Variants of inner membrane proteins and methods for producing target products by using the variants

Abstract

The present disclosure relates to variants of YjeH as an inner membrane protein, microorganisms comprising the same, and methods of producing target products using the same.

Description

[Technical field]

[0001] The present disclosure relates to variants of YjeH as an inner membrane protein, and methods of producing target products using the variants. [Background Technology]

[0002] O-acetylhomoserine serves as a precursor of methionine, which is one of the essential amino acids in the human body. It is known that homoserine, which is a precursor of methionine and threonine, is converted into threonine via phosphohomoserine and into methionine via acetylhomoserine.

[0003] Methionine is used not only as an additive for feed and food, but also as a raw material for infusion solutions and medicines, and is produced by chemical and biosynthesis. A two-step method for producing L-methionine (which is produced by fermentation) from an L-methionine precursor via enzymatic conversion is disclosed (International Publication No. WO2008 / 013432).

[0004] In the two-step method, O-succinyl homoserine and O-acetyl homoserine are used as methionine precursors, and for the purpose of economical large-scale production, it is very important to produce O-acetyl homoserine in high yield.

[0005] [public]

[0006] [Technical issues]

[0007] As a result of extensive efforts to increase the production of O-acetyl homoserine or homoserine, the inventors of the present application have discovered variants of inner membrane proteins having enhanced O-acetyl homoserine or homoserine export activity, thereby completing the present disclosure.

[0008] [Technical solution]

[0009] The present disclosure provides a variant of YjeH as an inner membrane protein, which has a homology of more than 95% and less than 100% with SEQ ID NO:1 and comprises: i) replacing the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) replacing the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii).

[0010] The present disclosure provides polynucleotides encoding the variants.

[0011] The present disclosure provides a vector comprising the polynucleotide.

[0012] The present disclosure provides a microorganism comprising at least any one of the following: a variant of the inner membrane protein YjeH, the variant having more than 95% and less than 100% homology with SEQ ID NO:1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0013] The present disclosure provides a method for producing a target product, the method comprising culturing a microorganism in a culture medium, wherein the microorganism comprises at least any one of the following: a variant of the inner membrane protein YjeH, the variant having more than 95% and less than 100% homology with SEQ ID NO:1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0014] The present disclosure provides a method for producing methionine, the method comprising: producing O-acetyl homoserine by culturing a microorganism in a culture medium; and converting O-acetyl homoserine into methionine by reacting O-acetyl homoserine with sulfide, wherein the microorganism comprises at least any one of the following: a variant of inner membrane protein YjeH, the variant having a homology of more than 95% and less than 100% with SEQ ID NO: 1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0015] The present disclosure provides a method for producing glufosinate, the method comprising: producing O-acetyl homoserine or homoserine by culturing a microorganism in a culture medium; and converting the O-acetyl homoserine or homoserine into glufosinate, wherein the microorganism comprises at least any one of the following: a variant of inner membrane protein YjeH, the variant having more than 95% and less than 100% homology with SEQ ID NO:1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0016] The present disclosure provides a composition for producing homoserine, comprising a microorganism or a culture of a microorganism.

[0017] The present disclosure provides a composition for producing O-acetyl homoserine, comprising a microorganism or a culture of a microorganism.

[0018] The present disclosure provides use of a variant of inner membrane protein YjeH for producing O-acetyl homoserine or homoserine.

[0019] The present disclosure provides use of a microorganism for producing O-acetyl homoserine or homoserine.

[0020] [Beneficial Effects]

