Preparation method and application of universal CAR-T cells with dual gene site-specific integration

Abstract

The present invention relates to a method for preparing a universal CAR-T cell with dual gene knock-in. The method comprises delivering a gene editing substance to a T cell to knock out the B2M gene and the TRAC gene; and delivering a repair template vector to the T cell to knock the CAR gene and the B2M-HLA-E gene into the TRAC or B2M site. The method is simple and efficient, and can achieve multi-gene knock-in and knock-out in one step.

Description

Technical Field

[0001] The present invention relates to the field of cell therapy, and in particular to a preparation method and application of dual-gene site-specific integrated universal CAR-T cells. Background Art

[0002] CAR-T therapy

[0003] Traditional cancer treatment drugs include chemotherapy drugs and targeted drugs. Although they have improved the survival of cancer patients to a certain extent, they also bring serious side effects and greatly reduce the quality of life of patients. Even more unfortunately, most patients will still relapse after receiving these traditional treatments, and once they relapse, it is highly likely that there is no cure.

[0004] In recent years, with the development of immunotherapy, the emergence of immune checkpoint inhibitor drugs (such as CTLA-4, PD-1 / PD-L1 antibodies) has completely changed the way of tumor treatment. However, the efficacy of this type of drug in different cancer patients is only 20%-40%, and most cancer patients are still waiting for the emergence of new effective treatment methods.

[0005] Chimeric antigen receptor T cell (CAR-T cell) therapy technology is to transfer an artificial gene that recognizes cancer cell surface antigens to T cells in vitro, so that T cells have the ability to specifically kill tumor cells. CAR-T cell therapy belongs to adoptive cell transfer (ACT), which uses human immune cells to fight tumors and is called "living medicine". This ACT therapy has been used in clinical trials in recent years, especially in the effective exploration of various leukemias, opening up a new path for researchers and doctors to treat tumors. Compared with traditional drugs, CAR-T drugs have the following innovations:

[0006] First, it precisely targets tumors and has reversible side effects. CAR-T cell therapy has a more specific ability to kill tumor cells than chemotherapy drugs and targeted drugs. After being injected into the patient's body, although cytokine effects will occur in a short period of time, this side effect is controllable, and the patient can basically live like a healthy person if he or she achieves complete remission.

[0007] Secondly, the duration of sustained remission is long. Some CAR-T cells are memory T cells, which can exist in the patient's body for a long time after being injected into the patient's body, constantly monitoring whether there are tumor cells in the body, and immediately killing new tumor cells once they appear.

[0008] Universal CAR-T therapy

[0009] Universal CAR-T (UCAR-T) is taken from healthy human blood, modified by gene editing technology, and then infused back into different patients. It knocks out certain genes in existing T cells, so that foreign healthy human T cells will not attack cells in the patient's body to cause anti-host rejection reactions (GvHD effect), and will not be eliminated by the patient's immune system, so that they survive in the patient's body and play a tumor-killing role. Universal CAR-T is a drug on the shelf, because it is taken from existing healthy human T cells and can be mass-produced according to the strict standards for drug production. Compared with autologous CAR-T, universal CAR-T has the characteristics of "off-the-shelf":

[0010] First, it is available at any time because it does not require the use of patient T cells and can be prepared in advance. Therefore, it is a "drug on the shelf" that can be used at any time without the patient having to wait.

[0011] Secondly, it can be mass-produced, and the cost is greatly reduced. It is not "customized" and can be mass-produced. A healthy person can draw 400ml of blood to prepare UCAR-T cell products that meet the needs of hundreds of patients. It is initially predicted that the cost of a single dose of UCAR-T will be 1 / 10 of the cost of autologous CAR-T.

[0012] Third, there are no restrictions on use. Because the T cells are extracted from healthy people's blood and do not need to be provided by the patient themselves, they are not affected by the patient's physical condition (T cell status) and have no restrictions on use.

[0013] However, universal CAR-T therapy still needs to overcome the following problems:

[0014] 1) Compatibility issues of allogeneic T cell transplantation

[0015] Although universal CAR-T therapy has many advantages, its production and research and development are much more difficult than autologous CAR-T therapy. The most influential problem in its efficacy is allogeneic rejection: different individuals have different tissue compatibility antigens, which leads to the attack and rejection of the transplant by the recipient T cells. To solve this problem, gene editing methods (such as ZFN, TALEN or CRISPR-Cas9) are usually used to knock out the B2M gene in CAR-T cells, so that the HLA-ABC protein cannot be displayed on the cell surface, thereby avoiding being attacked by the receptor T cells. Some researchers also knock out the CIITA gene to reduce the expression of class II tissue compatibility antigens.

[0016] 2) Graft versus host disease (GvHD)

[0017] Graft versus host disease (GVHD) is a reaction caused by specific lymphocytes in the graft recognizing host antigens. The conditions for its occurrence are that the graft contains T lymphocytes and the major tissue compatibility antigens of the graft and the host are inconsistent. In bone marrow transplantation, GvHD is the main obstacle, which will kill cells in the host and cause multiple organ failure, and then cause other complications. In universal CAR-T cell therapy, GvHD is the most important problem to avoid, otherwise the host will have serious side effects. TCR is the main gene for T lymphocytes to recognize target cells. Knocking out the TCR gene can avoid the attack of allogeneic T cells on host cells, so the universal CAR-T cells of allogeneic transplantation must knock out the TCR gene to avoid GvHD.

[0018] CAR gene transduction

[0019] The preparation of CAR-T cells can be divided into the following steps: T cell separation, T cell activation, CAR gene transduction, CAR-T cell expansion, and CAR-T cell harvesting. Among them, CAR gene transduction is the core of the entire preparation process. In recent years, multiple CAR transduction methods have been developed:

[0020] 1) Lentivirus or retrovirus

[0021] Lentivirus or retrovirus can be used to transfect target DNA with less than 3,000 bases. Its advantages are: a. High infection efficiency, usually the highest positive rate after transfection can reach about 50%; b. The virus is secreted into the culture medium in large quantities, and small-scale concentration and purification are relatively easy; cT lymphocytes can maintain a good cell state after being infected with the virus, and survival and amplification are not easily affected, which is conducive to subsequent transfusion to patients. Its disadvantages are: a. Random insertion into the cell genome can easily lead to exhaustion of the generated CAR-T cells and potential risk of cancer; b. After infecting T cells, the residual virus has strong immunogenicity; c. Large-scale preparation of the virus is cumbersome and costly.

[0022] 2) Transposon

[0023] The advantage of transposon transduction is the simple production process and no risk of virus residue. However, since the vector encoding the transposon is plasmid DNA, it has cytotoxic effects after electroporation into T cells, which is not conducive to the expansion of the generated CAR-T cells. Similarly, transposon-mediated random insertion of the CAR gene into the T cell genome can easily lead to exhaustion of the generated CAR-T cells and potential risk of cancer.

[0024] 3) mRNA

[0025] The mRNA-encoded CAR gene transduction into T cells relies on electroporation, which has the advantage of only briefly expressing the target protein in T cells (about 7 days). For CAR-T cells that are uncertain whether there are serious side effects in the early stage, this method can be relatively safe for human experiments. However, its disadvantage is also obvious, that is, it cannot be expressed for a long time and the duration of action is relatively limited.

[0026] CRISPR-Cas9 technology

[0027] CRISPR (Clusters of Regularly Interspaced Short Palindromic Repeats) technology was jointly discovered by scientists from MIT and the University of California, Berkeley in 2012. It is a double-stranded DNA endonuclease tool mediated by RNA sequences. It consists of two parts, one of which is a sgRNA of about 100 bases, which is used to target and recognize the target double-stranded DNA, and the other part is a Cas9 protein of 1369 amino acids, which can bind to the sgRNA and has DNA enzyme activity. After the artificially designed sgRNA and Cas9 protein form a complex, they can specifically cut the target DNA. When the cutting causes mismatch repair, it causes gene frameshift and achieves the purpose of knockout. When a repair DNA sequence is added, a purposeful editing will be performed. Since the advent of CRISPR-Cas9 technology, it has been applied in many fields.

[0028] Large fragment gene knock-in technology

[0029] Although gene knockout technology has made great progress, the efficiency of large-fragment gene knock-in has always been low. The difference between gene knock-in and gene knock-out lies in whether a repair template is added. The process is: after nucleases (such as ZFN, TALEN, CRISPR-Cas9, etc.) shear the specific DNA, the repair template repairs the "damaged" DNA according to the principle of homologous recombination, and introduces the specific DNA fragment into the specific site after repair. The repair templates currently used mainly include plasmid DNA, double-stranded DNA, single-stranded DNA and adeno-associated virus vectors. For knocking in a single or several bases, these repair templates can achieve very high efficiency, and for knocking in genes of more than 500 bases, only adeno-associated virus vectors are relatively efficient, which can achieve a knock-in efficiency of about 40%. The efficiency of gene knock-in with plasmid DNA, double-stranded DNA, and single-stranded DNA as repair templates does not exceed 5%. However, the preparation cost of adeno-associated virus vectors is high and time-consuming, which is not conducive to their application in the preparation of CAR-T cells.

[0030] Gene knock-in technology using double-stranded DNA as template

[0031] The advantage of double-stranded DNA as a repair template is that it can be obtained through large-scale PCR, which is cheaper and easier to obtain than other repair templates. However, previous studies have shown that the efficiency of long-fragment gene knock-in using double-stranded DNA as a repair template is relatively low, with a maximum efficiency of about 5%. Summary of the invention

[0032] definition

[0033] CAR-T (chimeric antigen receptor T cell): chimeric antigen receptor T cell.

[0034] CTLA-4 (cytotoxic T-lymphocyte associated protein 4): the earliest approved immune checkpoint inhibitor target.

[0035] PD-1 / PD-L1 (programmed cell death 1 / ligand of PD-1 protein): the two most famous targets of immune checkpoint inhibitors.

[0036] ACT (adoptive cell transfer): adoptive immunotherapy, which transfers donor lymphocytes to recipients to enhance their cellular immune function. Adoptive cellular immunity can be divided into two categories: specific and nonspecific. The former is to inject lymphocytes sensitized with known antigens into recipients to enable them to acquire cellular immunity to the antigen, while the latter is to inject normal human lymphocytes that have not been sensitized with specific antigens into recipients to enable them to acquire cellular immunity to multiple antigens.

[0037] CRISPR (clustered regularly interspaced short palindromic repeats): a bacterial immune system that has been transformed by scientists into the hottest gene editing tool in recent years.

[0038] ZFN: A gene editing technology, it is a type of artificially synthesized restriction endonuclease, which is composed of a fusion of a zinc finger DNA binding domain and a restriction endonuclease DNA cleavage domain. Researchers can target different DNA sequences by processing and modifying the zinc finger DNA binding domain of ZFN, so that ZFN can bind to the target sequence in a complex genome and perform specific cutting by the DNA cleavage domain.

[0039] TALEN: A gene editing technology. A typical TALEN consists of an N-terminal domain containing a nuclear localization signal, a central domain containing a typical tandem TALE repeat sequence that can recognize a specific DNA sequence, and a C-terminal domain with FokI nuclease function. It can bind to the target sequence in a complex genome and perform specific cutting by the DNA cleavage domain.

[0040] ARCUS: A gene editing technology that uses small nucleases that can be easily delivered in vivo.

[0041] megaTAL: A gene editing technology that is composed of a fusion of the DNA binding domains of a homing endonuclease and a transcription activator-like effector, which can bind to target sequences in complex genomes and perform specific cleavage by the DNA cleavage domain.

[0042] dsDNA: double-stranded DNA.

[0043] RNP: The abbreviation for the complex formed by Cas9 protein and sgRNA.

