Mask
By setting probe molecules, Cas enzymes and reporter molecules on the detection layer of the mask, in-situ detection of the new coronavirus is achieved, and the problems of false negative risk, high infection risk and low detection efficiency of existing detection methods are solved, and rapid and safe pathogen detection is achieved.
Patent Information
- Application Number
- CN202110162208.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-02-05
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2041-02-05
AI Technical Summary
The existing novel coronavirus detection methods have the risk of false negatives, high risk of infection during sampling, low detection efficiency, and complex and time-consuming testing processes.
A mask was designed, including a cover and a detection layer. The detection layer was provided with probe molecules, Cas enzymes and reporter molecules. The probe molecules specifically recognize the predetermined sequence of the pathogen genome. The Cas enzyme is activated after the probe binds to the sequence, and cleavage of the reporter molecule to generate a detectable signal.
Through this mask, pathogen particles can be collected from the wearer's exhaled aerosol and directly conducted in-situ testing, significantly simplifying the detection process, reducing the risk of infection and contamination, improving detection efficiency, and quickly obtaining the detection results.
Smart Images

Figure CN114847562B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of sanitary products, and more particularly, relates to a pathogen detection mask. Background Art
[0002] COVID-19 is mainly transmitted through respiratory droplets and close contact. In addition, there is also a possibility of aerosol transmission when exposed to high-concentration aerosols with droplets in a relatively enclosed environment for a long time. The novel coronavirus only contains RNA genetic material, and the specific RNA sequence in the virus is the marker for identifying the virus. In clinical tests, if the specific nucleic acid sequence of the novel coronavirus is detected in a patient's sample, then the patient may be infected with the novel coronavirus. Nucleic acid testing by throat swab collection is one of the main methods for diagnosing novel coronavirus infection at present. However, the infection and reproduction site of the novel coronavirus is in the lungs, and its presence in the upper respiratory tract is very small, so there may be false-negative problems in throat swab testing; in addition, during throat swab collection, the sampling personnel are in direct close contact with the person being tested, and the infection risk is also relatively high. Especially when conducting nucleic acid screening on a large scale, each sampling personnel needs to sample the person being tested one by one, and it is impossible to sample multiple people simultaneously, resulting in low efficiency. Moreover, the detection process required after sampling takes a long time. Currently, the nucleic acid test results usually come out 24 hours later; at the same time, throat swab collection also causes discomfort to the person being tested.
[0003] Therefore, the method for collecting detection samples of the novel coronavirus and even other respiratory infection viruses still needs to be further improved. Summary of the Invention
[0004] The present invention aims to solve at least one of the technical problems in the related art to some extent. For this reason, an object of the present invention is to provide a pathogen detection mask. Using this mask can eliminate the sampling operation and significantly simplify the detection process. It can complete sample collection, sampling, and detection without a strict detection environment and sampling and detection personnel with specific qualifications and capabilities, which can greatly reduce the time and labor required for detection, as well as the infection risk of staff and the sample contamination risk during sampling and detection, significantly improve the detection efficiency, and enable the wearer to quickly complete the detection of aerosol particles that may contain pathogens by simply wearing the mask normally and timely obtain the detection result.
[0005] This application is mainly proposed based on the following findings of the inventors:
[0006] COVID-19 is mainly transmitted through droplets, close contact, and aerosols formed by droplets. Obviously, the aerosols exhaled by COVID-19 patients contain the novel coronavirus, and relevant detections such as nucleic acid detection and antibody detection can be carried out by collecting the novel coronavirus carried in the aerosols. The inventor envisioned that an adsorption material could be set on the mask to collect the virus in the aerosols. However, although this setting can complete the collection of aerosol particles that may contain the virus while wearing the mask, avoiding the risk of person-to-person transmission and various discomforts brought to the human body during the sampling process, and realizing simultaneous sampling of multiple people at the same time; but after sampling, the adsorption material needs to be cut or folded into a predetermined size and then immersed in the preservation solution for preservation, and then the viral nucleic acid is extracted, amplified, and detected. This not only has cumbersome operations, a long inspection process, and high costs, but also has harsh detection conditions, high requirements for the detection personnel and the detection site. Among them, the detection site requires standard four-zone separation and air flow control, including reagent preparation, specimen preparation, PCR amplification detection, and amplified product detection test areas; the entire detection experiment process takes about four hours, has high requirements for the physical strength and endurance of the detection personnel, and the opening of the sample, the oscillation and centrifugation of nucleic acid extraction during the detection process may all generate aerosols, with a high detection risk and high protection requirements for the detection personnel; and during the sampling, adsorption material transfer, and detection processes, the sampling personnel and the detection personnel still have too much contact with the adsorption material, with a large infection risk, and the sample also has a contamination risk, which may affect the accuracy of the detection results.