[0021] O-acetyl homoserine or homoserine can be produced at a higher yield compared to unmodified protein by culturing a microorganism having the ability to produce O-acetyl homoserine or homoserine modified using a variant of YjeH as an inner membrane protein according to the present disclosure. <110> CJ CheilJedang Corporation <120> Variants of inner membrane proteins and methods for producing target products by using the variants <130> OPA20205 <150> KR 10-2019-0172055 <151> 2019-12-20 <160> 37 <170> KoPatentIn 3.0 <210> 1 <211> 418 <212> PRT <213> Unknown <220> <223> Escherichia coli YjeH <400> 1 Met Ser Gly Leu Lys Gln Glu Leu Gly Leu Ala Gln Gly Ile Gly Leu 1 5 10 15 Leu Ser Thr Ser Leu Leu Gly Thr Gly Val Phe Ala Val Pro Ala Leu 20 25 30 Ala Ala Leu Val Ala Gly Asn Asn Ser Leu Trp Ala Trp Pro Val Leu 35 40 45 Ile Ile Leu Val Phe Pro Ile Ala Ile Val Phe Ala Ile Leu Gly Arg 50 55 60 His Tyr Pro Ser Ala Gly Gly Val Ala His Phe Val Gly Met Ala Phe 65 70 75 80 Gly Ser Arg Leu Glu Arg Val Thr Gly Trp Leu Phe Leu Ser Val Ile 85 90 95 Pro Val Gly Leu Pro Ala Ala Leu Gln Ile Ala Ala Gly Phe Gly Gln 100 105 110 Ala Met Phe Gly Trp His Ser Trp Gln Leu Leu Leu Ala Glu Leu Gly 115 120 125 Thr Leu Ala Leu Val Trp Tyr Ile Gly Thr Arg Gly Ala Ser Ser Ser 130 135 140 Ala Asn Leu Gln Thr Val Ile Ala Gly Leu Ile Val Ala Leu Ile Val 145 150 155 160 Ala Ile Trp Trp Ala Gly Asp Ile Lys Pro Ala Asn Ile Pro Phe Pro 165 170 175 Ala Pro Gly Asn Ile Glu Leu Thr Gly Leu Phe Ala Ala Leu Ser Val 180 185 190 Met Phe Trp Cys Phe Val Gly Leu Glu Ala Phe Ala His Leu Ala Ser 195 200 205 Glu Phe Lys Asn Pro Glu Arg Asp Phe Pro Arg Ala Leu Met Ile Gly 210 215 220 Leu Leu Leu Ala Gly Leu Val Tyr Trp Gly Cys Thr Val Val Val Leu 225 230 235 240 His Phe Asp Ala Tyr Gly Glu Lys Met Ala Ala Ala Ala Ser Leu Pro 245 250 255 Lys Ile Val Val Gln Leu Phe Gly Val Gly Ala Leu Trp Ile Ala Cys 260 265 270 Val Ile Gly Tyr Leu Ala Cys Phe Ala Ser Leu Asn Ile Tyr Ile Gln 275 280 285 Ser Phe Ala Arg Leu Val Trp Ser Gln Ala Gln His Asn Pro Asp His 290 295 300 Tyr Leu Ala Arg Leu Ser Ser Arg His Ile Pro Asn Asn Ala Leu Asn 305 310 315 320 Ala Val Leu Gly Cys Cys Val Val Ser Thr Leu Val Ile His Ala Leu 325 330 335 Glu Ile Asn Leu Asp Ala Leu Ile Ile Tyr Ala Asn Gly Ile Phe Ile 340 345 350 Met Ile Tyr Leu Leu Cys Met Leu Ala Gly Cys Lys Leu Leu Gln Gly 355 360 365 Arg Tyr Arg Leu Leu Ala Val Val Gly Gly Leu Leu Cys Val Leu Leu 370 375 380 Leu Ala Met Val Gly Trp Lys Ser Leu Tyr Ala Leu Ile Met Leu Ala 385 390 395 400 Gly Leu Trp Leu Leu Leu Pro Lys Arg Lys Thr Pro Glu Asn Gly Ile 405 410 415 Thr Thr <210> 2 <211> 1257 <212> DNA <213> Unknown <220> <223> Escherichia coli yjeH <400> 2 atgagtggac tcaaacaaga actggggctg gcccagggca ttggcctgct atcgacgtca 60 ttattaggca ctggcgtgtt tgccgttcct gcgttagctg cgctggtagc gggcaataac 120 agcctgtggg cgtggcccgt tttgattatc ttagtgttcc cgattgcgat tgtgtttgcg 180 attctgggtc gccactatcc cagcgcaggc ggcgtcgcgc acttcgtcgg tatggcgttt 240 ggttcgcggc ttgagcgagt caccggctgg ctgtttttat cggtcattcc cgtgggtttg 300 cctgccgcac tacaaattgc cgccgggttc ggccaggcga tgtttggctg ccatagctgg 360 caactgttgt tggcagaact cggtacgctg gcgctggtgt ggtatatcgg tactcgcggt 420 gccagttcca gtgctaatct acaaaccgtt attgccggac ttatcgtcgc gctgattgtc 480 gctatctggt gggcgggcga tatcaaacct gcgaatatcc cctttccggc acctggtaat 540 atcgaactta ccgggttatt tgctgcgtta tcagtgatgt tctggtgttt tgtcggtctg 600 gaggcatttg cccatctcgc ctcggaattt aaaaatccag agcgtgattt tcctcgtgct 660 ttgatgattg gtctgctgct ggcaggatta gtctactggg gctgtacggt agtcgtctta 720 cacttgacg cctatggtga aaaaatggcg gcggcagcat cgcttccaaa aattgtagtg 780 cagttgttcg gtgtaggagc gttatggatt gcctgcgtga ttggctatct ggcctgcttt 840 gccagtctca acatttatat acagagcttc gcccgcctgg tctggtcgca ggcgcaacat 900 aatcctgacc actacctggc acgcctctct tctcgccata tcccgaataa tgccctcaat 960 gcggtgctcg gctgctgtgt ggtgagcact ttggtgattc atgctttaga gatcaatctg 1020 gacgctctta ttatttatgc caatggcatc tttattatga tttatctgtt atgcatgctg 1080 gcaggctgta aattattgca aggacgttat cgactactgg cggtggttgg cgggctgtta 1140 tgcgttctgt tactggcaat ggtcggctgg aaaagtctct atgcgctgat catgctggcg 1200 gggttatggc tgttgctgcc aaaacgaaaa acgccggaaa atggcataac cacataa 1257 <210> 3 <211> 267 <212> DNA <213> Artificial Sequence <220> <223> Tn2335 <400> 3 gtggcctaca ccttcgacca cgtcgtcgcc tggcgctggt gcaccaaaga agacgcctac 60 aactacaccc acctcttcga tcaactccaa ccacccttaa tcgtgaccac cgacggacaa 120 aaaaggcgca ctcaaagcca tcaccacgac ctggccgaca acgaaaatcc aacgctgcct 180 cgtccacgtc aaacgcaacg tccaaaaaca cgtcacccta agacccgtgc tgagctcgcc 240 gaaaagcact ccggggtctc tccttga 267 <210> 4 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Tn_5 F <400> 4 tgaattcgag ctcggtaccc caccgacgcg catctgcct 39 <210> 5 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Tn_5 R <400> 5 ggtgtggtga ctttcagcag ttcccggggg ggaggaggca tgtggtgttg 50 <210> 6 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Tn_3 F <400> 6 caacaccaca tgcctcctcc cccccgggaa ctgctgaaag tcaccacacc 50 <210> 7 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Tn_3 R <400> 7 gtcgactcta gaggatcccc ctcccaaacc attgaggaat gg 42 <210> 8 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> CJ7 <400> 8 agaaacatcc cagcgctact aatagggagc gttgaccttc cttccacgga ccggtaatcg 60 gagtgcctaa aaccgcatgc ggcttaggct ccaagatagg ttctgcgcgg ccgggtaatg 120 catcttcttt agcaacaagt tgaggggtag gtgcaaataa gaacgacata gaaatcgtct 180 cctttctgtt tttaatcaac atacaccacc acctaaaaat tccccgacca gcaagttcac 240 agtattcggg cacaatatcg ttgccaaaat attgtttcgg aatatcatgg gatacgtacc 300 caacgaaagg aaacactc 318 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CJ7_yjeH F <400> 9 acaccacatg cctcctcccc agaaacatcc cagcgctac 39 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> CJ7_yjeH R <400> 10 agttcttgtt tgagtccact catagtgttt cctttcgttg ggt 43 <210> 11 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> yj <400> 11 acccaacgaa aggaaacact atgagtggac tcaaacaaga actg 44 <210> 12 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> yjR <400> 12 gactttcagc agttcccggg ttatgtggtt atgccatttt ccgg 44 <210> 13 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> F92N F <400> 13 cggctggctg aatttatcgg tca 23 <210> 14 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> F92N R <400> 14 tgaccgataa attcagccag ccg 23 <210> 15 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> F351L F <400> 15 caatggcatc cttattatga ttt 23 <210> 16 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> F351L R <400> 16 aaatcataat aaggatgcca ttg 23 <210> 17 <211> 1161 <212> DNA <213> Unknown <220> <223> Corynebacterium glutamicum metB <400> 17 ttgtcttttg acccaaacac ccagggtttc tccactgcat cgattcacgc tgggtatgag 60 ccagacgact actacggttc gattaacacc ccaatctatg cctccaccac cttcgcgcag 120 aacgctccaa acgaactgcg caaaggctac gagtacaccc gtgtgggcaa ccccaccatc 180 gtggcattag agcagaccgt cgcagcactc gaaggcgcaa agtatggccg cgcattctcc 240 tccggcatgg ctgcaaccga catcctgttc cgcatcatcc tcaagccggg cgatcacatc 300 gtcctcggca acgatgctta cggcggaacc taccgcctga tcgacaccgt attcaccgca 360 tggggcgtcg aatacaccgt tgttgatacc tccgtcgtgg aagaggtcaa ggcagcgatc 420 areacaaca ccaagctgat ctgggtggaa accccaacca acccagcact tggcatcacc 480 gacatcgaag cagtagcaaa gctcaccgaa ggcaccaacg ccaagctggt tgttgacaac 540 accttcgcat ccccatacct gcagcagcca ctaaaactcg gcgcacacgc agtcctgcac 600 tccaccacca agtacatcgg aggacactcc gacgttgttg gcggccttgt ggttaccaac 660 gaccagaaa tggacgaaga actgctgttc atgcagggcg gcatcggacc gatcccatca 720 gttttcgatg catacctgac cgcccgtggc ctcaagaccc ttgcagtgcg catggatcgc 780 cactgcgaca acgcagaaaa gatcgcggaa ttcctggact cccgcccaga ggtctccacc 840 gtgctctacc caggtctgaa gaaccaccca ggccacgaag tcgcagcgaa ccagatgaag 900 cgcttcggcg gcatgatctc cgtccgtttc gcaggcggcg aagaagcagc taagaagttc 960 tgtacctcca ccaaactgat ctgtctggcc gagtccctcg gtggcgtgga atccctcctg 1020 gagcacccag caaccatgac ccaccagtca gctgccggct ctcagctcga ggttccccgc 1080 gacctcgtgc gcatctccat tggtattgaa gacattgaag acctgctcgc agatgtcgag 1140 caggccctca ataaccttta g 1161 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> metB_N_del F <400> 18 tctagacgcc cgcatactgg cttc 24 <210> 19 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> metB_N_del R <400> 19 cccatccact aaacttaaac agatgtgatc gcccggc 37 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> metB_C_del F <400> 20 tgtttaagtt tagtggatgg ggaagaacca cccaggcc 38 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> metB_C_del R <400> 21 gtcgaccaat cgtccagagg gcg 23 <210> 22 <211> 1314 <212> DNA <213> Artificial Sequence <220> <223> Corynebacterium glutamicum metY <400> 22 atgccaaagt acgacaattc caatgctgac cagtggggct ttgaaacccg ctccattcac 60 gcaggccagt cagtagacgc acagaccagc gcacgaaacc ttccgatcta ccaatccacc 120 gctttcgtgt tcgactccgc tgagcacgcc aagcagcgtt tcgcacttga ggatctaggc 180 cctgtttact cccgcctcac caacccaacc gttgaggctt tggaaaaccg catcgcttcc 240 ctcgaaggtg gcgtccacgc tgtagcgttc tcctccggac aggccgcaac caccaacgcc 300 attttgaacc tggcaggagc gggcgaccac atcgtcacct ccccacgcct ctacggtggc 360 accgagactc tattccttat cactcttaac cgcctgggta tcgatgtttc cttcgtggaa 420 aaccccgacg accctgagtc ctggcaggca gccgttcagc caaacaccaa agcattcttc 480 ggcgagactt tcgccaaccc acaggcagac gtcctggata ttcctgcggt ggctgaagtt 540 gcgcaccgca acagcgttcc actgatcatc gacaacacca tcgctaccgc agcgctcgtg 600 cgcccgctcg agctcggcgc agacgttgtc gtcgcttccc tcaccaagtt ctacaccggc 660 aacggctccg gactgggcgg cgtgcttatc gacggcggaa agttcgattg gactgtcgaa 720 aaggatggaa agccagtatt cccctacttc gtcactccag atgctgctta ccacggattg 780 aagtacgcag accttggtgc accagccttc ggcctcaagg ttcgcgttgg ccttctacgc 840 gacaccggct ccaccctctc cgcattcaac gcatgggctg cagtccaggg catcgacacc 900 ctttccctgc gcctggagcg ccacaacgaa aacgccatca aggttgcaga attcctcaac 960 aaccacgaga aggtggaaaa ggttaacttc gcaggcctga aggattcccc ttggtacgca 1020 accaaggaaa agcttggcct gaagtacacc ggctccgttc tcaccttcga gatcaagggc 1080 ggcaaggatg aggcttgggc atttatcgac gccctgaagc tacactccaa ccttgcaaac 1140 atcggcgatg ttcgctccct cgttgttcac ccagcaacca ccacccattc acagtccgac 1200 gaagctggcc tggcacgcgc gggcgttacc cagtccaccg tccgcctgtc cgttggcatc 1260 gagaccattg atgatatcat cgctgacctc gaaggcggct ttgctgcaat ctag 1314 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> metY_N_del F <400> 23 tctagaccat cctgcaccat ttag 24 <210> 24 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> metY_N_del R <400> 24 cccatccact aaacttaaac acgctcctgc caggttc 37 <210> 25 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> metY_C_del F <400> 25 tgtttaagtt tagtggatgg gcttggtacg caaccaagg 39 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> metY_C_del R <400> 26 gtcgacgatt gctccggctt cgg 23 <210> 27 <211> 1266 <212> DNA <213> Unknown <220> <223> Corynebacterium glutamicum lysC <400> 27 gtggccctgg tcgtacagaa atatggcggt tcctcgcttg agagtgcgga acgcattaga 60 aacgtcgctg aacggatcgt tgccaccaag aaggctggaa atgatgtcgt ggttgtctgc 120 tccgcaatgg gagacaccac ggatgaactt ctagaacttg cagcggcagt gaatcccgtt 180 ccgccagctc gtgaaatgga tatgctcctg actgctggtg agcgtatttc taacgctctc 240 gtcgccatgg ctattgagtc ccttggcgca gaagcccaat ctttcacggg ctctcaggct 300 ggtgtgctca ccaccgagcg ccacggaaac gcacgcattg ttgatgtcac tccaggtcgt 360 gtgcgtgaag cactcgatga gggcaagatc tgcattgttg ctggtttcca gggtgttaat 420 aaagaaaccc gcgatgtcac cacgttgggt cgtggtggtt ctgacaccac tgcagttgcg 480 ttggcagctg ctttgaacgc tgatgtgtgt gagatttact cggacgttga cggtgtgtat 540 accgctgacc cgcgcatcgt tcctaatgca cagaagctgg aaaagctcag cttcgaagaa 600 atgctgggaac ttgctgctgt tggctccaag attttggtgc tgcgcagtgt tgaatacgct 660 cgtgcattca atgtgccact tcgcgtacgc tcgtcttata gtaatgatcc cggcactttg 720 attgccggct ctatggagga tattcctgtg gaaagcag tccttaccgg tgtcgcaacc 780 gacaagtccg aagccaaagt aaccgttctg ggtatttccg ataagccagg cgaggctgcg 840 aaggttttcc gtgcgttggc tgatgcagaa atcaacattg acatggttct gcagaacgtc 900 tcttctgtag aagacggcac caccgacatc accttcacct gccctcgttc cgacggccgc 960 cgcgcgatgg agatcttgaa gaagcttcag gttcagggca actggaccaa tgtgctttac 1020 gacgaccagg tcggcaaagt ctccctcgtg ggtgctggca tgaagtctca cccaggtgtt 1080 accgcagagt tcatggaagc tctgcgcgat gtcaacgtga acatcgaatt gatttccacc tctgagattc gtatttccgt gctgatccgt gaagatgatc tggatgctgc tgcacgtgca ttgcatgagc agttccagct gggcggcgaa gacgaagccg tcgtttatgc aggcaccgga cgctaa <210> 28 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> lightC_L377K_5F <400> 28 tcctctagag ctgcgcagtg ttgaatacg <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> lightC_L377K_5 R <400> 29 aggtggaat cttttcgatg ttc <210> 30 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> lightC_L377K_3 F <400> 30 gacatcga aagatttcca cct <210> 31 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> lysC_L377K_3 R <400> 31 gactctagag ttcacctcag agacgatta 29 <210> 32 <211> 1134 <212> DNA <213> Artificial Sequence <220> <223> Corynebacterium glutamicum metX <400> 32 atgcccaccc tcgcgccttc aggtcaactt gaaatccaag cgatcggtga tgtctccacc 60 gaagccggag caatcattac aaacgctgaa atcgcctatc accgctgggg tgaataccgc 120 gtagataaag aaggacgcag caatgtcgtt ctcatcgaac acgccctcac tggagattcc 180 aacgcagccg attggtgggc tgacttgctc ggtcccggca aagccatcaa cactgatatt 240 tactgcgtga tctgtaccaa cgtcatcggt ggttgcaacg gttccaccgg acctggctcc 300 atgcatccag atggaaattt ctggggtaat cgcttccccg ccacgtccat tcgtgatcag 360 gtaaacgccg aaaaacaatt cctcgacgca ctcggcatca ccacggtcgc cgcagtactt 420 ggtggttcca tgggtggtgc ccgcacccta gagtgggccg caatgtaccc agaaactgtt 480 ggcgcagctg ctgttcttgc agtttctgca cgcgccagcg cctggcaaat cggcattcaa 540 tccgcccaaa ttaaggcgat tgaaaacgac caccactggc acgaaggcaa ctactacgaa 600 tccggctgca acccagccac cggactcggc gccgcccgac gcatcgccca cctcacctac 660 cgtggcgaac tagaaatcga cgaacgcttc ggcaccaaag cccaaaagaa cgaaaaccca 720 ctcggtccct accgcaagcc cgaccagcgc ttcgccgtgg aatcctactt ggactaccaa 780 gcagacaagc tagtacagcg tttcgacgcc ggctcctacg tcttgctcac cgacgccctc 840 aaccgccacg acattggtcg cgaccgcgga ggcctcaaca aggcactcga atccatcaaa 900 gttccagtcc ttgtcgcagg cgtagatacc gatattttgt acccctacca ccagcaagaa 960 cacctctcca gaaacctggg aaatctactg gcaatggcaa aaatcgtatc ccctgtcggc 1020 cacgatgctt tcctcaccga aagccgccaa atggatcgca tcgtgaggaa cttcttcagc 1080 ctcatctccc cagacgaaga caacccttcg acctacatcg agttctacat ctaa 1134 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> metX F <400> 33 ggatcccctc gttgttcacc cagcaacc 28 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> metX R <400> 34 ggatcccaaa gtcacaacta cttatgttag 30 <210> 35 <211> 418 <212> PRT <213> Artificial Sequence <220> <223> YjeH F92N <400> 35 Met Ser Gly Leu Lys Gln Glu Leu Gly Leu Ala Gln Gly Ile Gly Leu 1 5 10 15 Leu Ser Thr Ser Leu Leu Gly Thr Gly Val Phe Ala Val Pro Ala Leu 20 25 30 Ala Ala Leu Val Ala Gly Asn Asn Ser Leu Trp Ala Trp Pro Val Leu 35 40 45 Ile Ile Leu Val Phe Pro Ile Ala Ile Val Phe Ala Ile Leu Gly Arg 50 55 60 His Tyr Pro Ser Ala Gly Gly Val Ala His Phe Val Gly Met Ala Phe 65 70 75 80 Gly Ser Arg Leu Glu Arg Val Thr Gly Trp Leu Asn Leu Ser Val Ile 85 90 95 Pro Val Gly Leu Pro Ala Ala Leu Gln Ile Ala Ala Gly Phe Gly Gln 100 105 110 Ala Met Phe Gly Trp His Ser Trp Gln Leu Leu Leu Ala Glu Leu Gly 115 120 125 Thr Leu Ala Leu Val Trp Tyr Ile Gly Thr Arg Gly Ala Ser Ser Ser 130 135 140 Ala Asn Leu Gln Thr Val Ile Ala Gly Leu Ile Val Ala Leu Ile Val 145 150 155 160 Ala Ile Trp Trp Ala Gly Asp Ile Lys Pro Ala Asn Ile Pro Phe Pro 165 170 175 Ala Pro Gly Asn Ile Glu Leu Thr Gly Leu Phe Ala Ala Leu Ser Val 180 185 190 Met Phe Trp Cys Phe Val Gly Leu Glu Ala Phe Ala His Leu Ala Ser 195 200 205 Glu Phe Lys Asn Pro Glu Arg Asp Phe Pro Arg Ala Leu Met Ile Gly 210 215 220 Leu Leu Leu Ala Gly Leu Val Tyr Trp Gly Cys Thr Val Val Val Leu 225 230 235 240 His Phe Asp Ala Tyr Gly Glu Lys Met Ala Ala Ala Ala Ser Leu Pro 245 250 255 Lys Ile Val Val Gln Leu Phe Gly Val Gly Ala Leu Trp Ile Ala Cys 260 265 270 Val Ile Gly Tyr Leu Ala Cys Phe Ala Ser Leu Asn Ile Tyr Ile Gln 275 280 285 Ser Phe Ala Arg Leu Val Trp Ser Gln Ala Gln His Asn Pro Asp His 290 295 300 Tyr Leu Ala Arg Leu Ser Ser Arg His Ile Pro Asn Asn Ala Leu Asn 305 310 315 320 Ala Val Leu Gly Cys Cys Val Val Ser Thr Leu Val Ile His Ala Leu 325 330 335 Glu Ile Asn Leu Asp Ala Leu Ile Ile Tyr Ala Asn Gly Ile Phe Ile 340 345 350 Met Ile Tyr Leu Leu Cys Met Leu Ala Gly Cys Lys Leu Leu Gln Gly 355 360 365 Arg Tyr Arg Leu Leu Ala Val Val Gly Gly Leu Leu Cys Val Leu Leu 370 375 380 Leu Ala Met Val Gly Trp Lys Ser Leu Tyr Ala Leu Ile Met Leu Ala 385 390 395 400 Gly Leu Trp Leu Leu Leu Pro Lys Arg Lys Thr Pro Glu Asn Gly Ile 405 410 415 Thursday Thursday <210> 36 <211> 418 <212> PRT <213> Artificial Sequence <220> <223> YjeH F351L <400> 36 Met Ser Gly Leu Lys Gln Glu Leu Gly Leu Ala Gln Gly Ile Gly Leu 1 5 10 15 Leu Ser Thr Ser Leu Leu Gly Thr Gly Val Phe Ala Val Pro Ala Leu 20 25 30 Ala Ala Leu Val Ala Gly Asn Asn Ser Leu Trp Ala Trp Pro Val Leu 35 40 45 Ile Ile Leu Val Phe Pro Ile Ala Ile Val Phe Ala Ile Leu Gly Arg 50 55 60 His Tyr Pro Ser Ala Gly Gly Val Ala His Phe Val Gly Met Ala Phe 65 70 75 80 Gly Ser Arg Leu Glu Arg Val Thr Gly Trp Leu Phe Leu Ser Val Ile 85 90 95 Pro Val Gly Leu Pro Ala Ala Leu Gln Ile Ala Ala Gly Phe Gly Gln 100 105 110 Ala Met Phe Gly Trp His Ser Trp Gln Leu Leu Leu Ala Glu Leu Gly 115 120 125 Thr Leu Ala Leu Val Trp Tyr Ile Gly Thr Arg Gly Ala Ser Ser Ser 130 135 140 Ala Asn Leu Gln Thr Val Ile Ala Gly Leu Ile Val Ala Leu Ile Val 145 150 155 160 Ala Ile Trp Trp Ala Gly Asp Ile Lys Pro Ala Asn Ile Pro Phe Pro 165 170 175 Ala Pro Gly Asn Ile Glu Leu Thr Gly Leu Phe Ala Ala Leu Ser Val 180 185 190 Met Phe Trp Cys Phe Val Gly Leu Glu Ala Phe Ala His Leu Ala Ser 195 200 205 Glu Phe Lys Asn Pro Glu Arg Asp Phe Pro Arg Ala Leu Met Ile Gly 210 215 220 Leu Leu Leu Ala Gly Leu Val Tyr Trp Gly Cys Thr Val Val Val Leu 225 230 235 240 His Phe Asp Ala Tyr Gly Glu Lys Met Ala Ala Ala Ala Ser Leu Pro 245 250 255 Lys Ile Val Val Gln Leu Phe Gly Val Gly Ala Leu Trp Ile Ala Cys 260 265 270 Val Ile Gly Tyr Leu Ala Cys Phe Ala Ser Leu Asn Ile Tyr Ile Gln 275 280 285 Ser Phe Ala Arg Leu Val Trp Ser Gln Ala Gln His Asn Pro Asp His 290 295 300 Tyr Leu Ala Arg Leu Ser Ser Arg His Ile Pro Asn Asn Ala Leu Asn 305 310 315 320 Ala Val Leu Gly Cys Cys Val Val Ser Thr Leu Val Ile His Ala Leu 325 330 335 Glu Ile Asn Leu Asp Ala Leu Ile Ile Tyr Ala Asn Gly Ile Leu Ile 340 345 350 Met Ile Tyr Leu Leu Cys Met Leu Ala Gly Cys Lys Leu Leu Gln Gly 355 360 365 Arg Tyr Arg Leu Leu Ala Val Val Gly Gly Leu Leu Cys Val Leu Leu 370 375 380 Leu Ala Met Val Gly Trp Lys Ser Leu Tyr Ala Leu Ile Met Leu Ala 385 390 395 400 Gly Leu Trp Leu Leu Leu Pro Lys Arg Lys Thr Pro Glu Asn Gly Ile 405 410 415 Thr Thr <210> 37 <211> 5803 <212> DNA <213> Artificial Sequence <220> <223> pDCM2 <400> 37 gttcgcttgc tgtccataaa accgcccagt ctagctatcg ccatgtaagc ccactgcaag 60 ctacctgctt tctctttgcg cttgcgtttt cccttgtcca gatagcccag tagctgacat 120 tcatccgggg tcagcaccgt ttctgcggac tggctttcta cgtgttccgc ttcctttagc 180 agcccttgcg ccctgagtgc ttgcggcagc gtgaagctag cttttatcgc cattcgccat 240 tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc 300 tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt 360 cacgacgttg taaaacgacg gccagtgaat tcgagctcgg tacccgggga tcctctagag 420 tcgacctgca ggcatgcaag cttggcgtaa tcatggtcat agctgtttcc tgtgtgaaat 480 tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg 540 ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag 600 tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 660 ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 720 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 780 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 840 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 900 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 960 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 1020 tttctccctt cgggaagcgt ggcgctttct caatgctcac gctgtaggta tctcagttcg 1080 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 1140 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 1200 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 1260 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 1320 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 1380 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 1440 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 1500 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttgggg 1560 tgggcgaaga actccagcat gagatccccg cgctggagga tcatccagcc ctgatagaaa 1620 cagaagccac tggagcacct caaaaacacc atcatacact aaatcagtaa gttggcagca 1680 tcacccgacg cactttgcgc cgaataaata cctgtgacgg aagatcactt cgcagaataa 1740 ataaatcctg gtgtccctgt tgataccggg aagccctggg ccaacttttg gcgaaaatga 1800 gacgttgatc ggcacgtaag aggttccaac tttcaccata atgaaataag atcactaccg 1860 ggcgtatttt ttgagttatc gagattttca ggagctgata gaaacagaag ccactggagc 1920 acctcaaaaa caccatcata cactaaatca gtaagttggc agcatcaccc gacgcacttt 1980 gcgccgaata aatacctgtg acggaagatc acttcgcaga ataaataaat cctggtgtcc 2040 ctgttgatac cgggaagccc tgggccaact tttggcgaaa atgagacgtt gatcggcacg 2100 taagaggttc caactttcac cataatgaaa taagatcact accgggcgta ttttttgagt 2160 tatcgagatt ttcaggagct ctttggcatc gtctctcgcc tgtcccctca gttcagtaat 2220 ttcctgcatt tgcctgtttc cagtcggtag atattccaca aaacagcagg gaagcagcgc 2280 ttttccgctg cataaccctg cttcggggtc attatagcga ttttttcggt atatccatcc 2340 tttttcgcac gatatacagg attttgccaa agggttcgtg tagactttcc ttggtgtatc 2400 caacggcgtc agccgggcag gataggtgaa gtaggcccac ccgcgagcgg gtgttccttc 2460 ttcactgtcc cttattcgca cctggcggtg ctcaacggga atcctgctct gcgaggctgg 2520 ccggctaccg ccggcgtaac agatgagggc aagcggatgg ctgatgaaac caagccaacc 2580 aggaagggca gcccacctat caaggtgtac tgccttccag acgaacgaag agcgattgag 2640 gaaaaggcgg cggcggccgg catgagcctg tcggcctacc tgctggccgt cggccagggc 2700 tacaaaatca cgggcgtcgt ggactatgag cacgtccgcg agggcgtccc ggaaaacgat 2760 tccgaagccc aacctttcat agaaggcggc ggtggaatcg aaatctcgtg atggcaggtt 2820 gggcgtcgct tggtcggtca tttcgaaaaa ggttaggaat acggttagcc atttgcctgc 2880 ttttatatag ttcantatgg gattcacctt tatgttgata agaaataaaaa gaaaatgcca 2940 ataggatatc ggcattttct tttgcgtttt tatttgttaa ctgttaattg tccttgttca 3000 aggatgctgt ctttgacaac agatgttttc ttgcctttga tgttcagcag gaagctcggc 3060 gcaaacgttg attgtttgtc tgcgtagaat cctctgtttg tcatatagct tgtaatcacg 3120 acattgtttc ctttcgcttg aggtacagcg aagtgtgagt aagtaaaggt tacatcgtta 3180 ggcggatcaa gatccatttt taacacaagg ccagttttgt tcagcggctt gtatgggcca 3240 gttaaagaat tagaaacata accaagcatg taaatatcgt tagacgtaat gccgtcaatc 3300 gtcatttttg atccgcggga gtcagtgaac aggtaccatt tgccgttcat tttaaagacg 3360 ttcgcgcgtt caatttcatc tgttactgtg ttagatgcaa tcagcggttt catcactttt 3420 ttcagtgtgt aatcatcgtt tagctcaatc ataccgagag cgccgtttgc taactcagcc 3480 gtgcgttttt tatcgctttg cagaagtttt tgactttctt gacggaagaa tgatgtgctt 3540 ttgccatagt atgctttgtt aaataaagat tcttcgcctt ggtagccatc ttcagttcca 3600 gtgtttgctt caaatactaa gtatttgtgg cctttatctt ctacgtagtg aggatctctc 3660 agcgtatggt tgtcgcctga gctgtagttg ccttcatcga tgaactgctg tacattttga 3720 tacgtttttc cgtcaccgtc aaagattgat ttataatcct ctacaccgtt gatgttcaaa 3780 gagctgtctg atgctgatac gttaacttgt gcagttgtca gtgtttgttt gccgtaatgt 3840 ttaccggaga aatcagtgta gaataaacgg atttttccgt cagatgtaaa tgtggctgaa 3900 cctgaccatt cttgtgtttg gtcttttagg atagaatcat ttgcatcgaa tttgtcgctg 3960 tctttaaaga cgcggccagc gtttttccag ctgtcaatag aagtttcgcc gactttttga 4020 tagaacatgt aaatcgatgt gtcatccgca tttttaggat ctccggctaa tgcaaagacg 4080 atgtggtagc cgtgatagtt tgcgacagtg ccgtcagcgt tttgtaatgg ccagctgtcc 4140 caaacgtcca ggccttttgc agaagagata ttttaattg tggacgaatc aaattcagaa 4200 acttgatatt tttcattttt ttgctgttca gggatttgca gcatatcatg gcgtgtaata 4260 tgggaaatgc cgtatgtttc cttatatggc ttttggttcg tttctttcgc aaacgcttga 4320 gttgcgcctc ctgccagcag tgcggtagta aaggttaata ctgttgcttg tttgcaaac 4380 ttttgatgt tcatcgttca tgtctcctt tttatgtact gtgttagcgg tctgcttctt 4440 ccagccctcc tgtttgaaga tggcaagtta gttacgcaca ataaaaaaag acctaaaata 4500 tgtaaggggt gacgccaaag tatacacttt gccctttaca cattttaggt cttgcctgct 4560 tttcagtaa caaacccgcg cgatttactt ttcgacctca ttctattaga ctctcgtttg 4620 gattgcaact ggtctatttt cctctttgt ttgatagaaa atcataaaag gatttgcaga 4680 ctacgggcct aaagaactaa aaaatctatc tgtttctttt cattctctgt attttttata 4740 gttctctgttg catgggcata aagttgcctt tttaatcaca attcagaaaa tatcataata 4800 tctcatttca ctaaataata gtgaacggca ggtatatgtg atgggttaaa aaggatcacc 4860 ccagagtccc gctcagaaga actcgtcaag aaggcgatag aaggcgatgc gctgcgaatc 4920 gggagcggcg ataccgtaaa gcacgaggaa gcggtcagcc cattcgccgc caagctcttc 4980 agcaatatca cgggtagcca acgctatgtc ctgatagcgg tccgccacac ccagccggcc 5040 acagtcgatg aatccagaaa agcggccatt ttccaccatg atattcggca agcaggcatc 5100 gccatgggtc acgacgagat cctcgccgtc gggcatccgc gccttgagcc tggcgaacag 5160 ttcggctggc gcgagcccct gatgctcttc gtccagatca tcctgatcga caagaccggc 5220 ttccatccga gtacgtgctc gctcgatgcg atgtttcgct tggtggtcga atgggcaggt 5280 agccggatca agcgtatgca gccgccgcat tgcatcagcc atgatggata ctttctcggc 5340 aggagcaagg tgagatgaca ggagatcctg ccccggcact tcgcccaata gcagccagtc 5400 ccttcccgct tcagtgacaa cgtcgagaca gctgcgcaag gaacgcccgt cgtggccagc 5460 cacgatagcc gcgctgcctc gtcttggagt tcattcaggg caccggacag gtcggtcttg 5520 acaaaaagaa ccgggcgccc ctgcgctgac agccggaaca cggcggcatc agagcagccg 5580 attgtctgtt gtgcccagtc atagccgaat agcctctcca cccaagcggc cggagaacct 5640 gcgtgcaatc catcttgttc aatcatgcga aacgatcctc atcctgtctc ttgatcagat 5700 cttgatcccc tgcgccatca gatccttggc ggcaagaaag ccatccagtt tactttgcag 5760 ggcttcccaa ccttaccaga gggcgcccca gctggcaatt ccg 5803 [Drawings]