[0044] mRNA: messenger RNA, a type of single-stranded ribonucleic acid that is transcribed from a strand of DNA as a template, carries genetic information and can guide protein synthesis. Using the gene in the cell as a template, after transcribing to generate mRNA according to the principle of base complementary pairing, mRNA contains base sequences corresponding to certain functional fragments in the DNA molecule, serving as a direct template for protein biosynthesis.

[0045] AAV: Adeno-associated virus vector, a highly efficient and safe gene delivery tool, has been widely used in gene therapy in recent years and can also be used as a repair template for large gene knock-in.

[0046] TCR-T: An adoptive cell therapy technology that transduces natural or optimized TCR genes screened in the laboratory into T cells, amplifies and cultures them in vitro, and finally returns them to the patient. It can be used to treat a variety of refractory tumors.

[0047] sgRNA: An artificially invented RNA in CRISPR applications that combines crRNA and tracrRNA and can bind to Cas9 protein and target the target DNA.

[0048] PolyA: Polyadenylic acid structure, which is a post-transcriptional modification process of mRNA, helps me stabilize mRNA and improve translation efficiency.

[0049] The present invention relates to a method for preparing a universal CAR-T cell with double gene knock-in, the method comprising:

[0050] delivering gene editing materials to T cells to knock out the B2M gene and the TRAC gene; and

[0051] The repair template vector is delivered to T cells to knock the CAR gene and B2M-HLA-E gene into the TRAC site.

[0052] The gene editing method used to deliver gene editing materials to T cells can be ZFN, TALEN, CRISPR-Cas9, megaTAL, etc., preferably CRISPR-Cas9. The gene editing material can be a plasmid, a lentivirus, a retrovirus, an adeno-associated virus, mRNA or an RNA protein complex, preferably mRNA. The delivery of gene editing materials can use transfection methods such as liposomes, calcium phosphate, DEAE-dextran, electroporation, microinjection, gene guns, etc., preferably electroporation transfection.

[0053] In some embodiments, the CRISPR-Cas9 gene editing material includes Cas9 mRNA or Cas9 protein and sgRNA.

[0054] First, the genomic site to be knocked in is identified, and the sgRNA is designed using the DNA sequence around the site. The design principle is that the PAM region sequence is NGG, where N is any base among A, T, C, and G. The sgRNA includes the targeted crRNA sequence and tracrRNA sequence, where the crRNA can be 17, 18, 19, 20, 21, or 22 bases.

[0055] In some embodiments, the sgRNA is unmodified or chemically modified. Chemical modifications include 2-O-methylation, 3-thiolation, 2-O-methylation combined with 3-thiolation, etc. In some embodiments, the 3 bases at the 5' and 3' ends are simultaneously 2-O-methylated and 3-thiolated. Chemical modification can occur at 1 to 10 bases at the 5' and 3' ends of the sgRNA. The designed sgRNA can be obtained by T7 in vitro transcription or directly synthesized in vitro.

[0056] In some embodiments, the sgRNA sequences targeting TRAC and B2M genes are shown as SEQ ID NO:55 and SEQ ID NO:56, respectively.

[0057] Cas9 can be SpCas9, SaCas9, SpCas9-HF, eSpCas9, xCas9, cpf1 or other Cas9s of different bacterial genera, preferably SpCas9. In some embodiments, the amino acid sequence of SpCas9 is shown in SEQ ID NO:57. The N-terminus or C-terminus of the Cas9 protein can be coupled with one or more NLS nuclear import signal peptides. Cas9 mRNA can be obtained by in vitro transcription.

[0058] In some embodiments, transfection (electroporation) is performed using a mixture of mRNA and sgRNA encoding Cas9 protein. Cas9 protein can also be used instead of Cas9 mRNA. Cas9 protein can be obtained by expression and purification of bacteria or eukaryotic expression cells. In some embodiments, electroporation is performed using an RNP complex formed by Cas9 protein and sgRNA. The RNP complex can be obtained by directly mixing and incubating Cas9 protein and sgRNA, or by mixing the two in a specific buffer (such as an electroporation buffer).

[0059] In the present invention, adeno-associated virus and non-viral vectors are used as targeting vectors for delivering site-specific knock-in template DNA. The template DNA includes left homology arm DNA, knock-in foreign DNA, and right homology arm DNA.

[0060] The left homology arm of the template DNA is homologous to the 5' end sequence of the DNA nick, and the right homology arm is homologous to the 3' end sequence of the DNA nick. In some embodiments, the DNA sequence at the 3' end of the left homology arm is consistent with the 5' end sequence 0 to 300 bases away from the nick DNA, and the fragment length is 10 to 2000bp; the DNA sequence at the 5' end of the right homology arm is consistent with the 3' end sequence 0 to 300 bases away from the nick DNA, and the fragment length is 10 to 2000bp. In some embodiments, the length of the left and right homology arm fragments can be 300, 600 or 1000 bases, preferably 300 bases. In some embodiments, when the TRAC genomic site is knocked into, the left and right homology arm DNAs are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In some embodiments, when the B2M genomic site is knocked into, the left and right homology arm DNAs are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

[0061] In some embodiments, the CAR and B2M-HLA-E genes are separated by a cleavage peptide.

[0062] When an exogenous gene is knocked into the TRAC genomic site, it can be transcribed by relying on the endogenous TCR-alpha gene promoter or by relying on an exogenous promoter. When knocked into the TRAC site and relying on the TCR-alpha promoter, the knocked-in gene includes: a cleavage peptide, a CAR gene, a cleavage peptide, a B 2 M-HLA-E gene and Poly A. When knocked into the TRAC site and dependent on an exogenous promoter, the knocked-in gene comprises: an exogenous promoter, a CAR gene, a cleavage peptide, a B2M-HLA-E gene and Poly A. In some embodiments, the exogenous promoter is EF1, preferably its DNA sequence is as shown in SEQ ID NO:26.

[0063] When knocked into the B2M site and dependent on the B2M gene promoter, the knocked-in gene comprises: B2M-HLA-E gene, cleavage peptide, CAR gene and Poly A;

[0064] The cleavage peptide may be P2A or T2A, etc. In some embodiments, the cleavage peptide is P2A, and its amino acid sequence is shown in SEQ ID NO:25.

[0065] The polyA of the knocked-in exogenous DNA can be any polyA gene, preferably miniPolyA or bGHpA polyA. In some embodiments, the DNA sequences of miniPolyA and bGHpA polyA are shown in SEQ ID NO: 27 and SEQ ID NO: 28, respectively.

[0066] The antigen targets targeted by the CAR gene can be: CD19, CD22, CD20, CD7, CD5, CD4, CD123, CD30, CD33, CD70, CD38, CD138, BCMA, SLAMF7, PSMA, HER2, HER3, B7-H3, Mesothelin, CS1, MUC16, GD2, GUCY2C, ROR1, GPC3, FAP, FOLR1, CEA, CD138, CD56, CD147, EpCAM, CAIX, EGFR, Claudin18.2, Claudin 6, CLL-1, GPRC5D, Nectin-4, EGFRVIII, LewisY, DLL3, uPAR, MG7 and IL13Rα2, etc., single targets, dual targets or multiple targets. The antigen target can also be an MHC-presented polypeptide complex, such as NY-ESO-1 presented by HLA-A2, and the recognition of this type of antigen target is a TCR-like antibody scFv.

[0067] The CAR gene can be a second generation or third generation structure. If it is a second generation CAR structure, it contains one co-stimulatory factor, and if it is a third generation CAR structure, it contains two co-stimulatory factors. In some embodiments, the CAR gene comprises a signal peptide, an antigen binding region, a hinge region, a transmembrane region, one or two co-stimulatory factors and an activation region.

[0068] The signal peptide in the CAR gene is selected from the signal peptide domains of CD8, IL-2, GM-CSF, etc., preferably the CD8 signal peptide domain. In some embodiments, the amino acid sequence of the CD8 signal peptide domain is as shown in SEQ ID NO: 31

[0069] The antigen binding region in the CAR gene can be an antibody scFv or a corresponding ligand. In some embodiments, the antigen binding region is a CD19 antibody scFv, and its amino acid sequence is shown in SEQ ID NO: 29.

[0070] The hinge region in the CAR gene can be a hinge domain of IgG1, IgG4, IgD, CD8, etc., preferably a CD8 hinge domain. In some embodiments, the amino acid sequence of the CD8 hinge domain is as shown in SEQ ID NO: 32

[0071] The transmembrane region in the CAR gene can be a transmembrane domain such as CD3, CD4, CD5, CD8, CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD154, PD1, etc., preferably a CD8 transmembrane domain. In some embodiments, the amino acid sequence of the CD8 transmembrane domain is as shown in SEQ ID NO: 33,

[0072] The co-stimulatory structure in the CAR gene can be CD2, CD7, CD27, CD28, CD30, CD40, CD54, CD83, CD134, CD137, CD150, CD152, CD223, CD270, CD273, CD274, CD278, CARD11, NKD2C, DAP10, LAT, SLP76, ZAP70, 4-1BB and other co-stimulatory domains, preferably 4-1BB co-stimulatory domains. In some embodiments, the amino acid sequence of the 4-1BB co-stimulatory domain is shown in SEQ ID NO: 34.

[0073] The activation structure can be a CD3 zeta activation domain. In some embodiments, the amino acid sequence of the CD3 zeta activation domain is shown in SEQ ID NO:35.

[0074] The B2M-HLA-E fusion gene of the present invention has two forms. The first form (B2M-HLA-E structure 1) includes, from 5' to 3' end: B2M signal region DNA, presenting polypeptide DNA, linker DNA, B2M non-signal region DNA, linker DNA and HLA-E gene; the second form (B2M-HLA-E structure 2) includes, from 5' to 3' end: B2M signal region DNA, B2M non-signal region DNA, linker DNA and HLA-E gene.

[0075] In some embodiments, the amino acid sequence of the B2M signal region DNA is as shown in SEQ ID NO: 58. In some embodiments, the amino acid sequence of the B2M non-signal region DNA is as shown in SEQ ID NO:59.

[0076] In some embodiments, the presented polypeptide comprises VN2APRTN7N8L, N2 is an amino acid other than threonine, N7 is valine or leucine, and N8 is valine, leucine or isoleucine. In some embodiments, the amino acid sequence of the presented polypeptide is shown in SEQ ID NO:60.

[0077] In some embodiments, the amino acid sequence of the linker DNA is as shown in SEQ ID NO:61 or 62.

[0078] In some embodiments, the HLA-E gene includes the following forms: HLA-E*0101, HLA-E*0102, HLA-E*0103, HLA-E*0104, preferably HLA-E*0103. In some embodiments, the amino acid sequence of the HLA-E gene is shown in SEQ ID NO:63.

[0079] In some embodiments, the amino acid sequence of B2M-HLA-E structure 1 is shown as SEQ ID NO:30, and the amino acid sequence of B2M-HLA-E structure 2 is shown as SEQ ID NO:64.

[0080] In some embodiments, when the TRAC site is knocked in and the TCR-alpha promoter is dependent, the repair template DNA is as shown in SEQ ID NO: 39;

[0081] In some embodiments, when the TRAC site is knocked in and the exogenous promoter EF1 is relied upon, the repair template DNA is as shown in SEQ ID NO:45;

[0082] In some embodiments, when knocked into the B2M site and dependent on the B2M gene promoter, the repair template DNA is as shown in SEQ ID NO:52.

