Methods for detecting specific DNA in a test sample
By combining the CRISPR-Cas3 system with single-stranded probe DNA, the problem of the unclear molecular mechanism of DNA cleavage in the CRISPR-Cas3 system has been solved, achieving highly specific and sensitive target DNA detection, which is suitable for virus detection and gene mutation analysis.
Patent Information
- Application Number
- CN202180009880.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-05-18
- Filing Date
- 2021-01-25
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2041-01-25
AI Technical Summary
In existing technologies, the DNA cleavage molecular mechanism of the CRISPR-Cas3 system is unclear, making it difficult to effectively detect target DNA, especially lacking high specificity and sensitivity in trace amounts.
After recognizing and binding to target DNA using the CRISPR-Cas3 system, single-stranded probe DNA is added. The target DNA is detected by the cleavage reaction of the single-stranded probe DNA by the CRISPR-Cas3 system. Combined with gene amplification technologies such as RPA and LAMP, high-sensitivity detection can be achieved.
It achieves highly specific, single-base-level detection of target DNA, and can accurately identify trace amounts of target DNA even at extremely low copy numbers (1 to 10 copies), making it suitable for virus detection, liquid biopsy, and metagenomic analysis.
Smart Images

Figure CN115003825B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a method for detecting specific DNA in a sample using a CRISPR-Cas3 system and a single-stranded probe DNA. BACKGROUND
[0002] Genome editing technology is a technology that freely rewrites an arbitrary sequence by cutting a genomic DNA sequence specifically in cells of animals and plants and by utilizing an intrinsic repair mechanism. It is not only used in biological science research but also applied to improvement of varieties of crops and livestock, regenerative medicine, genome editing therapy, and the like in the world.
[0003] The CRISPR-Cas system possessed by bacteria and archaea is classified into Class 1 in which a target sequence is cut by a complex of various proteins and Class 2 in which a target sequence is cut by a single protein. The CRISPR-Cas9 system, the CRISPR-Cas12 (Cpf1) system, the CRISPR-Cas13 system, and the like developed so far as genome editing tools are all classified into Class 2.
[0004] Under such circumstances, the present inventors found that the CRISPR-Cas3 system, which is a Type I CRISPR-Cas system belonging to Class 1, can be utilized as a genome editing tool for eukaryotic cells (Patent Literature 1).
[0005] However, the detailed molecular mechanism of how the CRISPR-Cas3 system cuts DNA and introduces a mutation is not known.
[0006] PRIOR ART DOCUMENTS
[0007] PATENT LITERATURE
[0008] Patent Literature 1: International Publication No. 2018 / 225858 SUMMARY OF THE INVENTION
[0009] PROBLEMS TO BE SOLVED BY THE INVENTION
[0010] An object of the present application is to elucidate the molecular mechanism of DNA cleavage using the CRISPR-Cas3 system and to provide a method for detecting target DNA using the molecular mechanism. A further object of the present application is to provide a kit for the detection method.
[0011] MEANS FOR SOLVING THE PROBLEMS
[0012] The present inventors have conducted intensive studies in order to solve the above-described problem, and as a result, have found that if a CRISPR-Cas3 system recognizes and binds to a target DNA in a sample, single-stranded DNA (ssDNA) present in the vicinity is cut without distinction. Furthermore, the present inventors have found that, based on this knowledge, by mixing a single-stranded probe DNA whose cutting is detectable in advance in a reaction system containing a sample in which a target DNA to be detected and a CRISPR-Cas3 system, it is possible to detect the target DNA in the sample using the signal generated by the cutting of the single-stranded probe DNA as an index, and thus the present invention has been completed.
[0013] That is, the present invention relates to a method for detecting a target DNA using the indiscriminate cutting of single-stranded DNA caused by a CRISPR-Cas3 system, and a kit for the method, and more specifically provides the following (1) and (2).
[0014] (1) A method for detecting a specific DNA in a sample,
[0015] The method includes:
[0016] (a) a step of bringing the sample into contact with a CRISPR-Cas3 system that targets the specific DNA and a single-stranded probe DNA, and
[0017] (b) a step of detecting the cutting of the single-stranded probe DNA by the CRISPR-Cas3 system that occurs in the case where the specific DNA is present in the sample.
[0018] (2) A kit for detecting a specific DNA in a sample by the method described in (1),
[0019] The kit includes:
[0020] (a) a CRISPR-Cas3 system that targets the specific DNA, and
[0021] (b) a single-stranded probe DNA.
[0022] Effects of the Invention
[0023] According to the present invention, by using a CRISPR-Cas3 system and a single-stranded probe DNA, it is possible to detect a target DNA in a sample. The method of the present invention can detect a target DNA in a sample using the signal generated by the cutting of a single-stranded probe DNA as an index, and is simple (see Figure 10). The CRISPR-Cas3 system cleaves the single-stranded probe DNA only when the target DNA is correctly recognized and combined, but the specificity in the detection of the target DNA is single base level, which is extremely high. In addition, in the method of the present application, even if the target DNA present in the test sample is in a trace amount, it can be detected. For example, by combining with a gene amplification method such as RPA (recombinase polymerase amplification) method, LAMP (loop-mediated isothermal Amplification) method, etc., even in the case where only 1 copy to 10 copies of the target DNA are present in the test sample, it can be detected, and the sensitivity is high.
[0024] The method of the present application can be used as a tool for next-generation diagnosis, for example, for the identification of viruses in a short time with various body fluids (urine, saliva, serum, plasma, whole blood, etc.) as test samples, application to liquid biopsy for detecting trace amounts of DNA and mutations thereof in blood, or detection for distinguishing the type of pathogen DNA contained in metagenome, etc.
[0025] As a similar method, it is reported that DETECTR using CRISPR-Cas12a, CRISPR-Cas14a belonging to class 22, Cas14-DETECTR (Chen et al., Science. 2018 Apr 27; 360(6387): 436-439, Harrington et al., Science. 2018 Nov 16; 362(6416): 839-842). The target sequence in these systems is 21 bases, 20 bases, respectively, and in contrast, the target sequence of the CRISPR-Cas3 system, which is a type I CRISPR-Cas system belonging to class 1, is as long as 27 bases. Therefore, compared to the existing system, it is possible to detect the target DNA with higher specificity. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 is a graph showing that the CRISPR-Cas3 system non-specifically cleaves single-stranded DNA in the presence of hEMX1 target sequence. The upper part of the graph shows the composition of the test sample, and the lower part of the graph shows the result of capillary electrophoresis. Non-specific single-stranded DNA cleavage activity (arrow) was observed only for test samples 4, 5 in which a DNA fragment containing an appropriate PAM sequence and a target sequence was present.
[0027] Figure 2is a graph showing that the CRISPR-Cas3 system non-specifically cleaves double-stranded DNA even in the presence of the hEMXl target sequence. The upper part of the graph shows the composition of the samples, and the lower part of the graph shows the results of capillary electrophoresis. Non-specific double-stranded DNA cleavage activity (arrow) was not observed even for samples 4, 5 in which a DNA fragment containing an appropriate PAM sequence and a target sequence was present.
[0028] Figure 3 is a graph showing the results of detection of non-specific cleavage of single-stranded DNA by the CRISPR-Cas3 system in the presence of the hEMXl target sequence using a single-stranded DNA probe that emits fluorescence by cleavage (DNase Alert TM ). The upper part of the graph shows the composition of the samples, and the lower part of the graph shows the results of detection of fluorescence. Non-specific nuclease activity (fluorescence) over time was detected only for samples 4, 5 in which a DNA fragment containing an appropriate PAM sequence and a target sequence was present.
[0029] Figure 4 is a graph showing the results of detection of non-specific cleavage of single-stranded DNA by the CRISPR-Cas3 system in the presence of the mTyr target sequence using a single-stranded DNA probe that emits fluorescence by cleavage (DNase Alert TM ). The upper part of the graph shows the composition of the samples, and the lower part of the graph shows the results of detection of fluorescence. Non-specific nuclease activity (fluorescence) over time was detected only for samples 4, 5 in which a DNA fragment containing a PAM sequence and a target sequence was present.
[0030] Figure 5A is a graph showing the results of detection of non-specific cleavage of single-stranded DNA by the CRISPR-Cas3 system in the presence of the hEMXl target sequence using a single-stranded DNA probe that emits fluorescence by cleavage (Taqman TM ). The upper part of the graph shows the composition of the samples, and the lower part of the graph shows the results of detection of fluorescence. Non-specific single-stranded DNA cleavage activity (fluorescence) over time was detected only for samples 2, 3 in which a DNA fragment containing an appropriate PAM sequence and a target sequence was present.
[0031] Figure 5B is a graph in which the degree of increase in fluorescence intensity in Figure 5A is expressed as the intensity of activity.
[0032] Figure 6 is a graph showing the results of detection of non-specific cleavage of single-stranded DNA by the CRISPR-Cas3 system in the presence of the hEMXl target sequence using a probe that emits fluorescence by cleavage (Taqman TMThis graph shows the results of the CRISPR-Cas3 system nonspecifically cleaving single-stranded DNA in the presence of hEMX1 or mTyr target sequences (probes). In this experiment, single-stranded DNA was used as the target sequence. The upper part of the graph shows the sample composition, and the lower part represents the increase in fluorescence intensity as the activity intensity. Even when the target sequence recognized by CRISPR-Cas3 is a single-stranded DNA fragment, nonspecific single-stranded DNA cleavage can be induced, similar to the case of double-stranded DNA fragments. N=3.
[0033] Figure 7 This graph shows the results of evaluating the same experiment as Figure 5 using various PAM sequences (64 types). The upper part of the graph shows the results of the activity intensity determination, and the lower part is a visualization of the directionality of the PAM sequences using sequence logos. N=3.
[0034] Figure 8 This figure shows the results obtained from evaluating the detection limit concentration of CRISPR-Cas3. The DNA fragment containing the target sequence (hEMX1 shown in the upper part of the figure, mTyr shown in the lower part) was infinitesimally diluted and subjected to the same experiment as in Figure 5. 1×10 10 The signal was meaningfully detected given the presence of the copy above. N=3.
[0035] Figure 9 This graph shows the results of detecting a 1-copy DNA fragment using the same experiment as in Figure 5. DNA amplification via RPA was used to detect the 1-copy DNA fragment in the sample. N = 3.
[0036] Figure 10 This is a diagram illustrating the detection method of the present invention, which utilizes the non-specific single-stranded DNA cleavage activity caused by the CRISPR-Cas3 system.
[0037] Figure 11 This demonstrates the use of a mixed genomic solution containing target DNA fragments and mouse genomic DNA for comparison with... Figure 9 A graph showing the results of the same experiment.
[0038] Figure 12 This demonstrates the use of the novel coronavirus genome amplified via RT-LAMP for comparison with... Figure 9 A graph showing the results of the same experiment.
[0039] Figure 13A This is a diagram illustrating the detection principle of the lateral flow assay used in the detection of the novel coronavirus.
[0040] Figure 13BIt shows that the novel coronavirus is used Figure 13A The figure shows the results obtained by lateral flow assay.
[0041] Figure 14 This is a sample showing viral RNA obtained through serial dilution, compared to... Figure 13B The same figure shows the results obtained from the lateral flow assay.
[0042] Figure 15 This is a flowchart illustrating the method of the present invention (CONAN method) for detecting RNA viruses via lateral flow assay.
[0043] Figure 16 This indicates that Taqman is being used. TM The image shows the results of probe detection of the baloxavir (Xofluza) resistance mutation site in influenza A viruses (H1N1, H3N2). The mutation site was detected as a wild-type gene.
[0044] Figure 17 This indicates that Taqman is being used. TM The image shows the results of probe detection of Tamiflu-resistant mutation sites in influenza A viruses (H1N1, H3N2). The detected mutation sites are mutant genes. Detailed Implementation
[0045] <Methods for detecting specific DNA in samples>
[0046] This invention provides a method for detecting specific DNA in a sample using a CRISPR-Cas3 system and single-stranded probe DNA.
[0047] The detection method of the present invention includes: (a) a step of contacting the sample with a CRISPR-Cas3 system and a single-stranded probe DNA targeting the specific DNA, and (b) a step of detecting the cleavage of the single-stranded probe DNA caused by the CRISPR-Cas3 system in the presence of the specific DNA in the sample.
[0048] -Target DNA-
[0049] In the detection method of this invention, the specific DNA to be detected (hereinafter referred to as "target DNA") is not particularly limited as long as it can be a target of the CRISPR-Cas3 system. The target DNA can be either double-stranded DNA or single-stranded DNA (see [reference]). Figure 6 ).
[0050] The source of the target DNA is not particularly limited, and can be either DNA derived from nature or artificial DNA. As the DNA derived from nature, for example, DNA derived from viruses (e.g., animal viruses, plant viruses, bacterial viruses), DNA derived from prokaryotes (e.g., bacteria, actinomycetes, prokaryotic algae, archaea), and DNA derived from eukaryotes (e.g., animals, plants, eukaryotic algae, fungi, protozoa) can be mentioned.
[0051] An example of one preferred aspect of the detection method of the present application is the diagnosis of viral infection. The virus from which the target DNA to be detected is derived is not particularly limited, and can be either a DNA virus or an RNA virus. In the case of an RNA virus, the target DNA can be prepared by performing reverse transcription. As specific viruses, for example, retroviruses, picornaviruses, calciviruses, togaviruses, influenza viruses (flaviviruses), coronaviruses (e.g., the novel coronavirus "SARS-CoV2"), rhabdoviruses, filoviruses, paramyxoviruses, orthomyxoviruses, bunyaviruses (bungaviruses), arenaviruses, orthoreoviruses, birnaviruses, hepadnaviruses, parvoviruses, papovaviruses, adenoviruses, herpesviruses, poxviruses, iridoviruses, geminiviruses, algal DNA viruses, and the like can be mentioned, but are not limited thereto.