[0007] To this end, according to one aspect of the present invention, the present invention provides a mask, which includes: a mask body; and a detection layer disposed on the mask body, and the detection layer is provided with: probe molecules that specifically recognize a predetermined sequence of a pathogen genome; a Cas enzyme that is adapted to be activated after the probe molecule binds to the predetermined sequence; a reporter molecule that is adapted to be cleaved by the activated Cas enzyme, and the reporter molecule generates a detectable signal after being cleaved. When using this mask, the aerosol exhaled from the mouth of the person to be tested will be adsorbed in the detection layer. If the aerosol contains the predetermined sequence of the pathogen genome, the probe will specifically bind to the predetermined sequence. Further, after the probe and the predetermined sequence specifically bind to form a double-stranded structure, the Cas enzyme can be activated, and the Cas enzyme will further cleave the reporter molecule, so that the reporter molecule generates a detectable signal. Furthermore, by detecting the signal generated by the reporter molecule, it is possible to determine whether the corresponding pathogen, such as a virus particle, such as a novel coronavirus particle, exists in the aerosol. Thus, in-situ detection of the corresponding pathogen is achieved. Therefore, on the one hand, an adsorption material can be used to collect aerosol particles that may contain pathogens exhaled by the wearer to obtain a sample to be tested, avoiding the risk of person-to-person transmission and various discomforts brought to the human body during the sampling process, and at the same time enabling multiple people to be sampled simultaneously; on the other hand, the Crispr-Cas system can be directly used to detect the aerosol obtained from the detection layer. Therefore, using this mask can not only eliminate the sampling operation and significantly simplify the detection process, but also complete sample sampling, sampling and detection without a harsh detection environment and sampling and detection personnel with specific qualifications and capabilities, which can greatly reduce the time and labor required for detection, as well as the infection risk of the staff and the sample contamination risk during the sampling and detection process, significantly improve the detection efficiency, enabling the wearer to quickly complete the detection of aerosol particles that may contain pathogens by simply wearing the mask normally and timely obtain the detection result, so as to know whether they are infected with the pathogen to be tested. It should be noted that this mask is applicable not only to the sampling and detection of the pathogen of novel coronavirus pneumonia, but also to the sampling and detection of pathogens of other pneumonias and respiratory infections.
[0008] In addition, the pathogen detection mask according to the above embodiments of the present invention may further have the following additional technical features:
[0009] According to some embodiments of the present invention, the pathogen includes the novel coronavirus.
[0010] According to some embodiments of the present invention, the predetermined sequence includes at least one selected from the following: SEQ ID NO:1 and SEQ ID NO:2.
[0011] N gene fragment:
[0012] CCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTG(SEQ ID NO:1)
[0013] E gene fragment:
[0014] ACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCTTAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATT(SEQ ID NO:2)
[0015] According to some embodiments of the present invention, the probe molecule contains
[0016]
[0017] According to some embodiments of the present invention, the Cas enzyme includes at least one of Cas12 and Cas13.
[0018] According to some embodiments of the present invention, the Cas enzyme includes at least one of AsCas12a, FnCas12a, AaCas12b, LbCas12a and LwaCas13a.
[0019] According to some embodiments of the present invention, the Cas enzyme includes at least one of LbCas12a and LwaCas13a.
[0020] According to some embodiments of the present invention, the detection layer further comprises: a lysis agent, which is adapted to lyse the pathogen to release the genome of the pathogen.
[0021] According to some embodiments of the present invention, the lysis agent comprises at least one of Triton, NP-40 lysis reagent, CHAPS lysis reagent, and Tween.
[0022] According to some embodiments of the present invention, the lysis agent is in the form of a dry powder.
[0023] According to some embodiments of the present invention, the detection layer further comprises:
[0024] a nucleic acid amplification reagent, which is adapted to amplify at least a part of the genome of the pathogen.
[0025] According to some embodiments of the present invention, the nucleic acid amplification reagent is a reagent suitable for isothermal amplification.
[0026] According to some embodiments of the present invention, the nucleic acid amplification reagent is a reagent suitable for RT-RPA.
[0027] According to some embodiments of the present invention, the nucleic acid amplification reagent is in the form of a dry powder.
[0028] According to some embodiments of the present invention, a plurality of regions are defined on the detection layer, and the probes arranged in the plurality of regions respectively recognize the predetermined regions of different sequences.