[0083] In the present invention, an adeno-associated virus vector can be used as a repair template vector. The targeted template DNA is cloned into an adeno-associated virus vector and packaged into a recombinant adeno-associated virus (rAAV) virus. The virus can be packaged by 293T cells or SF9 expression system. The rAAV serotype can be any one, such as AAV1-AAV9, AAV-DJ, AAV-Retro, etc., preferably AAV6 type. The purification of rAAV can be carried out by ultracentrifugation or affinity or chromatography. In some embodiments, a certain amount of adeno-associated virus is added within zero to twelve hours after the gene editing material is delivered (e.g., electroporation), and the titer of the added adeno-associated virus can be one thousand to one million times that of the corresponding cell.

[0084] In some embodiments, when the repair template vector is an adeno-associated virus vector, the method includes the following steps: mixing Cas9 protein encoding mRNA with targeting sgRNA in vitro to form a mixture and transfecting (preferably electroporating) it into T cells; cloning the repair template DNA into a plasmid and packaging it into an adeno-associated virus vector; adding the adeno-associated virus vector within 0 to 12 hours after RNA transfection (preferably electroporating).

[0085] In the present invention, non-viral vectors can be used as repair template vectors. This process is simpler than the method using adeno-associated viruses, and all gene editing steps can be completed with only one electroporation in the entire preparation process. The non-viral vector design and preparation are as follows:

[0086] Template DNA is connected to a plasmid vector: Template DNA includes left homology arm DNA, knock-in DNA, and right homology arm DNA, wherein the left homology arm is homologous to the 5' end sequence of the DNA cut, and the right homology arm is homologous to the 3' end sequence of the DNA cut. The DNA sequence at the 3' end of the left homology arm is consistent with the 5' end sequence 0 to 300 bases away from the cut DNA, and the fragment length is 10 to 5000bp. The DNA sequence at the 5' end of the right homology arm is consistent with the 3' end sequence 0 to 300 bases away from the cut DNA, and the fragment length is 100 to 5000bp. After the template DNA is cloned, it is connected to a plasmid vector. The plasmid vector can be any one, such as pUC57, pCDNA3.1, pCMV, etc., and the connection position can also be flexible. It is also possible not to connect to the plasmid vector and go directly to the subsequent steps.

[0087] PCR amplification using modified primers: PCR amplification is performed using two modified primers, 5'-phosphorothioate combined with 5'-Biotin-TEG or 5'-locked nucleic acid, and 5'-phosphorothioate combined with 5'-Biotin-TEG or 5'-locked nucleic acid modification can be performed at 1 to 15 bases at the 5' end of the upstream and downstream primers. Preferably, the specific primer modification of 5'-phosphorothioate combined with 5'-Biotin-TEG is: the first base at the 5' end of the upstream and downstream primers is modified with Biotin-TEG, and the 2nd, 3rd, 4th, 5th, and 6th bases are modified with phosphorothioate. The specific primer modification of the preferred 5'-locked nucleic acid is that the 1st, 2nd, and 3rd bases at the 5' end of the upstream and downstream primers are modified with locked nucleic acid. The length of the modified primer can be 15 to 100 bases in length. The reagents used for PCR amplification can be kit products of any company. The PCR amplifier or related equipment used for PCR amplification can also be from any manufacturer.

[0088] Purification of modified template DNA: After PCR amplification, the modified template DNA can be purified and concentrated using the following methods separately or in combination: purification by DNA purification kits of various reagent companies, purification by various DNA-binding magnetic beads, gel chromatography, ion chromatography, affinity chromatography, ultrafiltration by ultrafiltration tubes, dialysis by dialysis membranes, etc.

[0089] The prepared non-viral vector is mixed with a gene editing substance (e.g., an RNP complex), and the mixing time can be zero to 20 minutes. The amount of the non-viral vector is determined according to the number of cells. Transfection methods such as liposomes, calcium phosphate, DEAE-dextran, electroporation, microinjection, and gene guns can be used, preferably electroporation. After transfection, the gene editing substance first shears the genomic DNA to produce a broken double-stranded DNA incision. At this time, the modified template DNA acts as a donor DNA and undergoes homologous recombination with the broken incision DNA, and the knocked-in DNA is successfully integrated into the target genomic site.

[0090] In some embodiments, when the repair template vector is a non-viral vector, the method includes the following steps: mixing the Cas9 protein with the targeting sgRNA in vitro to form an RNP complex, or mixing the Cas9 protein encoding mRNA with the targeting sgRNA in vitro to form a mixture; using modified primers to perform PCR amplification of the repair template DNA to obtain modified double-stranded DNA, wherein the modified primers contain: i) 5'-phosphorothioate (PS) modification together with 5'-biotin-triethylene glycol (Biotin-TEG) ​​modification; or ii) 5'-locked nucleic acid (LNA) modification; transfecting (preferably electroporating) the RNP complex or the mixture and the modified double-stranded DNA into T cells.

[0091] The method of the present invention also includes steps such as cell activation, amplification, purification and freezing.

[0092] Specifically, human blood collection can be venous blood drawing or single collection of mononuclear cells. Lymphocyte separation fluid can be used to separate PBMC from human blood, in combination with ordinary centrifuge tubes, sepmate tubes or other hardware equipment. You can choose to separate and purify T lymphocytes or not. If you need to separate and purify T lymphocytes, you can use kits from various manufacturers, including various negative and positive selection methods. T cell activation can be achieved by the following methods: single anti-CD3 antibody coating, anti-CD3 antibody / anti-CD28 antibody coating, direct addition of single anti-CD3 antibody, direct addition of anti-CD3 antibody / anti-CD28 antibody, anti-CD3 antibody / anti-CD28 antibody magnetic beads, etc. Activation time can be 1 to 8 days, preferably 2 to 3 days. If antibody magnetic beads are used for activation, the magnetic beads need to be removed by magnetic poles before electrotransfer.

[0093] T cells are cultured using 1640 medium + 10% serum or other serum-free medium specifically for T cell culture. The serum-free medium contains human albumin, transferrin, insulin and other important added ingredients. Some validated serum-free medium can also be selected, such as X-VIVO-15, ImmunoCult TM -XF, OpTmizer culture medium, etc. It can be placed in a bioreactor (such as), culture flask, culture dish, G-rex or culture bag for culture. A certain concentration of cytokines, such as IL-2, IL-7, IL-15, etc., are added during the culture process. During the T cell culture process, special magnetic beads or irradiated feeder cells (such as K562-CD19) can be added to activate and amplify cells to achieve a greater amplification effect. The total time for T cell culture can be ten to twenty days, preferably ten to fifteen days.

[0094] TCR-negative cell enrichment and purification: TCR-positive cells can cause severe GvHD effects during allogeneic transfusion. To eliminate this effect, TCR-positive cells must be completely removed before transfusion. The method used can be TCR-negative selection or CD3-negative selection magnetic bead sorting.

[0095] Universal CAR-T cell cryopreservation: After the culture is completed, the CAR-T cells are cryopreserved at a certain cell concentration. The cryopreservation fluid used can be a GMP or non-GMP grade product available on the market, and can be placed in a dedicated cryopreservation bag or cryopreservation tube for cryopreservation. After gradient cooling by dedicated equipment, it is stored in a minus 80 degree refrigerator or liquid nitrogen tank. Before CAR-T cells are cryopreserved, the following tests and analyses can be performed: sterility test, mycoplasma test, endotoxin test, CAR positive ratio, CD4 / CD8 ratio, memory T cell ratio, effector T cell ratio, killing effect on target cells, the amount of cytokines released after killing, anti-tumor effect in mice, off-target effect caused by CAR gene knock-in, etc.

[0096] The present invention also relates to universal CAR-T cells prepared by the method, which are used for treating diseases.

[0097] The present invention also relates to the use of the universal CAR-T cells prepared by the method for preparing drugs for treating diseases.

[0098] Specifically, the diseases include various leukemias (acute B lymphocytic leukemia, acute T lymphocytic leukemia, NK lymphocytic leukemia, various non-Hodgkin's lymphomas, chronic lymphocytic leukemia, acute myeloid leukemia, multiple myeloma, etc.), various solid tumors (lung cancer, liver cancer, gastric cancer, breast cancer, colorectal cancer, prostate cancer, pancreatic cancer, brain glioma, esophageal cancer, bile duct cancer, endometrial cancer, ovarian cancer, mesothelioma, thymic cancer, etc.), AIDS, autoimmune diseases and various diseases that are accessible to CAR-T cell therapy.

[0099] In the method of the present invention, knocking out the TRAC gene can avoid GvHD reaction, and it is necessary to remove the T cell surface TCR-CD3 complex protein. This purpose can be achieved by targeting genes such as TRAC, TRBC or CD3z, CD3e, preferably targeting the TRAC gene. Knocking out the B2M gene can completely inhibit the expression of HLA-I class molecules in the cell membrane, which is conducive to suppressing T cell rejection, but at the same time, NK rejection will also be significantly enhanced. And for knocking in the B2M-HLA-E gene, HLA-E and B2M proteins form dimers on the cell membrane surface under physiological conditions, which can inhibit NKG2A positive NK cell activity, but because the endogenous B2M gene has been knocked out, only the transduction of the HLA-E gene cannot form a dimer with B2M, so it cannot be expressed on the cell membrane surface. Transduction of the B2M-HLA-E fusion gene can express the HLA-E gene while the endogenous B2M gene is knocked out, thereby inhibiting NKG2A-positive NK cell rejection. NKG2A-positive NK cells account for about 70% of total NK cells, so knocking in the B2M-HLA-E gene can inhibit about 70% of NK cell rejection reactions.

[0100] In the present invention, CAR and B2M-HLA-E genes are knocked into the TRAC site at the same time. CAR and B2M-HLA-E genes are site-integrated into the TRAC genomic site, greatly reducing the random insertion probability of the CAR gene, avoiding the "cancerization" of CAR-T cells, and completing CAR gene transduction and TRAC gene knockout in one step. In previous studies, CAR and B2M-HLA-E genes were transduced to the TRAC and B2M genomic sites respectively (requiring two site-integrations). Compared to this, the present invention is simpler and more efficient, and only one site-integration is required to import two genes simultaneously.

[0101] The antigen targets targeted by the CAR gene can be: CD19, CD22, CD20, CD7, CD5, CD4, CD123, CD30, CD33, CD70, CD38, CD138, BCMA, SLAMF7, PSMA, HER2, HER3, B7-H3, Mesothelin, CS1, MUC16, GD2, GUCY2C, ROR1, GPC3, FAP, FOLR1, CEA, CD138, CD56, CD147, EpCAM, CAIX, EGFR, Claudin18.2, Claudin 6, CLL-1, GPRC5D, Nectin-4, EGFRVIII, LewisY, DLL3, uPAR, MG7 and IL13Rα2, etc., single targets, dual targets or multiple targets. The antigen target can also be an MHC-presented polypeptide complex, such as NY-ESO-1 presented by HLA-A2, and the recognition of this type of antigen target is a TCR-like antibody scFv.

[0102] The CAR gene mentioned above can also be a transgene of other T cell therapies, such as artificially screened TCR genes or transduction genes of other novel T cell therapies, and the corresponding obtained cells are universal TCR-T cells or other universal T cells. The present invention only uses CAR-T cell technology as an entry point to illustrate the advantages of the universal T cell platform, and does not mean that the platform technology is only suitable for preparing universal CAR-T cells.

[0103] The present invention uses gene editing technology to integrate CAR and B2M-HLA-E genes into the TRAC genomic locus, and knock out TRAC and B2M genes at the same time, wherein the targeting vector can be an adeno-associated virus or a non-viral vector. The prepared universal CAR-T cells can completely avoid the GvHD effect, while inhibiting T and NK cell rejection, and increasing the survival time of cells in the host body after allogeneic reinfusion to play a role. At the same time, the method for preparing the universal CAR-T is simple and efficient, and can achieve multi-gene knock-in and knock-out in one step. BRIEF DESCRIPTION OF THE DRAWINGS

[0104] Figure 1 This is a schematic diagram of the effect of universal CAR-T cells with double gene knock-in.