[0022] Figure 1 is a schematic diagram of the pDCM2 plasmid.

[0023] [Best Mode]

[0024] The present disclosure will be described in detail. Meanwhile, each description and embodiment disclosed in the present disclosure can be applied to the different descriptions and embodiments herein. In other words, all combinations of the various components disclosed in the present disclosure are included within the scope of the present disclosure. In addition, the scope of the present disclosure should not be limited by the description provided below.

[0025] To achieve the above-mentioned purpose, one aspect of the present disclosure provides a variant of the inner membrane protein YjeH, which has a homology of more than 95% and less than 100% with SEQ ID NO:1 and comprises: i) replacing the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) replacing the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii).

[0026] The variant of the inner membrane protein YjeH may have the ability to export O-acetylhomoserine or homoserine, ie, O-acetylhomoserine or homoserine export activity.

[0027] As used herein, the term "homoserine" is an α-amino acid with a hydroxyl group in the side chain. Homoserine is known to be produced from aspartate-4-semialdehyde (as an intermediate in the biosynthesis of threonine and methionine in microorganisms and plants), and its chemical formula is C4H9NO3. In the presence of acetyl-CoA, homoserine can be converted to O-acetyl homoserine by homoserine acetyltransferase.

[0028] As used herein, the term "O-acetyl homoserine" refers to an acetyl derivative of L-homoserine, which is a specific intermediate material in the biosynthetic pathway of methionine in microorganisms. It is known that O-acetyl homoserine is produced by a reaction between homoserine and acetyl-CoA catalyzed by homoserine acetyltransferase. Its chemical formula is C6H 11 NO4. O-Acetyl homoserine may also be named O-acetyl-L-homoserine.

[0029] Specifically, in the variant of the protein according to the present disclosure, i) the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 may be substituted by a different amino acid, ii) the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 may be substituted by a different amino acid, or iii) the two amino acids at positions 92 and 351 of the amino acid sequence corresponding to SEQ ID NO: 1 may be substituted by different amino acids, but are not limited thereto. The amino acid substitution can be i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 with asparagine, or ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 with leucine. More specifically, the variant of the protein can be a variant of the inner membrane protein YjeH, wherein i) the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 is substituted by asparagine, ii) the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 is substituted by leucine, or iii) the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 is substituted by asparagine, and the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 is substituted by leucine, but is not limited thereto.

[0030] As used herein, the term "inner membrane protein" refers to a protein that is a member of the amino acid efflux (AAE) family within the amino acid-polyamine-organic (APC) superfamily of transporters, mediating the export of O-acetyl homoserine and / or homoserine. The protein is predicted to contain 12 transmembrane alpha helices, 10 of which form an inverted repeat fold unique to the APC superfamily. The inner membrane protein can be, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1. The protein comprising the amino acid sequence of SEQ ID NO: 1 can be used interchangeably with a protein having the amino acid sequence of SEQ ID NO: 1 or a protein consisting of the amino acid sequence of SEQ ID NO: 1. In the present disclosure, the inner membrane protein can be used interchangeably with an O-acetyl homoserine- or homoserine-export protein, a protein having the ability to export O-acetyl homoserine or homoserine, a protein having O-acetyl homoserine or homoserine export activity, a YjeH protein, or a YjeH.

[0031] In the present disclosure, SEQ ID NO:1 may refer to the amino acid sequence of YjeH (which is an inner membrane protein). Specifically, SEQ ID NO:1 may be the amino acid sequence of an inner membrane protein encoded by the yjeH gene and having O-acetyl homoserine or homoserine export activity. The amino acid sequence of SEQ ID NO:1 can be obtained from the known database of NCBI GenBank. For example, the amino acid sequence may be derived from Escherichia coli (Escherichia coli / E.coli), but is not limited thereto, and may include any sequence having the same activity as the amino acid sequence, but is not limited thereto. In addition, although the inner membrane protein is defined as a protein comprising the amino acid sequence of SEQ ID NO:1 in the present disclosure, the inner membrane protein does not exclude mutations that may occur naturally or mutations or silent mutations thereof that occur by adding meaningless sequences upstream or downstream of the amino acid sequence of SEQ ID NO:1. As long as the protein has the same or equivalent activity as the protein comprising the amino acid sequence of SEQ ID NO:1, it obviously belongs to the inner membrane protein of the present disclosure. For example, the inner membrane protein of the present disclosure may be a protein consisting of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.7% homology or identity thereto. In addition, it is obvious that any protein having an amino acid sequence (including partial deletion, modification, substitution or addition of an amino acid sequence) is within the scope of the present disclosure, as long as the amino acid sequence retains the above homology or identity and effect equivalent to the homology or identity and effect of the protein.

[0032] That is, although the expressions "a protein or polypeptide having an amino acid sequence shown in a predetermined SEQ ID NO" and "a protein or polypeptide comprising an amino acid sequence shown in a predetermined SEQ ID NO" are used in the present disclosure, it is obvious that any protein having an amino acid sequence (including a partial deletion, modification, substitution or addition of an amino acid sequence) can also be used in the present disclosure, as long as the protein has the same or equivalent activity as a polypeptide consisting of a predetermined amino acid sequence. For example, it is obvious that "a protein comprising an amino acid sequence of SEQ ID NO: 1" or "a polypeptide comprising an amino acid sequence of SEQ ID NO: 1" belongs to "a protein consisting of an amino acid sequence of SEQ ID NO: 1" or "a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1", as long as the former has the same or equivalent activity as the latter.