[0052] An example of another preferred aspect of the detection method of the present application is the diagnosis of pathogenic bacterial infection or protozoan infection. As the pathogenic bacteria or protozoa from which the target DNA to be detected is derived, for example, Shigella, Salmonella, pathogenic Escherichia coli, Vibrio cholerae, Vibrio spp., Campylobacter, Clostridium perfringens, Bacillus cereus, Yersinia, Staphylococcus aureus, Entamoeba histolytica, Leishmania, Plasmodium, Trypanosoma, Toxoplasma, Giardia, Balantidium, Coccidium, and the like can be mentioned, but are not limited thereto.
[0053] Examples of other preferred aspects of the detection method of the present application are diagnosis of mutations, polymorphisms of genes. For example, mutations of viral genes can be utilized as an index of drug resistance and the like of the virus. For example, it is known that I38T mutation (ATA→AGA) of the RNA polymerase gene (hereinafter referred to as "PA gene") of influenza A virus H1N1 and I38T mutation (ATA→ACA) of the PA gene of influenza A virus H3N2 are associated with resistance to baloxavir (Xofluza), I222R mutation (ATA→AGA), H274Y mutation (CAC→TAC), N294S mutation (AAC→AGC) of the neuraminidase gene (hereinafter referred to as "NA gene") of influenza A virus H1N1, and E119V mutation (GAA→GTA), R292K mutation (AGA→AAA), N294S mutation (AAC→AGC) of the NA gene of influenza A virus H3N2 are associated with resistance to Tamiflu, Relenza (Pizzorno et al., Front. Immunol., 2019 March 19, doi. 10.3389 / fimmu.2019.00531). Therefore, by detecting mutations of these viral genes with the method of the present application, resistance to viral therapeutic drugs can be evaluated.
[0054] In addition, mutations, polymorphisms (for example, single nucleotide polymorphisms) of genes of humans and the like can be utilized as an index of, for example, the risk of onset of a disease, the effectiveness and / or side effects of a drug, and the like.
[0055] In the present application, in the case where 10 10 copies of the target DNA are present in the sample, detection can be suitably performed (see Figure 8 ), but by performing amplification of the DNA in the sample, even in the case where the original sample contains only 1 copy to 10 copies of the target DNA, detection can be performed (see Figure 9 、 11 、12).
[0056] Amplification of the DNA in the sample can be performed before or during contact with the CRISPR-Cas3 system. In addition, the amplification of the DNA can be amplification specific to the target DNA (or a specific region thereof) or amplification biased toward the target DNA (or a specific region thereof).
[0057] Methods for amplifying DNA are known to those skilled in the art, and various methods can be used. For example, various PCR (polymerase chain reaction) methods (PCR method, RT-PCR method, quantitative PCR method, etc.), RPA (recombinase polymerase amplification) method, various LAMP (loop-mediated isothermal Amplification) methods (LAMP method, RT-RAMP method, quantitative LAMP method, etc.), HDA (helicase-dependent Amplification) method, SDA (strand displacement amplification) method, NASBA (nucleic acid sequence-based amplification) method, TMA (transcription mediated amplification) method, NEAR (nicking enzyme amplification reaction) method, MDA (multiple displacement amplification) method, RAM (Ramification) method, and the like, but are not limited to these.
[0058] - Test sample -
[0059] As the test sample in the detection method of the present application, a desired test sample (hereinafter referred to as "test sample") in which the presence of a target DNA is to be detected can be used. As the test sample, for example, a test sample containing a body fluid (urine, saliva, serum, plasma, whole blood, etc.), a biological tissue, a cell, a cell lysate, DNA purified or synthesized can be exemplified.
[0060] In the case of diagnosing infection of a virus, pathogenic bacteria, or protozoa, the test sample can be derived from, for example, a human patient, an animal, a plant, etc. suspected of these infections.
[0061] As an animal from which a test sample is derived, there can be mentioned, for example, mammals, fish, birds, reptiles, amphibians, insects. Mammals are a concept including humans and non-human mammals. As examples of non-human mammals, there can be mentioned bovine, wild boar, domestic pig, sheep, goat, and the like ungulates, equine, and the like perissodactyls, mouse, rat, guinea pig, hamster, squirrel, and the like rodents, rabbit, and the like lagomorphs, dog, cat, weasel, and the like carnivores, and the like. The above non-human mammals can be domestic animals or companion animals (pets), or can be wild animals. Animal cells include, for example, cells constituting an individual of an animal, cells constituting an organ or tissue excised from an animal, cultured cells derived from a tissue of an animal, and the like. Specifically, there can be mentioned, for example, germ cells such as oocytes and sperm; embryonic cells of embryos at various stages (for example, 1-cell stage embryos, 2-cell stage embryos, 4-cell stage embryos, 8-cell stage embryos, 16-cell stage embryos, morula stage embryos, and the like); stem cells such as induced pluripotent stem (iPS) cells and embryonic stem (ES) cells; somatic cells such as fibroblasts, hematopoietic cells, neurons, muscle cells, bone cells, liver cells, pancreatic cells, brain cells, kidney cells, and the like.
[0062] As a plant from which a test sample is derived, there can be mentioned, for example, cereals, oil crops, forage crops, fruits, vegetables, specifically, for example, rice, corn, banana, peanut, sunflower, tomato, Arabidopsis thaliana, tobacco, wheat, barley, potato, soybean, cotton, carnation, and the like. Plant cells include, for example, cells constituting an individual of a plant, cells constituting an organ or tissue isolated from a plant, cultured cells derived from a tissue of a plant, and the like. As an organ or tissue of a plant, there can be mentioned, for example, leaves, stems, shoot tips (growth points), roots, tubers, callus, propagation materials (for example, seeds, tuberous roots, tubers, and the like).
[0063] -CRISPR-Cas3 system-
[0064] The CRISPR-Cas system of Class 1 is classified into Type I and Type III, and further, Type I is classified into 6 types of Type I-A, Type I-B, Type I-C, Type I-D, Type I-E, and Type I-F, and Type I-G which is a subtype of Type I-B, according to the kind of proteins constituting a Cascade (hereinafter, simply referred to as "Cascade" or "Cascade protein") (for example, refer to [van der Oost J et al., Nature Reviews Microbiology m, 2014 12(7): 479-492], [Jackson RN et al., Current Opinion in Structural Biology, 2014 24: 106-114]).
[0065] The type I CRISPR-Cas system cleaves DNA through Cas3 (a protein with nuclease and helicase activity), a cascade reaction, and crRNA in coordination. Because Cas3 is used as the nuclease, it is referred to as the "CRISPR-Cas3 system" in this invention.
[0066] By using the CRISPR-Cas3 system of the present invention, the following advantages can be obtained, for example.
[0067] First, the crRNA used in the CRISPR-Cas3 system generally recognizes target sequences of 32–37 bases (Ming Li et al., Nucleic Acids Res. 2017 May 5; 45(8):4642-4654). In contrast, the crRNA used in the CRISPR-Cas9 system generally recognizes target sequences of 18–24 bases. Therefore, it is believed that the CRISPR-Cas3 system can recognize target sequences more accurately than the CRISPR-Cas9 system.
[0068] Furthermore, the PAM sequence of the CRISPR-Cas9 system, a type II system of class 2, is "NGG" (where N is any base) adjacent to the 3' side of the target sequence. Similarly, the PAM sequence of the CRISPR-Cpf1 system, a type V system of class 2, is "AA" adjacent to the 5' side of the target sequence. In contrast, the PAM sequence of the CRISPR-Cas3 system of the present invention is "AAG" or a similar base sequence (e.g., "AGG", "GAG", "TAC", "ATG", "TAG", etc.) adjacent to the 5' side of the target sequence. Therefore, it is believed that if the CRISPR-Cas3 system of the present invention is used, DNA regions that cannot be recognized by existing methods can be targeted.
[0069] The CRISPR-Cas3 system of this invention comprises all six subtypes of type I. That is, the proteins constituting the CRISPR-Cas3 system may sometimes differ in composition, etc., depending on the subtype (e.g., the proteins constituting the cascade reaction may differ), and this invention includes all of these proteins. Furthermore, the species of bacteria from which the CRISPR-Cas3 system of this invention originates can be arbitrary.
[0070] In type I CRISPR-Cas3 systems, typical type IE CRISPR-Cas3 systems cleave DNA through the synergy of crRNA with Cas3 and a cascade of reactions (Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7).
[0071] In the IA type system, the cascade reaction is composed of Cas8a1, Csa5 (Cas11), Cas5, Cas6, and Cas7. In the IB type, the cascade reaction is composed of Cas8b1, Cas5, Cas6, and Cas7. In the IC type, the cascade reaction is composed of Cas8c, Cas5, and Cas7. In the ID type, the cascade reaction is composed of Cas10d, Csc1 (Cas5), Cas6, and Csc2 (Cas7). In the IF type, the cascade reaction is composed of Csy1 (Cas8f), Csy2 (Cas5), Cas6, and Csy3 (Cas7). In the IG type system, the cascade reaction is composed of Cst1 (Cas8a1), Cas5, Cas6, and Cst2 (Cas7). In this invention, Cas3 and the cascade reaction are collectively referred to as the "Cas protein group".
[0072] The following explanation uses the IE-type CRISPR-Cas3 system as a representative example. However, for other types of CRISPR-Cas3 systems, it is appropriate to replace the reading with the cascade reaction that constitutes the system.
[0073] -Cas protein groups, polynucleotides encoding these protein groups, and vectors expressing these polynucleotides-
[0074] In the detection method of the present invention, the Cas protein group can be utilized in the form of a protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide.
[0075] A preferred embodiment of the proteins constituting the Cas protein group used in this invention is the following wild-type Escherichia coli proteins.
[0076] Cas3: A protein consisting of the amino acid sequence described in Serial Number 1 (or a protein encoded by the base sequence described in Serial Number 7).
[0077] Cse1 (Cas8): A protein consisting of the amino acid sequence recorded in Serial Number 2 (a protein encoded by the base sequence recorded in Serial Number 8).
[0078] Cse2 (Cas11): A protein consisting of the amino acid sequence recorded in Serial Number 3 (encoded by the base sequence recorded in Serial Number 9).
[0079] Cas5: A protein consisting of the amino acid sequence described in Serial Number 4 (or a protein encoded by the base sequence described in Serial Number 10).
[0080] Cas6: A protein consisting of the amino acid sequence described in Serial Number 5 (or a protein encoded by the base sequence described in Serial Number 11).
[0081] Cas7: A protein consisting of the amino acid sequence recorded in Serial Number 6 (or a protein encoded by the base sequence recorded in Serial Number 12).
[0082] Another preferred embodiment of the proteins constituting the Cas protein group used in this invention is a protein composed of an amino acid sequence in which one or more amino acids have been substituted, deleted, added, and / or inserted. Here, "more" typically refers to 50 or fewer amino acids, preferably 30 or fewer, more preferably 20 or fewer, and particularly preferably 10 or fewer amino acids (e.g., 5 or fewer, 3 or fewer, 2 or fewer, 1 amino acid).
[0083] Another preferred embodiment of the proteins constituting the Cas protein group used in this invention is a protein composed of an amino acid sequence that has high identity with the amino acid sequence of the aforementioned proteins. High identity is, for example, 80% or more, preferably 85% or more, more preferably 90% or more (e.g., 91%, 92%, 93%, 94%), and even more preferably 95% or more (e.g., 96%, 97%, 98%, 99%). Sequence identity can be determined using tools such as BLAST (Basic Local Alignment Search Tool at the National Center for Biological Information) (using, for example, default, i.e., initially set parameters).
[0084] Another preferred embodiment of the proteins constituting the Cas protein group used in this invention is a protein encoded by a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of a polynucleotide consisting of a complementary base sequence of the base sequences of the aforementioned proteins.
[0085] "Strict conditions" refer to conditions under which two polynucleotide chains form a base sequence-specific double-stranded polynucleotide, but not a non-specific double-stranded polynucleotide. "Hybridization under strict conditions" can also be described as conditions within which hybridization can occur between nucleic acids with high sequence identity (e.g., perfectly paired hybrids) at a temperature range from the melting temperature (Tm value) to 15°C below the melting temperature, preferably 10°C below the melting temperature, and more preferably 5°C below the melting temperature.
[0086] If a stringent condition is indicated, the procedure is as follows: First, the two polynucleotides are hybridized for 16–24 hours at 60–68°C (preferably 65°C, more preferably 68°C) in a buffer solution (pH 7.2) consisting of 0.25 M Na₂HPO₄, 7% SDS, 1 mM EDTA, and 1× Denhardt's solution. Then, the two polynucleotides are washed twice for 15 minutes each in a buffer solution (pH 7.2) consisting of 20 mM Na₂HPO₄, 1% SDS, and 1 mM EDTA at 60–68°C (preferably 65°C, more preferably 68°C).
[0087] As another example, the following method can be cited. First, in a hybridization solution containing 25% formamide (50% formamide under more stringent conditions), 4×SSC (sodium chloride / sodium citrate), 50mM Hepes (4-hydroxyethylpiperazine ethanesulfonic acid, pH 7.0), 10×Denhardt's solution, and 20μg / mL denatured salmon sperm DNA, after pre-hybridization at 42°C overnight, a labeled probe is added, and the mixture is incubated at 42°C overnight to hybridize the two polynucleotides.
