A PSA detection method based on CRISPR / Cas12a and hybridization chain reaction amplification

Abstract

The present invention relates to a PSA detection method based on CRISPR / Cas12a and hybridization chain reaction amplification. First, through the hybridization chain reaction amplification based on nucleic acid aptamers, the signal of PSA is converted into a DNA signal. The repetitive DNA structure of the hybridization chain reaction product can recognize and activate the reverse cleavage function of the CRISPR / Cas12a system, and cut the single-stranded DNA connecting two gold nanoparticles into fragments containing 2-4 bases, causing the gold nanoparticles to change from an aggregated state to a dispersed state, and the color of the solution shows a change from purple to red. The present invention studied the feasibility of this method through ultraviolet-visible absorption spectroscopy, visible color change and dynamic light scattering (DLS).

Description

Technical Field

[0001] The present invention belongs to the development method of biosensors, and relates to a PSA detection method based on CRISPR / Cas12a and hybridization chain reaction amplification. Background Art

[0002] So far, many methods for detecting PSA have been developed, such as fluorescence spectroscopy (Clin Cancer Res 2019, 25(1), 177), chemiluminescence-based immunoassay (Luminescence 2017, 32(8), 1547), enzyme-linked immunosorbent assay (ELISA) (Biosens Bioelectron 2015, 69, 128), electrochemiluminescence method (Sens. Actuators B Chem. 2020, 315, 128155), surface-enhanced fluorescence immunoenzymatic method (ACS Nano 2017, 11(5), 4926) and surface-enhanced Raman scattering method (Biosens Bioelectron 2018, 119, 126). However, most of these methods are based on immune reactions and have some deficiencies. For example, they require expensive and variable antibodies, professional technicians and specific instrument equipment, which increases the difficulty of PSA detection. In addition, the invention patent of "a method for ultrasensitive detection of prostate-specific antigen PSA" applied by our research group earlier is currently in the public stage, with the publication number CN112301095A, China. This invention patent combines polymerase chain amplification technology (PCR) with dynamic light scattering technology to achieve quantitative and ultrasensitive detection of PSA by monitoring the diameter change of gold nanoparticles (AuNPs). This patent avoids the use of antibodies by introducing nucleic acid aptamers, but still requires professional operation by professional technicians due to the need to use PCR technology. In addition, the differences between this invention patent and the currently applied patent are as follows: (1) PCR technology is a temperature-variable amplification technology that requires specific instrument equipment, while the amplification technology in the currently applied patent is an isothermal amplification technology with mild reaction conditions and can be carried out at room temperature without additional instrument equipment; (2) This invention patent quantifies PSA by the diameter change of gold nanoparticles, while this invention patent quantifies PSA by the change of the absorption spectrum of the gold nanosolution, and the content of PSA can be preliminarily judged by observing the color change with the naked eye. The new invention avoids the use of expensive and variable antibodies, reduces the dependence of the detection process on professional instrument equipment and professional operators, and makes the detection of PSA no longer limited to specific occasions such as laboratories. Summary of the Invention

[0003] Technical Problems to be Solved

[0004] To avoid the deficiencies of the prior art, the present invention proposes a PSA detection method based on CRISPR / Cas12a and hybridization chain reaction amplification. By means of hybridization chain reaction amplification, the detection of PSA protein is transformed into DNA detection. The introduction of the CRISPR / Cas system is used to improve the detection sensitivity of PSA; the introduction of gold nanoparticles enables visual detection of PSA by the naked eye, reducing the dependence of existing detection technologies on instruments.

[0005] Technical solution

[0006] A PSA detection method based on CRISPR / Cas12a and hybridization chain reaction amplification, characterized in that the required DNA sequence list is:

[0007]

[0008] Note: n is a random number from 2 to 10, x is a random number from 6 to 20, and y is a random number from 1 to 50;

[0009] The PSA detection steps are as follows:

[0010] Step 1: Prepare deoxyribonucleic acid (DNA)-modified AuNPs: Dissolve thiol-modified DNA, namely Oligo 7 and Oligo 8, in acetate buffer solution with a pH of 5.0, and then add tris(2-carboxyethyl)phosphine (TCEP) to reduce the thiol groups modified on the DNA to disulfide bonds. Then transfer all the above solutions to 1 - 20.0 mL of AuNPs solution and incubate at room temperature for 1.0 - 26.0 hours;