[0029] According to some embodiments of the present invention, the detection layer defines a first region and a second region, wherein the probes in the first region specifically recognize the E gene, and the probes in the second region specifically recognize the N gene.
[0030] According to some embodiments of the present invention, the reporter molecule is a single-stranded nucleic acid molecule.
[0031] According to some embodiments of the present invention, a fluorescent group and biotin are respectively carried at both ends of the single-stranded nucleic acid molecule.
[0032] According to some embodiments of the present invention, the single-stranded nucleic acid molecule carries biotin, and the detection layer is connected to a lateral flow test strip.
[0033] According to some embodiments of the present invention, the detection layer further comprises:
[0034] a water storage member, which is configured to controllably supply water to the detection layer.
[0035] According to some embodiments of the present invention, the water storage member is a crushable water storage bag.
[0036] According to some embodiments of the present invention, the detection layer includes: a hydrophobic material sub-layer disposed on the side of the detection layer away from the oral cavity; a hydrophilic material sub-layer disposed on the side of the detection layer away from the hydrophobic material sub-layer; and a water-absorbing material sub-layer disposed between the hydrophobic material sub-layer and the hydrophilic material sub-layer.
[0037] According to some embodiments of the present invention, the cover body includes: a transparent region, and the detection layer is disposed on the side of the transparent region close to the oral cavity.
[0038] Additional aspects and advantages of the present invention will be given in part in the following description, become apparent in part from the following description, or be learned through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] The above and / or additional aspects and advantages of the present invention will become apparent and be readily understood from the description of the embodiments in conjunction with the following drawings, in which:
[0040] Figure 1 is a partial structural schematic diagram of a mask according to an embodiment of the present invention.
[0041] Figure 2 is a partial structural schematic diagram of a mask according to another embodiment of the present invention.
[0042] Figure 3 is a partial structural schematic diagram of a mask according to still another embodiment of the present invention.
[0043] Figure 4 is a partial structural schematic diagram of a mask according to still another embodiment of the present invention.
[0044] Figure 5 is a partial structural schematic diagram of a mask according to still another embodiment of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0045] Embodiments of the present invention will be described in detail below. Examples of the embodiments are shown in the drawings, where the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the drawings are exemplary and are intended to explain the present invention and should not be construed as limiting the present invention.
[0046] It should be noted that the RT-RPA used in this article refers to the improved RT-RPA method, that is, the reverse transcription-enzymatic recombinase amplification (RT-ERA) technology, which realizes the ultra-sensitive rapid detection of the whole process of closed-tube, 30 minutes without thermal cycling, and can be carried out on-site or at home for the RNA of the novel coronavirus. It can not only detect the novel coronavirus, but also its detection scheme can be applied to other RNA viruses that may break out in the future. The first step of this detection technology is to reverse transcribe the viral RNA fragment into cDNA for subsequent nucleic acid amplification; then, by means of isothermal amplification of ERA, combined with appropriate probes, exponential amplification of cDNA and detection of the amplified nucleic acid products are realized. The detection results can be presented either by observing fluorescence or in a more convenient way with a test strip.
[0047] This application is mainly proposed based on the following discoveries of the inventors:
[0048] COVID-19 is mainly transmitted through droplets, close contact, and aerosols formed by droplets. Obviously, the aerosols exhaled by COVID-19 patients contain the novel coronavirus, and relevant detections such as nucleic acid detection and antibody detection can be carried out by collecting the novel coronavirus carried in the aerosols. The inventors envisioned that an adsorption material could be set on the mask to collect the virus in the aerosol. However, although this setting can complete the collection of aerosol particles that may contain the virus while wearing the mask, avoiding the risk of person-to-person transmission and various discomforts brought to the human body during the sampling process, and realizing simultaneous sampling of multiple people at the same time; but after sampling, the adsorption material needs to be cut or folded into a predetermined size and then immersed in the preservation solution for preservation, and then the viral nucleic acid is extracted, amplified and detected. This is not only cumbersome in operation, time-consuming in the inspection process, and high in cost, but also has harsh detection conditions and high requirements for the detection personnel and the detection site. Among them, the detection site requires standard four-zone separation and air flow control, including reagent preparation, specimen preparation, PCR amplification detection, and amplified product detection test areas; the entire detection experiment process takes about four hours, with high requirements for the physical strength and endurance of the detection personnel, and the opening of the sample, shaking and centrifugation during nucleic acid extraction during the detection process may all generate aerosols, with a high detection risk and high requirements for the protection of the detection personnel; and during the sampling, adsorption material transfer and detection process, the sampling personnel and the detection personnel still have too much contact with the adsorption material, with a relatively high infection risk, and there is also a risk of sample contamination, which may affect the accuracy of the detection results.