[0033] As used herein, the term "variant" refers to a protein that is obtained by conservative substitution and / or modification of at least one amino acid different from the sequence while retaining its function or characteristics. Due to the substitution, deletion or addition of several amino acids, the variant may have an amino acid sequence different from the identified sequence. Such a variant can usually be identified by modifying at least one amino acid of the above amino acid sequence of the protein and evaluating the characteristics of the modified protein. That is, relative to the native protein, the ability of the variant can be enhanced, may not be changed, or may be reduced. In addition, some variants may include variants in which at least a portion such as the N-terminal leader sequence or the transmembrane domain has been removed. Other variants may include variants in which a portion has been removed from the N- and / or C-terminus of the mature protein. The term "variant" may also be used interchangeably with other terms such as modification, modified protein, modified polypeptide, mutant, mutant protein and divergent, and any term used to indicate a variant may also be used without restriction. Considering the purpose of the present disclosure, the ability of the variant may be enhanced relative to a native or unmodified protein, but is not limited thereto.

[0034] As used herein, the term "conservative substitution" refers to an amino acid being substituted by another amino acid having similar structure and / or chemical properties. For example, a variant may include at least one conservative substitution while retaining at least one biological activity. Such amino acid substitutions may generally occur based on the similarity of the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residue. For example, charged amino acids with side chains include positively charged (basic) amino acids such as arginine, lysine, and histidine, and negatively charged (acidic) amino acids such as glutamic acid and aspartic acid; uncharged amino acids with side chains include non-polar amino acids such as glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, as well as polar or hydrophilic amino acids such as serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Among non-polar amino acids, aromatic amino acids include phenylalanine and tryptophan.

[0035] Variants may also include deletions or additions of amino acids that have minimal effects on the properties and secondary structure of the polypeptide. For example, a polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of the protein that co-translationally or post-translationally directs the transfer of the protein. A polypeptide may also be conjugated to another sequence or linker to identify, purify or synthesize the polypeptide.

[0036] In the present disclosure, "substituted with a different amino acid" is not particularly limited as long as the amino acid after substitution is different from the amino acid before substitution.

[0037] In the present disclosure, "replaced by a different amino acid" is not particularly limited, as long as the amino acid after replacement is different from the amino acid before replacement. Specifically, the amino acid can be replaced by any one of lysine, histidine, glutamic acid, aspartic acid, glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine and glutamine that is different from the previous amino acid sequence.

[0038] Specifically, in the amino acid sequence of SEQ ID NO: 1, phenylalanine may be substituted with asparagine, which is the amino acid at position 92 of the amino acid sequence of SEQ ID NO: 1, or phenylalanine may be substituted with leucine, which is the amino acid at position 351 of the amino acid sequence of SEQ ID NO: 1. Meanwhile, in the present disclosure, it is obvious that the expression "substituted with a certain amino acid" means that the amino acid after substitution is different from the amino acid before substitution, unless the expression "substituted with a different amino acid" is used.

[0039] Moreover, the substituted amino acid residues may include not only natural amino acids but also non-natural amino acids. Non-natural amino acids may be, for example, D-amino acids, (high)-amino acids, (β-high)-amino acids, N-methyl amino acids, α-methyl amino acids and rare amino acids (e.g., citrulline or naphthylalanine), but are not limited thereto. Meanwhile, in the present disclosure, it is obvious that the expression "substituted with a certain amino acid" means that the amino acid after substitution is different from the amino acid before substitution, unless the expression "substituted with a different amino acid" is used.

[0040] The variant may be one in which at least any one of the amino acids corresponding to positions 92 and 351 is substituted with an amino acid different from the amino acid before substitution in the amino acid sequence of SEQ ID NO: 1, or is substituted with an uncharged amino acid having a side chain different from that before substitution, but is not limited thereto.

[0041] Specifically, the variant may be a variant of a protein, wherein i) the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 is substituted with a different amino acid, ii) the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 is substituted with a different amino acid, or iii) the amino acids at positions 92 and 351 of the amino acid sequence corresponding to SEQ ID NO: 1 are substituted with different amino acids, but not limited thereto. The amino acid substitution may be i) substitution of the 92nd amino acid with asparagine, or ii) substitution of the 351st amino acid with leucine. More specifically, the variant may be a variant of the inner membrane protein YjeH, wherein in the amino acid sequence of SEQ ID NO: 1, i) the 92nd amino acid is substituted with asparagine, ii) the 351st amino acid is substituted with leucine, or iii) the 92nd amino acid is substituted with asparagine, and the 351st amino acid is substituted with leucine, but not limited thereto.

[0042] As used herein, the term "corresponding to" refers to an amino acid residue at a referenced position in a protein or polypeptide or an amino acid residue that is similar, identical, or homologous to a referenced residue in a protein or polypeptide. As used herein, the term "corresponding region" generally refers to a region in a related protein or reference protein that is similar thereto.

[0043] In the present disclosure, specific numbering can be used for the positions of amino acid residues of the proteins used in the present disclosure. For example, by comparing the amino acid sequence of the protein to be compared with the amino acid sequence of the protein of the present disclosure, the positions corresponding to the amino acid residues of the protein of the present disclosure can be renumbered.

[0044] The variant of the inner membrane protein YjeH provided in the present disclosure may refer to a variant having an enhanced ability to export O-acetyl homoserine or homoserine compared to an unmodified protein by replacing an amino acid at a specific position in the above-mentioned inner membrane protein having the ability to export O-acetyl homoserine or homoserine.

[0045] The variant of the inner membrane protein YjeH may comprise any one of the amino acid sequences of SEQ ID NO:35 and 36, specifically be essentially composed of any one of the amino acid sequences of SEQ ID NO:35 and 36, more specifically be composed of any one of the amino acid sequences of SEQ ID NO:35 and 36, but not limited thereto, the variant of the inner membrane protein YjeH comprises i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or substitutions of i) and ii).

[0046] In addition, the variant may include an amino acid sequence of any one of SEQ ID NOs: 35 and 36, or an amino acid sequence in which at least any one of the 92nd and 351st amino acids is fixed in the amino acid sequences of SEQ ID NOs: 35 and 36, and has at least 80% homology with the amino acid sequences of SEQ ID NOs: 35 and 36, but is not limited thereto. Specifically, the variant of the present disclosure may include a polypeptide having at least 80%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with any one of the amino acid sequences of SEQ ID NOs: 35 and 36. Moreover, it is obvious that any protein having an amino acid sequence (including partial deletion, modification, substitution or addition at positions other than positions 92 and 351 of the amino acid sequence) is within the scope of the present disclosure, as long as the protein retains the above homology or identity and effect equivalent to the homology or identity and effect of the variant.

[0047] As used herein, the term "homology" or "identity" refers to the degree of relatedness between two given amino acid sequences or base sequences, and can be expressed as a percentage. These terms "homology" and "identity" are often used interchangeably.

[0048] The sequence homology or identity of conservative polynucleotide or polypeptide can be determined by standard comparison algorithm, and the default gap penalty set up by the program can be used together with it. Basically, homologous or identical sequences can hybridize to each other under medium or high stringency conditions for at least about 50%, 60%, 70%, 80% or 90% of the whole sequence or the whole length. In the polynucleotide of hybridization, it is also possible to consider the polynucleotide comprising degenerate codons instead of codons.

[0049] Sequence homology, similarity or identity between two given polypeptides or polynucleotides can be determined using any known computer algorithm such as the "FASTA" program using the default parameters introduced by, for example, Pearson et al., (1988) Proc. Natl. Acad. Sci. USA 85:2444. Alternatively, the Needleman-Wunsch algorithm (1970, J. Mol. Biol. 48:443-453) implemented in the Needleman program of the European Molecular Biology Open Software Suite (EMBOSS) package (Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or higher) can be used to determine it (including the GCG program package (Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF et al., J MOLEC BIOL 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994 and CARILLO et al. (1988) SIAM J Applied Math 48:1073). For example, BLAST, from the National Center for Biotechnology Information database or ClustalW can be used to determine homology, similarity or identity.

[0050] Homology, similarity or identity between polynucleotides or polypeptides can be determined, for example, by comparing sequence information using a GAP computer program, such as the program introduced by Needleman et al. (1970), J Mol Biol. 48:443, for example, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In short, the GAP program defines similarity as the number of similar aligned symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter sequence of the two sequences. Default parameters for the GAP program may include: (1) a binary comparison matrix (containing a value of 1 for identity and a value of 0 for non-identity); the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745 as published in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353–358 (1979) (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) replacement matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

[0051] In addition, the sequence homology, similarity or identity between two given polynucleotides or polypeptides can be identified by comparing their sequences by Southern hybridization under defined stringent conditions, and the defined stringent hybridization conditions are within the scope of the present technology and can be defined by methods well known to those of ordinary skill in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0052] As used herein, the term "variant of inner membrane protein" or "variant of inner membrane protein YjeH" may have the ability to export O-acetyl homoserine or homoserine, and may be used interchangeably with a modified polypeptide having the ability to produce O-acetyl homoserine or homoserine, a modified polypeptide that produces O-acetyl homoserine or homoserine, a modified polypeptide having the ability to produce O-acetyl homoserine or homoserine, a modified polypeptide having O-acetyl homoserine or homoserine export activity, a variant having O-acetyl homoserine or homoserine export activity, an O-acetyl homoserine or homoserine export variant, a modified homoserine export protein, a modified O-acetyl homoserine export protein, a modified YjeH, a variant YjeH, a YjeH variant, a YjeH mutant, and the like.

[0053] In addition, the protein may be derived from a strain belonging to the genera Escherichia, Erwinia, Serratia, Providencia, Corynebacterium, Pseudomonas, Leptospira, Salmonella, Brevibacterium, Hypomononas, Chromobacterium and Nocardia, or a fungus or yeast, specifically from a strain belonging to the genera Escherichia, Corynebacterium and Leptospira, and yeast, and more specifically from a strain belonging to the genus Escherichia, such as Escherichia coli, but not limited thereto.

[0054] Variants of inner membrane protein YjeH may include mutations at position 92 and / or position 351 in the amino acid sequence of SEQ ID NO: 1, and any variants including addition of amino acids to the amino acid sequence of SEQ ID NO: 1 or deletion of amino acids from the amino acid sequence of SEQ ID NO: 1 may be within the scope of the present disclosure, as long as the amino acids at position 92 and / or position 351 corresponding to the N-terminus of SEQ ID NO: 1 are substituted. Variants of inner membrane protein YjeH may include an amino acid sequence including that the 92nd amino acid and / or the 351st amino acid in the amino acid sequence of SEQ ID NO: 1 are substituted by different amino acids, and may have enhanced activity compared to inner membrane proteins including the amino acid sequence of SEQ ID NO: 1 or not including mutations. Variants of inner membrane protein YjeH may have 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or higher and less than 100% homology or identity with SEQ ID NO: 1.

[0055] The mutation of the 92nd or 351st amino acid may be a substitution of the 92nd amino acid with asparagine or a substitution of the 351st amino acid with leucine.

[0056] Specifically, the variant of the inner membrane protein YjeH may include in the amino acid sequence of SEQ ID NO: 1 i) substitution of the 92nd amino acid with asparagine, ii) substitution of the 351st amino acid with leucine, or substitutions of i) and ii), and may have enhanced activity compared to a protein comprising the amino acid sequence of SEQ ID NO: 1 or an inner membrane protein derived from a wild-type microorganism before modification.

[0057] Another aspect of the present disclosure provides a polynucleotide encoding a variant of the inner membrane protein YjeH.

[0058] The inner membrane protein YjeH and its variants are as described above.

[0059] As used herein, the term "polynucleotide" refers to a DNA or RNA chain of a specific minimum length or longer that is a polymer of nucleotides, in which nucleotide monomers are linked to each other in the form of a long chain by covalent bonds, and more specifically, a polynucleotide may be a polynucleotide fragment encoding a variant.

[0060] The polynucleotide may include any nucleotide sequence encoding a variant of the inner membrane protein YjeH of the present disclosure, but is not limited thereto. In the present disclosure, the gene encoding the amino acid sequence of the inner membrane protein YjeH is the yjeH gene, and the gene may be derived from Escherichia coli, but is not limited thereto.

[0061] Specifically, the polynucleotides of the present disclosure may include various modifications in the coding region, as long as the amino acid sequence of the polypeptide expressed from the coding region is not changed by codon degeneracy or codons preferred by the living organism expressing the protein. Specifically, any polynucleotide sequence encoding a variant of inner membrane protein YjeH may be included but is not limited to, wherein the 92nd or 351st amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted by a different amino acid.

[0062] In addition, any sequence encoding inner membrane protein may be included but is not limited to, wherein the 92nd or 351st amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced by a different amino acid by hybridization with a probe, and the probe may be prepared from a known gene sequence, for example, a sequence complementary to all or part of the nucleotide sequence under stringent conditions. The term "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. Such conditions are disclosed in detail in known literature (e.g., J. Sambrook et al.). For example, the conditions may include conditions for hybridizing between genes having high homology or identity, for example, 40% or more, specifically 90% or more, more specifically 95% or more, even more specifically 97% or more, and most specifically 99% or more homology or identity, and not hybridizing between genes having a homology lower than the above homology or identity, or conditions for performing one, specifically two or three hybridizations under conventional washing conditions for Southern hybridization at a salt concentration and temperature of 60°C, 1×SSC and 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC and 0.1% SDS.

[0063] Hybridization requires that the two polynucleotides have complementary sequences, although bases may be mismatched depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, for DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the present disclosure may include not only substantially similar nucleic acid sequences, but also isolated nucleic acid fragments that are complementary to the entire sequence.

[0064] Specifically, the above hybridization conditions and the use of T m The hybridization process with a T value of 55°C detects polynucleotides with homology or identity. m The value may be, but is not limited to, 60° C., 63° C., or 65° C., and may be appropriately adjusted by those skilled in the art according to the intended purpose.

[0065] The appropriate degree of stringency for hybridization of polynucleotides may depend on the length of the polynucleotides and the degree of complementation and its parameters are well known in the art (Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0066] Another aspect of the present disclosure provides a vector comprising a polynucleotide encoding a variant of the inner membrane protein YjeH.

[0067] The inner membrane protein YjeH, its variants and polynucleotides are as described above.

[0068] The vector of the present disclosure can be a DNA construct containing a nucleotide sequence of a polynucleotide encoding a target polypeptide and operably connected to a suitable expression control region (expression control sequence) so that the target polypeptide can be expressed in a suitable host cell. The expression control sequence can include a promoter capable of initiating transcription, any operon sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating transcription and translation termination. When a suitable host cell is transformed with a vector, the vector can replicate or function independently of the host genome, or can be integrated into its genome.

[0069] As used herein, the term "expression" includes any process involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion, but is not limited thereto.

[0070] As used herein, the term "expression vector" refers to a linear or circular nucleic acid molecule that includes a coding sequence and operably linked regulatory sequences for its expression.

[0071] As used herein, the term "operably linked" refers to placing a regulatory sequence in an appropriate position to regulate the expression of a coding sequence. Thus, "operably linked" includes binding between a regulatory region, such as a promoter, a stop codon, a signal sequence or an enhancer, and a target (gene or polypeptide) to regulate the expression, secretion or function of the target according to the known or desired activity.

[0072] The vector used in the present disclosure is not particularly limited, and any known vector can be used. Examples of known vectors may include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A and Charon21A etc. can be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, pBluescriptII-based, pGEM-based, PTZ-based, pCL-based and pET-based vectors can be used as plasmid vectors. Specifically, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118 and pCC1BAC vectors can be used. More specifically, the vector used in the present disclosure can be pDCM2 ( Figure 1 , SEQ ID NO: 37), but is not limited thereto, and any known expression vector may be used.