[0011] Then, within the next 10.0 - 64.0 hours, add sodium chloride solution to the gold nanoparticle solution and make the final concentration of NaCl in the solution 10.0 - 400.0 mM;

[0012] After the modification is completed, centrifuge the solution multiple times, with each centrifugation lasting no less than 15.0 minutes, to remove the DNA that has not been modified onto the surface of the gold nanoparticles, and obtain deoxyribonucleic acid (DNA)-modified AuNPs;

[0013] Step 2. Hybridization chain reaction based on nucleic acid aptamer: Heat the hairpin-structured DNAs, namely Oligo 3, Oligo 4, and Oligo 5, at 80.0 - 105.0 °C for not less than 5.0 minutes, and then naturally cool to room temperature; Incubate the solution to be detected with the aptamer, namely Oligo 2, at 20 - 40 °C for not less than 5 minutes for standby, and the subsequent extension reaction is carried out at 20 - 40 °C; PSA reacts with the aptamer, namely Oligo 2, in a buffer solution containing but not limited to Tris-Cl at 20 - 40 °C for not less than 5.0 minutes, and then add Oligo 1, Oligo 3, Oligo 4, and Oligo 5 in a ratio of 1:10:10:10, and carry out a hybridization chain reaction at 20 - 40 °C for not less than 30 minutes. Centrifuge the reaction product for not less than 1 minute, and take the supernatant;

[0014] Step 3. Activation of the reverse cleavage function of CRISPR / Cas12a: The Cas12a / crRNA reaction solution contains but not limited to components such as NaCl, Tris-HCl, and MgCl 2 and bovine fetal serum albumin; Add Cas 12a and crRNA to the reaction solution in a ratio of 1:1.2, then add Oligo 5, incubate at 20 - 40 °C for not less than 10 minutes, and then add the supernatant obtained in Step 2, and react at 20 - 40 °C for not less than 20 minutes to obtain a reaction solution;

[0015] Step 4. Color reaction and measurement of absorption spectrum: Add the deoxyribonucleic acid DNA-modified AuNPs prepared in Step 1 to the reaction solution in Step 3, and wait for not less than 5 minutes. If PSA exists in the solution to be detected, the color of the solution changes towards red, indicating that PSA exists in the solution to be detected.

[0016] When PSA is detected, measure the absorption spectrum and absorbance of the solution using ultraviolet-visible absorption spectroscopy.

[0017] When the concentration of PSA in the solution is in the range of 0.1 - 4.0 ng / mL, the concentration of PSA and the absorbance have a linear relationship, A = 0.1285 + 0.09281C, where A is the absorbance and C is the concentration of PSA, and the unit of C is ng / mL -1 。

[0018] The centrifugation treatment in Step 1 is carried out with a centrifuge at a speed of not less than 10000.0 rpm, and each centrifugation is not less than 15.0 minutes.

[0019] The centrifugation speed in Step 2 is not less than 1000.0 rpm.

[0020] Preparation of the gold nanoparticles AuNPs: Rapidly add the sodium citrate solution to the boiling chloroauric acid solution and stir. After the solution color changes from light yellow to wine red, reflux and stir, and then cool the solution to room temperature by continuous stirring and store it in a refrigerator at 4.0 °C.

[0021] The sequences used in the present invention were synthesized by Sangon Biotech Co., Ltd.

[0022] Beneficial effects

[0023] A PSA detection method based on CRISPR / Cas12a and hybridization chain amplification reaction proposed by the present invention first converts the PSA signal into a DNA signal through a hybridization chain amplification reaction based on nucleic acid aptamers. The repetitive DNA structure of the hybridization chain reaction product can recognize and activate the reverse cleavage function of the CRISPR / Cas12a system, and cut the single-stranded DNA connecting two kinds of gold nanoparticles into fragments containing 2-4 bases, causing the gold nanoparticles to change from an aggregated state to a dispersed state, and the color of the solution shows a change from purple to red.

[0024] The present invention studied the feasibility of this method by ultraviolet-visible absorption spectroscopy, visible color change and dynamic light scattering (DLS). As Figure 1 shown in A, with the addition of PSA, the absorbance of the solution increased significantly, indicating that the AuNPs changed from an aggregated state to a dispersed state. Figure 1 Before and after adding 20.0 ng mL -1 PSA in B, the solution color changed significantly. In the absence of PSA, the AuNPs in the solution aggregated and settled, making the solution color show light purple. After adding 20.0 ng mL -1 PSA, the AuNPs in the solution did not aggregate, and the solution color was red. The DLS image further confirmed this result. Before adding 20.0 ng mL -1 PSA, the hydrodynamic diameter of AuNPs was large and the particles were in an aggregated state. After adding 20.0 ng mL -1 PSA, the hydrodynamic diameter of AuNPs was small and the particles were in a dispersed state ( Figure 1 C). These results indicate that this method can quantify PSA by measuring the change in the absorption spectrum of AuNPs.