[0088] Next, wash under any of the following conditions: Normal conditions: Wash at approximately 37°C using a washing solution of 1×SSC and 0.1% SDS. Strict conditions: Wash at approximately 42°C using a washing solution of 5×SSC and 0.1% SDS. Even more stringent conditions: Wash at approximately 65°C using a washing solution of 0.2×SSC and 0.1% SDS.
[0089] Thus, the more stringent the washing conditions for hybridization, the more specific the hybridization. Furthermore, the combination of SSC, SDS, and temperature conditions described above is merely illustrative. The same stringency as described above can be achieved by appropriately combining the above-mentioned elements, or other elements (e.g., probe concentration, probe length, hybridization reaction time, etc.), which determine the stringency of hybridization. This is described, for example, in [Joseph Sambrook & David W. Russell, Molecular cloning: a laboratory manual 3rd Ed., New York: Cold Spring Harbor Laboratory Press, 2001].
[0090] When the proteins mentioned above form complexes with other molecules that constitute the CRISPR-Cas3 system to recognize target DNA, they impart non-specific cleavage activity to the complexes (see examples).
[0091] Each protein constituting the Cas protein group can be further supplemented with functional molecules as needed. Examples of functional molecules include, but are not limited to, nuclear localization signals that facilitate transport from eukaryotic cells into the nucleus, tags that facilitate purification, and reporter proteins that facilitate detection. These functional molecules can be added, for example, to the N-terminal and / or C-terminal sides of each protein constituting the Cas protein group.
[0092] Examples of nuclear localization signals include PKKKRKV (serial number 13) and KRTADGSEFESPKKKRKVE (serial number 14). Examples of tags include polyhistidine tags, FLAG tags, and glutathione S-transferase (GST). Additionally, examples of reporter proteins include fluorescent proteins such as green fluorescent protein (GFP) and chemiluminescent proteins such as luciferase.
[0093] In this invention, polynucleotides encoding the Cas protein group can be used, and one preferred embodiment is as follows.
[0094] Cas3: A polynucleotide consisting of the base sequence described in sequence number 7.
[0095] Cse1 (Cas8): A polynucleotide consisting of the base sequence recorded in sequence number 8.
[0096] Cse2 (Cas11): A polynucleotide consisting of the base sequence recorded in sequence number 9.
[0097] Cas5: A polynucleotide consisting of the base sequence described in sequence number 10.
[0098] Cas6: A polynucleotide consisting of the base sequence described in sequence number 11.
[0099] Cas7: A polynucleotide consisting of the base sequence recorded in sequence number 12.
[0100] These are polynucleotides encoding the wild-type Cas protein group of Escherichia coli, but artificially modified polynucleotides can also be used depending on the purpose. Examples of artificial modifications to polynucleotides include, for instance, changes to the base sequence to suit expression in host cells or in vitro expression systems (e.g., codon optimization).
[0101] In this invention, expression vectors for expressing the Cas protein group can be utilized. Various known vectors can be used as expression vectors. Examples of expression vectors include, for instance, phage vectors, plasmid vectors, viral vectors, retroviral vectors, chromosome vectors, episome vectors, and virus-derived vectors (bacterial plasmids, phages, yeast episomes, etc.), yeast chromosome elements and viruses (baculoviruses, papovaviruses, vaccinia viruses, adenoviruses, avipoxviruses, pseudorabies viruses, herpesviruses, lentiviruses, retroviruses, etc.), and vectors derived from combinations thereof (plasmids, phage particles, etc.).
[0102] The expression vector is further preferably equipped with sites for transcription initiation and termination, and the transcription region contains a ribosome-binding site. The coding portion of the mature transcript in the vector contains the transcription initiation codon AUG at the beginning of the polypeptide to be translated and a stop codon at an appropriate position at the end.
[0103] In this invention, the expression vector for expressing the Cas protein group may contain a promoter sequence. The promoter sequence is appropriately selected based on the site of gene expression (e.g., host species). Additionally, the expression vector may contain sequences for enhancing transcription from DNA, such as enhancer sequences. Examples of enhancers include, for example, the SV40 enhancer (located 100–270 bp downstream of the origin of replication), the initial promoter enhancer of cytomegalovirus, a polyomavirus enhancer located downstream of the origin of replication, and an adenovirus enhancer. Furthermore, the expression vector may contain sequences for stabilizing the transcribed RNA, such as polyA addition sequences (polyadenylation sequences, polyA). Examples of polyA addition sequences include polyA addition sequences derived from the growth hormone gene, bovine growth hormone gene, human growth hormone gene, SV40 virus, and human or rabbit β-globin gene.
[0104] Polynucleotides encoding Cas protein groups can be designed to be carried in one (same) vector, or they can be designed to carry all or part of the polynucleotides encoding each Cas protein group in their own different vectors. For example, it could be a design where polynucleotides encoding cascade reaction proteins are carried in one (same) vector, and polynucleotides encoding Cas3 are carried in a different vector.
[0105] Alternatively, an expression vector can be used containing multiple base sequences encoding a Cas protein group, with base sequences encoding amino acid sequences (such as 2A peptides) inserted between these multiple base sequences. If a polynucleotide with such a base sequence is transcribed / translated, a polypeptide chain linked together is expressed intracellularly. Then, through the action of intracellular proteases, the Cas protein group is separated, forming individual proteins that then form a complex to perform their function. This allows for adjustment of the amount of Cas protein group expressed.
[0106] The expression vectors used in this invention can be prepared by known methods. In addition to the methods described in the instruction manual accompanying the vector preparation kit, various other guidelines can be cited as examples. For instance, [Joseph Sambrook & David W. Russell, Molecular cloning: a laboratory manual 3rd Ed., New York: Cold Spring Harbor Laboratory Press, 2001] is a general guideline.
[0107] -crRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide- The CRISPR-Cas3 system used in this invention contains crRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide for targeting specific DNA.
[0108] crRNA is an RNA that forms part of the CRISPR-Cas system and has a base sequence complementary to the target sequence in the target DNA. The CRISPR-Cas3 system can specifically recognize and cleave the target sequence via crRNA.
[0109] In the case of forming a functional complex of the CRISPR-Cas3 system in the cell, pre-crRNA (International Publication No. 2018 / 225858) is preferred as crRNA.
[0110] Pre-crRNA typically has a structure of "leader sequence-repetition sequence-spacer sequence-repetition sequence (LRSR structure)" or "repetition sequence-spacer sequence-repetition sequence (RSR structure)". The leader sequence is an AT-enriched sequence that functions as a promoter for expressing the pre-crRNA. The repetition sequence is a sequence repeated with spacers in between, and the spacers are sequences designed in this invention as complementary to the target sequence in the target DNA (originally, sequences from foreign DNA sources introduced during adaptation). The pre-crRNA is cleaved by proteins that constitute a cascade reaction (e.g., Cas6 in types IA, IB, ID-IE, and Cas5 in type IC) to become mature crRNA.
[0111] Typically, the leader sequence is 86 bases long, and the repeat sequence is 29 bases long. The spacer sequence is, for example, 10–60 bases long, preferably 20–50 bases long, more preferably 25–40 bases long, and typically 32–37 bases long. Therefore, the pre-crRNA used in this invention has a chain length of, for example, 154–204 bases long in the case of an LRSR structure, preferably 164–194 bases long, more preferably 169–184 bases long, and typically 176–181 bases long in the case of an RSR structure. Furthermore, in the case of an RSR structure, it is, for example, 68–118 bases long, preferably 78–108 bases long, more preferably 83–98 bases long, and typically 90–95 bases long.
[0112] It is believed that for the CRISPR-Cas3 system complex to form and function within the cell, the process of the repetitive sequence of pre-crRNA being cleaved by the proteins constituting the cascade reaction is crucial. Therefore, it should be understood that the repetitive sequence described above can be either shorter or longer than the aforementioned chain length, provided such cleavage occurs. That is, pre-crRNA can be considered as crRNA with sequences sufficiently cleaved by the proteins constituting the cascade reaction added to both ends of the mature crRNA described later.
[0113] On the other hand, the mature crRNA generated by cleaving pre-crRNA has a structure of "5' handle sequence - spacer sequence - 3' handle sequence". Typically, the 5' handle sequence consists of 8 bases from positions 22 to 29 of the repeat sequence, held by Cas5. Additionally, the 3' handle sequence typically consists of 21 bases from positions 1 to 21 of the repeat sequence, forming a stem-loop structure with bases from positions 6 to 21, held by Cas6. Therefore, the chain length of mature crRNA is usually 61–66 bases. However, depending on the type of CRISPR-Cas3 system, there are also mature crRNAs without a 3' handle sequence, in which case the chain length becomes shorter, to 21 bases.
[0114] Furthermore, the RNA sequence can be appropriately designed based on the target sequence. Additionally, RNA synthesis can be performed using any method known in the field.
[0115] -Single-stranded probe DNA-
[0116] The single-stranded probe DNA used in the detection method of this invention is not particularly limited as long as it can be detected by cleavage. The single-stranded probe DNA can be linear or circular, but linear is preferred (see reference...). Figure 1 The nucleic acids that make up a single-stranded probe DNA can contain more than one type of modification (e.g., base modification, backbone modification, sugar modification).
[0117] A preferred approach for labeling single-stranded probe DNA is a fluorochrome / quencher pair. In this approach, the signal from the fluorochrome is reduced or eliminated when the fluorochrome / quencher pair is in close proximity to the single-stranded probe DNA, but a sufficient signal from the fluorochrome is detected if the single-stranded probe DNA is cleaved and the fluorochrome separates from the quencher. Therefore, the target DNA in the test sample can be detected using the fluorescence signal generated by the single-stranded probe DNA cleaved by the CRISPR-Cas3 system that recognizes and binds to the target DNA as an indicator.
[0118] The binding of fluorescent dye and quencher to single-stranded probe DNA is not particularly limited, as long as they are close enough to produce extinction and separate after the single-stranded probe DNA is cleaved. For example, fluorescent dye can be bound to one end of the single-stranded probe DNA and quencher to the other end. To increase the extinction effect within the probe, an additional quencher can also be bound. In this case, a dual-quencher probe (internal quencher) can be prepared, in which an additional quencher is bound inside the single-stranded probe DNA.
[0119] Examples of fluorescent dyes used in fluorescent dye / quencher pairs include, for example, ATTO dye, anthocyanins (e.g., Cy3, Cy5), tetramethylrhodamine (e.g., TRITC), carboxyfluorescein (FAM), tetrachlorofluorescein (TET), hexachlorofluorescein (HEX), Texas Red, Yakima Yellow, etc. Specific examples of quenchers include, for example, darkquencher, BHQ (Black Hole Quencher), IBFQ (Iowa Blak FQ), IBRQ (Iowa Blak RQ), Eclipse, etc., but are not limited to these. As internal quenchers, ZEN, TAO, etc., may be suitable. The use of fluorescent dye / quencher pairs for detecting probe DNA cleavage is well known to those skilled in the art (e.g., see International Publication No. 2019 / 104058).
[0120] Another preferred approach to labeling single-stranded probe DNA is the use of donor / acceptor pairs for fluorescence resonance energy transfer (FRET). In this approach, when the donor / acceptor pair is bound to and near the single-stranded probe DNA, excitation of the donor causes excitation and luminescence of the acceptor (i.e., generating a FRET signal). However, if the single-stranded probe DNA is cleaved and the donor separates from the acceptor, the FRET signal decreases or disappears. Therefore, the decrease or disappearance of the FRET signal in the single-stranded probe DNA cleaved by the CRISPR-Cas3 system that recognizes and binds to the target DNA can be used as an indicator to detect the target DNA in the test sample.
[0121] The binding of the FRET donor and acceptor to the single-stranded probe DNA is not particularly restricted, as long as they are close enough to produce FRET and separate after the single-stranded probe DNA is cleaved. For example, the single-stranded probe DNA can bind to the donor at one end and the acceptor at the other end.
[0122] Examples of donor / receptor pairs for FRET include, for example, BFP / eGFP, BFP / YFP, BFP / DsRed2, CFP / YFP, CFP / DsRed2, Midoriishi-Cyan / Kusabira-Orange, eGFP / DsRed, eGFP / Rhod-2, FITC / TRITC, FITC / Rhod-2, FITC / Cy3, Alexa488 / Alexa546, and A. Lexa488 / Alexa555, Alexa488 / Cy3, YFP / TRITC, YFP / Cy3, Cy3 / Cy5, Cy3 / Cy5.5, fluorescein / tetramethylrhodamine, IAEDANS / FITC, IAEDANS / 5-(iodoacetamido)fluorescein, fluorescein / fluorescein, EDANS / dansyl, tryptophan / dansyl, tryptophan / pyrene, dansyl / fluorescein, naphthalene / dansyl, pyrene / coumarin, phycoerythrin / Cy5, etc., but not limited to these. The use of donor / acceptor pairs for detecting probe DNA cleavage is well known to those skilled in the art (e.g., see International Publication No. 2019 / 104058).