[0105] Figure 2 Schematic diagram of universal CAR-T cell genetic modification.

[0106] Figure 3 Schematic diagram of the structure of B2M-HLA-E, one of the knock-in double genes.

[0107] Figure 4 Schematic diagram of the structure of CAR as one of the knock-in double genes.

[0108] Figure 5 Flow chart for the preparation of site-specific integration universal CAR-T cells using adeno-associated virus vectors.

[0109] Figure 6 Flow chart for preparing the site-specific integrated universal CAR-T cells using non-viral vectors.

[0110] Figure 7 Schematic diagram of 2-O-methylation combined with 3-thiolation modification of sgRNA.

[0111] Figure 8 ac are plasmid vector pAAV-MCS 、 Maps of pHelper and pAAV-RC6.

[0112] Fig. 9 The flow cytometry results of Example 3 are shown.

[0113] Fig.10 The flow cytometry results of Example 4 are shown.

[0114] Fig.11a -b show the cell identification results and killing effect detection results of Example 5 respectively.

[0115] Fig.12 The mouse survival curve of Example 6 is shown.

[0116] Fig.13 The comparison results of Example 7 are shown.

[0117] Fig.14 The flow cytometry results of Example 8 are shown.

[0118] Fig.15a -c shows the flow cytometry detection results of Example 9.

[0119] Fig.16a -b respectively show the schematic diagram of the scheme and the flow cytometry detection results of Example 10.

[0120] Fig.17a -b shows the schematic diagram of the scheme and the flow cytometry detection results of Example 11.

[0121] Fig.18 The flow cytometry results of Example 12 are shown.

[0122] Fig.19 The flow cytometry results of Example 13 are shown.

[0123] Fig. 20 The cell counting results of Example 14 are shown. DETAILED DESCRIPTION

[0124] Example 1: sgRNA design and synthesis

[0125] The sgRNA used was synthesized in vitro (Nanjing GenScript provides sgRNA synthesis services). It is a chemically modified sgRNA with 3'-thiolation and 2'-O-methylation modifications at the 5' and 3' ends, respectively. The modification diagram is as follows: Figure 7 , so that the sgRNA is more stable and not easily degraded by nucleases after transduction into cells. After chemical synthesis, the corresponding sgRNAs are purified by HLPC. The following are the sequences of the chemically synthesized sgRNAs used in the present invention:

[0126]

[0127]

[0128] Example 2: Molecular design of repair template DNA

[0129] The genetic modification scheme for preparing universal CAR-T cells of the present invention is to first use engineered CRISPR-Cas9 to generate DNA incisions at the TRAC and B2M genomic loci, and then use a repair template (the present invention uses adeno-associated virus or modified double-stranded DNA) to perform homologous recombination repair on the DNA incision, and finally knock the CAR and B2M-HLA-E genes into the TRAC genomic loci. This genetic modification can knock out the TRAC and B2M genes (corresponding to the loss of expression of TCR-alpha / beta and HLA class I genes) while introducing the CAR and B2M-HLA-E genes at a fixed point, and use the TCR-alpha gene promoter for transcriptional expression. In addition, to demonstrate the superiority of this scheme, other universal CAR-T cell gene modification schemes will be compared in the examples, including: (1) knocking in different TRAC genomic sites of CAR and B2M-HLA-E genes; (2) knocking in only the TRAC genomic site of CAR gene; (3) knocking in the TRAC and B2M genomic sites of CAR and B2M-HLA-E genes respectively; (4) knocking in the B2M genomic site of CAR and B2M-HLA-E genes; (5) knocking in the TRAC genomic site of CAR and B2M-HLA-E genes only using adeno-associated virus vectors without using gene editing; (6) knocking in the TRAC genomic site of CAR and HLA-E genes; (7) knocking in the TRAC genomic site of CAR and B2M-HLA-E genes and then relying on exogenous promoters for transcription; (8) knocking out the TRAC and B2M genes after lentiviral transduction of CAR and B2M-HLA-E genes. In order to better evaluate cell function and compare the above schemes, the CAR gene is the more mature CD19-targeting CAR gene. The site-specific integration repair template DNA used in the above-mentioned universal CAR-T cell genetic modification consists of two parts:

[0130] a. Left and right homology arms. The left and right homology arms are used to identify the target DNA and perform recombination exchange. In order to correctly express the knock-in gene, the knock-in gene is "landed" in the 5' end region of exon 1 of the TRAC gene. According to the length of the base sequence, homology arms of 300, 600, and 1000 bases are designed respectively. The sequences are shown in SEQ ID NO: 1-6, as shown in the table below:

[0131]

[0132]

[0133] In addition, homology arms for knocking in the B2M genomic locus were designed, as shown in the table below:

[0134] sequence name Sequence number 300 bases left homology arm SEQ ID NO:7 300 bases right homology arm SEQ ID NO:8 600 bases left homology arm SEQ ID NO:9 600 bases right homology arm SEQ ID NO:10 1000 bases left homology arm SEQ ID NO:11 1000 bases right homology arm SEQ ID NO:12

[0135] For the reference Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumour rejection, the designed homology arms for knocking into the TRAC genomic locus are shown in the table below:

[0136] sequence name Sequence number 300 bases left homology arm SEQ ID NO:13 300 bases right homology arm SEQ ID NO:14 600 bases left homology arm SEQ ID NO:15 600 bases right homology arm SEQ ID NO:16 1000 bases left homology arm SEQ ID NO:17 1000 bases right homology arm SEQ ID NO:18

[0137] For the reference Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumour rejection, the designed homology arms for knocking into the TRAC genomic locus are shown in the table below:

[0138] sequence name Sequence number 300 bases left homology arm SEQ ID NO:19 300 bases right homology arm SEQ ID NO:20 600 bases left homology arm SEQ ID NO:21 600 bases right homology arm SEQ ID NO:22 1000 bases left homology arm SEQ ID NO:23 1000 bases right homology arm SEQ ID NO:24

[0139] b. Knocked-in genes. When the target gene is knocked into the TRAC genomic DNA, when it depends on the TCR-alpha promoter, the knocked-in gene includes a cleavage peptide, an expression gene, and a polyA gene; when it depends on the exogenous promoter group, the knocked-in gene includes an exogenous promoter, an expression gene, and a polyA gene. When the target gene is knocked into the B2M genomic DNA, it depends on the B2M gene promoter transcription, and the knocked-in target gene includes an expression gene and a polyA gene. The cleavage peptide used in the embodiment of the present invention is P2A, and the exogenous promoter used in the embodiment of the present invention is EF1. The expression genes of the scheme of the present invention are targeted CD19 CAR and B2M-HLA-E genes, and the expression genes of other comparative schemes include: targeting CD19 CAR single gene and targeting CD19 CAR combined with HLA-E double gene, targeting CD19CAR gene adopts a second-generation structure, and the detailed structure includes targeting CD19 scFv, CD8 hinge region, CD8 transmembrane region, 4-1BB costimulatory region, and CD3ζ activation region. PolyA uses bGHpA polyA or mini polyA, and the gene structure sequences are as follows:

[0140]

[0141]

[0142]

[0143] Example 3: Preparation of universal CAR-T cells targeting CD19 using adeno-associated virus vectors

[0144] 1) Molecular cloning

[0145] The repair template DNA of SEQ ID NO:39 was digested and cloned into the pAAV-MCS plasmid vector (map as shown in Figure 8 The process is divided into the following steps:

[0146] a. Target fragment PCR preparation, first prepare the PCR reaction system:

[0147]

[0148]

[0149] b. Place the PCR reaction system in a PCR amplification instrument and perform amplification under the following conditions:

[0150]

[0151] c. The vector was digested in a 37°C water bath for two hours. The reaction system was as follows:

[0152] Reagents Amount used (μl) 10×Cusmart Buffer 5 pAAV-MCS plasmid and PCR fragment 2μg Not1-HF enzyme (purchased from NEB) 0.5 Sterilized water Make up to 50 μl Total volume 50

[0153] d. Connect the target gene and the linearized vector at a certain molar ratio and react at room temperature for one hour. The reaction system is as follows:

[0154] Reagents Amount used (μl) pAAV-MCS plasmid digested 2 PCR fragments digested 3 2×Ligation Mix (purchased from Takara) 5 Total volume 10

[0155] e. Transformation plate of reaction product: melt a tube of 100 μl Stbl3 competent cells on ice, tap the tube wall to resuspend the cells, add 10 μl ligation reaction solution to the competent cells, tap a few times, and place on ice for 30 minutes; heat shock in a 42°C water bath for 90 seconds and quickly place on ice for 5 minutes; add 500 μl LB liquid culture medium and incubate in a shaking table at 37°C for 45-60 minutes; centrifuge at 5000 rpm for 3 minutes to collect the bacteria, discard 300 μl of the supernatant, and spread the remaining amount of bacteria on a plate containing ampicillin antibiotics, and incubate in a 37°C incubator overnight.

[0156] f. Pick a single clone and extract the plasmid. Column balancing step: Add 500μl of balancing solution BL to the adsorption column CP3, centrifuge at 12,000rpm (13,400×g) for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube; take 5ml of overnight cultured bacterial solution, add it to a centrifuge tube, use a regular desktop centrifuge, centrifuge at 12,000rpm (13,400×g) for 1 minute, and remove the supernatant as much as possible; add 250μl of solution P1 to the centrifuge tube with bacterial sediment, use a pipette or vortex oscillation Thoroughly suspend the bacterial precipitate; add 250 μl of solution P2 to the centrifuge tube, gently turn it upside down 6-8 times to fully lyse the bacteria; add 350 μl of solution P3 to the centrifuge tube, immediately and gently turn it upside down 6-8 times to mix it thoroughly, and a white flocculent precipitate will appear; centrifuge at 12,000 rpm (13,400 × g) for 10 minutes; transfer the supernatant collected in the previous step to the adsorption column CP3 with a pipette (the adsorption column is placed in the collection tube); centrifuge at 12,000 rpm (13,40 0×g) for 30-60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube; add 500μl of deproteinization solution PD to the adsorption column CP3, centrifuge at 12,000rpm (13,400×g) for 30 to 60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CP3 back into the collection tube; add 600μl of rinsing solution PW to the adsorption column CP3, centrifuge at 12,000rpm (13,400×g) for 30-60 seconds, and discard the waste liquid in the collection tube , place the adsorption column CP3 in the collection tube; repeat the previous step; place the adsorption column CP3 in the collection tube, centrifuge at 12,000rpm (13,400×g) for 2 minutes to remove the residual rinsing liquid in the adsorption column; place the adsorption column CP3 in a clean centrifuge tube, add 50-100μl elution buffer EB to the middle part of the adsorption membrane, leave it at room temperature for 2 minutes, centrifuge at 12,000rpm (13,400×g) for 2 minutes to collect the plasmid solution in the centrifuge tube. Add the obtained solution back to the adsorption column, leave it at room temperature for 2 minutes, centrifuge at 12,000rpm (13,400×g) for 2 minutes, and collect the plasmid solution in the centrifuge tube.

[0157] g. After sequencing confirmation, the vector was named pAAV-0039.

[0158] 2) Preparation and purification of adeno-associated virus vector

[0159] a. Packaging: 293T cells (purchased from ATCC) were cultured at 225 cm 2 After culturing to 95% density in a culture dish, the culture was subcultured at a ratio of 1:3. The medium for a single culture dish was 20 ml, and a single adeno-associated virus was packaged in five 225 cm 2Culture dish. First prepare the transfection system (for a 225cm 2 Petri dish), as shown in the following table:

[0160]

[0161]

[0162] After mixing the transfection system, let it stand for 10 minutes and carefully add it to 293T cells. After 6 hours, replace the culture medium with fresh one. After 72 hours, collect the culture medium and cells separately.