[0025] The linear response to the analyte is the key to the analysis. Therefore, this method measured the change in the absorption spectrum of the spherical nucleic acid solution in the presence of different concentrations of PSA, and used the absorption spectrum value at 522 nm as the judgment basis. As Figure 2 can be seen, with the increase of PSA concentration, the absorption value of the spherical nucleic acid at 522 nm gradually increased. The results showed that in the range of 0.1 ng mL -1 to 4.0 ng mL-1 In the range, the ultraviolet absorption of spherical nucleic acid decreases linearly with the PSA concentration. The linear regression equation is A = 0.1176 + 0.1058C (C: ng mL -1 ), and the detection limit). 24 pg mL -1 (3δ / slope). These results indicate that the biosensor can achieve highly sensitive detection of PSA. Description of the Drawings

[0026] Figure 1 :(A) Results of the absorption spectrum; (B) Color of the solution; (C) Results of dynamic light scattering; (a) Results without adding PSA; (b) Adding 20.0 ng mL -1 Results of PSA.

[0027] Figure 2 : Linear relationship between the absorbance of the solution and the change in PSA concentration, with the PSA concentration ranging from 0.1 ng mL -1 to 4.0 ng mL -1 . Error bars represent the standard deviation of three measurements. Detailed Embodiment

[0028] The present invention will be further described in combination with embodiments and drawings:

[0029] The operating steps of this method are as follows:

[0030] The DNA sequences required for the embodiments of this method are listed in Table 1-1 and synthesized by Sangon Biotech Co., Ltd. as follows:

[0031] 1-1 Sequences used in the present invention

[0032]

[0033]

[0034] Note: n is a random number from 2 to 10, x is a random number from 6 to 20, and y is a random number from 1 to 50.

[0035] The operating steps of this embodiment are as follows:

[0036] Step 1: Preparation of gold nanoparticles (AuNPs) ( Refer to the existing methods ). Rapidly add 2.0 mL of 38.8 mM sodium citrate solution to the boiling 1.0 mM chloroauric acid (HAuCl 4 ) solution and stir. After the solution color changes from light yellow to wine red, reflux and stir for 15.0 minutes, and then cool the solution to room temperature by continuous stirring. Finally, the AuNPs are collected by filtration through a 0.4 μm nylon membrane and stored in a refrigerator at 4.0 °C for later use.

[0037] Next, prepare DNA-modified AuNPs: First, dissolve thiol-modified DNAs (Oligo7 and Oligo 8) in 60.0 μL of acetate buffer solution with a pH of 5.0, and then add 12.0 μL of 20.0 mM tris(2-carboxyethyl)phosphine (TCEP) to reduce the thiols modified on the DNA to disulfide bonds. Then transfer all the above solutions to 1 - 20.0 mL of AuNP solution and incubate at room temperature for 1.0 - 26.0 hours.

[0038] Then, within the next 10.0 - 64.0 hours, add 5.0 M sodium chloride (NaCl) solution to the gold nanoparticle solution and make the final concentration of NaCl in the solution 10.0 - 400.0 mM.

[0039] After the modification is completed, centrifuge the solution three times at a speed of 13800.0 rpm for no less than 15.0 minutes each time to remove the DNA that has not been modified onto the surface of the gold nanoparticles (wash with tris(hydroxymethyl)aminomethane-hydrochloride (Tris-Cl) buffer solution with a pH of 7.4 each time). Finally, dilute the prepared DNA-modified gold nanoparticles (spherical nucleic acids) to the required concentration and store them in a refrigerator at 4.0 °C for use in step 3.