[0123] Furthermore, the detection method of the present invention, utilizing single-stranded probe DNA, can be applied to immunochromatography (lateral flow assay). In this scheme, for example, single-stranded probe DNA bound to a first tag and a second tag is used as the single-stranded probe DNA, and a labeled antibody against the second tag (hereinafter referred to as "labeled antibody") is used as a marker to capture the tagged single-stranded probe DNA. Furthermore, a binding molecule against the first tag is pre-immobilized on the first test line (the upstream test line of the test strip) of the immunochromatographic test strip, and a binding molecule against the labeled antibody is pre-immobilized on the second test line (the downstream test line of the test strip).
[0124] In this immunochromatographic assay, in the absence of target DNA in the sample, a complex of single-stranded probe DNA (uncut) and labeled antibody is formed by a second tag of the single-stranded probe DNA (uncut). This complex is captured by a first tag-binding molecule immobilized on a first test line via a first tag of the single-stranded probe DNA (uncut). A signal generated by the labeled antibody is detected on the first test line.
[0125] On the other hand, in the presence of target DNA in the sample, the first tag and the second tag are separated by cleavage of the single-stranded probe DNA. A complex of the separated second tag and the labeled antibody is formed. This complex is captured by the second test line via a binding molecule against the labeled antibody, and the signal generated by the labeled antibody is detected on the second test line. The complex of the second tag and the labeled antibody does not retain the first tag and is not captured by the first test line, therefore the signal is not detected on the first test line.
[0126] The binding of the first and second tags to the single-stranded probe DNA is not particularly restricted, as long as the two tags separate after the single-stranded probe DNA is cleaved. For example, the first tag can be bound to one end of the single-stranded probe DNA and the second tag can be bound to the other end.
[0127] Examples of first tags and their binding molecules include, for example, a combination of streptavidin and biotin; examples of second tags include, for example, FITC; examples of markers in labeled antibodies include, for example, gold particles; and examples of binding molecules against labeled antibodies include, for example, protein A and secondary antibodies (antibodies that bind to labeled antibodies). The principle of detecting DNA cleavage using single-stranded probes via immunochromatography is well known to those skilled in the art (Gootenberg et al., Science 2018; 360: 439-444). Commercially available test strips can be used in this immunochromatographic assay (e.g., HybriDetect (Milenia Biotec)).
[0128] In the detection of single-stranded probe DNA cleavage, various methods other than those mentioned above can be used (for example, see International Publication No. 2019 / 104058).
[0129] -Contact between the test sample, the CRISPR-Cas3 system, and the single-stranded probe DNA-
[0130] In the detection method of the present invention, the contact between the test sample, the CRISPR-Cas3 system, and the single-stranded probe DNA can be achieved, for example, by mixing the test sample, the CRISPR-Cas3 system, and the single-stranded probe DNA. When the test sample contains cells, further steps may be included, such as introducing the CRISPR-Cas3 system and the single-stranded probe DNA into the cells of the test sample.
[0131] In the contact between the test sample and the CRISPR-Cas3 system, crRNA and Cas protein groups can be prepared separately and then contacted with the test sample. Alternatively, a complex of crRNA and Cas protein groups can be prepared in advance and then contacted with the test sample. When the CRISPR-Cas3 system is introduced into the cells of the test sample, crRNA and / or Cas protein groups can be expressed within those cells.
[0132] As a method for introducing molecules constituting the CRISPR-Cas3 system of the present invention into cells in the form of polynucleotides or expression vectors containing such polynucleotides, known methods such as electroporation, calcium phosphate method, liposome method, DEAE dextran method, microinjection, cationic liposome-mediated transfection, electroporation, transduction, and infection using viral vectors can be used. As a method for introducing molecules constituting the CRISPR-Cas3 system into cells in the form of proteins (or ribonucleoprotein complexes), known methods such as microinjection, electroporation, and cationic liposome-mediated transfection can be used. Such methods are described in numerous standard laboratory manuals, such as "Leonard G. Daviset et al., Basic methods in molecular biology, New York: Elsevier, 1986".
[0133] <Kits for detecting specific DNA in samples>
[0134] The kit for detecting specific DNA in a sample according to the present invention comprises (a) a CRISPR-Cas3 system targeting the specific DNA and (b) single-stranded probe DNA. The components of the kit of the present invention may be independent of each other or may be a combination of all or some of them.
[0135] Furthermore, depending on the detection method, the kit of the present invention may further include, for example, standard samples (at various concentrations), control samples, sample dilution solutions, reaction buffers, washing solutions, etc. Additionally, depending on the type of label in the single-stranded probe DNA, it may further include, for example, a label-binding molecule (e.g., a label-binding antibody), reagents required for label detection, etc. The kit of the present invention may further include instructions for use.
[0136] Example
[0137] The invention is described in more detail based on the embodiments, but the invention is not limited to the following embodiments.
[0138] A. Materials and Methods
[0139] (1) Preparation of Cas3 and cascade reaction proteins
[0140] In this detection system, an IE-type CRISPR derived from *E. coli* was used. The Cas3 protein was purified using insect Sf9 cells. The His-tagged Cas3 sequence with a nuclear localization signal (bpNLS) was inserted into a baculovirus gene expression vector, and baculovirus was generated using *E. coli* strain DH10bac. The generated baculovirus was infected with Sf9 insect cells to express the Cas3 protein. The total protein was then recovered, and the Cas3 protein was purified by nickel column chromatography and gel filtration. In the preparation of the NLS-tagged cascade reaction complex containing crRNA, three plasmids were prepared: a His-tagged Cas11 expression plasmid (pCDFDuet-1), Cas5, Cas6, Cas7, Cas8, and Cas11 expression plasmid (pRSFDuet-1), and a target crRNA expression plasmid (pACYCDuet-1). All plasmids were introduced into *E. coli* BL21 for expression. The total protein was recovered, and the cascade reaction complex was purified by nickel column chromatography and gel filtration.
[0141] In addition, the target sequence is the human EMX1 gene intragenic sequence (TGGCGCATTGCCACG). NNN CAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAG / Sequence No.: 15) and mouse Tyr gene sequence (GCATTACTATGTGTC) NNN GGACACACTGCTTGGGGGCTCTGAAATATGGAGGGACATTGA / Sequence No.: 16). “NNN” is the PAM sequence used in each experiment. In addition, the sequences of the Cas protein group are shown in sequence numbers 1–12, and the sequence of the nuclear localization signal (bpNLS) is shown in sequence number 14.
[0142] (2) Electrophoresis was used to determine nonspecific cleavage.
[0143] Cas3 protein (5 ng / μL), cascade reaction complex (25 ng / μL), a double-stranded DNA fragment containing the target sequence (2 ng / μL), and donor DNA (4.5 ng / μL) for confirming nonspecific cleavage were mixed in a reaction buffer (5 mM HEPES-K pH 7.5, 60 mM KCl, 10 mM MgCl2, 10 μM CoCl2, 2.5 mM ATP). The reaction solution was incubated at 37°C for 1 hour and electrophoresis was performed using a MultiNa capillary electrophoresis apparatus (Shimadzu Corporation). The PAM sequence of the double-stranded DNA fragment was studied using the non-recognizable sequences "CCA" in addition to "AAG" and "ATG," which are recognizable by the CRISPR-Cas3 system. As donor DNA, approximately 1 kb of straight single-stranded DNA, approximately 7 kb of circular single-stranded DNA (M13mp18 DNA), and approximately 3 kb of circular double-stranded DNA (pBlueScript) were used to investigate the cleavage activity using the CRISPR-Cas3 system.
[0144] (3)Use DNaseAlert TM Nuclease activity assay
[0145] To detect nonspecific cleavage using a fluorescent probe, DNaseAlert was used. TM Non-specific cleavage assays were performed using a kit (IDT Corporation). Cas3 protein (20 ng / μL), cascade reaction complex (32 ng / μL), and a double-stranded DNA fragment containing the target sequence (2 ng / μL) were mixed in reaction buffer (5 mM HEPES-K pH 7.5, 60 mM KCl, 10 mM MgCl2, 10 μM CoCl2, 2.5 mM ATP). The substrate solution was prepared by adding 5 μL of nuclease-free water and 10×Alert Buffer to a DNaseAlert substrate tube. Then, 20 μL of the sample was mixed with 5 μL of the substrate solution (fluorescent probe solution), and the intensity of the HEX signal was observed every 30 seconds using a real-time PCR device at 37°C.
[0146] (4)Use Taqman TM Nuclease activity assay of probe
[0147] To enable detection using fluorescent probes of single-stranded DNA, Taqman was used. TMNon-specific cleavage assays were performed using the probe (Sequence information: HEX-AAGGTCGGA-ZEN-GTCAACGGATTTGGTC-IBFQ / Sequence number: 17; Thermo Fisher). Cas3 protein (20 ng / μL), cascade reaction complex (32 ng / μL), and a double-stranded or single-stranded DNA fragment containing the target sequence (2 ng / μL) were mixed in reaction buffer (5 mM HEPES-K pH 7.5, 60 mM KCl, 10 mM MgCl2, 10 μM CoCl2, 2.5 mM ATP). TaqMan... TM 0.5 μL of probe was prepared using 5 μL of nuclease-free water and 10×AlertBuffer. Then, 20 μL of sample and 5 μL of substrate solution were mixed and the intensity of HEX signal was observed every 30 seconds at 37°C using a real-time PCR device (CFX Connect, Bio-Rad Laboratories).
[0148] (5) Evaluation of target specificity of PAM sequences
[0149] Samples were prepared by altering the PAM sequence (3 bases) of the double-stranded DNA fragment to the complete sequence map (64 types), using Taqman in the same manner as (4). TM Non-specific cleavage activity was measured using the probe. The rate of increase in fluorescence signal in the first minute after the reaction began was calculated and compared to evaluate the activity intensity caused by differences in target recognition of the PAM sequence.
[0150] (6) Determination of detection limit concentration
[0151] (i) Determination of double-stranded DNA fragment solutions
[0152] The concentration of the double-stranded DNA fragment was adjusted by serial dilution, using Taqman in the same manner as in (4). TM The activity intensity of the probe at each concentration was measured. In addition, for diluted DNA samples, the RPA method of the TwistAmp Basic kit (TwistDx) was used to amplify the DNA in the samples under the conditions of incubation at 37°C for 20 minutes, and the activity intensity was measured again.
[0153] (ii) Determination in genomic mixtures
[0154] A genomic mixture solution was prepared by serially diluting the concentration of double-stranded DNA fragments into a DNA solution, which was then used as a non-specific DNA mixture of 20 ng of mouse genome. The DNA in the sample was then amplified using the RPA method of the TwistAmp Basic kit (TwistDx) at 37°C for 20 minutes, similar to (4) using TaqMan. TM The probe was used to determine the activity intensity at each concentration.
[0155] (7) Detection of novel coronavirus RNA
[0156] Using the N gene of the novel coronavirus (SAS-CoV2) as a target, a SARS-specific Cascade complex for detection was prepared. The novel coronavirus RNA was purified from virus propagated using the VeroE6 / TMPRSS2 cell line via the QIAamp Viral RNA Mini Kit (QIAGEN). After serial dilution of the viral RNA solution, the viral genome was amplified using the RT-LAMP method on the WarmStart LAMP Kit (NEB) at 62°C for 30 minutes. The reaction buffer contained 5 mM HEPES-K pH 7.5, 60 mM KCl, 10 mM MgCl2, 10 μM CoCl2, 2.5 mM ATP, 400 nM Cas3 protein, 100 nM cascade complex, and 250 nM TaqMann. TM Mix 2 μl of the above viral genome amplification solution with 18 μl of the probe, and determine the activity intensity at each concentration by real-time PCR. The primer set used in target amplification was designed using PrimerExplorerV5 (https: / / primerexplorer.jp / lampv5 / index.html).
[0157] In addition, the virus-specific target sequences are as follows.
[0158] SARS-N1: aaggccaaactgtcactaagaaatctgctgctgag / Serial Number: 18
[0159] SARS-N2: aaggaactgattacaaacattggccgcaaattgca / Serial Number: 19
[0160] In addition, the primers used in the RT-RAMP method are as follows.
[0161] <SARS-N1 Group>
[0162] SARS-N1-FIP: GTTGGCCTTTACCAGACATTTTGGTGATGCTGCTCTTGCTT / Serial Number: 20
[0163] SARS-N1-BIP: TGCTGAGGCTTCTAAGAAGCCAGCTTGTGTTACATTGTATGC / Serial Number: 21
[0164] SARS-N1-F3: ACTTCTCCTGCTAGAATGG / Serial Number: 22
[0165] SARS-N1-B3: GTTTGTTCTGGACCACGT / Serial Number: 23
[0166] SARS-N1-LF: TTCAATCTGTCAAGCAGCAGCA / Serial Number: 24
[0167] SARS-N1-LB: GGCAAAAACGTACTGCCACTA / Serial Number: 25.
[0168] <SARS-N2 Group>
[0169] SARS-N2-FIP: TCTGATTAGTTCCTGGTCCCCAAAGCATACAATGTAACACAAGC / Serial Number: 26
[0170] SARS-N2-BIP: CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG / Serial Number: 27
[0171] SARS-N2-F3: GCAAAAACGTACTGCCAC / Serial Number: 28
[0172] SARS-N2-B3: GAAATTTGGATCTTTGTCATCC / Serial Number: 29
[0173] SARS-N2-LF: TGGACCACGTCTGCCGA / Serial Number: 30
[0174] SARS-N2-LB: ACCTTCGGGAACGTGGTT / Serial Number: 31.