[0049] To this end, according to one aspect of the present invention, the present invention provides a mask, which includes: a mask body 100 and a detection layer 200. The detection layer 200 is disposed on the mask body 100, and the detection layer 200 is provided with: probe molecules, which specifically recognize a predetermined sequence of a pathogen genome; Cas enzymes, which are adapted to be activated after the probe molecules bind to the predetermined sequence; a reporter molecule, which is adapted to be cleaved by the activated Cas enzyme, and the reporter molecule generates a detectable signal after being cleaved. When using this mask, the aerosol exhaled from the mouth of the person to be tested will be adsorbed in the detection layer. If the aerosol contains the predetermined sequence of the pathogen genome, the probe will specifically bind to the predetermined sequence. Further, after the probe and the predetermined sequence specifically bind to form a double-stranded structure, the Cas enzyme can be activated. The Cas enzyme will further cleave the reporter molecule, so that the reporter molecule generates a detectable signal. Furthermore, by detecting the signal generated by the reporter molecule, it can be determined whether the corresponding pathogen exists in the aerosol, such as virus particles, such as novel coronavirus particles, etc. Thus, in-situ detection of the corresponding pathogen is achieved. Therefore, on the one hand, an adsorption material can be used to collect the aerosol particles that may contain pathogens exhaled by the wearer, obtaining a sample to be tested, avoiding the risk of person-to-person transmission and various discomforts brought to the human body during the sampling process, and at the same time enabling multiple people to be sampled simultaneously; on the other hand, the Crispr-Cas system can be directly used to detect the aerosol obtained from the detection layer. Therefore, using this mask can not only eliminate the sampling operation and significantly simplify the detection process, but also complete sample sampling, sampling and detection without a harsh detection environment and sampling and detection personnel with specific qualifications and capabilities, which can greatly reduce the time and labor required for detection, as well as the infection risk of the staff and the sample contamination risk during the sampling and detection process, significantly improve the detection efficiency, enabling the wearer to quickly complete the detection of aerosol particles that may contain pathogens by simply wearing the mask normally and promptly obtain the detection result, so as to know whether they are infected with the pathogen to be tested. It should be noted that this mask is not only applicable to the sampling and detection of the pathogen of novel coronavirus pneumonia, but also applicable to the sampling and detection of the pathogens of other pneumonias and respiratory tract infections.
[0050] It should be noted that this mask is not only applicable to the sampling and detection of the pathogen of novel coronavirus pneumonia, but also applicable to the sampling and detection of the pathogens of other pneumonias and respiratory tract infections, such as SARS virus, influenza virus, Corynebacterium diphtheriae, Bordetella pertussis, Group A streptococcus, Mycobacterium tuberculosis, measles virus, mumps virus, Neisseria meningitidis, etc. In addition, those skilled in the art can understand that this mask may also have other components, such as ear straps, etc., which are well-known to those skilled in the art and will not be elaborated here.
[0051] The following refers to Figures 1 to 5A detailed description of the pathogen detection mask of the above embodiments of the present invention is given.
[0052] As described above, for the specific type of pathogen to be detected, those skilled in the art need to design a specific predetermined region. Additionally, considering the rapid mutation of pathogens, the predetermined region needs to be carefully screened to improve the accuracy and sensitivity of detection. According to some embodiments of the present invention, the predetermined region includes at least one selected from the following:
[0053] N gene fragment
[0054] CCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTG(SEQ ID NO:1)
[0055] E gene fragment
[0056] ACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCTTAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATT(SEQ ID NO:2)
[0057] By adopting the above-mentioned predetermined sequence, the novel coronavirus can be effectively detected, avoiding the detection failure caused by mutations.
[0058] According to some embodiments of the present invention, the probe molecule contains
[0059]
[0060]
[0061] By adopting the above-mentioned probe molecules, the conserved regions of the N gene and the E gene can be recognized, thereby further improving the detection sensitivity and avoiding the detection failure caused by mutations. Of course, for the novel coronavirus, the novel coronavirus gene encodes multiple structural proteins, such as S protein, N protein, E protein, M protein, etc. These proteins include multiple antigenic epitopes. Therefore, when detecting the novel coronavirus, the principle of specific binding of antigen and antibody can be utilized to set one or more pathogen detection regions, and the targets in the pathogen detection regions include at least one of the S protein, N protein, E protein, and M protein of the novel coronavirus, thereby improving the reliability of the novel coronavirus detection result.