[0073] For example, a vector for chromosome insertion into a cell can be used to insert a polynucleotide encoding a target polypeptide into the chromosome. Insertion of a polynucleotide into a chromosome can be performed by any method known in the art, such as homologous recombination, but is not limited thereto. The polynucleotide can also include a selection marker to confirm chromosome insertion. Selection markers are used to select cells transformed with a vector, that is, to confirm the insertion of a desired nucleic acid molecule, and examples of selection markers can include markers that provide selectable phenotypes, such as drug tolerance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides. Only cells expressing selection markers can survive or show different phenotypes under an environment treated with a selective agent, so transformed cells can be selected.

[0074] Another aspect of the present disclosure provides a microorganism, which contains at least any one of the following: a variant of the inner membrane protein YjeH, which has a homology of more than 95% and less than 100% with SEQ ID NO:1 and contains: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector containing the polynucleotide.

[0075] SEQ ID NO: 1, inner membrane protein YjeH, its variants, polynucleotides encoding the variants and vectors comprising the polynucleotides are as described above.

[0076] As used herein, the term "microorganism comprising a variant of inner membrane protein YjeH" refers to a microorganism having an enhanced ability to export O-acetyl homoserine or homoserine prepared by introducing a variant of inner membrane protein YjeH into a microorganism having a weak ability to export O-acetyl homoserine or homoserine. Specifically, the microorganism is a microorganism expressing a variant of inner membrane protein YjeH comprising at least one amino acid modification in the amino acid sequence of SEQ ID NO: 1, and the amino acid modification may include replacing the 92nd or 351st amino acid from the N-terminus with a different amino acid.

[0077] In view of the purpose of the present disclosure, the extracellular export of O-acetyl homoserine or homoserine of the microorganism is increased compared to the wild-type or unmodified microorganism, and the microorganism comprises at least any one of the following: a variant of the inner membrane protein YjeH; a polynucleotide encoding the variant; and a vector comprising the polynucleotide; so the microorganism is characterized in that the ability to produce O-acetyl homoserine or homoserine is enhanced. Although the wild-type or unmodified microorganism cannot export or can produce trace amounts of O-acetyl homoserine or homoserine, according to the present disclosure, the output of O-acetyl homoserine or homoserine can be increased by introducing at least a variant of the inner membrane protein YjeH; a polynucleotide encoding the variant; and any one of the vectors comprising the polynucleotides to enhance the ability to produce O-acetyl homoserine or homoserine.

[0078] As used herein, the term "unmodified microorganism" does not exclude strains including mutations that can occur naturally in microorganisms, and refers to wild-type strains or microorganisms that do not include inner membrane protein YjeH variants." Unmodified microorganism" can be used interchangeably with "strain before modification", "microorganism before modification", "non-mutant strain", "non-mutant microorganism", "unmodified strain" or "reference microorganism".

[0079] As used herein, the term "protein to be expressed / expressed" means that the target protein is introduced into a microorganism or modified to be expressed in a microorganism. In the case of the presence of the target protein in a microorganism, the activity of the protein can be enhanced compared to the activity of its endogenous protein or the activity before modification. In view of the purpose of the present disclosure, the "target protein" can be a variant of the above-mentioned inner membrane protein YjeH.

[0080] Specifically, the term "introduction of protein" refers to providing the activity of a specific protein to a microorganism that does not have the protein, or enhancing the activity of the protein compared to the intrinsic activity of the protein or the activity before modification. For example, the introduction of a protein may refer to the introduction of a polynucleotide encoding a specific protein into a chromosome or the introduction of a vector containing a polynucleotide encoding a specific protein into a microorganism, thereby expressing the activity of the protein. In addition, "enhancement of activity" may mean that the activity of a specific protein of a microorganism is enhanced compared to the intrinsic activity or the activity before modification. The term "intrinsic activity" may refer to the activity of a specific protein possessed by a parent strain before transformation when a microorganism is transformed by natural or artificial genetic variation.

[0081] Specifically, the enhancement of the activity of the content of the present disclosure can be achieved by at least one method selected from the following: a method of increasing the copy number of a gene encoding a variant protein; a method of introducing a mutation into the expression regulatory sequence of a gene encoding a variant protein; a method of replacing the expression regulatory sequence of a gene with a sequence encoding a variant protein and having a stronger activity; a method of replacing a gene encoding a wild-type inner membrane protein on a chromosome with a gene encoding a variant protein; a method of additionally introducing a mutation into a gene encoding a variant protein to enhance the activity of the variant protein; and a method of introducing a variant protein into the microorganism, without being limited thereto.

[0082] In the above description, the copy number of the gene is increased, although not particularly limited thereto, and can be carried out in a state where it is operably connected to a vector, or by being inserted into a chromosome in a host cell. Specifically, the increase in the number of gene copies can be carried out by introducing a vector into the cell of the host, and the polynucleotide encoding the variant protein of the present disclosure can be operably connected to the vector, and the vector can be replicated and function independently of the host cell. Alternatively, the vector is introduced into a host cell, and the polynucleotide is operably connected to the vector, and the vector can insert the polynucleotide into the chromosome of the host cell. Methods known in the art can be used, for example, by homologous recombination, the polynucleotide is inserted into the chromosome.

[0083] Modification of the expression control sequence to improve the expression level of the polynucleotide can be carried out by, but not particularly limited to, inducing sequence mutations by deletion, insertion, non-conservative substitution, conservative substitution or any combination thereof to further enhance the activity of the expression control sequence or replacing it with a sequence with stronger activity. The expression control sequence may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating transcription and translation termination.

[0084] A promoter stronger than the intrinsic promoter may be connected upstream of the polynucleotide expression unit, but is not limited thereto. Examples of stronger promoters known in the art may include CJ1 to CJ7 promoters (US 7662943B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US 10584338B2), O2 promoter (US10273491B2), tkt promoter and yccA promoter, but are not limited thereto.

[0085] In addition, modification of the polynucleotide sequence on the chromosome can be carried out by inducing mutations in the expression regulatory sequence through deletion, insertion, non-conservative substitution, conservative substitution or any combination thereof to further enhance the activity of the polynucleotide sequence, or by replacing the nucleotide sequence with a nucleotide sequence modified to have stronger activity, but is not limited thereto.

[0086] The introduction of a protein and the enhancement of its activity may increase the activity or concentration of a protein from a wild-type or unmodified microbial strain, but is not limited thereto.

[0087] In the present disclosure, the microorganism comprising the variant of inner membrane protein YjeH may be a recombinant microorganism prepared by transformation with a vector comprising a polynucleotide encoding the variant of inner membrane protein YjeH, but is not limited thereto.

[0088] As used herein, the term "conversion" refers to the process of introducing a vector containing a polynucleotide encoding a target protein into a host cell in such a way that the protein encoded by the polynucleotide is expressed in the host cell. The converted polynucleotide can be in the form of an insertion into the host cell chromosome or in the form of an extrachromosomal insertion, as long as the protein is expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target protein. The polynucleotide can be introduced into the host cell in any form, as long as the polynucleotide is introduced into the host cell and the protein is expressed therein. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a gene construct including all the necessary elements required for self-expression. The expression cassette can generally include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are operably connected to the polynucleotide. The expression cassette can be in the form of a self-replicable expression vector. Moreover, the polynucleotide can be introduced into the host cell in its original form and operably connected to the sequence required for expression in the host cell, but is not limited thereto.

[0089] The type of microorganism having homoserine production ability is not particularly limited, as long as the microorganism can produce O-acetylhomoserine or homoserine, specifically, the microorganism may be any microorganism belonging to the genus Corynebacterium, Escherichia, Enterobacter, Erwinia, Serratia, Providencia and Brevibacterium, more specifically, a microorganism belonging to the genus Corynebacterium.

[0090] More specifically, the microorganism belonging to the genus Corynebacterium may be Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens, and any microorganism belonging to the genus Corynebacterium may be used without limitation.

[0091] In the present disclosure, the parent strain of the microorganism may be a microorganism in which a gene that attenuates the biosynthetic pathway of O-acetyl homoserine or homoserine is additionally inactivated or the biosynthetic pathway of O-acetyl homoserine or homoserine is enhanced to increase the production of O-acetyl homoserine or homoserine, but is not limited thereto.

[0092] Specifically, in order to inactivate a gene that weakens O-acetyl homoserine or the biosynthetic pathway of homoserine, for example, the expression of the metB gene (SEQ ID NO: 17) encoding cystathionine γ-synthase involved in the O-acetyl homoserine degradation pathway or the metY gene (SEQ ID NO: 22) encoding O-acetyl homoserine (thiol) lyase involved in the O-acetyl homoserine degradation pathway can be weakened or inactivated.

[0093] To enhance the biosynthetic pathway of O-acetyl homoserine or homoserine, for example, a genetic mutation can be introduced into the lysC gene encoding aspartate kinase (SEQ ID NO: 27), or the expression of the metX gene encoding O-acetyl homoserine transferase (SEQ ID NO: 32) can be amplified.

[0094] However, the embodiment is not limited thereto, and the ability to produce O-acetyl homoserine or homoserine may be enhanced by any known gene expression regulation method.

[0095] As used herein, the term "enhance / increase" is a concept including an increase in activity compared to inherent activity.

[0096] The enhancement or increase of gene activity can be achieved by applying various methods well known in the art. Examples of the method may include at least one selected from the following: a method of increasing the copy number of a gene; a method of introducing a mutation into the expression control sequence of a gene; a method of replacing the expression control sequence of a gene with a sequence having a stronger activity; a method of additionally introducing a mutation into a gene to enhance gene activity; a method of introducing an exogenous gene into a microorganism; and any combination of the above, but not limited thereto.

[0097] As used herein, the term "inactivation" of a protein means that the activity of the protein is weakened compared to the intrinsic activity, or the protein has no activity.

[0098] Inactivation of proteins can be achieved by various methods well known in the art. Examples of the methods may include: a method of deleting part or all of a gene encoding a protein on a chromosome, including removing the activity of a protein; a method of replacing a gene encoding a protein on a chromosome with a mutant gene to reduce enzyme activity; a method of introducing a mutation into an expression regulatory sequence of a gene encoding a protein on a chromosome; a method of replacing an expression regulatory sequence of a gene encoding a protein with a sequence having weak activity or inactivity (e.g., a method of replacing a promoter of a gene with a promoter weaker than an endogenous promoter); a method of deleting part or all of a gene encoding a protein on a chromosome; a method of introducing an antisense oligonucleotide (e.g., an antisense RNA) that inhibits translation of mRNA into a protein via complementary binding to a transcript of a gene on a chromosome; a method of artificially adding a complementary sequence to a Shine-Dalgarno (SD) sequence upstream of the SD sequence of a gene encoding a protein to form a secondary structure so that the ribosome cannot attach; and a reverse transcription engineering (RTE) method, which adds a promoter for reverse transcription to the 3' end of the open reading frame (ORF) of the corresponding sequence and a combination of the above, but is not particularly limited thereto.

[0099] Another aspect of the present disclosure provides a method for producing a target product, comprising culturing a microorganism in a culture medium, wherein the microorganism comprises at least any one of the following: a variant of the inner membrane protein YjeH, the variant having more than 95% and less than 100% homology with SEQ ID NO: 1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0100] SEQ ID NO: 1, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors comprising the polynucleotides, and microorganisms comprising the same are as described above.

[0101] The target product may be O-acetyl homoserine or homoserine, but is not limited thereto.

[0102] As used herein, the term "culture" refers to growing a microorganism in an appropriately adjusted environment. The culture process of the present disclosure can be carried out according to appropriate culture media and culture conditions known in the art. Those skilled in the art can easily adjust the culture process for use according to the selected strain. The culture of microorganisms can be carried out in a batch process, a continuous process, a fed-batch process, etc., but is not limited thereto.

[0103] As used herein, the term "culture medium" refers to a substance in which the nutrients required for culturing microorganisms are mixed as main components and the nutrients and growth factors necessary for survival and growth and water are provided. Specifically, although the culture medium and other culture conditions for culturing the microorganisms of the present disclosure are not particularly limited, as long as the culture medium is commonly used for culturing microorganisms, the microorganisms of the present disclosure can be cultured under aerobic conditions in a common culture medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids and / or vitamins, while adjusting temperature, pH, etc.

[0104] In the present disclosure, carbohydrates such as glucose, fructose, sucrose and maltose can be used; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid and citric acid; and amino acids such as glutamic acid, methionine and lysine can be used as carbon sources. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, bagasse and corn steep liquor can be used, specifically, carbohydrates such as glucose and aseptically pretreated molasses (i.e., molasses converted into reducing sugars) can be used, and any other carbon source of appropriate amount can also be used without restriction. These carbon sources can be used alone or in combination of at least two thereof.

[0105] Inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate and ammonium nitrate, and organic nitrogen sources such as amino acids, for example, glutamic acid, methionine and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation product, and defatted soybean cake or its degradation product can be used as nitrogen sources. These nitrogen sources can be used alone or in combination of at least two thereof, but are not limited thereto.

[0106] As the phosphorus source, monopotassium phosphate, dipotassium phosphate or the corresponding sodium salts thereof can be used. As inorganic compounds, sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc. can be used. Moreover, amino acids, vitamins and / or suitable precursors can be further included. The culture medium and precursors can be added to the culture medium in a batch method or a continuous method, but are not limited thereto.

[0107] In the present disclosure, in the culturing process of microorganism, compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be suitably added to the culture, to regulate the pH of the culture medium. In addition, defoamer such as fatty acid polyglycol ester can be added in the culturing process, to suppress the formation of foam. In addition, oxygen or oxygen-containing gas can be injected into the culture medium so that the culture medium is maintained under aerobic conditions, and nitrogen, hydrogen or carbon dioxide can be injected into the culture so that the culture is maintained under anaerobic and microaerobic conditions, and do not inject any other gas, but embodiments are not limited thereto.

[0108] The temperature of the culture medium may be maintained at 25 to 50° C., more specifically 30 to 37° C., but not limited thereto. The culture may be continued until a desired amount of product is obtained, specifically 10 to 100 hours, but not limited thereto.

[0109] The target product produced by the culture may be exported into the culture medium or retained in the cells.

[0110] The method may further comprise recovering the target product from the culture medium or the microorganism.

[0111] The recovery of the target product produced in the cultivation step of the present disclosure can be carried out by collecting the target product from the culture using any known method selected according to the cultivation method. For example, centrifugation, filtration, anion exchange chromatography, crystallization and high performance liquid chromatography (HPLC) can be used, and the target amino acid can be recovered from the culture medium or microorganism using any appropriate method in the art, but is not limited thereto. The culture can also be named as a culture fluid.

[0112] In addition, the recovery step may include a purification process that can be performed using appropriate methods well known in the art. Therefore, the recovered target product can be a purified form of a microorganism or a fermentation broth that includes the target product (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008).