[0175] (8) Detection using lateral flow test paper
[0176] To visualize the signal using lateral flow test strips, a FITC- and biotin-labeled signal probe (FITC-GTCAACGGATTTGGTC-BIO / Serial No.: 32) was synthesized by FASMAC. 2 μl of the above viral genome amplification solution was mixed with 18 μl of reaction buffer (5 mM HEPES-K pH 7.5, 60 mM KCl, 10 mM MgCl2, 10 μM CoCl2, 2.5 mM ATP, 400 nM Cas3 protein, 200 nM cascade reaction complex, 100 nM probe) and incubated at 37°C for 10 minutes. After adding 50 μl of water, one end of a HybriDetect (Milenia Biotec) test strip (control test line side) was immersed in the reaction buffer and allowed to stand at room temperature for 2 minutes before detection.
[0177] (9) Detection of drug-resistant mutant influenza virus sequences
[0178] To detect single-base mutations in drug-resistant influenza viruses, a target sequence of crRNA was designed targeting the resistance mutations in baloxavir formulations and neuraminidase inhibitors. A cascade reaction complex containing this crRNA was prepared. A solution of double-stranded DNA fragments (40 ng / μl) containing wild-type and mutant sequences was prepared, along with reaction buffers (5 mM HEPES-K pH 7.5, 60 mM KCl, 10 mM MgCl2, 10 μM CoCl2, 2.5 mM ATP, 400 nM Cas3 protein, 100 nM cascade reaction complex, 250 nM TaqMan). TM The activity intensity of the 20 μl mixture of probes was determined using a real-time PCR device (CFX Connect, Bio-Rad Laboratories).
[0179] In addition, the crRNA sequence is as follows.
[0180] <Baloxavir (Xofluza) resistance mutation>
[0181] For wild-type detection; H1N1-Cascade-I38: TGCAGCAAACTTATTAGTTTCAATTTTGGGGT / Serial Number: 33
[0182] For wild-type detection; H3N2-Cascade-I38: TGCACTCACTTGGAGGTGTGTTTCATGTATTC / Serial No.: 34.
[0183] <Tamiflu resistance mutation>
[0184] For mutation detection; H1N1-Cascade-I222: ATTGAGAACACAAGAGTCTGAATGTGCATGTG / Serial Number: 35
[0185] For mutation detection; H1N1-Cascade-H274: TAATTAGGGGCTTTCATTTCGACTGATTTGAT / Serial Number: 36
[0186] For mutation detection; H3N2-Cascade-N294: CTGTCTCTGCAGACACATCTGACACCAGGATA / Serial number: 37.
[0187] In addition, the DNA fragment sequence used to detect drug resistance mutations in influenza viruses is as follows (underlined bases indicate the bases corresponding to the mutation sites).
[0188] H1N1-PA-I38: GGGAAGACCCCAAAATTGAAACTAATAAGTTTGCTGCAATTTGCACACATTTGGAAGTTTGTTTCATGTATTCGGATTTC / Serial Number: 38
[0189] H1N1-PA-I38T: GGGAAGACCCCAAAATTGAAACTAATAAGTTTGCTGCAA C TTGCACACATTTGGAAGTTTGTTTCATGTATTCGGATTTC / Serial number: 39
[0190] H3N2-PA-I38:GGGGAGGATCTGAAAATTGAAACCAACAAATTTGCAGCAATATGCACTCACTTGGAGGTGTGTTTCATGTATTCAGATTT / Serial number: 40
[0191] H3N2-PA-I38T:GGGGAGGATCTGAAAATTGAAACCAACAAATTTGCAGCAA C ATGCACTCACTTGGAGGTGTGTTTCATGTATTCAGATTT / Serial number: 41
[0192] H1N1-NA-I222: GGCATAATAACAGACACTATCAAGAGTTGGAGGAACAATATATTGAGAACACAAGAGTCTGAATGTGCATGTGTAAATGG / Serial Number: 42
[0193] H1N1-NA-I222R: GGCATAATAACAGACACTATCAAGAGTTGGAGGAACAATA G ATTGAGAACACAAGAGTCTGAATGTGCATGTGTAAATGG / Serial Number: 43
[0194] H1N1-NA-H274: AAAGATAATCAAATCAGTCGAAATGAAAGCCCCTAATTATCACTATGAGGAATGCTCCTGTTACCCTGATTCTAGTGAAA / Serial Number: 44
[0195] H1N1-NA-H274Y: AAAGATAATCAAATCAGTCGAAATGAAAGCCCCTAATTAT T ACTATGAGGAATGCTCCTGTTACCCTGATTCTAGTGAAA / Serial Number: 45
[0196] H3N2-PA-N294: TATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACAACTGGAAAGGATCCAACCGGCCCATCATAGATATAAACAT / Serial Number: 46
[0197] H3N2-PA-N294S: TATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACA G CTGGAAAGGATCCAACCGGCCCATCATAGATATAAACAT / Serial Number: 47.
[0198] B. Result
[0199] Results of nonspecific cleavage assays using electrophoresis showed that, in any case—whether it was a single Cas3 protein, a single cascade reaction complex, or a combination of Cas3 protein and a cascade reaction complex—no single-stranded DNA cleavage activity was detected as long as no DNA fragment containing the target sequence was present. On the other hand, in cases involving a mixture of PAM sequences (AAG or ATG) recognizable by the CRISPR-Cas3 system and DNA fragments containing the target sequence, cleavage of the donor single-stranded DNA was detected. Figure 1(Arrow). On the other hand, in the case of DNA fragments mixed with PAM sequences (CCA) that are not recognized by the CRISPR-Cas3 system, no degradation of the donor DNA was detected. Even when circular single-stranded DNA was used, cleavage activity generated by the CRISPR-Cas3 system was confirmed, but the cleavage activity was lower compared to the case of linear single-stranded DNA. On the other hand, the result of using double-stranded DNA as the donor DNA was that no DNA degradation was detected even in the presence of DNA fragments containing the target sequence. Figure 2 (Arrow). The results above indicate that the CRISPR-Cas3 system exhibits non-specific single-stranded DNA cleavage activity only in the presence of the target sequence.
[0200] Next, utilizing the characteristics of this CRISPR-Cas3 system, we investigated whether a fluorescent probe (DNaseAlert) could be used. TM The probe, which binds the fluorescent dye "HEX" and the quencher "dark quencher" to each end, detects the presence or absence of the target sequence. Results from time-varying fluorescence signal measurements of substrates (fluorescent probes) that fluoresce upon DNA degradation (DNase) show that strong fluorescence signals were detected only when a strong fluorescence signal was detected in a mixture of a PAM sequence (AAG or ATG) recognizable by the CRISPR-Cas3 system and a DNA fragment containing the target sequence. Figure 3 The same result was obtained when the target sequence was mTyr. Figure 4 To more accurately detect single-stranded DNA degradation, a fluorescent probe (TaqMann) is used. TM The probe (a dual-quencher probe with the fluorescent dye "HEX" and the quencher "IBFQ" bound to each end, and "ZEN" introduced as an internal quencher) was studied. The results showed that, similarly, the fluorescent signal was detected only when the CRISPR-Cas3 system could recognize the target sequence (Figure 5).
[0201] Furthermore, to confirm whether the CRISPR-Cas3 system exhibits nonspecific single-stranded DNA cleavage activity even when the target DNA is single-stranded, experiments were conducted using single-stranded DNA fragments as the target DNA. The results showed that even when the target DNA is single-stranded (target strand), it meaningfully exhibits nonspecific single-stranded DNA cleavage activity. Figure 6 ).
[0202] The results above demonstrate that the CRISPR-Cas3 system recognizes target DNA sequences (both single-stranded and double-stranded DNA) and induces non-specific cleavage activity in surrounding single-stranded DNA. Furthermore, it was determined that this activity of the CRISPR-Cas3 system can be easily and effectively identified using fluorescent probes.
[0203] Next, to investigate the differences in single-stranded DNA cleavage activity caused by varying target specificity in the CRISPR-Cas3 system, the PAM sequence within the target double-stranded DNA fragment was altered, and the activity was measured using the full PAM sequence mapping. The results showed high activity for previously reported PAM sequences (AAG, ATG, etc.), while essentially no activity was observed when the first or second base was C, or when the third base was T. Figure 7 It was determined that changes in single bases on the PAM sequence affect the non-specific single-stranded DNA cleavage activity caused by the CRISPR-Cas3 system, and therefore this activity can be used as an indicator to detect target DNA in the sample with specificity at the single base level.
[0204] Next, in order to study the critical concentration of the target DNA that could be detected, the target DNA fragment was infinitesimally diluted to prepare single copies up to 10^6. 12 The activity intensity of the target DNA fragment at various concentrations was determined by copying. The results were obtained using 10... 10 Significant signals can be detected when the target DNA is copied above. Figure 8 Existing systems utilizing Cas12a and Cas13 have also been reported to show 10 10 The detection sensitivity of approximately 1 copy indicates that the CRISPR-Cas3 system exhibits equivalent detection sensitivity to these samples. Furthermore, the DNA in these diluted samples was amplified using the RPA method, and the activity intensity was measured again. The results showed that even samples initially containing only 1 copy of the target DNA exhibited nonspecific single-stranded DNA cleavage activity. Figure 9 The above demonstrates that, by combining simple gene amplification methods such as RPA, it is possible to detect trace amounts (e.g., 1 copy) of target DNA in a sample using the CRISPR-Cas3 system.
[0205] In addition, to investigate the critical concentration of target DNA in the presence of abundant nonspecific DNA sequences, mouse genomic DNA was mixed into samples after limited dilution of the target DNA fragment, and the activity intensity was measured. The results were consistent with... Figure 9 Similarly, it can detect even samples containing only 1 copy of the target DNA. Figure 11This indicates that by amplifying the target DNA using methods such as RPA, it is possible to specifically detect more than one copy of the target DNA, even when other DNA is present.
[0206] To demonstrate its practical applicability in the detection of viruses, including those causing emerging infectious diseases, two cascade reaction complexes (N1 and N2) specific to the N gene of the novel coronavirus (SARS-CoV-2) were synthesized. RT-LAMP was performed on each region, mixing the amplified viral genome with Cas3 and the cascade reaction complex proteins. The results showed that N1 could be detected with a signal in a sample containing 1 copy of viral RNA, and N2 could be detected with a signal in a sample containing 10 copies of viral RNA. Samples containing more than 1000 copies of virus were 100% detectable. Figure 12 ).
[0207] Next, in order to use the lateral flow assay... Figure 13A To detect the novel coronavirus, the viral genome amplified by RT-LAMP was mixed with FITC- and biotin-labeled signal probes, Cas3, and Cascade complex proteins. One end of a lateral flow test strip (control line side) was then immersed in this reaction system. Results showed that the signal of the positive band on the lateral flow test strip intensified with reaction time, and a reaction time of 10 minutes at 37°C was sufficient to clearly distinguish the presence or absence of the band. Figure 13B ).
[0208] Furthermore, the results of lateral flow assays on serially diluted viral RNA samples showed that sufficient discrimination could be achieved using 100 copies of the sample. Figure 14 ).
[0209] The summary of the measurements in this experiment is as follows: Figure 15 The above results confirm that the novel coronavirus (SARS-CoV-2) can be easily detected by using the Cascade complex and Cas3 protein.
[0210] Next, the study investigated whether the CRISPR-Cas3 system could be used to detect single-base mutations in influenza viruses resistant to baloxavir formulations (such as baloxavir (Xofluza)) and neuraminidase inhibitors (such as Tamiflu and Relenza). For the I38T mutation in the RNA polymerase (PA) gene, which is known to be a baloxavir (Xofluza) resistance mutation in influenza A viruses (H1N1 and H3N2), detection was performed. The results showed that significant strong signals were successfully obtained in the wild-type sequence for both H1N1 and H3N2. Figure 16 ).
[0211] Next, mutations in the neuraminidase (NA) gene (H1N1: I222R or H274Y, H3N2: N294S), which are known to be resistant to Tamiflu and Relenza in influenza A viruses, were detected. The results showed that both H1N1 and H3N2 successfully obtained meaningfully strong signals in the mutant sequences. Figure 17 ).
[0212] Based on the above, by designing target sequences for crRNA in the CRISPR-Cas3 system targeting the mutation sites, drug resistance mutations at the single-base level were successfully detected.