[0163] b. Purification: Use a high-speed centrifuge to centrifuge the culture medium at 50,000 g for 2 hours, then remove the culture medium supernatant, add 1 ml PBS buffer to resuspend the virus precipitate, and place it in a 4-degree refrigerator for standby use; resuspend the collected 293T cells with 10 ml PBS buffer, repeatedly freeze and thaw in liquid nitrogen and a 37-degree water bath for 4 times, add the spare supernatant virus, add universal nuclease (purchased from Millipore) and treat at 37 degrees for 30 minutes, centrifuge at 2000 rpm for 30 minutes at 4 degrees to remove cell debris, and take the supernatant; prepare different concentrations of iodixanol according to the following table, namely: 60%, 40%, 25%, and 15%; take a 32 ml PP ultracentrifuge tube (purchased from Beckman), add 60% layer 5ml, 40% layer 5ml, 25% layer 5ml, 15% layer 5ml layer layer by layer, and finally add the sample carefully until the tube is full; ultracentrifuge at 70000rpm for 3 hours; after the centrifugation is completed, use a syringe to draw about 5ml at the junction layer of 40% and 60%, then add 18ml PBS buffer to dilute and use a 100KDa ultrafiltration tube to concentrate the virus by centrifugation, discard the centrifuged liquid, re-add PBS buffer and centrifuge, repeat several times to complete the liquid change, and finally obtain about 5ml of virus; after ultrafiltration and liquid change, filter using a 0.2μm PVDF filter.

[0164]

[0165] c. Titer determination: Take 1 μl rAAV virus liquid for titer detection. The first step is to use DNase digestion. The system is as follows (the virus liquid is diluted 20 times):

[0166] Element content Virus fluid 1μl Deionized water 17μl 10×DNase buffer 2μl DNase I (purchased from NEB) 1μl

[0167] After mixing, place in a 37-degree water bath for 10 minutes, and then place in a 75-degree water bath for 10 minutes to terminate the reaction; in the second step, proteinase K (purchased from ThermoFisher) was used to digest the adeno-associated virus capsid, and the reaction system was prepared as follows (further diluted 5 times):

[0168] Element content First step reaction 20μl Deionized water 79μl Proteinase K (20 mg / ml) 1μl

[0169] After mixing, place in a 55-degree water bath for 30 minutes, and then place in a 95-degree water bath for 10 minutes to terminate the reaction; Step 3: Prepare the fluorescent quantitative PCR reaction system as follows:

[0170]

[0171] The primer sequences are:

[0172] 1F(10μM) GGAACCCCTAGTGATGGAGTT 1R(10μM) CGGCCTCAGTGAGCGA

[0173] After mixing, place it on a fluorescent quantitative PCR instrument (IT-TS) and perform the following reaction:

[0174]

[0175] After the reaction is completed, the Ct value is obtained as follows:

[0176] Sample name Ct value <![CDATA[Standard 10 8 > 10.809 <![CDATA[Standard 10 7 > 14.696 <![CDATA[Standard 10 6 > 18.932 <![CDATA[Standard 10 5 > 23.431 pAAV-0039 14.440

[0177] Finally, the adeno-associated virus titer was calculated according to the Ct value results:

[0178] pAAV-0039 <![CDATA[1.25×10 12 vg / ml]]>

[0179] 3) CAR-T cell preparation

[0180] a. Extraction of mononuclear cells (PBMC): Recruit healthy volunteers who have no symptoms of cold or fever and no infectious diseases (including hepatitis B and AIDS, etc.); Professional medical personnel collect 200 ml of blood from the median cubital vein and connect it to a BD anticoagulant tube; After blood collection, the blood is mixed with an equal amount of PBS buffer (containing 2% fetal bovine serum); Take a Sepmate-50 separation tube (purchased from STEMCELL technologies), carefully add 15 ml of Ficoll buffer, and then carefully add the mixture of blood and PBS along the tube wall, carefully adding about 30 ml to each tube; After centrifugation at 1200g for 10 minutes, quickly pour the supernatant into a new 50 ml tube, centrifuge at 200g for 8 minutes, discard the supernatant, add 10 ml of PBS buffer to resuspend the precipitate, centrifuge at 200g for 8 minutes, discard the supernatant, add 10 ml of PBS buffer to resuspend, centrifuge and discard the supernatant, and resuspend the cell precipitate with 10 ml of PBS buffer; Count the resuspended cells, take 10 μl of the suspension and add 10 μl Mix well with 0.1% trypan blue and count the cells and viability.

[0181] bT cell purification: Take a small amount of the obtained PBMC cells and calculate the proportion of CD3 positive T cells by flow cytometry; according to the experimental needs and the proportion of CD3 positive cells, take out the required PBMC cells, and the required cells should be 70% of the taken cells; resuspend the total PBMC cells with positive selection buffer (the kit used was purchased from STEMCELL technologies) to make the total cell concentration 1×10 8 / ml; every 1×10 8 100 μl CD3 antibody (Release Human CD3 Positive Selection Cocktail) was added to the cells; incubated at room temperature for 3 minutes; magnetic beads (Releasable Rapid Sphenes) were mixed in advance with a vortex mixer for 30 seconds, and 1×10 8 Add 100 μl of magnetic beads to the cells and incubate at room temperature for 3 minutes; transfer the cell suspension to a special sorting tube, and dilute to 2.5 ml with positive selection buffer, place it on a magnetic rack and incubate at room temperature for 5 minutes; carefully grasp the magnetic rack, pour the sorting tube, discard the unbound cell suspension, resuspend the attached magnetic beads and cells with 2.5 ml of positive selection buffer, place it on the magnetic rack again and incubate at room temperature for 3 minutes, and discard the unbound cell suspension again; remove the sorting tube from the magnetic rack, add "Release buffer" to the suspension, and incubate it at room temperature for 3 minutes; place it on a magnetic rack and incubate at room temperature for 5 minutes; carefully grasp the magnetic rack, pour the sorting tube, and collect the unbound cell suspension in a clean and sterile 15 ml centrifuge tube. These cells are the extracted T cells.

[0182] cT cell activation: take 5×10 purified T cells 7 1.5×10 Anti-CD3 / anti-CD28 magnetic beads (purchased from ThermoFisher) were used for activation. 8 The washed beads were added to T cells, mixed well, and cultured at 37 degrees for two days. After two days, the magnetic beads were taken out, the T cells were resuspended several times with a pipette, and the cell suspension was placed in a magnetic pole. After standing for two minutes, the magnetic beads on the tube wall were discarded. The cell number and survival rate were counted on a computer.

[0183] d. Electroporation: Count cells 48 hours after activation; take 6×10 7The cells were electroporated to deliver spCas9 mRNA and sgRNA to cleave the TRAC and B2M genomic loci using the Lonza electroporation kit (Cat. No.: V4XP-3024) and the Lonza electroporation device (4D-Nucleofector); the cells were dispensed into 12 tubes, with 5 × 10 cells per tube. 6 Place the cell suspension in a centrifuge tube and centrifuge at 200 g for 5 minutes. After centrifugation, completely remove the culture medium and set aside. Prepare Lonza electroporation buffer. 6 10 μg of spCas9 mRNA (amino acid sequence as shown in SEQ ID NO: 57) and 1 μg of designed and synthesized sgRNA-0003 and sgRNA-0004 were added to each cell, mixed at room temperature and then mixed with the cell pellet and added to the electroporation cup, and electroporated with the E0-115 program. After the electroporation, the cell was placed in a 37-degree incubator for 10 minutes, and then added to 5 ml of preheated cell culture medium; the above electroporation process was repeated 11 times in a row.

[0184] e. Adeno-associated virus transfection: 4 hours after electroporation, the purified adeno-associated virus (pAAV-0039) described in Example 3 was added to the cells, with 0.4 ml of adeno-associated virus added to every 5 ml of cell suspension; after 24 hours, new culture medium was replaced to remove the adeno-associated virus in the culture medium.

[0185] f. Cell expansion: After electroporation, the cells were cultured in the well plate for two days, and then transferred to culture bags (purchased from Takara) for culture. The initial culture density was 5×10 5 Cells / ml were collected every other day to measure the cell density, and fresh culture medium was added to adjust the cell density to 5×10 5 cells / ml, and 10 ng / ml recombinant IL-2 (purchased from PeproTech) was added.

[0186] g. TCR-negative cell enrichment: The cells were counted after 15 days of culture and the cell density was 3.7×10 6 / ml, viability 93%, a total of about 1800ml cell suspension, the total number of living cells is 1×10 10 ; Take 1×10 5cells, added TCR-PE antibody for staining for 25 minutes, washed with PBS buffer, and then detected the proportion of TCR-negative cells by flow cytometry, and the measured TCR-negative cells accounted for 92%; all universal CAR-T cells were collected, centrifuged and resuspended in 100 ml of culture medium; CD3 antibody-coupled Dynabeads sorting magnetic beads (purchased from ThermoFisher) were taken, the number of magnetic beads was twice the number of TCR-positive cells, the magnetic beads were mixed with the above cell suspension, and incubated on a rotator; after 30 minutes, the magnetic stand was transferred to the magnetic stand, and after standing for 5 minutes, the unbound cells, i.e., TCR-negative cells, were aspirated.

[0187] h. Cell cryopreservation: After enrichment of TCR-negative cells, a total of 1×10 10 cells; collect the cells by centrifugation, resuspend the cell pellet with PBS; centrifuge again and discard the supernatant; mix the pellet with 50 ml of cell freezing solution (purchased from STEMCELL Technologies) to make the cell concentration 2×10 8 / ml; the packaged cells were placed in a 4℃ refrigerator for 10 minutes, then transferred to a gradient cooling box; and stored in a -80℃ refrigerator.

[0188] 4) Flow cytometry

[0189] The cells were divided into two groups before and after TCR negative enrichment to detect the genetic modification. The specific method was as follows: 1×10 cells were taken from each group of control cells before and after sorting and universal CAR-T cells. 5 After washing with PBS buffer, add two groups of flow cytometry antibodies CD19-FITC / PE-TCR and HLA-ABC-APC / HLA-E-PE to stain for 25 minutes, then wash again with PBS buffer, and finally resuspend the cells with PBS buffer and analyze on flow cytometer. Fig. 9 The results show that the TCR and HLA-ABC negative cells of the universal CAR-T cells are more than 90% before sorting, and the positive expression of targeted CD19 CAR and HLA-E genes exceeds 60%, proving that the gene modification scheme can efficiently edit multiple genes at the same time. In addition, the targeted CD19 CAR and HLA-E positive expression cells are TCR negative at the same time, which is in line with the gene editing settings of the present invention. After cell sorting, the TCR negative ratio exceeds 99%, proving that the sorting is successful and can be used for allogeneic cell transfusion.