[0040] Step 2: Nucleic acid aptamer-based hybridization chain reaction. Hybridization chain reaction (HCR), as an isothermal and enzyme-free nucleic acid amplification technology, has attracted much attention. It is a cascade hybridization reaction of two hairpin probes induced by an initiator strand, forming a long and nicked double-stranded DNA. HCR can be combined with various probes. AuNPs are one of the most commonly used nanomaterials and are widely used in the construction of sensing platforms due to their large specific surface area, unique optical properties, and good biocompatibility. When PSA is absent, Oligo 1 and Oligo 2 form a DNA / DNA double-stranded structure and cannot initiate strand displacement amplification reaction, so the reaction terminates. When PSA is present, PSA binds to the aptamer Oligo 2 and releases the primer Oligo 1. The released Oligo 1 forms a DNA / DNA double-stranded structure with partial complementarity to the hairpin DNA Oligo 3, thereby opening the hairpin. After the hairpin is opened, the single-stranded part of Oligo 3 forms a double-stranded structure with partial complementarity to the hairpin Oligo 4, opening the hairpin Oligo 4. The single-stranded part of Oligo 4 is complementary to the hairpin Oligo 5, opening the hairpin structure. The single-stranded part of the opened hairpin (Oligo 5) is complementary to the hairpin Oligo 4, continuing to open another Oligo 4 hairpin structure. This process repeats to carry out the hybridization chain reaction and form a repeating double-stranded structure unit of Oligo4 / Oligo 5. The newly generated repeating double-stranded structure unit of Oligo 4 / Oligo 5 can activate the reverse cleavage activity of the CRISPR / Cas12a system in step (3), affecting the color and absorption signal changes of AuNPs in the solution, thereby achieving signal amplification for detection. PSA can be quantified by observing the color change and measuring the absorption signal change.

[0041] Nucleic acid aptamer-based hybridization chain reaction conditions: Heat the hairpin-structured DNA (Oligo 3 / Oligo4 / Oligo 5) at 80.0 - 105.0 °C for no less than 5.0 minutes, and then let it cool naturally to room temperature. Incubate the solution to be detected with the aptamer (Oligo 2) at 20 - 40 °C for no less than 5 minutes for standby. The subsequent extension reaction is carried out at 20 - 40 °C with a total solution volume of 50.0 μL. React 5.0 μL of the detection solution with the aptamer (Oligo2) in a buffer solution containing 10.0 mM Tris-Cl (pH 7.4) at 0 - 40 °C for no less than 5.0 minutes, and then add 5.0 μL of 0.1 μM Oligo 1, 5.0 μL of 1.0 μM Oligo 3, 5.0 μL of 1.0 μM Oligo 4, and 5.0 μL of 1.0 mM Oligo 5, and carry out a hybridization chain reaction at 20 - 40 °C for no less than 30 minutes. Centrifuge the reaction product at 8000.0 rpm for 1 minute in a tabletop centrifuge, and take the supernatant for use in step 3.

[0042] Step 3: Activation of the reverse cleavage function of CRISPR / Cas12a. The Cas12a protein (LbCpf1, FnCpf1, AsCpf1) has both forward (cis) and reverse (trans) single-stranded DNA cleavage activities. When Cas12a forms a ternary complex with a specific crRNA and its target DNA, this complex acquires a strong reverse cleavage activity and cuts the single-stranded DNA into 2 - 4 nucleotide fragments. Utilizing this property of Cas12a, we first convert the signal detection of PSA into DNA signal detection through a hybridization chain reaction, and then the double-stranded repeating unit of the hybridization chain reaction is complementary to the designed crRNA (Oligo 9) and activates the reverse cleavage activity of Cas12a.

[0043] Reaction conditions for activating the reverse cleavage function of CRISPR / Cas12a: The 20 μL Cas12a / crRNA reaction solution with a pH of 7.9 contains 100.0 mM NaCl, 50.0 mM Tris-HCl, 10.0 mM MgCl 2 and 100.0 μg mL -1 bovine fetal serum albumin (BSA). Add 100.0 nM Cas 12a, 120.0 nM crRNA, and 400.0 nM Oligo 5 to the reaction solution, incubate at 20 - 40 °C for no less than 10 minutes, then add 5.0 μL of the supernatant from step 2, and react at 20 - 40 °C for no less than 20 minutes to obtain the reaction solution for use in step 4.

[0044] Step 4: Color reaction and measurement of absorption spectrum. Since Oligo 6 can form double helices with Oligo 7 and Oligo 8 respectively, bringing the AuNPs modified by Oligo 7 and Oligo 8 closer together, changing the AuNPs from a dispersed state to an aggregated state, and the solution color presenting purple. However, the activated Cas12a can cleave Oligo 6 into fragments of 2 - 4 nt, preventing the aggregation of AuNPs and keeping the solution color red.

