form the reporter molecular complex.

[0101] Table 2 Annealing system of reporter molecular complex

[0102] Component Amount TNaK buffer 1× Reporter-F Final concentration 10 μM Reporter-Q Final concentration 20 μM

[0103] The annealing procedure is as follows: keeping at 95℃ for 1 min, and then slowly reducing to 25℃ at a speed of 0.1℃ / s. The reporter molecular complex without fluorescence is obtained.

[0104] (3) Detection of target ctDNA:

[0105] The hairpin sequence H1 and the hairpin sequence H2 with folded structure obtained in the above steps and the reporter molecular complex are mixed according to the system shown in Table 3.

[0106] Table 3 System for detecting target ctDNA

[0107]

[0108]

[0109] The target ctDNA content in the sample is quantitatively detected by fluorescence intensity after 40 min of reaction at 37℃.

[0110] Feasibility of isothermal enzyme-free system for detecting ctDNA

[0111] (1) Gel electrophoresis experiment verifies the feasibility of the isothermal enzyme-free system:

[0112] In this embodiment, the target ctDNA is set as PIK3CA E545K, the nucleotide sequence of which is 5'-CTCAGTGATTTTAGAGAGAGGAT-3'(SEQ ID NO: 5), and the specific nucleotide composition of the hairpin sequence H1, the hairpin sequence H2 and the reporter sequence used are the sequences in the above embodiment. Of course, the target ctDNA in the embodiment of the present application can also be set as a specific ctDNA according to the actual situation, and the specific nucleotide composition of the hairpin sequence H1, the hairpin sequence H2 and the reporter sequence is adjusted adaptively according to the principle of complementary pairing.

[0113] The experiment is divided into 5 groups: (1) containing only hairpin sequence H1; (2) containing only hairpin sequence H2; (3) mixture of hairpin sequence H1 and hairpin sequence H2; (4) mixture of target ctDNA and hairpin sequence H1; (5) mixture of target ctDNA, hairpin sequence H1 and hairpin sequence H2.

[0114] In each experimental group, the final concentration of hairpin sequence H1 and hairpin sequence H2 is 400 nM, and the concentration of target ctDNA is 100 nM.

[0115] The specific test method is as follows:

[0116] Each of the above experimental group samples is 10 μL, respectively, and after 1 h of reaction at 37°C in 1xTNaK buffer, 2 μL of DNA loading buffer is added for mixing, and then loaded into a polyacrylamide gel (9%), and the electrophoresis buffer is 1xTBE buffer (89 mM Tris-Borate and 2 mM EDTA, pH 8.3). Electrophoresis is carried out at a working voltage of 100 V. After electrophoresis, staining with GelRed for 30 min, and then gel imaging.

[0117] The results are shown in Figure 3 .

[0118] As can be seen from the gel image, lane 1 (group (1)) and lane 2 (group (2)) have only hairpin sequences H1 and H2, respectively. Similarly, in group (3) without the addition of target ctDNA, no new band appears, indicating that the mixture of hairpin sequences H1 and H2 can stably coexist without mutual hybridization reaction. In group (4), a new electrophoresis band appears due to the addition of target ctDNA, indicating that hairpin sequence H1 and ctDNA can hybridize to generate H1-Target product. In group (5), which contains target ctDNA and hairpin sequences H1 and H2, another bright new band appears in lane 5, and the electrophoretic mobility is lower than that of lane (4), indicating that under the initiation of target ctDNA, hairpin sequences H1 and H2 hybridize to each other to generate H1-H2 complex. The above results show that the above isothermal enzyme-free system can only be initiated by target ctDNA, and the system has high signal gain and negligible background, proving the successful operation of the isothermal enzyme-free system.

[0119] Optimization of isothermal enzyme-free system for detecting ctDNA

[0120] In order to further optimize the reaction system composition of the above isothermal enzyme-free system for detecting ctDNA, the inventors used fluorescence experiments to verify.

[0121] (1) Optimization of the concentration of hairpin sequence

[0122] Three groups of experiments with different concentrations of hairpin sequences H1 and H2 were set up in the detection system shown in Table 4 in a 96-well plate, and the total volume of the reaction solution was set to 200 μL.

[0123] Table 4 Verification test of the optimization of the concentration of hairpin sequence

[0124]

[0125] The target ctDNA content in the sample was quantitatively detected by fluorescence intensity at 37°C for 40 min. The fluorescence detection used a filter with an excitation wavelength of 485 nm and an emission wavelength of 535 nm.

[0126] The results are shown in Table 5. Figure 4

[0127] F0 and F are the fluorescence intensity values before and after the addition of target ctDNA to the reaction, respectively. From the F / F0 ratio of the fluorescence signal obtained to the background signal, it can be determined that the optimal combination concentration of hairpin sequences H1 and H2 in the above constant-temperature enzyme-free CHA reaction system is 50 nM:400 nM. Figure 4

[0128] (2) Optimization of reaction time

[0129] Further, the optimal combination concentration of hairpin sequences H1 and H2 (50 nM:400 nM) was used to construct the detection system (same as Table 4) to detect the effect of reaction time on the above constant-temperature enzyme-free CHA reaction system.