[0190] Example 4: Preparation of CD19-targeted universal CAR-T cells using non-viral vectors

[0191] 1) Molecular cloning

[0192] After the repair template DNA of SEQ ID NO: 39-41 was synthesized, it was cloned into the pUC57 plasmid vector respectively. The process was divided into the following steps:

[0193] a. Target fragment PCR, prepare the PCR reaction system as follows:

[0194]

[0195]

[0196] b. Place the PCR reaction system in a PCR amplification instrument and perform amplification under the following conditions:

[0197]

[0198] c. Vector PCR, first prepare the PCR reaction system:

[0199] Reagents Amount used (μl) 5×primeSTAR GXL Buffer 10 dNTP Mix 4 Primer F 1 Primer R 1 pUC57 0.5 Sterilized water 31.5 PrimeSTAR GXL DNA Polymerase 2 Total volume 50

[0200] d. Place the PCR reaction system in a PCR amplification instrument and perform amplification according to the following conditions:

[0201]

[0202]

[0203] e. Recombination of target fragment and vector: Add the target gene and linearized vector to a centrifuge tube at a certain molar ratio for recombination reaction, and react in a 50°C water bath for 10 minutes. The reaction system is as follows:

[0204] Reagents Amount used (μl) Vector pUC57 3.5 Target fragment (0039-0041) 4 5× reaction buffer 2 NovoRec Plus Recombinase 0.5 Total volume 10

[0205] f. The reaction product is converted into a coating plate, and the process is the same as in Example 3.

[0206] g. Pick a single clone and extract the plasmid in the same way as in Example 3.

[0207] h. Sequencing confirmation. The obtained vector is as follows:

[0208] serial number Vector Name 1 pUC57-0039 2 pUC57-0040 3 pUC57-0041

[0209] 2) PCR amplification of repair template DNA

[0210] a. The PCR primer sequences and modifications for repairing template DNA are as follows:

[0211]

[0212] b. Prepare 20 ordinary PCR tubes respectively and prepare the PCR reaction system mixture Mix as follows:

[0213]

[0214]

[0215]

[0216]

[0217]

[0218] c. Place the PCR reaction system in a PCR amplification instrument and perform amplification under the following conditions:

[0219]

[0220] After PCR, all samples were collected into 15 ml centrifuge tubes.

[0221] 3) Purification of PCR products of repaired template DNA

[0222] The PCR product of the template DNA was purified using the large-scale DNA product purification kit (DP205) of Tiangen Biochemical Technology (Beijing) Co., Ltd. 100 μl PCR system using one column, 1000 μl The PCR product needs 10 tubes of column purification, and the specific steps are as follows: a. Column balancing step: add 500μl of balancing solution BL to the adsorption column CB3 (the adsorption column is placed in the collection tube), centrifuge at 12,000rpm (~13,400×g) for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube; b. Estimate the volume of the PCR reaction solution, add 5 times the volume of binding solution PB to it, and mix thoroughly; c. Add the solution obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in the collection tube), leave it at room temperature for 2 minutes, centrifuge at 12,000rpm (~13,400×g) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CB3 in the collection tube; d. Add 600μl of rinsing solution PW to the adsorption column CB3, centrifuge at 12,0 00rpm (~13,400×g) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CB3 in the collection tube; e. Repeat the above steps; f. Put the centrifugal adsorption column CB3 back into the collection tube, centrifuge at 12,000rpm (~13,400×g) for 2 minutes, remove the rinsing liquid as much as possible, leave the adsorption column at room temperature for several minutes, and dry it thoroughly to prevent the residual rinsing liquid from affecting the next experiment; g. Take out the adsorption column CB3 and place it in a clean centrifuge tube, add an appropriate amount of elution buffer EB to the middle position of the adsorption membrane, leave it at room temperature for 2 minutes, centrifuge at 12,000rpm (~13,400×g) for 2 minutes, and collect the DNA solution; h. Combine the collected DNA solutions and use Nanodrop to detect the DNA concentration.

[0223] 4) CAR-T cell preparation

[0224] a. The methods of PBMC extraction, T cell purification, T cell activation, cell expansion, TCR-negative cell enrichment and cell freezing were the same as those in Example 3, with only a significant difference in the step of electroporation.

[0225] b. Electroporation: Count cells 48 hours after activation; take 6×10 7 The cells were electroporated to deliver spCas9 protein (purchased from ThermoFisher), sgRNA, and modified double-stranded DNA (pUC57-0039 PCR product) to achieve the cleavage of TRAC and B2M genomic loci and knock-in of the target gene at one time. The electroporation process used the Lonza electroporation kit (Cat. No.: V4XP-3024) and the Lonza electroporation device (4D-Nucleofector); the cells were divided into 12 tubes, each tube with 5×10 6 Place the cell suspension in a centrifuge tube and centrifuge at 200 g for 5 minutes. After centrifugation, completely remove the culture medium and set aside. Prepare Lonza electroporation buffer. 6 Add 10 μg of spCas9 protein, 1 μg of designed and synthesized sgRNA-0003 and sgRNA-0004, and 10 μg of modified double-stranded DNA to each cell, mix well at room temperature, mix well with the cell pellet and add to the electroporation cup, and perform electroporation with the E0-115 program. After the electroporation, place the cell in a 37-degree incubator for 10 minutes, and then add the cell to 5 ml of preheated cell culture medium; repeat the above electroporation process 11 times in a row.

[0226] 5) Flow cytometry

[0227] The cells were divided into two groups before and after TCR negative enrichment to detect the genetic modification. The specific method was as follows: 1×10 cells were taken from each group of control cells before and after sorting and universal CAR-T cells. 5 After washing with PBS buffer, add two groups of flow cytometry antibodies CD19-FITC / PE-TCR and HLA-ABC-APC / HLA-E-PE to stain for 25 minutes, then wash again with PBS buffer, and finally resuspend the cells with PBS buffer and analyze on flow cytometer. Fig.10 The results show that the TCR and HLA-ABC negative cells of the universal CAR-T cells are more than 80% before sorting, and the positive expression of targeted CD19 CAR and HLA-E genes exceeds 40%, proving that the gene modification scheme can edit multiple genes at the same time. In addition, the targeted CD19 CAR and HLA-E positive expression cells are TCR negative at the same time, which is in line with the gene editing setting of the present invention. After cell sorting, the TCR negative ratio exceeds 99%, proving that the sorting is successful and can be used for allogeneic cell transfusion.

[0228] Example 5: In vitro killing experiment

[0229] The lactate dehydrogenase (LDH) cytotoxicity method was used to detect the killing effect of the universal CAR-T cells prepared in Examples 3 and 4 (the kit used was purchased from Promega). The specific process is: after the cells are cultured to the 15th day and the sorting is completed, the effector cells (universal CAR-T cells) and target cells (K562-CD19, cell identification as shown in Figure 2) are respectively aspirated. Fig.11a ) to a 1.5 ml EP tube, centrifuge at 300 g for 5 minutes, discard the cell supernatant, and then resuspend all cells with 200 μl of 1640 medium containing 1% bovine serum, mix thoroughly and count the cells; according to the counting results, configure the system according to the effect-target ratio of 5:1, and add them to the round-bottom 96-well plate in sequence; after the addition, put the cell plate into a centrifuge, centrifuge at 100 g for 2 minutes, and place the cell plate in an incubator after the centrifugation; after overnight incubation, add 20 μl of cell lysis solution to the wells with the maximum release of K562-CD19 cells , then place the 96-well plate in the incubator and incubate for 45 minutes, and place the substrate in the kit at room temperature to dissolve; after the incubation, aspirate 50μl of liquid from each well and transfer it to a 96-well flat-bottom plate, and use a spray gun to quickly add 50μl of the substrate in the kit to each well. After the test liquid and substrate react at room temperature for about 30 minutes, quickly add 50μl of the termination reaction solution in the kit to each well; wait for about 3 minutes for the color of each well to stabilize, puncture the bubble with a clean needle, and then use an enzyme reader (Thermo Fisher Multiskan FC model) to detect the value of each well at 490nm, and calculate the original data according to the formula in the kit manual. The results of the killing effect test of the control cells and CAR-T cells on the target cells K562-CD19 in this example are as follows Fig.11b The results showed that universal CAR-T cells prepared by both methods could effectively kill CD19-positive target cells.

[0230] Example 6: Universal CAR-T cell therapy for B acute lymphoblastic leukemia mouse model

[0231] 1) The mouse model and cell information used are as follows:

[0232] Options information variety NOG mice Age 6-8 weeks old gender female Transplanted tumor cells Raij-GFP-Luciferase cells Experimental cells Universal CAR-T and control cells prepared in Examples 3 and 4

[0233] 2) Methods: Mice were divided into three groups as shown in the following table; each mouse was injected with 3.5×10 Raji-GFP-Luciferase cells. 5 (injection method: tail vein); 5 days after Raji cell injection, 2×10 6The CD19-targeted universal CAR-T (from Examples 3 and 4) and control cells prepared by adeno-associated virus or non-viral vectors were injected into the tail vein; the subsequent survival of the mice was observed for 70 days, and the weight data were recorded weekly.

[0234]

[0235]

[0236] Results: The survival curve of mice is shown in Fig.12 From the figure, it can be seen that both groups of universal CAR-T cells can significantly prolong the survival time of B acute lymphoblastic leukemia mice compared with control cells, and the efficacy of universal CAR-T cells prepared by adeno-associated vectors is slightly better than that of universal CAR-T cells prepared by non-viral vectors in mouse models, but the difference between the two is not large. This experiment proves that the universal CAR-T cells prepared by the scheme of the present invention have significant efficacy against CD19-positive tumors in vivo.

[0237] Example 7: Off-target detection

[0238] The off-target problem of CRISPR-Cas9 gene editing technology is a hot topic. In the present invention, potential off-target comes from two factors: the specificity of sgRNA and the specificity of gene knock-in mediated by adeno-associated virus vector. This example will verify the specificity of the two main sgRNAs used, that is, the off-target probability of sgRNA.

[0239] The website https: / / design.synthego.com / was used to analyze the off-target sites of sgRNA-0003 (targeting the TRAC gene), and potential off-target sites encoding amino acids were selected. The results were as follows:

[0240]

[0241]

[0242] Primers were designed according to the DNA sequences of these sites. The PCR fragments of these primers are about 700 to 1000 bases in size (potential off-target sequences are located in the middle of the PCR fragments). The specific primer sequences are as follows:

[0243]

[0244]

[0245] The cells tested were the TCR negative enriched universal CAR-T and T control cells prepared in Example 3; the genomic DNA of the two groups of cells was extracted (using the Tiangen Bio Kit); the above two groups of off-target detection primers were used for PCR amplification, and the prepared PCR systems and procedures were as follows:

[0246] Reagents Amount used (μl) 5×primeSTAR GXL Buffer 4 dNTP Mix 1.6 Primer F 0.5 Primer R 0.5 Genomic DNA 2.5 Sterilized water 10.4 PrimeSTAR GXL DNA Polymerase 0.5 Total volume 20

[0247]

[0248] After PCR was completed, DNA gel electrophoresis was performed; DNA was recovered by gel excision (using the kit of Tiangen Biotechnology); and then sequencing was performed using the corresponding PCR upstream primers. The ab1 files obtained by sequencing were used for TIDE alignment in pairs using the website https: / / tide.nki.nl / ; the alignment results were as follows: Fig.13 .

[0249] Fig.13 The comparison results show that sgRNA-0003 has no off-target effects. The reasons may be due to two reasons: T cells are relatively conservative, and gene editing of T cells is highly accurate; the delivery method used in this example is spCas9 protein electroporation, so CRISPR shearing is transient, which is more accurate than virus and plasmid delivery methods.

[0250] Example 8: Targeted CD19 CAR and B2M-HLA-E gene knock-in at different TRAC genomic sites compared with the scheme of Example 3.