[0213] Industry availability
[0214] According to the present invention, by utilizing the CRISPR-Cas3 system and single-stranded probe DNA, target DNA in a sample can be detected simply and effectively. The present invention makes significant contributions, for example, to the diagnosis of infections caused by viruses, pathogens, and protozoa, and to the diagnosis of gene mutations and polymorphisms related to disease risk, drug effectiveness, etc. sequence list <110> C4U Co., Ltd. National University Corporation Osaka University <120> Methods for detecting specific DNA in samples <130> G20200143 <150> JP 2020-010216 <151> 2020-01-24 <150> JP 2020-086698 <151> 2020-05-18 <160> 47 <170> PatentIn version 3.5 <210> 1 <211> 888 <212> PRT <213> Escherichia coli <400> 1 Met Glu Pro Phe Lys Tyr Ile Cys His Tyr Trp Gly Lys Ser Ser Lys 1 5 10 15 Ser Leu Thr Lys Gly Asn Asp Ile His Leu Leu Ile Tyr His Cys Leu 20 25 30 Asp Val Ala Ala Val Ala Asp Cys Trp Trp Asp Gln Ser Val Val Leu 35 40 45 Gln Asn Thr Phe Cys Arg Asn Glu Met Leu Ser Lys Gln Arg Val Lys 50 55 60 Ala Trp Leu Leu Phe Phe Ile Ala Leu His Asp Ile Gly Lys Phe Asp 65 70 75 80 Ile Arg Phe Gln Tyr Lys Ser Ala Glu Ser Trp Leu Lys Leu Asn Pro 85 90 95 Ala Thr Pro Ser Leu Asn Gly Pro Ser Thr Gln Met Cys Arg Lys Phe 100 105 110 Asn His Gly Ala Ala Gly Leu Tyr Trp Phe Asn Gln Asp Ser Leu Ser 115 120 125 Glu Gln Ser Leu Gly Asp Phe Phe Ser Phe Phe Asp Ala Ala Pro His 130 135 140 Pro Tyr Glu Ser Trp Phe Pro Trp Val Glu Ala Val Thr Gly His His 145 150 155 160 Gly Phe Ile Leu His Ser Gln Asp Gln Asp Lys Ser Arg Trp Glu Met 165 170 175 Pro Ala Ser Leu Ala Ser Tyr Ala Ala Gln Asp Lys Gln Ala Arg Glu 180 185 190 Glu Trp Ile Ser Val Leu Glu Ala Leu Phe Leu Thr Pro Ala Gly Leu 195 200 205 Ser Ile Asn Asp Ile Pro Pro Asp Cys Ser Ser Leu Leu Ala Gly Phe 210 215 220 Cys Ser Leu Ala Asp Trp Leu Gly Ser Trp Thr Thr Thr Asn Thr Phe 225 230 235 240 Leu Phe Asn Glu Asp Ala Pro Ser Asp Ile Asn Ala Leu Arg Thr Tyr 245 250 255 Phe Gln Asp Arg Gln Gln Asp Ala Ser Arg Val Leu Glu Leu Ser Gly 260 265 270 Leu Val Ser Asn Lys Arg Cys Tyr Glu Gly Val His Ala Leu Leu Asp 275 280 285 Asn Gly Tyr Gln Pro Arg Gln Leu Gln Val Leu Val Asp Ala Leu Pro 290 295 300 Val Ala Pro Gly Leu Thr Val Ile Glu Ala Pro Thr Gly Ser Gly Lys 305 310 315 320 Thr Glu Thr Ala Leu Ala Tyr Ala Trp Lys Leu Ile Asp Gln Gln Ile 325 330 335 Ala Asp Ser Val Ile Phe Ala Leu Pro Thr Gln Ala Thr Ala Asn Ala 340 345 350 Met Leu Thr Arg Met Glu Ala Ser Ala Ser His Leu Phe Ser Ser Pro 355 360 365 Asn Leu Ile Leu Ala His Gly Asn Ser Arg Phe Asn His Leu Phe Gln 370 375 380 Ser Ile Lys Ser Arg Ala Ile Thr Glu Gln Gly Gln Glu Glu Ala Trp 385 390 395 400 Val Gln Cys Cys Gln Trp Leu Ser Gln Ser Asn Lys Lys Val Phe Leu 405 410 415 Gly Gln Ile Gly Val Cys Thr Ile Asp Gln Val Leu Ile Ser Val Leu 420 425 430 Pro Val Lys His Arg Phe Ile Arg Gly Leu Gly Ile Gly Arg Ser Val 435 440 445 Leu Ile Val Asp Glu Val His Ala Tyr Asp Thr Tyr Met Asn Gly Leu 450 455 460 Leu Glu Ala Val Leu Lys Ala Gln Ala Asp Val Gly Gly Ser Val Ile 465 470 475 480 Leu Leu Ser Ala Thr Leu Pro Met Lys Gln Lys Gln Lys Leu Leu Asp 485 490 495 Thr Tyr Gly Leu His Thr Asp Pro Val Glu Asn Asn Ser Ala Tyr Pro 500 505 510 Leu Ile Asn Trp Arg Gly Val Asn Gly Ala Gln Arg Phe Asp Leu Leu 515 520 525 Ala His Pro Glu Gln Leu Pro Pro Arg Phe Ser Ile Gln Pro Glu Pro 530 535 540 Ile Cys Leu Ala Asp Met Leu Pro Asp Leu Thr Met Leu Glu Arg Met 545 550 555 560 Ile Ala Ala Ala Asn Ala Gly Ala Gln Val Cys Leu Ile Cys Asn Leu 565 570 575 Val Asp Val Ala Gln Val Cys Tyr Gln Arg Leu Lys Glu Leu Asn Asn 580 585 590 Thr Gln Val Asp Ile Asp Leu Phe His Ala Arg Phe Thr Leu Asn Asp 595 600 605 Arg Arg Glu Lys Glu Asn Arg Val Ile Ser Asn Phe Gly Lys Asn Gly 610 615 620 Lys Arg Asn Val Gly Arg Ile Leu Val Ala Thr Gln Val Val Glu Gln 625 630 635 640 Ser Leu Asp Val Asp Phe Asp Trp Leu Ile Thr Gln His Cys Pro Ala 645 650 655 Asp Leu Leu Phe Gln Arg Leu Gly Arg Leu His Arg His His Arg Lys 660 665 670 Tyr Arg Pro Ala Gly Phe Glu Ile Pro Val Ala Thr Ile Leu Leu Pro 675 680 685 Asp Gly Glu Gly Tyr Gly Arg His Glu His Ile Tyr Ser Asn Val Arg 690 695 700 Val Met Trp Arg Thr Gln Gln His Ile Glu Glu Leu Asn Gly Ala Ser 705 710 715 720 Leu Phe Phe Pro Asp Ala Tyr Arg Gln Trp Leu Asp Ser Ile Tyr Asp 725 730 735 Asp Ala Glu Met Asp Glu Pro Glu Trp Val Gly Asn Gly Met Asp Lys 740 745 750 Phe Glu Ser Ala Glu Cys Glu Lys Arg Phe Lys Ala Arg Lys Val Leu 755 760 765 Gln Trp Ala Glu Glu Tyr Ser Leu Gln Asp Asn Asp Glu Thr Ile Leu 770 775 780 Ala Val Thr Arg Asp Gly Glu Met Ser Leu Pro Leu Leu Pro Tyr Val 785 790 795 800 Gln Thr Ser Ser Gly Lys Gln Leu Leu Asp Gly Gln Val Tyr Glu Asp 805 810 815 Leu Ser His Glu Gln Gln Tyr Glu Ala Leu Ala Leu Asn Arg Val Asn 820 825 830 Val Pro Phe Thr Trp Lys Arg Ser Phe Ser Glu Val Val Asp Glu Asp 835 840 845 Gly Leu Leu Trp Leu Glu Gly Lys Gln Asn Leu Asp Gly Trp Val Trp 850 855 860 Gln Gly Asn Ser Ile Val Ile Thr Tyr Thr Gly Asp Glu Gly Met Thr 865 870 875 880 Arg Val Ile Pro Ala Asn Pro Lys 885 <210> 2 <211> 502 <212> PRT <213> Escherichia coli <400> 2 Met Asn Leu Leu Ile Asp Asn Trp Ile Pro Val Arg Pro Arg Asn Gly 1 5 10 15 Gly Lys Val Gln Ile Ile Asn Leu Gln Ser Leu Tyr Cys Ser Arg Asp 20 25 30 Gln Trp Arg Leu Ser Leu Pro Arg Asp Asp Met Glu Leu Ala Ala Leu 35 40 45 Ala Leu Leu Val Cys Ile Gly Gln Ile Ile Ala Pro Ala Lys Asp Asp 50 55 60 Val Glu Phe Arg His Arg Ile Met Asn Pro Leu Thr Glu Asp Glu Phe 65 70 75 80 Gln Gln Leu Ile Ala Pro Trp Ile Asp Met Phe Tyr Leu Asn His Ala 85 90 95 Glu His Pro Phe Met Gln Thr Lys Gly Val Lys Ala Asn Asp Val Thr 100 105 110 Pro Met Glu Lys Leu Leu Ala Gly Val Ser Gly Ala Thr Asn Cys Ala 115 120 125 Phe Val Asn Gln Pro Gly Gln Gly Glu Ala Leu Cys Gly Gly Cys Thr 130 135 140 Ala Ile Ala Leu Phe Asn Gln Ala Asn Gln Ala Pro Gly Phe Gly Gly 145 150 155 160 Gly Phe Lys Ser Gly Leu Arg Gly Gly Thr Pro Val Thr Thr Phe Val 165 170 175 Arg Gly Ile Asp Leu Arg Ser Thr Val Leu Leu Asn Val Leu Thr Leu 180 185 190 Pro Arg Leu Gln Lys Gln Phe Pro Asn Glu Ser His Thr Glu Asn Gln 195 200 205 Pro Thr Trp Ile Lys Pro Ile Lys Ser Asn Glu Ser Ile Pro Ala Ser 210 215 220 Ser Ile Gly Phe Val Arg Gly Leu Phe Trp Gln Pro Ala His Ile Glu 225 230 235 240 Leu Cys Asp Pro Ile Gly Ile Gly Lys Cys Ser Cys Cys Gly Gln Glu 245 250 255 Ser Asn Leu Arg Tyr Thr Gly Phe Leu Lys Glu Lys Phe Thr Phe Thr 260 265 270 Val Asn Gly Leu Trp Pro His Pro His Ser Pro Cys Leu Val Thr Val 275 280 285 Lys Lys Gly Glu Val Glu Glu Lys Phe Leu Ala Phe Thr Thr Ser Ala 290 295 300 Pro Ser Trp Thr Gln Ile Ser Arg Val Val Val Asp Lys Ile Ile Gln 305 310 315 320 Asn Glu Asn Gly Asn Arg Val Ala Ala Val Val Asn Gln Phe Arg Asn 325 330 335 Ile Ala Pro Gln Ser Pro Leu Glu Leu Ile Met Gly Gly Tyr Arg Asn 340 345 350 Asn Gln Ala Ser Ile Leu Glu Arg Arg His Asp Val Leu Met Phe Asn 355 360 365 Gln Gly Trp Gln Gln Tyr Gly Asn Val Ile Asn Glu Ile Val Thr Val 370 375 380 Gly Leu Gly Tyr Lys Thr Ala Leu Arg Lys Ala Leu Tyr Thr Phe Ala 385 390 395 400 Glu Gly Phe Lys Asn Lys Asp Phe Lys Gly Ala Gly Val Ser Val His 405 410 415 Glu Thr Ala Glu Arg His Phe Tyr Arg Gln Ser Glu Leu Leu Ile Pro 420 425 430 Asp Val Leu Ala Asn Val Asn Phe Ser Gln Ala Asp Glu Val Ile Ala 435 440 445 Asp Leu Arg Asp Lys Leu His Gln Leu Cys Glu Met Leu Phe Asn Gln 450 455 460 Ser Val Ala Pro Tyr Ala His His Pro Lys Leu Ile Ser Thr Leu Ala 465 470 475 480 Leu Ala Arg Ala Thr Leu Tyr Lys His Leu Arg Glu Leu Lys Pro Gln 485 490 495 Gly Gly Pro Ser Asn Gly 500 <210> 3 <211> 160 <212> PRT <213> Escherichia coli <400> 3 Met Ala Asp Glu Ile Asp Ala Met Ala Leu Tyr Arg Ala Trp Gln Gln 1 5 10 15 Leu Asp Asn Gly Ser Cys Ala Gln Ile Arg Arg Val Ser Glu Pro Asp 20 25 30 Glu Leu Arg Asp Ile Pro Ala Phe Tyr Arg Leu Val Gln Pro Phe Gly 35 40 45 Trp Glu Asn Pro Arg His Gln Gln Ala Leu Leu Arg Met Val Phe Cys 50 55 60 Leu Ser Ala Gly Lys Asn Val Ile Arg His Gln Asp Lys Lys Ser Glu 65 70 75 80 Gln Thr Thr Gly Ile Ser Leu Gly Arg Ala Leu Ala Asn Ser Gly Arg 85 90 95 Ile Asn Glu Arg Arg Ile Phe Gln Leu Ile Arg Ala Asp Arg Thr Ala 100 105 110 Asp Met Val Gln Leu Arg Arg Leu Leu Thr His Ala Glu Pro Val Leu 115 120 125 Asp Trp Pro Leu Met Ala Arg Met Leu Thr Trp Trp Gly Lys Arg Glu 130 135 140 Arg Gln Gln Leu Leu Glu Asp Phe Val Leu Thr Thr Asn Lys Asn Ala 145 150 155 160 <210> 4 <211> 224 <212> PRT <213> Escherichia coli <400> 4 Met Arg Ser Tyr Leu Ile Leu Arg Leu Ala Gly Pro Met Gln Ala Trp 1 5 10 15 Gly Gln Pro Thr Phe Glu Gly Thr Arg Pro Thr Gly Arg Phe Pro Thr 20 25 30 Arg Ser Gly Leu Leu Gly Leu Leu Gly Ala Cys Leu Gly Ile Gln Arg 35 40 45 Asp Asp Thr Ser Ser Leu Gln Ala Leu Ser Glu Ser Val Gln Phe Ala 50 55 60 Val Arg Cys Asp Glu Leu Ile Leu Asp Asp Arg Arg Val Ser Val Thr 65 70 75 80 Gly Leu Arg Asp Tyr His Thr Val Leu Gly Ala Arg Glu Asp Tyr Arg 85 90 95 Gly Leu Lys Ser His Glu Thr Ile Gln Thr Trp Arg Glu Tyr Leu Cys 100 105 110 Asp Ala Ser Phe Thr Val Ala Leu Trp Leu Thr Pro His Ala Thr Met 115 120 125 Val Ile Ser Glu Leu Glu Lys Ala Val Leu Lys Pro Arg Tyr Thr Pro 130 135 140 Tyr Leu Gly Arg Arg Ser Cys Pro Leu Thr His Pro Leu Phe Leu Gly 145 150 155 160 Thr Cys Gln Ala Ser Asp Pro Gln Lys Ala Leu Leu Asn Tyr Glu Pro 165 170 175 Val Gly Gly Asp Ile Tyr Ser Glu Glu Ser Val Thr Gly His His Leu 180 185 190 Lys Phe Thr Ala Arg Asp Glu Pro Met Ile Thr Leu Pro Arg Gln Phe 195 200 205 Ala Ser Arg Glu Trp Tyr