[0130] The reaction temperature was 37°C, and the time was set to 0-175 min.

[0131] The results are shown in Table 5. Figure 5

[0132] F0 and F are the fluorescence intensity values before and after the addition of target ctDNA to the reaction, respectively. From the F / F0 ratio of the fluorescence signal obtained to the background signal, it can be determined that the optimal reaction time of the above constant-temperature enzyme-free CHA reaction system is 40 min. Figure 4

[0133] Detection effect of the constant-temperature enzyme-free system for detecting ctDNA

[0134] (1) Detection sensitivity:

[0135] According to the optimal reaction conditions obtained in the above optimization test, the detection system shown in Table 5 was constructed. The detection effect of the above constant-temperature enzyme-free CHA reaction system was tested by detection samples containing different concentrations of target ctDNA.​​​​

[0136] Table 5: Detection system of constant temperature enzyme-free CHA reaction system

[0137] Component Amount TNaK buffer 1× Hairpin sequence H1 with folding structure Final concentration 50 nM H2 hairpin sequence with fold structure Final concentration 400 nM Reporter complex 50 nM Test sample -

[0138] Wherein, the target ctDNA concentration in the detection sample is 0 (Blank), 10 pM, 50 pM, 100 pM, 200 pM, 500 pM, 1 nM, 2 nM, 5 nM, respectively.

[0139] Reaction at 37°C for 40 min, and the target ctDNA content in the sample was quantitatively detected by fluorescence intensity. The fluorescence detection selected the filter with excitation wavelength of 485 nm and emission wavelength of 535 nm.

[0140] The results are shown in Figure 6 .

[0141] It can be found from Figure 6 that the constant temperature enzyme-free CHA reaction system has good fluorescence response to different concentrations of ctDNA (0-5 nM). According to the 3σ / K method (σ is the standard deviation of the blank group of the constant temperature enzyme-free CHA reaction system, and K is the slope of the linear Figure 6 B), the detection limit of the constant temperature enzyme-free CHA reaction system for ctDNA is calculated to be 7 pM.

[0142] (2) Detection specificity:

[0143] In order to verify the detection specificity of the constant temperature enzyme-free CHA reaction system, the inventors set the following verification tests:

[0144] A. Hairpin sequence deletion test:

[0145] The sequence shown in SEQ ID NO: 5 is the target ctDNA, and the detection is carried out according to the system shown in Table 5. Group 1 is set as no hairpin sequence H1 (-H1), group 2 is set as no hairpin sequence H2 (-H2), and group 3 is the complete constant temperature enzyme-free CHA reaction system (CHA).

[0146] Reaction at 37°C for 40 min, and the target ctDNA content in the sample was quantitatively detected by fluorescence intensity.

[0147] The results are shown in Figure 7 .

[0148] From the difference of fluorescence intensity ratio shown in the hairpin sequence deletion test, it can be shown that the constant temperature enzyme-free CHA reaction system can effectively avoid the background leakage problem.

[0149] B. Base mismatch experiment:

[0150] Mismatched sequences 1 to 3 (denoted as 1-Mut, 2-Mut, and 3-Mut, respectively) were set up using the sequence shown in SEQ ID NO: 5 as a template (0-Mut), and a blank control was also set up. The detection system is the same as in Table 5.

[0151] The sequences for 1-Mut, 2-Mut, and 3-Mut are as follows:

[0152] 1-Mut: 5'-CTCAGTGATTTAAGAGAGAGGAT-3' (SEQ ID NO: 6);

[0153] 2-Mut: 5'-CTCAGTGATTTAAGAGTGAGGAT-3' (SEQ ID NO: 7);

[0154] 3-Mut: 5'-CTCAGAGATTTAAGAGTGAGGAT-3' (SEQ ID NO: 8).

[0155] The sample was reacted at 37°C for 40 min, and the content of the target ctDNA in the sample was quantitatively detected by fluorescence intensity.

[0156] The results are as follows Figure 8 As shown.

[0157] The difference in fluorescence intensity ratio in the base mismatch experiment demonstrates that the above-mentioned isothermal enzyme-free CHA reaction system has the ability to distinguish single base mismatches (1-Mut) in ctDNA, and therefore has good specificity.

[0158] C. Selective detection test:

[0159] The inventors selected the above-mentioned ctDNA and ctDNA analogs such as miR-155, let-7a and miR-429 in the field as detection targets, and used the detection system shown in Table 5 above for detection.

[0160] The sequences of miR-155, let-7a, and miR-429 are as follows:

[0161] miR-155: 5'-UUAAUGCUAAUCGUGAUAGGGGU-3' (SEQ ID NO: 9);

[0162] let-7a: 5'-UGAGGUAGUAGGUUGUAUAGUU-3' (SEQ ID NO: 10);

[0163] miR-429: 5'-UAAUACUGUCUGGUAAAACCGU-3' (SEQ ID NO: 11).