[0045] Conditions for color reaction and measurement of absorption spectrum: Add 50.0 μL of 0.4 nM spherical nucleic acid prepared in Step 1 to the reaction solution in Step 3 respectively, wait for no less than 5 minutes, observe the color change of the solution with the naked eye. If PSA exists in the solution to be measured, the color change of the solution goes towards red, proving the existence of PSA in the solution to be measured.

[0046] Then measure the absorption spectrum of the solution with a UV - visible absorption spectrometer.

[0047] For the concentration of PSA and absorbance of the solution, when the concentration of PSA is in the range of 0.1 - 4.0 ng / mL, the concentration of PSA and absorbance have a linear relationship: A = 0.1285 + 0.09281C, where A is the absorbance and C is the concentration of PSA, and the unit of C is ng / mL. -1 。

[0048] Example 1: Study the detection ability of this detection method in complex biological matrices through the spike - recovery rate, that is, add a quantitative standard substance to the sample matrix without the substance to be measured, analyze according to the sample treatment steps, and obtain the ratio of the result to the theoretical value. The specific process is as follows: First, add 2% human serum and 0.1 ng / mL -1 standard PSA sample to the buffer solution for hybridization chain amplification reaction. After the hybridization chain amplification reaction, the PSA concentration detected by the method of the present invention is 0.1169 ng / mL -1 , and the recovery rate is 116.9%, and the relative standard deviation (RSD) is 0.3%.

[0049] Example 2: Study the detection ability of this detection method in complex biological matrices through the spike - recovery rate, that is, add a quantitative standard substance to the sample matrix without the substance to be measured, analyze according to the sample treatment steps, and obtain the ratio of the result to the theoretical value. The specific process is as follows: First, add 2% human serum and 0.5 ng / mL -1 standard PSA sample to the buffer solution for hybridization chain amplification reaction. After the hybridization chain amplification reaction, the PSA concentration detected by the method of the present invention is 0.5001 ng / mL -1 , and the recovery rate is 100.1%, and the relative standard deviation (RSD) is 1.2%.

[0050] Example 3: The detection ability of this detection method in complex biological matrices was studied by the spike recovery rate, that is, a quantitative standard substance was added to the sample matrix without the analyte, and analyzed according to the sample treatment steps, and the ratio of the obtained result to the theoretical value. The specific process is as follows: First, 2% human serum and 1.0 ng / mL -1 of the standard PSA sample were added to the buffer solution of the hybridization chain reaction. After the hybridization chain reaction, the PSA concentration detected by the method of the present invention was 0.915 ng / mL -1 , and the recovery rate was 91.5%, and the relative standard deviation (RSD) was 1.4%. Sequence Listing <120> PSA Detection Method Based on CRISPR / Cas12a and Hybridization Chain Reaction <141> 2022-06-16 <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 14 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 1 tcatcccagc aacc 14 <210> 2 <211> 40 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 2 gagcggggtt gctgggatga taaggcccct ttgatgtctg 40 <210> 3 <211> 44 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 3 ggttgctggg atgatcaacc acgtagagca tcaccatgat cctg 44 <210> 4 <211> 48 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 4 ttaacccacg ccgaatccta gactcaaagt agtctaggat tcggcgtg 48 <210> 5 <211> 48 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 5 agtctaggat tcggcgtggg ttaacacgcc gaatcctaga ctactttg 48 <210> 6 <211> 20 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 6 tcctaaacac cacaacgaac 20 <210> 7 <211> 17 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 7 (sh)n-(ch2)x-(t)ygttcgttgtg 27 <210> 8 <211> 16 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 8 (sh)n -(ch2)x-(t)ytgtttagga 26 <210> 9 <211> 30 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 9 uaauuucuacuaaguguagauggcguguuaacccacgccgaau 43