Val Ile Lys Gly Gly Met Asp Val Ser Gln 210 215 220 <210> 5 <211> 199 <212> PRT <213> Escherichia coli <400> 5 Met Tyr Leu Ser Lys Val Ile Ile Ala Arg Ala Trp Ser Arg Asp Leu 1 5 10 15 Tyr Gln Leu His Gln Gly Leu Trp His Leu Phe Pro Asn Arg Pro Asp 20 25 30 Ala Ala Arg Asp Phe Leu Phe His Val Glu Lys Arg Asn Thr Pro Glu 35 40 45 Gly Cys His Val Leu Leu Gln Ser Ala Gln Met Pro Val Ser Thr Ala 50 55 60 Val Ala Thr Val Ile Lys Thr Lys Gln Val Glu Phe Gln Leu Gln Val 65 70 75 80 Gly Val Pro Leu Tyr Phe Arg Leu Arg Ala Asn Pro Ile Lys Thr Ile 85 90 95 Leu Asp Asn Gln Lys Arg Leu Asp Ser Lys Gly Asn Ile Lys Arg Cys 100 105 110 Arg Val Pro Leu Ile Lys Glu Ala Glu Gln Ile Ala Trp Leu Gln Arg 115 120 125 Lys Leu Gly Asn Ala Ala Arg Val Glu Asp Val His Pro Ile Ser Glu 130 135 140 Arg Pro Gln Tyr Phe Ser Gly Asp Gly Lys Ser Gly Lys Ile Gln Thr 145 150 155 160 Val Cys Phe Glu Gly Val Leu Thr Ile Asn Asp Ala Pro Ala Leu Ile 165 170 175 Asp Leu Val Gln Gln Gly Ile Gly Pro Ala Lys Ser Met Gly Cys Gly 180 185 190 Leo Leo Leo Serum Ala Pro Leo 195 <210> 6 <211> 363 <212> PRT <213> Escherichia coli <400> 6 Met Ser Asn Phe Ile Asn Ile His Val Leu Ile Ser His Ser Pro Ser 1 5 10 15 Cys Leu Asn Arg Asp Asp Met Asn Met Gln Lys Asp Ala Ile Phe Gly 20 25 30 Gly Lys Arg Arg Val Arg Ile Ser Ser Gln Ser Leu Lys Arg Ala Met 35 40 45 Arg Lys Ser Gly Tyr Tyr Ala Gln Asn Ile Gly Glu Ser Ser Leu Arg 50 55 60 Thr Ile His Leu Ala Gln Leu Arg Asp Val Leu Arg Gln Lys Leu Gly 65 70 75 80 Glu Arg Phe Asp Gln Lys Ile Ile Asp Lys Thr Leu Ala Leu Leu Ser 85 90 95 Gly Lys Ser Val Asp Glu Ala Glu Lys Ile Ser Ala Asp Ala Val Thr 100 105 110 Pro Trp Val Val Gly Glu Ile Ala Trp Phe Cys Glu Gln Val Ala Lys 115 120 125 Ala Glu Ala Asp Asn Leu Asp Asp Lys Lys Leu Leu Lys Val Leu Lys 130 135 140 Glu Asp Ile Ala Ala Ile Arg Val Asn Leu Gln Gln Gly Val Asp Ile 145 150 155 160 Ala Leu Ser Gly Arg Met Ala Thr Ser Gly Met Met Thr Glu Leu Gly 165 170 175 Lys Val Asp Gly Ala Met Ser Ile Ala His Ala Ile Thr Thr His Gln 180 185 190 Val Asp Ser Asp Ile Asp Trp Phe Thr Ala Val Asp Asp Leu Gln Glu 195 200 205 Gln Gly Ser Ala His Leu Gly Thr Gln Glu Phe Ser Ser Gly Val Phe 210 215 220 Tyr Arg Tyr Ala Asn Ile Asn Leu Ala Gln Leu Gln Glu Asn Leu Gly 225 230 235 240 Gly Ala Ser Arg Glu Gln Ala Leu Glu Ile Ala Thr His Val Val His 245 250 255 Met Leu Ala Thr Glu Val Pro Gly Ala Lys Gln Arg Thr Tyr Ala Ala 260 265 270 Phe Asn Pro Ala Asp Met Val Met Val Asn Phe Ser Asp Met Pro Leu 275 280 285 Ser Met Ala Asn Ala Phe Glu Lys Ala Val Lys Ala Lys Asp Gly Phe 290 295 300 Leu Gln Pro Ser Ile Gln Ala Phe Asn Gln Tyr Trp Asp Arg Val Ala 305 310 315 320 Asn Gly Tyr Gly Leu Asn Gly Ala Ala Ala Gln Phe Ser Leu Ser Asp 325 330 335 Val Asp Pro Ile Thr Ala Gln Val Lys Gln Met Pro Thr Leu Glu Gln 340 345 350 Leu Lys Ser Trp Val Arg Asn Asn Gly Glu Ala 355 360 <210> 7 <211> 2667 <212> DNA <213> Escherichia coli <400> 7 atggaacctt ttaaatatat atgccattac tggggaaaat cctcaaaaag cttgacgaaa 60 ggaaatgata ttcatctgtt aatttatcat tgccttgatg ttgctgctgt tgcagattgc 120 tggtgggatc aatcagtcgt actgcaaaat actttttgcc gaaatgaaat gctatcaaaa 180 cagagggtga aggcctggct gttatttttc attgctcttc atgatattgg aaagtttgat 240 atacgattcc aatataaatc agcagaaagt tggctgaaat taaatcctgc aacgccatca 300 cttaatggtc catcaacaca aatgtgccgt aaatttaatc atggtgcagc cggtctgtat 360 tggtttaacc aggattcact ttcagagcaa tctctcgggg attttttcag tttttttgat 420 gccgctcctc atccttatga gtcctggttt ccatgggtag aggccgttac aggacatcat 480 ggttttatat tacattccca ggtcaagat aagtcgcgtt gggaaatgcc agcttctctg 540 gcatcttatg ctgcgcaaga taaacaggct cgtgaggagt ggatatctgt actggaagca ttatttttaa cgccagcggg gttatctata aacgatatac cacctgattg ttcatcactg 660 ttagcaggtt tttgctcgct tgctgactgg ttaggctcct ggactacaac gaataccttt ctgtttaatg aggatgcgcc ttccgacata aatgctctga gaacgtattt ccaggaccga cagcaggatg cgagccgggt attggagttg agtggacttg tatcaaataa gcgatgttat gaggtgttc atgcactact ggacaatggc tatcaaccca gacaattaca ggtgttagtt gatgctcttc cagtagctcc cgggctgacg gtaatagagg cacctacagg ctccggtaaa acggaacag cgctggccta tgcttggaa cttattgatc aacaaattgc ggatagtgtt atttttgccc tcccaacaca agctaccgcg aatgctatgc ttacgagaat ggaagcgagc gcgagccact tattttcatc cccaaatctt attcttgctc atggcaattc acggtttaac cacctctttc aatcaataaa atcacgcgcg attactgaac aggggcaaga agaagcgtgg 1200 gttcagtgtt gtcagtggtt gtcacaaagc aataagaaag tgtttcttgg gcaaatcggc 1260 gtttgcacga ttgatcaggt gttgatatcg gtattgccag ttaaacaccg ctttatccgt 1320 ggtttgggaa ttggtcgaag tgttttaatt gttgatgaag ttcatgctta cgacacctat 1380 atgaacggct tgctggaggc agtgctcaag gctcaggctg atgtgggagg gagtgttatt 1440 cttctttccg caaccctacc aatgaaacaa aaacagaaac ttctggatac ttatggtctg 1500 catacagatc cagtggaaaa taactccgca tatccactca ttaactggcg aggtgtgaat 1560 ggtgcgcaac gttttgatct gctagctcat ccagaacaac tcccgccccg cttttcgatt 1620 cagccagaac ctatttgttt agctgacatg ttacctgacc ttacgatgtt agagcgaatg 1680 atcgcagcgg caaacgcggg tgcacaggtc tgtcttattt gcaatttggt tgacgttgca 1740 caagtatgct accaacggct aaaggagcta aataacacgc aagtagatat agatttgttt 1800 catgcgcgct ttacgctgaa cgatcgtcgt gaaaaagaga atcgagttat tagcaatttc 1860 ggcaaaaatg ggagcgaa tgttggacgg atacttgtcg caacccaggt cgtggaca tcactcgacg ttgattttga ttggttaatt actcagcatt gtcctgcaga tttgcttttc caacgattgg gccgtttaca tcgccatcat cgcaaatatc gtcccgctgg ttttgagatt cctgttgcca ccattttgct gcctgatggc gagggttacg gacgacatga gcatatttat agcaacgtta gagtcatgtg gcggacgcag caacatattg aggagcttaa tggagcatcc ttatttttcc ctgatgctta ccggcaatgg ctggatagca tttacgatga tgcggaaatg 2280. gatgagccag aatgggtcgg caatggcatg gataaatttg aaagcgccga gtgtgaaaaa aggttcaagg ctcgcaaggt cctgcagtgg gctgaagaat atagcttgca ggataacgat gaaaccattc ttgcggtac gagggatggg gaatgagcc tgccattatt gccttatgta caaacgtctt caggtaaaca actgctcgat ggccaggtct acgaggacct aagtcatgaa cagcagtatg aggcgcttgc acttaatcgc gtcaatgtac ccttcacctg gaaacgtagt ttttctgaag tagtagtag agatgggtta ctttggctgg aagggaaaca gaatctggat ggatgggtct ggcagggtaa cagtattgtt attacctata caggggatga agggatgacc 2640 agagtcatcc ctgcaaatcc caaataa 2667 <210> 8 <211> 1509 <212> DNA <213> Escherichia coli <400> 8 atgaatttgc ttattgataa ctggatccct gtacgcccgc gaaacggggg gaaagtccaa 60 atcataaatc tgcaatcgct atactgcagt agagatcagt ggcgattaag tttgccccgt 120 gacgatatgg aactggccgc tttagcactg ctggtttgca ttgggcaaat tatcgccccg 180 gcaaaagatg acgttgaatt tcgacatcgc ataatgaatc cgctcactga agatgagttt 240 caacaactca tcgcgccgtg gatagatatg ttctacctta atcacgcaga acatcccttt 300 atgcagacca aaggtgtcaa agcaaatgat gtgactccaa tggaaaaact gttggctggg 360 gtaagcggcg cgacgaattg tgcatttgtc aatcaaccgg ggcagggtga agcattatgt 420 ggtggatgca ctgcgattgc gttattcaac caggcgaatc aggcaccagg ttttggtggt 480 ggttttaaaa gcggtttacg tggaggaaca cctgtaacaa cgttcgtacg tgggatcgat 540 cttcgttcaa cggtgttact caatgtcctc acattacctc gtcttcaaaa acaatttcct 600 aatgaatcac atacggaaaa ccaacctacc tggattaaac ctatcaagtc caatgagtct 660 atacctgctt cgtcaattgg gtttgtccgt ggtctattct ggcaaccagc gcatattgaa 720 ttatgcgatc cattgggat tggtaaatgt tcttgctgtg gacaggaaag caatttgcgt 780 tataccggtt ttcttaagga aaaatttacc tttacagtta atgggctatg gccccatccg 840 cattcccctt gtctggtaac agtcaagaaa ggggaggttg aggaaaaatt tcttgctttc 900 accacctccg caccatcatg gacacaaatc agccgagttg tggtagataa gattattcaa 960 aatgaaaatg gaaatcgcgt ggcggcggtt gtgaatcaat tcagaaatat tgcgccgcaa 1020 agtcctcttg aattgattat ggggggatat cgtaataatc aagcatctat tcttgaacgg 1080 cgtcatgatg tgttgatgtt taatcagggg tggcaacaat acggcaatgt gataaacgaa 1140 atagtgactg ttggtttggg atataaaaca gccttacgca aggcgttata tacctttgca 1200 gaagggttta aaaataaaga cttcaaaggg gccggagtct ctgttcatga gactgcagaa 1260 aggcatttct atcgacagag tgaattatta attcccgatg tactggcgaa tgttaatttt 1320 tcccaggctg atgaggtaat agctgattta cgagacaaac ttcatcaatt gtgtgaaatg 1380 ctatttaatc aatctgtagc tccctatgca catcatccta aattaataag cacattagcg 1440 cttgcccgcg ccacgctata caaacattta cgggagttaa aaccgcaagg agggccatca 1500 aatggctga 1509 <210> 9 <211> 483 <212> DNA <213> Escherichia coli <400> 9 atggctgatg aaattgatgc aatggcttta tatcgagcct ggcaacaact ggataatgga 60 tcatgtgcgc aaattagacg tgtttcagaa cctgatgaat tacgcgatat ccctgcgttt 120 tataggctgg tgcaaccttt tggttgggaa aacccacgtc accagcaggc tcttttgcgc 180 atggtgtttt gcctgagcgc aggaaagaat gtcatccgac atcaggacaa aaaatcggag 240 caaacaacag gtatctcgtt gggaagagct ttagccaata gtggaagaat taacgagcgc 300 cgtatctttc aattaattcg ggctgacaga acagccgata tggtccagtt acgtcgatta 360 cttactcacg ccgaacccgt acttgactgg ccattaatgg ccaggatgtt gacctggtgg 420 ggaaagcgcg aacgccagca acttctggaa gattttgtat tgaccacaaa caaaaatgcg 480 taa 483 <210> 10 <211> 675 <212> DNA <213> Escherichia coli <400> 10 atgagatctt atttgatctt gcggcttgct gggccaatgc aagcctgggg gcagccgacc 60 tttgaaggaa cgcgacctac cggaagattt ccgacccgaa gcgggttatt agggctactc 120 ggggcttgtc ttgggatcca acgtgatgat acttcttcat tacaggcgtt atcagagagt 180 gtgcaatttg cagtgcgctg cgatgaactc attcttgacg atcgtcgtgt gtctgtaacg 240 gggttgcgtg attaccatac agtccttgga gcgcgagaag attaccgtgg tttgaaaagt 300 catgaaacga ttcaaacatg gcgcgaatat ttatgtgatg cctcctttac cgtcgctctc 360 tggttaacac cccatgcaac gatggttatc tcagaacttg aaaaagcagt attaaagcct 420 cggtatacac cttacctggg gcggagaagt tgcccactaa cacacccgct ttttttgggg 480 acatgtcagg catcggatcc tcagaaggcg ctattaatt atgagcccgt tggcggcgat fathers aggaatcagt tacagggcat catttaaaat ttacggcgcg cgacgaaccg atgatcacct tgcctcgaca atttgcttcc cgagaatggt atgtgattaa aggaggtatg 660 gatgtatctc 675 <210> 11 <211> 600 <212> DNA <213> Escherichia coli (Escherichia coli) <400> 11 atgtatctca gtaaagtcat cattgccagg