[0164] Results are shown in Figure 9

[0165] From the difference of fluorescence intensity ratio in the selective detection test, it can be shown that the above-mentioned constant-temperature enzyme-free CHA reaction system has good selectivity in the ctDNA analog.

[0166] D. Serum stability experiment:

[0167] In order to verify the anti-interference ability of the above-mentioned constant-temperature enzyme-free CHA reaction system, the inventors respectively used serum (10% serum, 20% serum, 50% serum and 100% serum, Ser represents serum) containing or not containing target ctDNA in different concentration ratios as detection samples for detection, and set blank control (PBS Buffer) at the same time. The detection system is the same as Table 5.

[0168] Results are shown in Figure 10

[0169] From the difference of fluorescence intensity ratio in the serum stability experiment, it can be shown that the above-mentioned constant-temperature enzyme-free CHA reaction system can well detect the target ctDNA in serum containing or not containing target ctDNA in different concentration ratios, and has good anti-interference ability.

[0170] In summary, the above results show that the above-mentioned constant-temperature enzyme-free CHA reaction system can be effectively applied to the liquid biopsy application of ctDNA, and can lay effective technical support and theoretical basis for the early diagnosis of breast cancer and related diseases.

[0171] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above embodiments, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement methods, and all are included in the protection scope of the present application. SEQUENCE LISTING <110> Guangdong Provincial Academy of Sciences Institute of Biology and Medical Engineering <120> Construction of a constant-temperature enzyme-free system for detecting ctDNA and its application <130> <160> 11 <170> PatentIn version 3.5 <210> 1 <211> 65 <212> DNA <213> Artificial sequence <400> 1​​ atcctctctc taaaatcact gagccatgtg tagactcagt gattttagac cttgtcatag 60 agcac 65 <210> 2 <211> 45 <212> DNA <213> Artificial Sequence <400> 2 tcactgagtc tacacatggc tcagtgattt tagaccatgt gtaga 45 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <400> 3 cgagtgctct atgacaaggt ctaaaa 26 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <400> 4 ccttgtcata gagcactcg 19 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <400> 5 ctcagtgatt ttagagagag gat 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <400> 6 ctcagtgatt taagagagag gat 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <400> 7 ctcagtgatt taagagtgag gat 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <400> 8 ctcagagatt taagagtgag gat 23 <210> 9 <211> 23 <212> RNA <213> Artificial Sequence <400> 9 uuaaugcuaa ucgugauagg ggu 23 <210> 10 <211> 22 <212> RNA <213> Artificial Sequence <400> 10 ugagguagua gguuguauag uu 22 <210> 11 <211> 22 <212> RNA <213> Artificial Sequence <400> 11 uaauacuguc ugguaaaacc gu 22

Claims

1. Application of the ctDNA detection probe set in the preparation of a breast cancer ctDNA detection product; The ctDNA detection probe set comprises a hairpin sequence group and a reporter sequence group; The hairpin sequence group comprises a hairpin sequence H1 and a hairpin sequence H2; The reporter sequence group comprises Reporter-F and Reporter-Q; The nucleotide sequence of the hairpin sequence H1 is 5'-ATCCTCTCTCTAAAATCACTGAGCCATGTGTAGACTCAGTGATTTTAGACCTTGTCATAGAGCAC-3'; The nucleotide sequence of the hairpin sequence H2 is 5'-TCACTGAGTCTACACATGGCTCAGTGATTTTAGACCATGTGTAGA-3'; The nucleotide sequence of the Reporter-F is 5'-CGAGTGCTCTATGACAAGGTCTAAAA-3'; The nucleotide sequence of the Reporter-Q is 5'-CCTTGTCATAGAGCACTCG-3'; The ctDNA is breast cancer ctDNA; The nucleotide sequence of the ctDNA is 5'-CTCAGTGATTTTAGAGAGAGGAT-3'; One of the Reporter-F and Reporter-Q is connected with a fluorescent group, and the other is connected with a quenching group.

2. Use according to claim 1, characterized in that, The breast cancer ctDNA detection product comprises a detection reagent, a detection kit, and a detection chip.

3. Use according to claim 1, characterized in that, The use method of the breast cancer ctDNA detection product is as follows: (1) anneal the hairpin sequence H1, the hairpin sequence H2, and the reporter sequence group respectively to obtain hairpin sequences H1 and H2 with folded structures and a reporter molecule complex; (2) mix the hairpin sequences H1 and H2 with folded structures and the reporter molecule complex, add a detection sample, react at 37±1℃ for at least 35 min, compare the fluorescence intensity before and after the reaction, and determine whether the detection sample contains the target ctDNA.

4. Use according to claim 3, characterized in that, The judgment criteria in step (2) are as follows: (1) if there is no significant difference in fluorescence intensity before and after the reaction, the detection sample does not contain the target ctDNA; (2) if there is a significant difference in fluorescence intensity before and after the reaction, the detection sample contains the target ctDNA.