[0062] According to some embodiments of the present invention, the Cas enzyme includes at least one of Cas12 and Cas13. According to the embodiments of the present invention, Cas12 can be activated by DNA and has non-specific cleavage activity on single-stranded DNA, can completely degrade single-stranded DNA. The cleaved single-stranded DNA does not necessarily require a target sequence, and the target sequence part will not be cleaved. Since the cleaved probe is DNA, it is easier to preserve and more stable than an RNA probe, so the detection system is more stable. The detection system of Cas12 is easier to expand to detect other DNA pathogens, such as adenovirus. Cas13 is an RNA nuclease that depends on RNA targeting, specifically cleaves RNA and does not cleave DNA. It can specifically cleave the target RNA gene and can also incidentally cleave the RNA reporter molecule.
[0063] According to some embodiments of the present invention, the Cas enzyme includes at least one of AsCas12a, FnCas12a, AaCas12b, LbCas12a, and LwaCas13a.
[0064] According to some embodiments of the present invention, the Cas enzyme includes at least one of LbCas12a and LwaCas13a.
[0065] According to some embodiments of the present invention, the detection layer further includes: a lysing agent, and the lysing agent is suitable for lysing the pathogen to release the genome of the pathogen. Thus, by using the lysing agent, the pathogen can be lysed, thereby increasing the amount of genomic nucleic acid available for detection in the aerosol sample and further improving the detection sensitivity.
[0066] According to some embodiments of the present invention, the lysing agent includes at least one of Triton, NP-40 lysis reagent, CHAPS lysis reagent, and Tween.
[0067] According to some embodiments of the present invention, the lysis agent is in dry powder form. Thus, the lysis agent does not exert its lysis effect in dry powder form, but only exerts its effect after being mixed with water, thereby enabling the controlled progress of the lysis reaction. Thus, it is suitable for the case where the genome of the virus is an RNA molecule, avoiding the degradation of the RNA molecule after long-term exposure.
[0068] According to some embodiments of the present invention, the detection layer further comprises: a nucleic acid amplification reagent, which is suitable for amplifying at least a part of the genome of the pathogen. According to some embodiments of the present invention, the nucleic acid amplification reagent is a reagent suitable for isothermal amplification. According to some embodiments of the present invention, the nucleic acid amplification reagent is a reagent suitable for RT-RPA. According to some embodiments of the present invention, the nucleic acid amplification reagent is in dry powder form. Thus, the amount of nucleic acid available for detection can be increased by amplification, further improving the detection sensitivity. In addition, the nucleic acid amplification reagent does not exert its lysis effect in dry powder form, but only exerts its effect after being mixed with water, thereby enabling the controlled progress of the amplification reaction. Thus, it is suitable for the case where the genome of the virus is an RNA molecule, avoiding the degradation of the RNA molecule after long-term exposure.
[0069] In addition, referring to Figure 2 , according to some embodiments of the present invention, a plurality of regions 210 and 22 are defined on the detection layer 200, and the probes provided in the plurality of regions respectively recognize the predetermined regions of different sequences. Thus, multiple pathogens can be detected simultaneously, or multiple target sequences of the same pathogen can be detected simultaneously, thereby further improving the detection sensitivity and accuracy. According to some embodiments of the present invention, the detection layer 200 defines a first region 210 and a second region 220, wherein the probes in the first region specifically recognize the E gene, and the probes in the second region specifically recognize the N gene.
[0070] According to some embodiments of the present invention, the reporter molecule is a single-stranded nucleic acid molecule, such as an RNA molecule. According to some embodiments of the present invention, a fluorescent group and a quenching group are respectively carried at both ends of the single-stranded nucleic acid molecule. Thus, by cleaving the single-stranded nucleic acid molecule with the Cas enzyme, the separation of the fluorescent group and the quenching group can be caused, thereby generating a detectable fluorescent group. In addition, according to an embodiment of the present invention, a fluorescent group and a biotin are respectively carried at both ends of the single-stranded nucleic acid molecule. After the single-stranded nucleic acid molecule is cleaved, it is broken into two fragments, one fragment carrying biotin and the other fragment carrying a fluorescent group.
[0071] According to some embodiments of the present invention, the single-stranded nucleic acid molecule carries biotin, and the detection layer is connected to a lateral flow test strip. Due to the cleavage effect of the Cas enzyme, the length of the single-stranded nucleic acid molecule changes significantly. Thus, by detecting the length change of the single-stranded nucleic acid molecule, the detection result can also be obtained. Therefore, it should be noted here that the term "detectable signal" used herein refers to any information that can reflect the cleavage effect of the Cas enzyme on the single-stranded nucleic acid molecule, such as length change, fluorescence change, etc.