[0251] In the paper - Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumor rejection, the CAR gene was knocked into the TRAC genomic locus through a type 6 adeno-associated virus vector and gene editing methods. Although a certain efficiency was achieved (about 40% knock-in efficiency), there is still a little gap in efficiency compared to the preparation of CAR-T cells using lentiviral vectors. In another paper - Reprogramming human T cell function and specificity with non-viral genome targeting, researchers knocked the NY-ESO-1TCR gene into the TRAC genomic locus through an unmodified double-stranded DNA template combined with CRISPR-Cas9 technology. Although the feasibility of the non-viral site-specific integration method has been proven, the efficiency is still not high (about 10% knock-in efficiency). The TRAC genomic locus targeted and knocked in in the present invention is not consistent with the above literature. The present invention will prove that this site will have a higher efficiency for CAR gene knock-in. The following is a comparative experimental process of CAR gene site-specific knock-in of different TRAC genomic DNA sites:

[0252] (1) Cell preparation

[0253] a. PBMC extraction was the same as in Example 3.

[0254] bT cell purification: same as Example 3.

[0255] cT cell activation was the same as in Example 3, and a total of 1.5×10 7 T cells.

[0256] d. Electrotransfection: After 48 hours of T cell activation, three 5×106 T cells were taken to remove the activation magnetic beads and then electrotransfected according to the method of Example 3 and added with adeno-associated viral vectors. The template DNA of the TRAC genomic site in the document Targeting a CAR to the TRAClocus with CRISPR / Cas9 enhances tumour rejection is shown in SEQ ID NO: 48 (the DNA is cloned into the pAAV-MCS vector and then packaged into the adeno-associated viral vector, and the method is consistent with Example 3. In addition, the sgRNA used for targeting TRAC is 0001), the template DNA of the TRAC genomic site in the document Reprogramming human T cell function and specificity with non-viral genome targeting is shown in SEQ ID NO: 49 (the DNA is cloned into the pAAV-MCS vector and then packaged into the adeno-associated viral vector, and the method is consistent with Example 3. In addition, the sgRNA used for targeting TRAC is 0002), and the knock-in of the TRAC genomic DNA site of the present invention is shown in SEQ ID NO: 39 (the adeno-associated viral vector is from Example 3, and the sgRNA used for targeting TRAC is 0003).

[0257] e. Cell expansion, TCR-negative cell purification and cell freezing are the same as in Example 3.

[0258] (2) Flow cytometry

[0259] On the 8th day after transduction, 1×10 cells were collected. 5 The cells were washed once with PBS, stained with flow cytometry antibody CD19-FITC / TCR-PE for 25 minutes, washed again with PBS, and finally resuspended with PBS for analysis on a flow cytometer. Fig.14 The TRAC genomic locus targeted and knocked-in and its sgRNA combination in the present invention are used for CAR gene knock-in with higher efficiency than those in the two papers Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumour rejection and Reprogramming human T cell function and specificity with non-viral genome targeting.

[0260] Example 9: Comparison of targeting CD19 CAR single gene knock-in TRAC genomic site with the scheme of Example 3.

[0261] 1) Cell preparation

[0262] a. PBMC extraction was the same as in Example 3, and the peripheral blood of the recruited volunteers was negative for HLA-A2 expression.

[0263] bT cell purification was the same as in Example 3.

[0264] cT cell activation was the same as in Example 3, and a total of 1×10 7 T cells.

[0265] d. Electroporation and adeno-associated virus vector transduction: After 48 hours of T cell activation, two 5×10 6 After removing the activation magnetic beads, the T cells were electroporated and an adeno-associated viral vector was added according to the method of Example 3, wherein the template DNA for single knock-in targeting CD19 CAR to the TRAC genomic site is shown in SEQ ID NO: 50 (the DNA was cloned into the pAAV-MCS vector and then packaged into the adeno-associated viral vector, the method was consistent with Example 3. In addition, the sgRNA used to target TRAC was 0003), and the template DNA for double gene knock-in of CAR and B2M-HLA-E into the TRAC genomic site was shown in SEQ ID NO: 39 (the adeno-associated viral vector was from Example 3).

[0266] e. Cell expansion, TCR-negative cell purification and cell freezing are the same as in Example 3.

[0267] 2) Flow cytometry

[0268] Take 1×10 cells from each group of control and universal CAR-T cells before sorting. 5 After washing with PBS buffer, the cells were stained with flow cytometry antibodies CD19-FITC, HLA-ABC-APC and HLA-E-PE for 25 minutes, washed again with PBS buffer, and finally resuspended with PBS buffer and analyzed by flow cytometry. Fig.15a The results show that the effective cells obtained by single knock-in of the targeted CD19 CAR gene are comparable to those of the present invention.

[0269] 3) Universal CAR-T cells prepared by two methods were co-cultured with allogeneic NK cells to detect in vitro NK allogeneic rejection reaction

[0270] Extraction of NK cells: HLA-A2 positive volunteers were screened; peripheral blood mononuclear cells (PBMC) of volunteers were collected and the cell number and viability were detected by trypan blue staining, the method was the same as in Example 3; NK cells in PBMC were purified using an NK cell sorting kit (purchased from Miltenyi Company); the extraction effect of NK cells was detected, and 1×10 5NK cells were stained with flow cytometry antibodies (antibodies: CD3-PC5.5 and CD56-FITC). The results of flow cytometry analysis are shown in Fig.15b .

[0271] Cell incubation: Trypan blue staining was used to detect the number and viability of control T cells, universal CAR-T cells (UCART-1) with only knock-in targeting CD19 CAR gene, and universal CAR-T cells (UCART-2) with double knock-in targeting CD19 CAR and B2M-HLA-E gene; the cells were mixed and incubated according to the following table, the incubation medium was RPMI Medium 1640 + 10% fetal bovine serum + cytokine interleukin 2 (10 ng / ml), the incubation volume was 200 μl, and the cells were incubated in a 96-well flat-bottom plate. After plating, the 96-well plate was placed in a 5% CO2, 37°C cell culture incubator; for the detection of the incubation effect, on the corresponding days, each group of mixed experimental cells was mixed and 100 μl of the volume was transferred to a 1.5 ml centrifuge tube for flow antibody staining (antibodies: HLA-A2-PE, HLA-ABC-APC), and flow cytometry was used for analysis. The results were analyzed as follows: Fig.15c It can be seen that after one and two days of co-incubation, the proportion of universal CAR-T cells with only knocked-in targeting CD19 CAR gene was significantly less than that of universal CAR-T cells with double knocked-in targeting CD19 CAR and B2M-HLA-E genes, indicating that in the case of B2M gene knockout, the scheme of the present invention has the ability to inhibit NK killing activity, suggesting that it is more resistant to the rejection reaction of allogeneic NK cells.

[0272]

[0273] Example 10: Targeted CD19 CAR and B2M-HLA-E genes were knocked into the TRAC and B2M genomic loci respectively to compare the scheme of Example 3.

[0274] The universal CAR-T cells prepared in the preparation and application of universal CD19 antigen-targeted chimeric receptor T cells (application number: CN201810636413.7) and the method for increasing the compatibility of allogeneic T cell transplantation and its application (application number: CN201810634501.3) are the CAR gene and the B2M-HLA-E gene knocked into the TRAC and B2M genomic loci (such as Fig.16a As shown in Figure 2, this scheme requires the use of two adeno-associated virus vectors, which is significantly inferior to the scheme of the present invention (using only one adeno-associated virus vector). In order to compare the effective cell numbers obtained by the two (i.e., CAR and HLA-E gene expression is positive while TCR and HLA-ABC gene expression is negative), a comparative experiment was designed, and the specific implementation is as follows:

[0275] 1) Cell preparation

[0276] a. PBMC extraction was the same as in Example 3.

[0277] bT cell purification: same as Example 3.

[0278] cT cell activation was the same as in Example 3, and a total of 1×10 7 T cells.

[0279] d. Electroporation and adeno-associated virus vector transduction: After 48 hours of T cell activation, two 5×10 6 After removing the activation magnetic beads, the T cells were electroporated according to the method of Example 3 and an adeno-associated viral vector was added, wherein the transduction gene of the single gene targeting CD19 CAR knocked into the TRAC genomic site is shown in SEQ ID NO: 50 (the DNA was cloned into the pAAV-MCS vector and then packaged into the adeno-associated viral vector, and the method was consistent with Example 3), the transduction gene of the single gene B2M-HLA-E knocked into the B2M genomic site is shown in SEQ ID NO: 51 (the DNA was cloned into the pAAV-MCS vector and then packaged into the adeno-associated viral vector, and the method was consistent with Example 3), and the transduction gene of the CAR and B2M-HLA-E double gene knocked into the TRAC genomic site is shown in SEQ ID NO: 39 (the adeno-associated viral vector is from Example 3).

[0280] e. Cell expansion, TCR-negative cell purification and cell freezing are the same as in Example 3.

[0281] (2) Flow cytometry

[0282] Take 1×10 cells from each group of control and universal CAR-T cells before sorting. 5 After washing with PBS buffer, the cells were stained with flow cytometry antibodies CD19-FITC / PE-TCR and HLA-ABC-APC / HLA-E-PE for 25 minutes, then washed with PBS buffer again, and finally resuspended with PBS buffer and analyzed by flow cytometry. Fig.16b As shown, it can be seen from the results that the knock-in efficiency obtained by knocking in the TRAC and B2M genomic loci groups by targeting CD19 CAR and B2M-HLA-E single genes respectively is not much different from that of the method in Example 3, but the effective cells (CAR positive cell ratio multiplied by HLA-E positive cell ratio) are only about half of that of the method in Example 3.

[0283] Example 11: Targeted CD19 CAR and B2M-HLA-E gene knock-in to the B2M genomic locus compared with the scheme of Example 3.

[0284] Corresponding to the solution in Example 3, the targeted CD19 CAR and B2M-HLA-E genes are simultaneously knocked into the B2M genomic locus (eg Fig.17a In order to compare the advantages and disadvantages of knocking in the TRAC genomic locus and knocking in the B2M genomic locus, a comparative experiment was designed, and the specific implementation is as follows:

[0285] 1) Cell preparation

[0286] a. PBMC extraction was the same as in Example 3.

[0287] bT cell purification: same as Example 3.

[0288] cT cell activation was the same as in Example 3, and a total of 1×10 7 T cells.

[0289] d. Electroporation and rAAV vector transduction: After 48 hours of T cell activation, two 5×10 6 After removing the activation magnetic beads, the T cells were electroporated and an adeno-associated virus vector was added according to the method of Example 3, wherein the template DNA knocked into the B2M genomic site is shown in SEQ ID NO: 52 (the DNA was cloned into the pAAV-MCS vector and then packaged into the adeno-associated virus vector, the method was consistent with Example 3), and the transduction gene knocked into the TRAC genomic site is shown in SEQ ID NO: 39 (the adeno-associated virus vector is from Example 3).

[0290] e. Cell expansion, TCR-negative cell purification and cell freezing are the same as in Example 3.

[0291] (2) Flow cytometry

[0292] Take 1×10 cells from each group of control and universal CAR-T cells before sorting. 5 After washing with PBS buffer, the cells were stained with flow cytometry antibodies CD19-FITC and HLA-ABC-APC / HLA-E-PE for 25 minutes, then washed with PBS buffer again, and finally resuspended with PBS buffer and analyzed by flow cytometry. Fig.17b The results show that knocking into the B2M genomic locus is also feasible, but the efficiency is slightly lower than knocking into the TRAC genomic locus.

[0293] Example 12: Comparison of the scheme of Example 3 by targeting CD19CAR and B2M-HLA-E gene knock-in into the TRAC genomic site using only adeno-associated virus vector without using gene editing.

[0294] The literature - HlA-E-expressing pluripotent stem cells escape allogeneicresponses and lysis by NK cells uses an adeno-associated virus vector to knock the B2M-HLA-E gene into the B2M genomic locus, so that the edited stem cells reduce T and NK cell rejection reactions. In this study, the gene knock-in process did not use gene editing, but only relied on adeno-associated virus vectors. In order to prove that the CRISPR-Cas9 gene editing + adeno-associated virus vector scheme used in the present invention is superior to the literature, a set of experiments was specially designed to compare the differences between the two. The specific process is as follows:

[0295] 1) Cell preparation

[0296] a. PBMC extraction was the same as in Example 3.