[0113] Another aspect of the present disclosure provides a method for producing methionine, the method comprising: producing O-acetyl homoserine by culturing a microorganism in a culture medium; and converting O-acetyl homoserine into methionine by reacting O-acetyl homoserine with a sulfide, wherein the microorganism comprises at least any one of the following: a variant of the inner membrane protein YjeH, the variant having a homology of more than 95% and less than 100% with SEQ ID NO: 1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0114] SEQ ID NO: 1, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors comprising the polynucleotides, microorganisms comprising the same, and O-acetyl homoserine are as described above.

[0115] In the present disclosure, O-acetyl homoserine, which is a methionine precursor, can be converted into methionine via a reaction with sulfide.

[0116] The reaction with sulfide refers to a method of producing L-methionine from O-succinyl homoserine using any known method. For example, L-methionine can be produced by reacting methyl mercaptan (as sulfide) with O-acetyl homoserine. In addition, a catalyst or enzyme can be added, or the reaction can be carried out in a microorganism including an enzyme to increase the reaction rate and improve the yield.

[0117] The “sulfide” may be, for example, methyl mercaptan, and the methyl mercaptan may be any methyl mercaptan derivative capable of providing a sulfur atom, such as dimethyl sulfide (DMS) disclosed in International Publication No. WO 2010 / 098629, and sodium methyl mercaptan (CH3S-Na) in a liquid phase and methyl mercaptan (CH3SH) in a gaseous or liquid state.

[0118] As the enzyme used in the methionine conversion reaction, cystathionine-γ-synthase, O-acetyl homoserine sulfhydrylase or O-succinyl homoserine sulfhydrylase well known in the art can be used.

[0119] The process of the methionine conversion reaction of the present disclosure can be represented by the following reaction scheme:

[0120]

[0121] In this reaction, the CH3S-residue of methyl mercaptan is replaced by the acetate residue of O-acetyl homoserine to produce L-methionine.

[0122] The reaction may be carried out at a temperature of 20° C. to 45° C. while maintaining the pH of the reaction medium in the range of 6 to 7, and pyridoxal 5′-phosphate may be added as a coenzyme.

[0123] The conversion of an L-methionine precursor to L-methionine in the presence of methyl mercaptan is an enzymatic reaction and is disclosed in International Publication No. WO 2008 / 013432. International Publication No. WO 2008 / 013432 provides details on the properties and preparation of a methionine converting enzyme having suitable activity for converting an L-methionine precursor to L-methionine in the presence of methyl mercaptan. Such a suitable methionine converting enzyme can be prepared using gene expression according to biotechnological methods.

[0124] The sequence of the gene encoding the enzyme with methionine conversion activity can be obtained from, but not limited to, the NCBI database (USA) and the DNA database (KEGG, Japan). For biological conversion, the gene can be cloned from the obtained gene sequence and then introduced into an expression vector. Specifically, the gene can be expressed in an active form from a pCL-CJI vector (CJ, Korea), which is an expression vector for Escherichia coli in a recombinant strain, and the expressed protein can be obtained from an enzyme solution of ultrasonic cell lysis. The strain expressing the methionine convertase and the expressed methionine convertase can be directly used in the methionine conversion reaction.

[0125] The methionine converting enzyme expressed from a gene or microbial strain expressing the methionine converting enzyme can be directly, partially or completely mixed with a fermentation supernatant or a fermentation broth, and an L-methionine precursor is accumulated in the fermentation supernatant or the fermentation broth to initiate the reaction. That is, the reaction can be initiated by adding the methionine converting enzyme or the microbial strain expressing the methionine converting enzyme to a fermentation solution in which O-acetyl homoserine has accumulated and adding methyl mercaptan thereto.

[0126] Specifically, O-acetyl homoserine accumulated in the fermentation solution can be converted into L-methionine by cystathionine-γ-synthase, O-acetyl homoserine sulfhydrylase, or O-succinyl homoserine sulfhydrylase.

[0127] The methionine conversion reaction can be confirmed using DTNB (5,5-dithiobis(2-nitro-benzoic acid), Sigma, USA), and the reaction product can be analyzed by HPLC. During the methionine conversion reaction, byproducts such as acetic acid can be additionally obtained via the reaction between methyl mercaptan and O-acetyl homoserine without a separate production process.

[0128] The enzymatic reaction between the L-methionine precursor and methyl mercaptan can be represented by the following reaction scheme:

[0129]

[0130] Under known optimal culture conditions and enzyme activation conditions, those skilled in the art can easily determine the method for producing methionine. The specific culture method and culture medium are as described above.

[0131] Another aspect of the present disclosure provides a method for producing glufosinate, the method comprising: producing O-acetyl homoserine or homoserine by culturing a microorganism in a culture medium; and converting the O-acetyl homoserine or homoserine into glufosinate, wherein the microorganism comprises at least any one of the following: a variant of the inner membrane protein YjeH, the variant having more than 95% and less than 100% homology with SEQ ID NO:1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0132] SEQ ID NO: 1, inner membrane protein YjeH, its variant, polynucleotide encoding the variant, vector comprising the polynucleotide, microorganism comprising the same, and homoserine are as described above.

[0133] As used herein, the term "glufosinate" refers to a widespread, naturally occurring herbicide produced by several species of Streptomyces soil bacteria and is also known as glufosinate.

[0134] In the present disclosure, O-acetyl homoserine or homoserine can be converted to glufosinate via multiple steps including halogenation.

[0135] The glufosinate conversion reaction is disclosed in, for example, CN 108516991 A. Specifically, the glufosinate conversion reaction may include: (1) a step of azeotropic dehydration of homoserine (Formula II) using an organic solvent in the presence of an acidic catalyst; and a step of adding a halogenating agent to the azeotropically dehydrated homoserine and performing halogenation to obtain L-3,6-bis(2-haloethyl)-2,5-diketopiperazine (Formula III); (2) a step of adding methylphosphinate diester or methylphosphite diester to L-3,6-bis(2-haloethyl)-2,5-diketopiperazine and performing an Abbov reaction using a high boiling point solvent in the presence of a catalyst to obtain a compound of Formula IV; and (3) a step of dissolving the compound of Formula IV in an acid and heating the solution to perform a hydrolysis reaction, removing the solvent after the reaction is completed, adding an alcohol thereto, and performing a conversion reaction by adding an alkylene oxide thereto to obtain glufosinate (Formula I).

[0136] The glufosinate conversion reaction using homoserine as a precursor can be represented by the following reaction scheme:

[0137]

[0138] The method for producing glufosinate-ammonium can be carried out using homoserine prepared by biological fermentation as a precursor according to the present disclosure. Glufosinate-ammonium can be prepared by azeotropic dehydration and halogenation with methylphosphonium to prepare L-3,6-bis(2-haloethyl)-2,5-diketopiperazine, Abbov reaction, and then hydrolysis reaction as described above.

[0139] Another aspect of the present disclosure provides a composition for producing homoserine, comprising a microorganism or a culture of a microorganism, wherein the microorganism comprises at least any one of the following: a variant of the inner membrane protein YjeH, the variant having more than 95% and less than 100% homology with SEQ ID NO:1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0140] Another aspect of the present disclosure provides a composition for producing O-acetyl homoserine, comprising a microorganism or a culture of a microorganism, wherein the microorganism comprises at least any one of the following: a variant of the inner membrane protein YjeH, the variant having more than 95% and less than 100% homology with SEQ ID NO:1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO:1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO:1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0141] SEQ ID NO: 1, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors comprising the polynucleotides, microorganisms comprising the same, homoserine and O-acetyl homoserine are as described above.

[0142] The composition for producing O-acetyl homoserine or homoserine may refer to a composition for producing O-acetyl homoserine or homoserine by a variant of the inner membrane protein YjeH of the present disclosure. The composition may include a variant of the inner membrane protein YjeH or a component capable of operating a variant of the inner membrane protein YjeH, but is not limited thereto. The variant of the inner membrane protein YjeH may be in the form of being inserted into a vector capable of expressing an operably linked gene in a host cell.

[0143] The composition may also include a cryoprotectant or excipient. The cryoprotectant or excipient may be a naturally occurring substance or a substance that does not exist naturally, but is not limited thereto. As another example, the cryoprotectant or excipient may be a substance that the microorganism does not naturally contact or a substance that is not naturally contained in the microorganism, but is not limited thereto.

[0144] Another aspect of the present disclosure provides use of a variant of inner membrane protein YjeH for producing O-acetyl homoserine or homoserine.

[0145] Another aspect of the present disclosure provides the use of a microorganism for producing O-acetyl homoserine or homoserine, wherein the microorganism comprises at least any one of the following: a variant of the inner membrane protein YjeH, the variant having more than 95% and less than 100% homology with SEQ ID NO: 1 and comprising: i) substitution of the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 with asparagine, ii) substitution of the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 with leucine, or iii) the substitutions described in i) and ii); a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

[0146] Homoserine, O-acetylhomoserine, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors comprising the polynucleotides, and microorganisms comprising the same are as described above.

[0147] [Invention Mode]

[0148] Hereinafter, the present disclosure will be described in more detail with reference to the following examples. However, the following examples are presented only for illustrating the present disclosure, and the scope of the present disclosure is not limited thereto.

[0149] Example 1: Construction of plasmid

[0150] Plasmid (pDCM2, Figure 1 , SEQ ID NO:37) is designed to insert and replace the gene in the coryneform bacterium chromosome, and uses the gene synthesis service of Bionics Co., Ltd. to synthesize.With reference to the paper (Gene, 145 (1994) 69-73) relevant to the sacB system commonly known in the art, plasmid is designed to contain the effective restriction enzyme to cloning.Synthetic pDCM2 plasmid has the following characteristics.

[0151] 1) Since the replication origin is active only in E. coli, the plasmid can replicate itself only in E. coli and cannot replicate itself in Corynebacterium.

[0152] 2) The plasmid contains the kanamycin resistance gene as a selection marker.

[0153] 3) The plasmid contains the Levan sucrose gene (sacB) as a secondary positive selection marker.

[0154] The finally prepared strain does not retain the genetic information derived from the pDCM2 plasmid.

[0155] Example 2: Construction of strains introducing variant exogenous membrane proteins (YjeH) and production of O-acetyl homoserine and Evaluation of homoserine capacity

[0156] 2-1. Construction of strains introducing exogenous membrane protein (YjeH) and variant YjeH

[0157] In order to evaluate the effectiveness of YjeH introduced into Corynebacterium glutamicum ATCC13032 as an exogenous membrane protein and O-acetylhomoserine exporter, a vector for chromosomal insertion containing the yjeH gene (SEQ ID NO: 2) encoding YjeH derived from Escherichia coli was prepared.

[0158] Specifically, in order to construct a transposase deletion vector, a pair of primers (SEQ ID NOs: 4 and 5) for amplifying the 5' upstream region and a pair of primers (SEQ ID NOs: 6 and 7) for amplifying the 3' downstream region were designed relative to the gene encoding the transposase (SEQ ID NO: 3, gene number NCgl2335). The primers of SEQ ID NOs: 5 and 6 were designed to cross each other. The restriction enzyme SmaI sequence is located in this region. The primer sequences are shown in Table 1 below.

[0159] Table 1

[0160]

[0161] PCR was performed using the chromosome of wild type (WT) ATCC13032 as a template and primers of SEQ ID NOs: 4 and 5 and SEQ ID NOs: 6 and 7. PCR was performed under the following conditions. After denaturation at 95°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds were repeated, followed by polymerization at 72°C for 7 minutes. As a result, a DNA fragment of 851 bp 5' upstream region and 847 bp 3' downstream region relative to the NCgl2335 gene deletion region was obtained.

[0162] PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NO: 4 and 7. PCR was performed under the following conditions. After denaturation at 95°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds were repeated, followed by polymerization at 72°C for 7 minutes. As a result, a 1648 bp DNA fragment was amplified, which included a region capable of deleting a gene encoding a transposase (SEQ ID NO: 3, gene number NCgl2335).

[0163] pDCM2 vector treated with restriction enzyme SmaI and The PCR products obtained were cloned by fusion cloning with HD cloning kit (Clontech). The cloned vector was used to transform E. coli DH5α, and the transformed E. coli was plated on LB solid medium containing kanamycin (25 mg / L). The colonies transformed with the plasmid inserted with the target gene were selected by PCR, and the plasmid was obtained using a plasmid extraction method. Finally, the pDCM2-ΔNCgl2335 recombinant vector containing the cloned NCgl2335 deletion cassette was constructed.

[0164] In order to evaluate the effectiveness of O-acetyl homoserine export protein, a vector for chromosome insertion containing a gene (SEQ ID NO:2) encoding YjeH derived from Escherichia coli was prepared. To this end, a vector expressing the yjeH gene was constructed using the CJ7 promoter (SEQ ID NO:8, US 7662943 B2). A pair of primers (SEQ ID NO:9 and 10) for amplifying the CJ7 promoter region and a pair of primers (SEQ ID NO:11 and 12) for amplifying the yjeH region of Escherichia coli were designed. The primer sequences are shown in Table 2 below.

[0165] Table 2

[0166]

[0167] PCR was performed using pECCG117-PCJ7-gfp (US 7662943 B2) as a template and primers of SEQ ID NOs: 9 and 10, and using the chromosome of wild-type Escherichia coli as a template and primers of SEQ ID NOs: 11 and 12. PCR was performed under the following conditions. After denaturation at 95°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds were repeated, followed by polymerization at 72°C for 7 minutes. As a result, a 360bp DNA fragment of the CJ7 promoter region and a 1297bp DNA fragment of the yjeH gene of Escherichia coli were obtained.

[0168] PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NO: 9 and 12. PCR was performed under the following conditions. After denaturation at 95°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds were repeated, followed by polymerization at 72°C for 7 minutes. As a result, a 1614 bp DNA fragment containing a region where the CJ7 promoter and yjeH gene were inserted was amplified.

[0169] use The gene deletion DNA fragment obtained by PCR was cloned into the pDCM2-ΔNCgl2335 vector treated with the restriction enzyme SmaI using the HD cloning kit (Clontech). Finally, the pDCM2-ΔNCgl2335::PCJ7-yjeH (eco, WT) recombinant vector was constructed.

[0170] Specifically, using pDCM2-ΔNCgl2335::PCJ7-yjeH (eco, WT) plasmid as a template and primers of SEQ ID NO: 13 and 14, phenylalanine (Phe) (F92N) was substituted with asparagine (Asn), which is the 92nd amino acid of the amino acid sequence of YjeH. The constructed plasmid containing the gene encoding variant YjeH (F92N) was named pDCM2-ΔNCgl2335::PCJ7-yjeH (eco, F92N).

[0171] In addition, using pDCM2-ΔNCgl2335::PCJ7-yjeH (eco, WT) plasmid as a template and primers of SEQ ID NOS: 15 and 16, phenylalanine (Phe) (F351L) was substituted with leucine, which is the 351st amino acid of the amino acid sequence of YjeH. The constructed plasmid containing the gene encoding variant YjeH (F351L) was named pDCM2-ΔNCgl2335::PCJ7-yjeH (eco, F351L). The primer sequences are shown in Table 3 below.