[0072] According to some embodiments of the present invention, the two ends of the single-stranded nucleic acid molecule carry a fluorescent group and biotin respectively. After the single-stranded nucleic acid molecule is cleaved by the Cas enzyme, it breaks into two fragments, one fragment carries biotin and the other carries a fluorescent group. The above two fragments enter the lateral flow test strip. The fragment carrying biotin is captured by streptavidin located in the control region (C-Line). The gold-labeled antibody carrying gold nanoparticles (GNP) captures the fragment carrying the fluorescent group and binds to the antibody in the test region (T-Line) for color development, thereby indicating that the test sample is positive, that is, the target gene is detected, the novel coronavirus is detected, and the test sample or subject is positive for the novel coronavirus. When there is no novel coronavirus, the probe molecule in the detection layer cannot recognize the target sequence, the Cas enzyme will not be activated, the reporter molecule remains intact, enters the lateral flow test strip, is captured by streptavidin located in the control region (C-Line), and the gold-labeled antibody carrying gold nanoparticles (GNP) binds to the fluorescent group for color development. Thus, the control region shows color while the test region does not show color, indicating that the target gene is not detected and the novel coronavirus is not detected.
[0073] In addition, referring to Figure 3 , according to some embodiments of the present invention, the detection layer further includes a water storage member 230, and the water storage member is configured to controllably supply water to the detection layer. According to some embodiments of the present invention, the water storage member is a crushable water storage bag. Thus, water can be conveniently supplied to the detection layer in a controllable manner, so as to exert the functions of the lysis reagent and the amplification reagent, thereby improving the detection efficiency.
[0074] Referring to Figure 4 , according to some embodiments of the present invention, the detection layer includes a hydrophobic material sub-layer 240 disposed on the side of the detection layer 200 away from the oral cavity; a hydrophilic material sub-layer 250 disposed on the side of the detection layer 200 away from the hydrophobic material sub-layer 240; and an absorbent material sub-layer 260 disposed between the hydrophobic material sub-layer 240 and the hydrophilic material sub-layer 250. Thus, aerosol diffusion away from the detection layer can be avoided, thereby improving the safety of use and the detection efficiency.
[0075] Reference Figure 5 , according to some embodiments of the present invention, the cover body includes: a transparent region, and the detection layer is disposed on a side of the transparent region close to the oral cavity. According to yet another specific embodiment of the present invention, a portion of the detection layer disposed on a side of the cover body 100 away from the oral cavity may be coated with a layer of impermeable transparent material (not shown), thereby not only isolating the pathogen detection test strip from the external air, avoiding the external air from contaminating the pathogen detection test strip or reducing the effectiveness of the pathogen detection test strip and thus affecting the test result, but also not affecting the observation of the test result.
[0076] In addition, according to an embodiment of the present invention, the detection layer may further contain other materials to further improve the detection efficiency. Specifically, according to a specific embodiment of the present invention, an adsorption material may be included to conveniently capture the aerosol in the detection layer. The types of adsorption materials that can be used are not particularly limited, and those skilled in the art can select according to the actual situation, as long as it can adsorb the aerosol particles that may contain pathogens in the exhaled aerosol of the wearer. For example, the adsorption material may include a porous material and / or a fibrous material, and may further include a catalyst for catalytic adsorption. Among them, the porous material may be at least one selected from inorganic materials, organic materials, and organic / inorganic composite materials, and the morphological structure of the porous material may be granular or layered; for another example, considering comprehensively from aspects such as production cost, the adsorption capacity of the adsorption material, facilitating the adsorption of aerosol particles that may contain pathogens, and facilitating the elution of aerosol particles when the adsorption material contacts the preservation solution, the adsorption material may include at least one selected from cotton, graphite, graphene, activated carbon, porous carbon materials, polyester fibers, nylon, and polypropylene fibers. By using the above adsorption materials, the aerosol particles that may contain pathogens exhaled by the human body can be effectively adsorbed, and then the adsorbed material can be eluted to achieve the collection of the aerosol particles that may contain pathogens.