[0297] bT cell purification was the same as in Example 3.

[0298] cT cell activation was the same as in Example 3, and a total of 1×10 7 T cells.

[0299] d. Adeno-associated virus vector transduction: 48 hours after T cell activation, 5×10 6 After removing the activation beads, rAAV vector virus was directly added (i.e., transfected) to each T cell, and the MOI was set to 1×10 5 Take 5×10 6 After removing the activation magnetic beads, the T cells were electroporated according to the method in Example 3 and rAAV vector virus was added.

[0300] e. Cell expansion, TCR-negative cell purification and cell freezing are the same as in Example 3.

[0301] 2) Flow cytometry

[0302] Take 1×10 cells from each group of control and universal CAR-T cells before sorting. 5 After washing with PBS buffer, the cells were stained with flow cytometry antibodies CD19-FITC / PE-TCR and HLA-ABC-APC / HLA-E-PE for 25 minutes, then washed with PBS buffer again, and finally resuspended with PBS buffer and analyzed by flow cytometry. Fig.18As shown in the results, it can be seen that the gene knock-in efficiency is almost undetectable in the rAAV vector-transfected virus group, which shows that the method of HlA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells in the literature is not suitable for the preparation of gene knock-in universal CAR-T cells.

[0303] Example 13: Targeted CD19 CAR and HLA-E gene knock-in TRAC genomic site comparison scheme of Example 3.

[0304] In the patent - Universal CAR-T cells and their preparation methods and applications (application number: CN201710983276.X), the B2M and TRAC genes are knocked out after transduction of the HLA-E gene, with the purpose of inhibiting the expression of HLA-E while expressing HLA-I genes. However, in theory, after knocking out the endogenous B2M gene, any HLA-I gene (including HLA-E) cannot be expressed after transduction, while the transduction of the B2M-HLA-E gene is not affected by the knockout of the endogenous B2M gene (i.e., the scheme of the present invention). In order to verify the theoretical conjecture, an experimental verification is specially designed, and the specific implementation method is as follows:

[0305] 1) Cell preparation

[0306] a. PBMC extraction was the same as in Example 3.

[0307] bT cell purification was the same as in Example 3.

[0308] cT cell activation was the same as in Example 3, and a total of 1×10 7 T cells.

[0309] d. Electroporation and adeno-associated virus vector transduction: After 48 hours of T cell activation, two 5×10 6 After removing the activation magnetic beads, the T cells were electroporated according to the method of Example 3 and an adeno-associated virus vector was added, wherein the template DNA for double gene knock-in of CAR and HLA-E into the TRAC genomic site is shown in SEQ ID NO: 53 (the DNA was cloned into the pAAV-MCS vector and then packaged into the adeno-associated virus vector, the method was consistent with Example 3), and the template DNA for double gene knock-in of CAR and B2M-HLA-E into the TRAC genomic site was shown in SEQ ID NO: 39 (the adeno-associated virus vector was from Example 3).

[0310] e. Cell expansion, TCR-negative cell purification and cell freezing: Same as Example 3.

[0311] 2) Flow cytometry

[0312] Take 1×10 cells from each group of control and universal CAR-T cells before sorting. 5 After washing with PBS buffer, the cells were stained with flow cytometry antibodies CD19-FITC / PE-TCR and HLA-ABC-APC / HLA-E-PE for 25 minutes, then washed with PBS buffer again, and finally resuspended with PBS buffer and analyzed by flow cytometry. Fig.19 As shown in the results, it can be seen that the transduced HLA-E group cannot express HLA-E under HLA-ABC negative conditions, while in this scheme, after transduction of B2M-HLA-E, HLA-E protein can be expressed under HLA-ABC negative conditions, which theoretically can reduce the rejection reaction of T and NK cells at the same time, so this scheme is more feasible.

[0313] Example 14: Comparison of the scheme of Example 3 with that of knocking out TRAC and B2M genes after lentiviral transduction targeting CD19 CAR and B2M-HLA-E genes.

[0314] Lentiviral transduction for preparing CAR-T cells is a relatively mature technology, but it has two disadvantages, namely limited packaging capacity and random insertion that can easily lead to cell canceration. In particular, the small packaging capacity limits the lentivirus to carry no more than three thousand bases of foreign genes. If this upper limit is exceeded, the packaging and transfection of the virus will be greatly affected. This example will compare the final effective cell yield of universal CAR-T cells transduced with dual genes prepared by lentivirus and adeno-associated virus to determine the superiority of the scheme of the present invention. The specific steps are as follows:

[0315] 1) Lentiviral packaging

[0316] Lentiviral transduction targeting CD19 CAR and B2M-HLA-E gene Kozak-CAR19-B2M-HLA-E (SEQ ID NO: 54) was cloned into the pLVX-EF1 vector; 293T cells (purchased from ATCC) were cultured at 75 cm one day before transfection. 2 The culture dish is full and subcultured at a ratio of 1:3. Each culture dish has 15 ml of culture medium. Transfection is performed according to the manufacturer's steps for Lipo3000. First, prepare the transfection system:

[0317]

[0318] Mix systems 1 and 2, let stand for 5 minutes, then mix them and let stand for another 10 minutes. Carefully add to 293T cells. Replace with fresh culture medium after 6 hours. After 48 hours, collect the culture medium and store it at 4°C, re-add 15 ml of new culture medium, and collect the supernatant after 24 hours. Filter the obtained viral supernatant with a 0.45μm filter membrane and put it into an ultracentrifuge tube. Centrifuge at 50,000g for 2 hours and 45 minutes at 4°C, carefully and thoroughly remove the supernatant, and resuspend the remaining white virus precipitate visible to the naked eye with PBS buffer at one percent of the supernatant volume. After the virus is resuspended, dissolve it at 4 degrees for about 30 minutes. After the dissolution is completed, divide it into small portions and freeze it in a refrigerator at minus 80 degrees.

[0319] 2) Cell preparation

[0320] a. PBMC extraction was the same as in Example 3.

[0321] bT cell purification was the same as in Example 3.

[0322] cT cell activation was the same as in Example 3, and a total of 1×10 7 T cells.

[0323] d. Lentivirus transfection: 24 hours after activation, take 5×10 6 T cells were placed in a 15 ml tube, centrifuged to remove the culture medium, and then lentivirus targeting CD19 CAR and B2M-HLA-E genes (SEQ ID NO: 54) was added at an MOI value of 5, and centrifuged at 2000g for 90 minutes; after the centrifugation, the lentiviral supernatant was removed and the culture medium was added to continue the culture.

[0324] e. Electroporation: 72 hours after activation, take 5×10 6 untransfected T cells and 5×10 6 The T cell suspensions transfected with lentivirus targeting CD19 CAR and B2M-HLA-E genes were placed in centrifuge tubes for centrifugation at 200g for 5 minutes. After centrifugation, the culture medium was completely removed for use. Lonza electroporation buffer was prepared, and 10 μg of Cas9 mRNA and 1 μg of designed and synthesized sgRNA-0003 and sgRNA-0004 were added to the two groups respectively. After mixing, they were mixed with the cell pellet and added to the electroporation cup. The E0115 program was used for electroporation. After the electroporation was completed, it was placed in a 37-degree incubator for 10 minutes and then added to 5 ml of preheated cell culture medium.

[0325] f. Adeno-associated virus vector transfection: After electroporation, pAAV-0039 purified from Example 3 was added to the non-transfected lentivirus cell group 4 hours later (5 ml of cell suspension was added with a titer of 5×10 11 vg of adeno-associated virus vector); after 24 hours, the cells were replaced with new culture medium to remove the adeno-associated virus vector.

[0326] g. Cell expansion, TCR-negative cell purification and cell freezing are the same as in Example 3.

[0327] 2) Cell counting

[0328] The cells were counted on the fourth, seventh, tenth, thirteenth and sixteenth days after electroporation. The cells were stained with trypan blue and read on a CountStar automatic cell counter. The results are summarized as follows:

[0329]

[0330] 3) Flow cytometry

[0331] Take 1×10 cells from each of the control and universal CAR-T cells at different time points. 5 After washing with PBS buffer, add two groups of flow cytometry antibodies CD19-FITC / PE-TCR and HLA-ABC-APC / HLA-E-PE for staining for 25 minutes, then wash with PBS buffer again, and finally resuspend the cells with PBS buffer and analyze them on flow cytometer. The results are summarized in the following table:

[0332]

[0333]

[0334] According to the cell counting results, it can be seen that the expansion multiples of universal CAR-T cells prepared by the two groups of methods are not much different, and the final viability is above 90%. In addition, the flow cytometry results show that the HLA-ABC and TCR knockout efficiencies are similar, but the CAR-positive cell ratio of the lentivirus group is significantly lower than that of the universal CAR-T cell group prepared by adeno-associated virus. It can be concluded that the effective cells prepared by the lentivirus group (HLA-ABC negative, TCR negative and CAR positive) are far less than those prepared by the adeno-associated virus group ( Fig. 20 ), indicating the superiority of the present invention in preparing universal CAR-T cells under the same gene editing requirements.

Claims

1. A method for preparing a universal CAR-T cell with double gene knock-in, the method comprising: Delivering gene-editing materials to T cells to knock out the B2M gene and the TRAC gene; and The repair template vector is delivered to T cells to knock the CAR gene and B2M-HLA-E gene into the TRAC site, where The gene editing substance is delivered using a CRISPR-Cas9 gene editing method, Cas9 is selected from SpCas9, and the sgRNA sequence targeting the TRAC gene is as shown in SEQ ID NO: 55, The antigen target of the CAR gene is CD19, and The repair template DNA is shown in SEQ ID NO:

39.

2. The method according to claim 1, wherein The delivery methods of the gene editing substance include transfection methods using liposomes, calcium phosphate, DEAE-dextran, electroporation, microinjection or gene gun.

3. The method according to claim 1, wherein the gene editing substance is delivered by electroporation transfection.

4. The method according to claim 1, wherein the CRISPR-Cas9 gene editing material comprises Cas9 mRNA or Cas9 protein and sgRNA.

5. The method according to claim 1, wherein the sgRNA sequence targeting the B2M gene is shown in SEQ ID NO:

56.

6. The method according to claim 1, wherein the amino acid sequence of Cas9 is as shown in SEQ ID NO:

57.

7. The method of claim 1, wherein the repair template vector comprises an adeno-associated virus and a non-viral vector.

8. The method according to claim 7, wherein the repair template vector is an adeno-associated virus vector, and the method comprises mixing Cas9 protein encoding mRNA with targeting sgRNA in vitro to form a mixture and transfecting it into T cells; cloning the repair template DNA into a plasmid and packaging it into an adeno-associated virus vector; adding the adeno-associated virus vector within 0 to 12 hours after RNA transfection.

9. The method of claim 8, wherein the adeno-associated virus is an adeno-associated virus type 6 vector.

10. The method according to claim 7, wherein the repair template vector is a non-viral vector, and the method comprises mixing the Cas9 protein with the targeting sgRNA in vitro to form an RNP complex, or mixing the Cas9 protein encoding mRNA with the targeting sgRNA in vitro to form a mixture; performing PCR amplification of the repair template DNA using modified primers to obtain modified double-stranded DNA, wherein the modified primers contain: i) 5'-phosphorothioate modification together with 5'-biotin-triethylene glycol modification; or ii) 5'-locked nucleic acid modification; transfecting the RNP complex or the mixture and the modified double-stranded DNA into T cells.

Images