[0172] Table 3

[0173] SEQ ID NO: sequence name sequence SEQ ID NO:13 F92N F CGGCTGGCTGAATTTATCGGTCA SEQ ID NO:14 F92N R TGACCGATAAATTCAGCCAGCCG SEQ ID NO:15 F351L F CAATGGCATCCTTATTATGATTT SEQ ID NO:16 F351L R AAATCATAATAAGGATGCCATTG

[0174] The ATCC13032 strain was transformed with each of the constructed pDCM2-ΔNCgl2335, pDCM2-ΔNCgl2335::PCJ7-yjeH (eco, WT), pDCM2-ΔNCgl2335::PCJ7-yjeH (eco, F92N) and pDCM2-ΔNCgl2335::PCJ7-yjeH (eco, F351L) using the electric pulse method, and a secondary cross was performed. The replacement process was performed to obtain ATCC13032ΔNCgl2335, ATCC13032ΔNCgl2335::PCJ7-yjeH (eco, WT), ATCC13032ΔNCgl2335::PCJ7-yjeH (eco, F92N) and ATCC13032ΔNCgl2335::PCJ7-yjeH (eco, F351L), in which the NCgl2335 gene was deleted from the chromosome. By performing PCR using primers of SEQ ID NO: 4 and 7 and comparing the results with those of ATCC13032 in which the NCgl2335 gene was not inactivated, the inactivated NCgl2335 gene and the insertion of the newly introduced E. coli yjeH gene were identified.

[0175] 2-2. Evaluation of the ability to produce O-acetyl homoserine

[0176] In order to compare the O-acetyl homoserine (O-AH) production ability of ATCC13032ΔNCgl2335, ATCC13032ΔNCgl2335::PCJ7-yjeH(eco, WT), ATCC13032ΔNCgl2335::PCJ7-yjeH(eco, F92N) and ATCC13032ΔNCgl2335::PCJ7-yjeH(eco, F351L) constructed in Example 2-1 with the O-acetyl homoserine (O-AH) production ability of the wild-type strain ATCC13032, O-acetyl homoserine contained in the culture was analyzed according to the following method.

[0177] One inoculation loop of each strain was inoculated into a 250 mL baffled flask containing 25 mL of the following medium, and then cultured at 33° C. for 20 hours while shaking at 200 rpm. The concentration of O-acetyl homoserine was analyzed using HPLC, and the analyzed concentrations are shown in Table 4.

[0178] O-Acetylhomoserine production medium (pH 7.2)

[0179] 30 g glucose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g (10 mL) corn steep liquor (CSL, Sigma), 0.5 g MgSO4.7H2O and 20 g CaCO3 (based on 1 L distilled water)

[0180] Table 4

[0181]

[0182] The results confirmed that when ATCC13032 as a control was cultured, O-acetyl-L-homoserine was accumulated at a concentration of 0.3 g / L, and that the production of O-acetyl-L-homoserine was not affected by the deletion of the NCgl2335 gene (transposase), as shown in Table 4. In particular, it was confirmed that when the wild-type yjeH gene was expressed, O-acetyl-L-homoserine was accumulated at a concentration of 0.7 g / L, and when the variant yjeH gene was expressed, O-acetyl-L-homoserine was accumulated at concentrations of 1.2 g / L and 1.0 g / L.

[0183] Therefore, based on the results shown above, it was confirmed that the wild-type and variant yjeH genes of the present disclosure significantly increased the production of the target amino acid by exporting O-acetyl homoserine from ATCC13032.

[0184] The ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F92N) and ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) strains were named Corynebacterium glutamicum CM04-0651 and Corynebacterium glutamicum CM04-0652, respectively, and were deposited in the Korean Collection of Microorganisms on December 4, 2019 in accordance with the Budapest Treaty, with the deposit numbers KCCM12633P and KCCM12634P, respectively.

[0185] 2-3. Evaluation of homoserine production ability

[0186] In order to compare the homoserine production ability of ATCC13032ΔNCgl2335, ATCC13032ΔNCgl2335::PCJ7-yjeH(eco, WT), ATCC13032ΔNCgl2335::PCJ7-yjeH(eco, F92N) and ATCC13032ΔNCgl2335::PCJ7-yjeH(eco, F351L) constructed in Example 2-1 with the homoserine production ability of the wild-type strain ATCC13032, the homoserine contained in the culture was analyzed according to the following method.

[0187] One inoculation loop of each strain was inoculated into a 250 mL baffled flask containing 25 mL of the following medium, and then cultured at 33° C. for 20 hours while shaking at 200 rpm. The concentration of homoserine was analyzed using HPLC, and the analyzed concentrations are shown in Table 5.

[0188] Homoserine production medium (pH 7.2)

[0189] 30 g glucose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g (10 mL) corn steep liquor (CSL, Sigma), 0.5 g MgSO4.7H2O and 20 g CaCO3 (based on 1 L distilled water)

[0190] Table 5

[0191] Strain name Homoserine(g / L) ATCC13032 0.0 ATCC13032ΔNCgl2335 0.0 ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,WT) 0.0 ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F92N) 0.2 ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) 0.2

[0192] The results confirmed that when ATCC13032 as a control was cultured, homoserine was not accumulated at a concentration of 0.0 g / L, and the production of homoserine was not affected by the deletion of the NCgl2335 gene (transposase), as shown in Table 5. In particular, it was also confirmed that when the wild-type yjeH gene was expressed, homoserine was not accumulated at a concentration of 0.0 g / L, and when the variant yjeH gene was expressed, homoserine was accumulated at concentrations of 0.2 g / L and 0.2 g / L.

[0193] Therefore, based on the results shown above, it was confirmed that the variant yjeH gene of the present disclosure increased the production of the target amino acid by exporting homoserine from ATCC13032.

[0194] Example 3: Construction of strains with enhanced ability to produce O-acetyl homoserine and evaluation of strains producing O-acetyl homoserine Capacity of acylhomoserine and homoserine

[0195] 3-1. Inactivation of cystathionine gamma (γ)-synthase (MetB)

[0196] Using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as template, obtained the metB gene of the cystathionine gamma-synthase that coding participates in O-acetyl homoserine degradation pathway via PCR. Information about the nucleotide sequence of metB gene (NCBI number: Ncgl2360, SEQ ID NO:17) is available from the GenBank of National Institutes of Health (National Institutes of Health) (USA), and based on this synthesis comprises the N-terminal of metB gene and the primer (SEQ ID NO:18 and 19) of joint and comprises the primer (SEQ ID NO:20 and 21) of C-terminal and joint.Primer sequence is shown in the following table 6.

[0197] Table 6

[0198]

[0199] PCR was performed using chromosomal DNA of ATCC13032 as a template and primers of SEQ ID NOs: 18 and 19 and SEQ ID NOs: 20 and 21. TM High reliability DNA polymerase (Stratagene) was used as a polymerase, and PCR was performed by repeating 30 cycles of denaturation at 96° C. for 30 seconds, annealing at 53° C. for 30 seconds, and polymerization at 72° C. for 1 minute. As a result, an amplified 558 bp gene containing the N-terminus and linker of the metB gene and an amplified 527 bp gene containing the C-terminus and linker of the metB gene were obtained, respectively.

[0200] Using the two amplified genes obtained as described above as templates, PCR was performed by repeating 10 cycles of denaturation at 96°C for 60 seconds, annealing at 50°C for 60 seconds and polymerization at 72°C for 1 minute, and then adding primers of SEQ ID NOs: 18 and 21 thereto, followed by polymerization 20 times. As a result, a 1064 bp inactivation box including the N-terminus-linker-C-terminus of the metB gene was obtained. The obtained PCR product was treated with restriction enzymes XbaI and SalI and ligated to the pDCM2 vector treated with restriction enzymes XbaI and SalI for cloning to finally construct a pDCM2-ΔmetB recombinant vector cloned with the metB inactivation box.

[0201] ATCC13032 was transformed with the constructed pDCM2-ΔmetB vector using the electric pulse method and a secondary crossover process was performed to obtain ATCC13032ΔmetB, in which the metB gene was inactivated in the chromosome. The inactivated metB gene was finally confirmed by comparison with ATCC13032 in which the metB gene was not inactivated after PCR using primers of SEQ ID NO: 18 and 21.

[0202] 3-2. Inactivation of O-acetylhomoserine (thiol) lyase (MetY)

[0203] Using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as template, the metY gene of the O-acetyl homoserine (thiol) lyase encoding the O-acetyl homoserine degradation pathway was obtained via PCR. Information about the nucleotide sequence of metY gene (NCBI No. Ncgl0625, SEQ ID NO:22) was obtained from the GenBank of the National Institutes of Health (USA), and based on this synthesis, primers (SEQ ID NO:23 and 24) comprising the N-terminus and joints of metY gene and primers (SEQ ID NO:25 and 26) comprising the C-terminus and joints were prepared. Primer sequences are shown in Table 7 below.

[0204] Table 7

[0205]

[0206] PCR was performed using chromosomal DNA of ATCC13032 as a template and primers of SEQ ID NOs: 23 and 24 and SEQ ID NOs: 25 and 26. TMHigh reliability DNA polymerase (Stratagene) was used as a polymerase, and PCR was performed by repeating 30 cycles of denaturation at 96°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 1 minute. As a result, an amplified 548bp gene containing the N-terminus and the linker of the metY gene and an amplified 550bp gene containing the C-terminus and the linker of the metY gene were obtained, respectively. Using the two amplified genes obtained as described above as templates, 10 cycles of denaturation at 96°C for 60 seconds, annealing at 50°C for 60 seconds, and polymerization at 72°C for 1 minute were repeated, and then primers of SEQ ID NOs: 23 and 26 were added thereto, followed by polymerization 20 times for PCR. As a result, a 1077bp inactivation box including the N-terminus-linker-C-terminus of the metY gene was obtained. The obtained PCR product was treated with restriction enzymes XbaI and SalI and ligated to the pDCM2 vector treated with restriction enzymes XbaI and SalI for cloning to finally construct the pDCM2-ΔmetY recombinant vector cloned with the metY inactivation cassette.

[0207] The ATCC13032ΔmetB was transformed with the constructed pDCM2-ΔmetY vector using the electric pulse method and a secondary crossover process was performed to obtain ATCC13032ΔmetBΔmetY, in which the metY gene was inactivated in the chromosome. The inactivated metY gene was finally confirmed by comparison with ATCC13032 in which the metY gene was not inactivated after PCR using primers of SEQ ID NO: 23 and 26.

[0208] 3-3. Introduction of aspartate kinase variant (lysC)

[0209] In order to maximize the output of O-acetyl homoserine, the lysC gene (SEQ ID NO:27) in the Corynebacterium glutamicum ATCC13032 source of encoding aspartate kinase is introduced into mutation (L377K), for enhancing the expression of lysC gene and alleviating the feedback inhibition (US 10662450 B2) of L-Methionine and L-Threonine. In order to prepare the carrier comprising lysC gene variant, a pair of primers (SEQ ID NO:28 and 29) for increasing 5 ' upstream region and a pair of primers (SEQ ID NO:30 and 31) for increasing 3 ' downstream region are designed relative to the mutation position. XbaI and SaII restriction enzyme region are inserted into the two ends of the primer of SEQ ID NO:28 and 31, the primer of design SEQ ID NO:29 and 30 is to intersect each other, and nucleotide replacement is positioned in this region. The sequence of primer is as shown in table 8 below.

[0210] Table 8

[0211] SEQ ID NO sequence name sequence SEQ ID NO:28 lysC_L377K_5F TCCTCTAGAGCTGCGCAGTGTTGAATACG SEQ ID NO:29 lysC_L377K_5R AGGTGGAAATCTTTTCGATGTTC SEQ ID NO:30 lysC_L377K_3F GAACATCGAAAAGATTTCCACCT SEQ ID NO:31 lysC_L377K_3R GACTCTAGAGTTCACCTCAGAGACGATTA

[0212] Use the chromosome of Corynebacterium glutamicum ATCC13032 to carry out PCR as template and SEQ ID NO:28 and 29 and SEQ IDNO:30 and 31 primers.Carry out PCR under the following conditions.After 95 ℃ of denaturation for 5 minutes, repeat at 95 ℃ of denaturation for 30 seconds, anneal at 55 ℃ for 30 seconds and at 72 ℃ of polymerization for 30 seconds 30 cycles, then carry out polymerization at 72 ℃ for 7 minutes.As a result, obtained the 512bp DNA fragmentation at 5 ' upstream zone and the 522bp DNA fragmentation at 3 ' downstream zone with respect to the sudden change of lysC gene.

[0213] PCR was performed using two amplified DNA fragments as templates and primers of SEQ ID NO:28 and 31. PCR was performed under the following conditions. After denaturation at 95°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds and polymerization at 72°C for 60 seconds were repeated, and then polymerization was performed at 72°C for 7 minutes. As a result, a 1011bp DNA fragment comprising a lysC variant (L377K) gene encoding an aspartate kinase variant was amplified, in which the leucine at position 377 was replaced by lysine.

[0214] The lysC(L377K) fragment obtained by PCR was treated with restriction enzymes XbaI and SalI at both ends and ligated to the pDCM2 vector treated with restriction enzymes XbaI and SalI, followed by cloning to finally obtain the pDCM2-lysC(L377K) recombinant vector cloned with the lysC(L377K) replacement cassette.

[0215] By the pDCM2-lysC (L377K) carrier transformation ATCC13032ΔmetBΔmetY bacterial strain of preparation with the electric pulse method, and carry out the second time crossover process, to obtain the Corynebacterium glutamicum ATCC 13032ΔmetBΔmetY lysC (L377K) of introducing lysC gene variant on chromosome.By using the primer of SEQ ID NO:28 and 31 to carry out PCR, then by order-checking, sequence and the sequence of wild-type lysC gene are compared, finally identify variant gene.

[0216] 3-4. Construction of plasmid for introducing O-acetyl homoserine transferase (MetX)

[0217] In order to amplify the gene encoding O-acetyl homoserine transferase (MetX), information on the nucleotide sequence of the metX gene (NCBI No. NCgl0624, SEQ ID NO: 32) was obtained from GenBank of the National Institutes of Health (USA), and BamHI restriction enzyme sites were inserted into both ends of each primer (SEQ ID NO: 33 and 34) to amplify from the promoter region (located about 300 bp upstream of the start codon) to the terminator region (located about 100 bp downstream of the stop codon) based on this. PCR was performed under the following conditions. After denaturation at 95°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds were repeated, and then polymerization was performed at 72°C for 7 minutes. As a result, a 1546 bp DNA fragment of the metX gene coding region was obtained. The pECCG117 vector (KR 10-0057684B1) and the metX DNA fragment were treated with restriction enzyme BamHI, ligated using DNA ligase, and cloned to obtain a plasmid designated as pECCG117-metX WT. The sequences of the primers are shown in Table 9 below.

[0218] Table 9

[0219] SEQ ID NO sequence name sequence SEQ ID NO:33 F GGATCCCCTCGTTGTTCACCCAGCAACC SEQ ID NO:34 metX R GGATCCCAAAGTCACAACTACTTATGTTAG

[0220] 3-5. Construction of strains producing O-acetyl homoserine and evaluation of their ability to produce O-acetyl homoserine

[0221] After the pECCG117-metX WT vector prepared in Example 3-4 was introduced into Corynebacterium glutamicum ATCC13032ΔmetBΔmetY lysC (L377K) using an electric pulse method, the strain was spread on a selective medium containing kanamycin (25 mg / L) and cultured to obtain transformants.