[0077] According to still another specific embodiment of the present invention, it should be noted that the particle size (or fiber diameter) range of the adsorption material is not particularly limited, and those skilled in the art can select according to the actual needs such as the material of the adsorption material and the particle size range of the aerosol particles required for sampling, so as to improve the effective adsorption capacity of the adsorption material for aerosol particles that may contain pathogens. Among them, the particle size range of the aerosol particles that the adsorption material can adsorb can be 0.001 to 100 μm, for example, it can be 0.001 to 50 μm, 0.01 to 100 μm, 0.1 to 100 μm, 1 to 100 μm, 0.1 to 10 μm, etc. Preferably, the adsorption particle size range of the adsorption material for aerosol particles can be selected based on the particle size range of the pathogen to be detected, the particle size range of the aerosol particles that can carry the pathogen, and the proportion of the aerosol particles that can carry the pathogen in all the aerosols exhaled by the wearer, so as to improve the collection efficiency of the effective aerosol particles.
[0078] According to still another specific embodiment of the present invention, the structure of the adsorption material in the present invention is not particularly limited, and those skilled in the art can select according to actual needs. For example, the adsorption material can be in the form of an adsorption sheet, and adopting this structure can increase the contact area between the adsorption material and the aerosol exhaled by the human body and improve the sampling efficiency.
[0079] In the present invention, unless otherwise clearly specified and limited, the first feature being "on" the second feature may be that the first and second features are in direct contact, or the first and second features are in indirect contact through an intermediate medium. Moreover, in the description of the present invention, the meaning of "a plurality" is at least two, such as two, three, etc., unless otherwise clearly and specifically limited. In the present invention, unless otherwise clearly specified and limited, terms such as "connected" should be understood in a broad sense. For example, it can be a fixed connection, a detachable connection, or integrated. It can be directly connected, or indirectly connected through an intermediate medium, unless otherwise clearly limited. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.
[0080] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.
[0081] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Shenzhen BGI Genomics Co., Ltd. <120> Mask <130> PIDC3205609 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 931 <212> DNA <213> Artificial Sequence <220> <223> N gene fragment <400> 1 ccaaattggc tactaccgaa gagctaccag acgaattcgt ggtggtgacg gtaaaatgaa 60 agatctcagt ccaagatggt atttctacta cctaggaact gggccagaag ctggacttcc 120 ctatggtgct aacaaagacg gcatcatatg ggttgcaact gagggagcct tgaatacacc 180 aaaagatcac attggcaccc gcaatcctgc taacaatgct gcaatcgtgc tacaacttcc 240 tcaaggaaca acattgccaa aaggcttcta cgcagaaggg agcagaggcg gcagtcaagc 300 ctcttctcgt tcctcatcac gtagtcgcaa cagttcaaga aattcaactc caggcagcag 360 taggggaact tctcctgcta gaatggctgg caatggcggt gatgctgctc ttgctttgct 420 gctgcttgac agattgaacc agcttgagag caaaatgtct ggtaaaggcc aacaacaaca 480 aggccaaact gtcactaaga aatctgctgc tgaggcttct aagaagcctc ggcaaaaacg 540 tactgccact aaagcataca atgtaacaca agctttcggc agacgtggtc cagaacaaac 600 ccaaggaaat tttggggacc aggaactaat cagacaagga actgattaca aacattggcc 660 gcaaattgca caatttgccc ccagcgcttc agcgttcttc ggaatgtcgc gcattggcat 720 ggaagtcaca ccttcgggaa cgtggttgac ctacacaggt gccatcaaat tggatgacaa 780 agatccaaat ttcaaagatc aagtcatttt gctgaataag catattgacg catacaaaac 840 attcccacca acagagccta aaaaggacaa aaagaagaag gctgatgaaa ctcaagcctt 900 accgcagaga cagaagaaac agcaaactgt g 931 <210> 2 <211> 598 <212> DNA <213> Artificial Sequence <220> <223> E gene fragment <400> 2 actattacca gctgtactca actcaattga gtacagacac tggtgttgaa catgttacct 60 tcttcatcta caataaaatt gttgatgagc ctgaagaaca tgtccaaatt cacacaatcg 120 acggttcatc cggagttgtt aatccagtaa tggaaccaat ttatgatgaa ccgacgacga 180 ctactagcgt gcctttgtaa gcacaagctg atgagtacga acttatgtac tcattcgttt 240 cggaagagac aggtacgtta atagttaata gcgtacttct ttttcttgct ttcgtggtat 300 tcttgctagt tacactagcc atccttactg cgcttcgatt gtgtgcgtac tgctgcaata 360 ttgttaacgt gagtcttgta aaaccttctt tttacgttta ctctcgtgtt aaaaatctga 420 attcttctag agttcctgat cttctggtct aaacgaacta aatattatat tagtttttct 480 gtttggaact ttaattttag ccatggcaga ttccaacggt actattaccg ttgaagagct 540 taaaaagctc cttgaacaat ggaacctagt aataggtttc ctattcctta catggatt 598 <210> 3 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> N-gene gRNA #1 <400> 3 uaauuucuac uaaguguaga ucccccagcg cuucagcguu c 41 <210> 4 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> E-gene gRNA #2 <400> 4 uaauuucuac uaaguguaga ugugguauuc uugcuaguua c 41 <210> 5 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> RNaseP POP7 gRNA <400> 5 uaauuucuac uaaguguaga uaauuacuug ggugugaccc u 41 <210> 6 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> N-gene gRNA #2 <400> 6 uaauuucuac uaaguguaga ugcaauguug uuccuugagg a 41 <210> 7 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> E-gene gRNA #1 <400> 7 uaauuucuac uaaguguaga uuugcuuucg ugguauucuu g 41