Claims

1. A method for detecting prostate-specific antigen (PSA) for non-diagnostic purposes based on CRISPR / Cas12a and hybridization chain reaction amplification, characterized in that: The required DNA sequence list is: Note: n is a random number from 2 to 10, x is a random number from 6 to 20, and y is a random number from 1 to 50; The PSA detection steps are as follows: Step 1, Preparation of deoxyribonucleic acid (DNA)-modified AuNPs: Dissolve thiol-modified DNA, namely Oligo 7 and Oligo 8, in acetate buffer solution with a pH of 5.0, then add tris(2-carboxyethyl)phosphine (TCEP) to reduce the thiol groups modified on the DNA to disulfide bonds, and then transfer all the above solutions to 1 - 20.0 mL of AuNPs solution and incubate at room temperature for 1.0 - 26.0 hours; Then, within the next 10.0 - 64.0 hours, add sodium chloride solution to the gold nanoparticle solution and make the final concentration of NaCl in the solution 10.0 - 400.0 mM; After the modification is completed, centrifuge the solution multiple times, with each centrifugation lasting no less than 15.0 minutes, to remove the DNA that has not been modified onto the surface of the gold nanoparticles, and obtain deoxyribonucleic acid (DNA)-modified AuNPs; Step 2, Hybridization chain reaction based on nucleic acid aptamer: Heat the hairpin-structured DNA, namely Oligo 3, Oligo 4, and Oligo 5, at 80.0 - 105.0 °C for no less than 5.0 minutes, and then naturally cool to room temperature; Incubate the solution to be detected with the aptamer, namely Oligo 2, at 20 - 40 °C for no less than 5 minutes for standby, and the subsequent extension reaction is carried out at 20 - 40 °C; PSA reacts with the aptamer, namely Oligo 2, in a buffer solution containing Tris-Cl at 20 - 40 °C for no less than 5.0 minutes, and then add Oligo 1, Oligo 3, Oligo 4, and Oligo 5 in a ratio of 1:10:10:10 and carry out a hybridization chain reaction at 20 - 40 °C for no less than 30 minutes. After the reaction, centrifuge for no less than 1 minute and take the supernatant; Step 3: Activation of the reverse digestion function of CRISPR / Cas12a: The Cas12a / crRNA reaction solution contains components such as NaCl, Tris-HCl, and bovine fetal serum albumin; Cas12a and crRNA are added to the reaction solution in a ratio of 1:1.2, and then Oligo 5 is added. Incubate at 20-40 °C for no less than 10 minutes, and then add the supernatant obtained in Step 2. React at 20-40 °C for no less than 20 minutes to obtain a reaction solution; 2 The reaction solution contains components such as NaCl, Tris-HCl, and bovine fetal serum albumin; Cas12a and crRNA are added to the reaction solution in a ratio of 1:1.2, and then Oligo 5 is added. Incubate at 20-40 °C for no less than 10 minutes, and then add the supernatant obtained in Step 2. React at 20-40 °C for no less than 20 minutes to obtain a reaction solution; Step 4, Color reaction and measurement of absorption spectrum: Add the deoxyribonucleic acid (DNA)-modified AuNPs prepared in Step 1 to the reaction solution in Step 3 and wait for no less than 5 minutes. If PSA exists in the solution to be detected, the color of the solution changes towards red, indicating the presence of PSA in the solution to be detected.

2. The method for detecting prostate-specific antigen (PSA) for non-diagnostic purposes based on CRISPR / Cas12a and hybridization chain reaction amplification according to claim 1, characterized in that: When PSA is detected, the absorption spectrum and absorbance of the solution are measured using ultraviolet-visible absorption spectroscopy.

3. The method for detecting prostate-specific antigen (PSA) for non-diagnostic purposes based on CRISPR / Cas12a and hybridization chain reaction amplification according to claim 2, characterized in that: When the concentration of PSA in the solution ranges from 0.1 to 4.0 ng / mL, the concentration of PSA and the absorbance have a linear relationship: A = 0.1285 + 0.09281 C, where A is the absorbance and C is the PSA concentration, with the unit of C being ng / mL. -1 .

4. The prostate-specific antigen PSA detection method for non-diagnostic purposes based on CRISPR / Cas12a and hybridization chain reaction according to claim 1, characterized in that: the centrifugation treatment in step 1 is carried out with a centrifuge at a speed of not less than 10000.0 rpm for not less than 15.0 minutes each time.

5. The prostate-specific antigen PSA detection method for non-diagnostic purposes based on CRISPR / Cas12a and hybridization chain reaction according to claim 1, characterized in that: the centrifugation speed in step 2 is not less than 1000.0 rpm.

6. The prostate-specific antigen PSA detection method for non-diagnostic purposes based on CRISPR / Cas12a and hybridization chain reaction according to claim 1, characterized in that: the preparation of the gold nanoparticles AuNPs: quickly add the sodium citrate solution to the boiling chloroauric acid solution and stir. After the color of the solution changes from light yellow to wine red, reflux and stir, and cool the solution to room temperature by continuous stirring and store it in a refrigerator at 4.0 °C.

Images