[0222] In order to compare the O-acetyl homoserine-producing abilities of the strains, the strains were cultured by the following method, and O-acetyl homoserine contained in the culture was analyzed.

[0223] One inoculation loop of each strain was inoculated into a 250 mL baffled flask containing 25 mL of the following medium, and then cultured at 37° C. for 20 hours while shaking at 200 rpm. The concentration of O-acetyl homoserine was analyzed using HPLC, and the analyzed concentrations are shown in Table 10.

[0224] O-Acetylhomoserine production medium (pH 7.2)

[0225] 30 g glucose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g (10 mL) corn steep liquor (CSL, Sigma), 0.5 g MgSO4.7H2O, 400 mg methionine and 20 g CaCO3 (based on 1 L distilled water)

[0226] Table 10

[0227] strain O-AH(g / L) ATCC13032ΔmetBΔmetY lysC(L377K) 0.7 ATCC13032ΔmetBΔmetY lysC(L377K) / pECCG117-metX WT 1.3

[0228] The results confirmed that when ATCC13032ΔmetBΔmetY lysC (L377K) as a control was cultured, O-acetyl-L-homoserine was accumulated at a concentration of 0.7 g / L, and when ATCC13032ΔmetBΔmetY lysC (L377K) / pECCG117-metX WT strain was cultured as shown in Table 10, O-acetyl-L-homoserine was accumulated at a concentration of 1.3 g / L.

[0229] Therefore, based on the results shown above, an increase in the production of O-acetyl-L-homoserine was confirmed in the ATCC13032ΔmetBΔmetY lysC(L377K) / pECCG117-metX WT strain.

[0230] 3-6. Evaluation of homoserine production capacity

[0231] The pECCG117-metX WT vector constructed in Example 3-4 was introduced into Corynebacterium glutamicum ATCC13032ΔmetBΔmetYlysC (L377K) constructed in Example 3-3 using an electric pulse method, plated on a selective medium containing kanamycin (25 mg / L) and cultured to obtain transformants.

[0232] In order to compare the homoserine-producing abilities of the strains, the strains were cultured by the following method, and homoserine contained in the cultures was analyzed.

[0233] One inoculation loop of each strain was inoculated into a 250 mL baffled flask containing 25 mL of the following medium, and then cultured at 37° C. for 20 hours while shaking at 200 rpm. The concentration of homoserine was analyzed using HPLC, and the analyzed concentrations are shown in Table 11.

[0234] Homoserine production medium (pH 7.2)

[0235] 30 g glucose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g (10 mL) corn steep liquor (CSL, Sigma), 0.5 g MgSO4.7H2O, 400 mg methionine and 20 g CaCO3 (based on 1 L distilled water)

[0236] Table 11

[0237]

[0238] As a result, it was confirmed that homoserine accumulated at a concentration of 0.2 g / L when ATCC13032ΔmetBΔmetYlysC(L377K) was cultured as a control, and that homoserine accumulated at a concentration of 0.2 g / L when ATCC13032ΔmetBΔmetYlysC(L377K) / pECCG117-metX WT strain was cultured, as shown in Table 11.

[0239] Therefore, based on these results, it was confirmed that the ATCC13032ΔmetBΔmetY lysC(L377K) / pECCG117-metX WT strain had the same level of homoserine production.

[0240] Example 4: Introduction of an exogenous membrane protein (YjeH) with enhanced ability to produce O-acetyl homoserine Construction of strains and evaluation of their ability to produce O-acetyl homoserine

[0241] 4-1. Introduction of exogenous membrane protein (YjeH) variants

[0242] The pDCM2-ΔNCgl2335, pDCM2-ΔNCgl2335::PCJ7-yjeH(eco, WT), pDCM2-ΔNCgl2335::PCJ7-yjeH(eco, F92N) and pDCM2-ΔNCgl2335::PCJ7-yjeH(eco, F351L) vectors previously constructed in Example 2-1 were used to transform the Corynebacterium glutamicum ATCC13032ΔmetBΔmetY lysC(L377K) strain constructed in Example 3-3, and a secondary crossover process was performed to obtain ATCC13032ΔmetBΔmetY lysC(L377K)ΔNCgl2335, ATCC13032ΔmetBΔmetY lysC (L377K) ΔNCgl2335:: PCJ7-yjeH (eco, WT), ATCC13032 ΔmetB ΔmetY lysC (L377K) ΔNCgl2335:: PCJ7-yjeH (eco, F92N) and ATCC13032 ΔmetB ΔmetY lysC (L377K) ΔNCgl2335:: PCJ7-yjeH (eco, F351L), in which the NCgl2335 gene (transposase) is deleted from the chromosome. By performing PCR using primers of SEQ ID NO: 4 and 7 and comparing the results with those of ATCC13032 in which the NCgl2335 gene was not inactivated, the inactivated NCgl2335 gene and the insertion of the newly introduced E. coli yjeH gene were identified.

[0243] 4-2. Construction of strain producing O-acetyl homoserine and evaluation of ability to produce O-acetyl homoserine

[0244] After the pECCG117-metX WT vector prepared in Example 3-4 was introduced into ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335, ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, WT), ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, F92N) and ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, F351L) prepared in Example 4-1 using an electric pulse method, the strains were spread on a selective medium containing kanamycin (25 mg / L) and cultured to obtain transformants.

[0245] In order to compare the O-acetyl homoserine-producing abilities of the strains, the strains were cultured by the following method, and O-acetyl homoserine contained in the culture was analyzed.

[0246] One inoculation loop of each strain was inoculated into a 250 mL baffled flask containing 25 mL of the O-acetyl homoserine production medium (pH 7.2) of Example 3-5, and then cultured with shaking at 200 rpm for 20 hours at 33° C. The concentration of O-acetyl homoserine was analyzed using HPLC, and the analyzed concentrations are shown in Table 12.

[0247] Table 12

[0248]

[0249]

[0250] The results confirmed that when Corynebacterium glutamicum ATCC13032ΔmetBΔmetY lysC (L377K) was cultured as a control, O-acetyl-L-homoserine was accumulated at a concentration of 1.3 g / L, and the yield of O-acetyl-L-homoserine was not affected by the deletion of the NCgl2335 gene (transposase), as shown in Table 12. In particular, it was confirmed that when the wild-type yjeH gene was expressed, O-acetyl-L-homoserine was accumulated at a concentration of 2.1 g / L, and when the variant yjeH gene was expressed, O-acetyl-L-homoserine was accumulated at concentrations of 2.7 g / L and 2.3 g / L.

[0251] Therefore, based on the results shown above, it was confirmed that the wild-type and variant yjeH genes of the present disclosure significantly increased the production of the target amino acid by exporting O-acetyl-L-homoserine from Corynebacterium glutamicum ATCC13032.

[0252] 4-3. Evaluation of homoserine production capacity

[0253] After the pECCG117-metX WT vector prepared in Example 3-4 was introduced into ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335, ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, WT), ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, F92N) and ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, F351L) prepared in Example 4-1 using an electric pulse method, the strains were spread on a selective medium containing kanamycin (25 mg / L) and cultured to obtain transformants.

[0254] In order to compare the homoserine-producing abilities of the strains, the strains were cultured by the following method, and homoserine contained in the cultures was analyzed.

[0255] One inoculation loop of each strain was inoculated into a 250 mL baffled flask containing 25 mL of the following medium, and then cultured at 33° C. for 20 hours while shaking at 200 rpm. The concentration of homoserine was analyzed using HPLC, and the analyzed concentrations are shown in Table 13.

[0256] Homoserine production medium (pH 7.2)

[0257] 30 g glucose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g (10 mL) corn steep liquor (CSL, Sigma), 0.5 g MgSO4.7H2O, 400 mg methionine and 20 g CaCO3 (based on 1 L distilled water)

[0258] Table 13

[0259]

[0260] The results confirmed that when Corynebacterium glutamicum ATCC13032ΔmetBΔmetY lysC (L377K) was cultured as a control, homoserine was accumulated at a concentration of 0.2 g / L, and the production of homoserine was not affected by the deletion of the NCgl2335 gene (transposase), as shown in Table 13. In particular, it was confirmed that when the wild-type yjeH gene was expressed, homoserine was accumulated at a concentration of 0.2 g / L, and when the variant yjeH gene was expressed, homoserine was accumulated at concentrations of 1.2 g / L and 0.7 g / L.

[0261] Therefore, based on the results shown above, it was confirmed that the wild-type and variant yjeH genes of the present disclosure significantly increased the production of the target amino acid by exporting homoserine from Corynebacterium glutamicum ATCC13032.

[0262] Example 5: Production of methionine (MET) using conversion reaction of O-acetyl homoserine produced by strains

[0263] After the pECCG117-metX WT vector prepared in Example 3-4 was introduced into ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335, ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, WT), ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, F92N) and ATCC13032ΔmetBΔmetYlysC(L377K)ΔNCgl2335::PCJ7-yjeH(eco, F351L) prepared in Example 4-1 using an electric pulse method, the strains were spread on a selective medium containing kanamycin (25 mg / L) and cultured to obtain transformants.

[0264] In addition, according to the method disclosed in the previously submitted patent document (WO2008 / 013432), the metZ gene encoding O-succinyl homoserine sulfhydrylase from Pseudomonas aeruginosa and Pseudomonas putida was cloned, which will be used to convert O-acetyl homoserine into methionine. The metZ gene of Pseudomonas aeruginosa and Pseudomonas putida was obtained by using the chromosome of each strain as a template and primers as follows: denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 2 minutes to obtain DNA fragments. The obtained DNA fragment was digested with NdeI / PacI and cloned into the pCL-CJ1 vector (CJ, Korea) digested with the same enzymes. Escherichia coli W3110 cells were transformed with cloned vectors and cultured in LB plate medium containing 50 μg / L spectinomycin, and then colonies were selected. The selected colonies were inoculated into 3 mL LB medium containing 50 μg / L spectinomycin and cultured overnight at 37 ° C. The cultured cells were recovered, washed with 0.1 M potassium phosphate buffer (pH 7.5), suspended in 200 μL potassium phosphate buffer, and lysed by ultrasonic treatment 5 times at 30 second intervals. The cell lysate was centrifuged at 12,000 rpm for 10 minutes, and the supernatant was obtained to quantify the total protein level using Bio-Rad protein quantitative solution (Bio-Rad, USA). Protein expression was identified by SDS-PAGE. The supernatant obtained from the cell extract was used for enzymatic conversion reaction.

[0265] In addition, the metz gene encoding O-succinylhomoserine sulfhydrylase from Hyphomonas neptunium was cloned. In the same manner as above, PCR was performed using the chromosome of Hyphomonas neptunium as a template and primers to obtain DNA fragments. The obtained DNA fragments were digested with NdeI / AvrII and cloned into the pCL-CJ1 vector (CJ, Korea) digested with the same enzymes. The cloned vector was used to obtain the supernatant in the same manner as above and used for enzymatic transformation reactions.

[0266] Each of the W3110 strains transformed with a metz expression vector derived from Pseudomonas and transformed with a metz expression vector derived from Mycelium was inoculated onto an LB plate medium containing spectinomycin as an antibiotic and cultured overnight at a temperature of 30°C to 40°C. Then, a single colony was inoculated into 40mL of LB medium containing spectinomycin and cultured at a temperature of 30°C to 40°C for 5 hours. At a temperature of 30°C to 40°C, the metZ expression strain derived from Pseudomonas and the metZ expression strain derived from Mycelium were cultured at 600rpm to 900rpm in a 1L fermentation bath for 15 to 30 hours to obtain a fermentation broth. The culture medium used in the culture is as follows. The cells of the obtained fermentation broth were lysed by ultrasonic treatment to prepare an enzyme solution.

[0267] 2XYT medium

[0268] 10g yeast extract, 16g tryptophan, 40g glucose and 50g spectinomycin (based on 1L distilled water)

[0269] Methionine conversion reaction was carried out by adding O-succinyl homoserine sulfhydrylase solutions derived from Pseudomonas and Mycelium to the culture of the transformant producing O-acetyl homoserine. 0.1 L of enzyme solution was added to 2.0 L of O-acetyl homoserine culture without removing cells, and 0.3 L of 15% sodium methyl mercaptan solution was added thereto to initiate the reaction. After 2 hours, the fermentation broth was recovered, cells were removed therefrom, and the concentration of methionine produced was identified by HPLC. The concentration analyzed is shown in Table 14.

[0270] Table 14

[0271]

[0272] The above description of the present invention is provided for the purpose of illustration, and it will be appreciated by those skilled in the art that various changes and modifications may be made without changing the technical concept and basic features of the present invention. Therefore, it is apparent that the above embodiments are illustrative in all respects and do not limit the present invention. Therefore, the scope of the present disclosure is not limited by the detailed description, but by the claims and their equivalents, and all changes within the scope of the claims and their equivalents will be interpreted as being included in the present disclosure.

[0273]

[0274]

Claims

1. A variant of the inner membrane protein YjeH, wherein: i) replacing the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 with asparagine, ii) replacing the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 with leucine, or iii) replacing the amino acid at position 92 of the amino acid sequence corresponding to SEQ ID NO: 1 with asparagine and replacing the amino acid at position 351 of the amino acid sequence corresponding to SEQ ID NO: 1 with leucine.

2. A variant according to claim 1, wherein the variant has an output O -Acetyl homoserine or homoserine capacity.

3. A polynucleotide encoding the variant of claim 1.

4. A vector comprising the polynucleotide of claim 3.

5. A microorganism comprising at least one of the following: A variant of the inner membrane protein YjeH according to claim 1; and A polynucleotide encoding the variant.

6. The microorganism according to claim 5, wherein the microorganism has enhanced production of O -Acetyl homoserine or homoserine capacity.

7. The microorganism according to claim 5, wherein the microorganism belongs to Corynebacterium ( Corynebacterium ) belongs to.

8. A method for producing a target product, comprising culturing the microorganism of claim 5, wherein the target product is O -Acetyl homoserine or homoserine.

9. The method according to claim 8, further comprising recovering the target product from the culture medium or the microorganism.

10. A method for producing methionine, the method comprising: Produced by culturing the microorganism according to claim 5 O -Acetyl homoserine; as well as By making the O -Acetyl homoserine reacts with sulfide to convert the O -Acetyl homoserine is converted to methionine.

11. A method for producing glufosinate-ammonium, the method comprising: Produced by culturing the microorganism according to claim 5 O -Acetylhomoserine or homoserine; as well as The O -Acetyl homoserine or homoserine is converted to glufosinate.

12. A composition for producing homoserine, comprising the microorganism according to claim 5 or a culture of the microorganism.

13. Used to generate O - A composition of acetyl homoserine, comprising the microorganism according to claim 5 or a culture of the microorganism.

14. The variant of inner membrane protein YjeH according to claim 1 is used for producing O - Use of acetyl homoserine or homoserine.

15. The microorganism according to claim 5 is used for producing O - Use of acetyl homoserine or homoserine.

Images