gcctggagca gggatcttta ccaacttcac cagggattat ggcatttatt tccaaacaga ccggatgctg ctcgtgattt tctttttcat gttgagaagc gaaacacacc agaaggctgt catgttttat tgcagtcagc gcaaatgcct gtttcaactg ccgttgcgac agtcattaaa actaacagg ttgaatttca acttcaggtt ggtgttccac tctattttcg gcttcgggca aatccgatca aaactattct cgacaatcaa aagcgcctgg acagtaaagg gaatattaaa cgctgtcggg ttccgttaat aaaagaagca gacaaatcg cgtggttgca acgtaaattg ggcaatgcgg cgcgcgttga agatgtgcat cccatatcgg aacggccaca gtatttttct ggtgatggta aaagtggaaa gatccaaacg 480 gtttgctttg aaggtgtgct caccatcaac gacgcgccag cgttaataga tcttgtacag 540 caaggtattg ggccagctaa atcgatggga tgtggcttgc tatctttggc tccactgtga 600 <210> 12 <211> 1092 <212> DNA <213> Escherichia coli <400> 12 atgtctaact ttatcaatat tcatgttctg atctctcaca gcccttcatg tctgaaccgc 60 gacgatatga acatgcagaa agacgctatt ttcggcggca aaagacgagt aagaatttca 120 agtcaaagcc ttaaacgtgc gatgcgtaaa agtggttatt acgcacaaaa tattggtgaa 180 tccagtctca gaaccattca tcttgcacaa ttacgtgatg ttcttcggca aaaacttggt 240 gaacgttttg accaaaaaat catcgataag acattagcgc tgctctccgg taaatcagtt 300 gatgaagccg aaaagatttc tgccgatgcg gttactccct gggttgtggg agaaatagcc 360 tggttctgtg agcaggttgc aaaagcagag gctgataatc tggatgataa aaagctgctc 420 aaagttctta aggaagatat tgccgccata cgtgtgaatt tacagcaggg tgttgatatt 480 gcgcttagtg gaagaatggc aaccagcggc atgatgactg agttgggaaa agttgatggt 540 gcaatgtcca ttgcgcatgc gatcactact catcaggttg attctgatat tgactggttc 600 accgctgtag atgatttaca ggaacaaggt tctgcacatc tgggaactca ggaattttca 660 tcgggtgttt tttatcgtta tgccaacatt aacctcgctc aacttcagga aaatttaggt 720 ggtgcctcca gggagcaggc tctggaaatt gcaacccatg ttgttcatat gctggcaaca 780 gaggtccctg gagcaaaaca gcgtacttat gccgcttta acctgcgga tatggtaatg 840 gttaatttct ccgatatgcc actttctatg gcaaatgctt ttgaaaaagc ggttaaagcg 900 aaagatggct ttttgcaacc gtctatacag gcgtttaatc aatattggga tcgcgttgcc 960 aatggatatg gtctgaacgg agctgctgcg caattcagct tatctgatgt agacccaatt 1020 actgctcaag ttaaacaaat gcctacttta gaacagttaa aatcctgggt tcgtaataat 1080 ggcgaggcgt ga 1092 <210> 13 <211> 7 <212> PRT <213> Artificial sequence <220> <223> NLS <400> 13 Pro Lys Lys Lys Arg Lys Val 1 5 <210> 14 <211> 19 <212> PRT <213> Artificial sequence <220> <223> bpNLS <400> 14 Lys Arg Thr Ala Asp Gly Ser Glu Phe Glu Ser Pro Lys Lys Lys Arg 1 5 10 15 Lys Val Glu <210> 15 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Target DNA (hEMX1) <220> <221> protein_bind <222> (16) (18) <223> Different PAM sequences <220> <221> misc_feature <222> (16) (18) <223> n is a, c, g, or t <400> 15 tggcgcattg ccacgnnnca ggccaatggg gaggacatcg atgtcacctc caatgactag 60 <210> 16 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Target DNA (mTyr) <220> <221> protein_bind <222> (16) (18) <223> Different PAM sequences <220> <221> misc_feature <222> (16) (18) <223> n is a, c, g, or t <400> 16 gcattactat gtgtcnnngg acacactgct tgggggctct gaaatatgga gggacattga 60 <210> 17 <211> 16 <212> DNA <213> Artificial sequence <220> <223> Taqman probe sequence <400> 17 gtcaacggat ttggtc 16 <210> 18 <211> 35 <212> DNA <213> Coronavirus <400> 18 aaggccaaac tgtcactaag aaatctgctg ctgag 35 <210> 19 <211> 35 <212> DNA <213> Coronavirus <400> 19 aaggaactga ttacaaacat tggccgcaaa ttgca 35 <210> 20 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N1-FIP" <400> 20 gttggccttt accagacatt ttggtgatgc tgctcttgct t 41 <210> twenty one <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N1-BIP" <400> twenty one tgctgaggct tctaagaagc cagcttgtgt tacattgtat gc 42 <210> twenty two <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N1-F3" <400> twenty two acttctcctg ctagaatgg 19 <210> twenty three <211> 18 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N1-B3" <400> twenty three gtttgttctg gaccacgt 18 <210> twenty four <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N1-LF" <400> twenty four ttcaatctgt caagcagcag ca 22 <210> 25 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N1-LB" <400> 25 ggcaaaaacg tactgccact a 21 <210> 26 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N2-FIP" <400> 26 tctgattagt tcctggtccc caaagcatac aatgtaacac aagc 44 <210> 27 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N2-BIP" <400> 27 cgcattggca tggaagtcac tttgatggca cctgtgtag 39 <210> 28 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N2-F3" <400> 28 gcaaaaacgt actgccac 18 <210> 29 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N2-B3" <400> 29 gaaatttgga tctttgtcat cc 22 <210> 30 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N2-LF" <400> 30 tggaccacgt ctgccga 17 <210> 31 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Primer "SARS-N2-LB" <400> 31 accttcggga acgtggtt 18 <210> 32 <211> 16 <212> DNA <213> Artificial sequence <220> <223> Probe sequences for lateral flow detection <400> 32 gtcaacggat ttggtc 16 <210> 33 <211> 32 <212> DNA <213> Artificial sequence <220> <223> crRNA "H1N1-Cascade-I38" <400> 33 tgcagcaaac ttattagttt caattttggg gt 32 <210> 34 <211> 32 <212> DNA <213> Artificial sequence <220> <223> crRNA "H3N2-Cascade-I38" <400> 34 tgcactcact tggaggtgtg tttcatgtat tc 32 <210> 35 <211> 32 <212> DNA <213> Artificial sequence <220> <223> crRNA "H1N1-Cascade-I222" <400> 35 attgagaaca caagagtctg aatgtgcatg tg 32 <210> 36 <211> 32 <212> DNA <213> Artificial sequence <220> <223> crRNA "H1N1-Cascade-H274" <400> 36 taattagggg ctttcatttc gactgatttg at 32 <210> 37 <211> 32 <212> DNA <213> Artificial sequence <220> <223> crRNA "H3N2-Cascade-N294" <400> 37 ctgtctctgc agacacatct gacaccagga ta 32 <210> 38 <211> 80 <212> DNA <213> Influenza A virus <400> 38 gggaagaccc caaaattgaa actaataagt ttgctgcaat ttgcacacat ttggaagttt 60 gtttcatgta ttcggatttc 80 <210> 39 <211> 80 <212> DNA <213> Influenza A virus <400> 39 gggaagaccc caaaattgaa actaataagt ttgctgcaac ttgcacacat ttggaagttt 60 gtttcatgta ttcggatttc 80 <210> 40 <211> 80 <212> DNA <213> Influenza A virus <400> 40 ggggaggatc tgaaaattga aaccaacaaa tttgcagcaa tatgcactca cttggaggtg 60 tgtttcatgt attcagattt 80 <210> 41 <211> 80 <212> DNA <213> Influenza A virus <400> 41 ggggaggatc tgaaaattga aaccaacaaa tttgcagcaa catgcactca cttggaggtg 60 tgtttcatgt attcagattt 80 <210> 42 <211> 80 <212> DNA <213> Influenza A virus <400> 42 ggcataataa cagacactat caagagttgg aggaacaata tattgagaac acaagagtct 60 gaatgtgcat gtgtaaatgg 80 <210> 43 <211> 80 <212> DNA <213> Influenza A virus <400> 43 ggcataataa cagacactat caagagttgg aggaacaata gattgagaac acaagagtct 60 gaatgtgcat gtgtaaatgg 80 <210> 44 <211> 80 <212> DNA <213> Influenza A virus <400> 44 aaagataatc aaatcagtcg aaatgaaagc ccctaattat cactatgagg aatgctcctg 60 ttaccctgat tctagtgaaa 80 <210> 45 <211> 80 <212> DNA <213> Influenza A virus <400> 45 aaagataatc aaatcagtcg aaatgaaagc ccctaattat tactatgagg aatgctcctg 60 ttaccctgat tctagtgaaa 80 <210> 46 <211> 80 <212> DNA <213> Influenza A virus <400> 46 tatcctcgat atcctggtgt cagatgtgtc tgcagagaca actggaaagg atccaaccgg 60 cccatcatag atataaacat 80 <210> 47 <211> 80 <212> DNA <213> Influenza A virus <400> 47 tatcctcgat atcctggtgt cagatgtgtc tgcagagaca gctggaaagg atccaaccgg 60 cccatcatag atataaacat 80
Claims
1. A method of detecting a specific DNA in a test sample, which is not directly aimed at diagnosis, the method comprising: (a) a process of bringing the test sample into contact with a CRISPR-Cas3 system targeting the specific DNA and a single-stranded probe DNA, and (b) a process of detecting cleavage of the single-stranded probe DNA by the CRISPR-Cas3 system, which occurs in the presence of the specific DNA in the test sample.
2. A kit for detecting a specific DNA in a test sample by the method of claim 1, the kit comprising: (a) a CRISPR-Cas3 system targeting the specific DNA, and (b) a single-stranded probe DNA, the single-stranded probe DNA being a single-stranded probe DNA whose cleavage is detectable, and the target DNA in the test sample being able to be detected with the signal generated by cleavage of the single-stranded probe DNA as an index.
3. A method of detecting a specific DNA in a test sample, which is not directly aimed at diagnosis, the method comprising: (a) a process of bringing the test sample into contact with a CRISPR-Cas3 system targeting the specific DNA and a single-stranded probe DNA, and (b) a process of detecting cleavage of the single-stranded probe DNA by the CRISPR-Cas3 system, which occurs in the presence of the specific DNA in the test sample.
4. A kit for detecting a specific DNA in a test sample by the method of claim 3, the kit comprising: (a) a CRISPR-Cas3 system targeting the specific DNA, and (b) a single-stranded probe DNA, the single-stranded probe DNA being a single-stranded probe DNA whose cleavage is detectable, and the target DNA in the test sample being able to be detected with the signal generated by cleavage of the single-stranded probe DNA as an index.
5. A method of detecting a specific DNA in a test sample, which is not directly aimed at diagnosis, the method comprising: (a)
Citation Information
Patent Citations
Image processing apparatus, information processing method, and program
JP2020010216A
Image processing device, image processing system, and image processing program
JP2020086698A
Method for manufacturing dna-edited eukaryotic cell, and kit used in method
WO2018225858A1
Type v crispr / CAS effector proteins for cleaving ssdnas and detecting target dnas
WO2019104058A1
Methods for in vitro site-directed mutagenesis using gene editing technologies
US20190359973A1