Claims
1. A mask, characterized in that, it comprises: a mask body; and a detection layer, the detection layer is provided on the mask body, and the detection layer is provided with: probe molecules, the probe molecules specifically recognize a predetermined sequence of the pathogen genome, the pathogen includes the novel coronavirus, the predetermined sequence includes at least one selected from the following: SEQ ID NO:1 and SEQ ID NO:2, and the probe molecules contain at least one of the sequences shown in SEQ ID NO:3-7; Cas enzyme, the Cas enzyme is adapted to be activated after the probe molecule binds to the predetermined sequence; a reporter molecule, the reporter molecule is adapted to be cleaved by the activated Cas enzyme, and the reporter molecule generates a detectable signal after being cleaved.
2. The mask according to claim 1, characterized in that, the Cas enzyme includes at least one of Cas12 and Cas13.
3. The mask according to claim 1, characterized in that, the Cas enzyme includes at least one of AsCas12a, FnCas12a, AaCas12b, LbCas12a and LwaCas13a.
4. The mask according to claim 1, characterized in that, the Cas enzyme includes at least one of LbCas12a and LwaCas13a.
5. The mask according to claim 1, characterized in that, the detection layer further includes: a lysing agent, the lysing agent is adapted to lyse the pathogen to release the genome of the pathogen.
6. The mask according to claim 5, characterized in that, the lysing agent includes at least one of Triton, NP-40 lysis reagent, CHAPS lysis reagent and Tween.
7. The mask according to claim 5, characterized in that, the lysing agent is in dry powder form.
8. The mask according to claim 5, characterized in that, the detection layer further includes: a nucleic acid amplification reagent, the nucleic acid amplification reagent is adapted to amplify at least a part of the genome of the pathogen.
9. The mask according to claim 8, characterized in that, the nucleic acid amplification reagent is a reagent suitable for isothermal amplification.
10. The mask according to claim 9, characterized in that, the nucleic acid amplification reagent is a reagent suitable for RT-RPA.
11. The mask according to claim 8, characterized in that, the nucleic acid amplification reagent is in dry powder form.
12. The mask according to claim 1, characterized in that, a plurality of regions are defined on the detection layer, and the probes provided in the plurality of regions respectively recognize the predetermined sequences of different sequences.
13. The mask according to claim 1, characterized in that, the detection layer defines a first region and a second region, wherein the probe in the first region specifically recognizes the E gene, and the probe in the second region specifically recognizes the N gene.
14. The mask according to claim 1, characterized in that, the reporter molecule is a single-stranded nucleic acid molecule.
15. The mask according to claim 14, characterized in that, both ends of the single-stranded nucleic acid molecule carry a fluorophore and biotin respectively.
16. The mask according to claim 15, wherein, the single-stranded nucleic acid molecule carries biotin, and the detection layer is connected to a lateral flow test strip.
17. The mask according to claim 1, wherein, the detection layer further comprises: a water storage member configured to controllably supply water to the detection layer.
18. The mask according to claim 17, wherein, the water storage member is a crushable water storage bag.
19. The mask according to claim 1, wherein, the detection layer comprises: a hydrophobic material sub-layer disposed on a side of the detection layer away from the oral cavity; a hydrophilic material sub-layer disposed on a side of the detection layer away from the hydrophobic material sub-layer; and a water-absorbing material sub-layer disposed between the hydrophobic material sub-layer and the hydrophilic material sub-layer.
20. The mask according to claim 19, wherein, the mask body comprises: a transparent region, and the detection layer is disposed on a side of the transparent region close to the oral cavity.
Citation Information
Patent Citations
Respiratory virus sample collection and detection integrated device
CN111537722A
Protective mask
CN111713779A
Crispr effector system based diagnostics for virus detection
US20200181720A1