Application of cyp19a1b as a biomarker for combined exposure to tritiated water and genistein

Abstract

The present invention relates to the use of cyp19a1b as a biomarker for combined exposure to tritiated water and genistein, and relates to the fields of genetic engineering and detection technology. In the present invention, zebrafish embryos are cultured in a culture medium and divided into a blank control group, a tritiated water group, a genistein group, and a tritiated water and genistein combination group. The growth process of the zebrafish embryos into zebrafish fry is then observed, and survival indicators of the zebrafish embryos and fry are recorded. Finally, zebrafish in the blank control group and the tritiated water and genistein combination group at 96 hpf are analyzed to screen for the biomarker for combined exposure to tritiated water and genistein.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and detection technology, and in particular to an application of cyp19a1b as a biomarker for combined poisoning by tritiated water and genistein. Background Art

[0002] Numerous species depend on aquatic systems for survival, and many also constitute a significant component of the human diet. Aquatic systems are the ultimate receptors for a range of pollutants. Water pollutants can accumulate in organisms through bioaccumulation, and when accumulated to a certain level, they can cause toxic effects. Most nuclear facilities are connected to rivers or oceans. Tritium, one of the primary radionuclides released into the natural environment by nuclear facilities, behaves chemically similar to hydrogen, forming water molecules, tritiated hydrogen, or biomolecules. This makes tritium highly susceptible to biological uptake, potentially causing internal radiation damage. Furthermore, tritium has a relatively long half-life (12.31 years), leading to its accumulation in organisms. Once these organisms are consumed by humans, tritium accumulates in the body, posing a threat to human health and safety. Therefore, understanding the effects of tritium on organisms is crucial. Existing research has primarily focused on the effects of tritium on organisms alone. However, natural media often contain mixtures of multiple chemicals. Once introduced into organisms, these chemicals may interact synergistically or antagonistically to affect the organism. First, a chemical can affect the availability of another chemical in vitro through precipitation or morphological changes, such as copper affecting the absorption of zinc by organisms. Second, a chemical can affect the uptake rate of another chemical, such as accelerating the entry of another chemical into the organism by promoting permeation or increasing the ventilation rate of aquatic organisms. Third, a chemical can affect the transport of another chemical to its target or inhibit or promote the conversion of other chemicals by interacting with biotransformation enzymes. Finally, different chemicals can compete for the same target or affect each other's biological metabolism. Therefore, considering the impact of a chemical on organisms alone may lead to an incorrect assessment of its hazard in the environment.

[0003] Among the many environmental exposures, endocrine disruptors (EDCs) are common, affecting ecosystem stability by interfering with the normal endocrine system. However, there are currently no studies examining the effects of simultaneous exposure to these two environmental pollutants on sensitive organisms. Genistein is a phytoestrogen found in high concentrations in soybeans. Studies have shown that genistein exhibits anti-proliferative and anti-differentiation effects in many tumor cells and has a preventive effect on certain cancers. However, other studies have demonstrated that high doses of genistein can cause necrosis and apoptosis in testicular cells, primary rat cortical neurons, human thymocytes, and human lymphocytes. Furthermore, in vitro studies have shown that genistein can cause abnormalities in the early development of Senegalese sole, induce apoptosis in the mouse brain, and affect the reproductive capacity of mice and their offspring.

[0004] As common water pollutants, the two not only threaten the stability of the surrounding ecological environment, but also threaten human health. Therefore, it is very necessary to study the biomarkers of combined exposure to the two. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides an application of cyp19a1b as a biomarker for the combined contamination of tritium water and genistein. It also has the potential to be used as a biomarker for tritium and other endocrine disruptors, laying the foundation for studying the combined effects of water pollutants.

[0006] The first object of the present invention is to provide a use of cyp19a1b as a biomarker for combined poisoning of tritiated water and genistein.

[0007] Furthermore, cyp19a1b was upregulated in individuals co-exposed to tritiated water and genistein.

[0008] Furthermore, screening the above biomarkers includes the following steps:

[0009] (1) Zebrafish embryos were cultured in culture medium and divided into blank control group, tritium water group, genistein group, and tritium water and genistein combined group;

[0010] (2) observing the growth process of the zebrafish embryos to the zebrafish larvae in step (1), and recording the survival indicators of the zebrafish embryos and the zebrafish larvae;

[0011] (3) Analyze the zebrafish at 96 hpf in the blank control group and the tritiated water and genistein combined group in step (2) to screen out the biomarkers of the tritiated water and genistein combined toxicity.

[0012] In one embodiment of the present invention, in step (1), the concentration of tritium water in the tritium water group and the tritium water and genistein combination group is 0.1-3.7*10 2Bq / mL.

[0013] In one embodiment of the present invention, in step (1), the concentration of genistein in the genistein group and the tritium water and genistein combination group is 0.1-1.4 mg / L.

[0014] In one embodiment of the present invention, in step (1), the culture medium in the blank control group is E3 culture medium.

[0015] In one embodiment of the present invention, in step (1), the components of the E3 culture solution are NaCl, KCl, CaCl2 and MgSO4.

[0016] In one embodiment of the present invention, in step (1), at least three parallel groups are set for each of the blank control group, tritium water group, genistein group, and tritium water and genistein combination group.

[0017] In one embodiment of the present invention, in step (1), the culture temperature is 28.5±1°C.

[0018] In one embodiment of the present invention, in step (2), the recorded time is 2 hpf-120 hpf.

[0019] In one embodiment of the present invention, in step (2), the survival indicators include heart malformation rate and heart rate.

[0020] The second object of the present invention is to provide a use of cyp19a1b in the preparation of a drug for preventing and treating tritiated water and genistein combined poisoning, wherein the drug inhibits the expression of the cyp19a1b gene in vivo.

[0021] Furthermore, the preventive and therapeutic drugs include cyp19a1b antagonists.

[0022] Furthermore, the antagonist substance is an antibody, siRNA, shRNA or a sequence packaged by a lentivirus.

[0023] Furthermore, the dosage form of the preventive and therapeutic drug is an injection or an oral targeted drug.

[0024] A third object of the present invention is to provide a use of cyp19a1b in preparing a detection kit for combined exposure to tritiated water and genistein. The detection kit includes a reagent for detecting the expression level of cyp19a1b. Cyp19a1b is upregulated in individuals exposed to the combined exposure to tritiated water and genistein. Therefore, by comparing the expression level of cyp19a1b in the tested individual with the expression level of cyp19a1b in normal individuals, it can be determined whether the tested individual has been exposed to the combined exposure to tritiated water and genistein.

[0025] The fourth object of the present invention is to provide a drug for preventing and treating the combined poisoning of tritiated water and lignin, which inhibits the expression of cyp19a1b, such as antagonistic substances of cyp19a1b: antibodies, siRNA, shRNA or sequences packaged by lentivirus, or inhibits the effects of the combined poisoning of tritiated water and lignin on exposed individuals by knocking out the cyp19a1b gene.

[0026] The technical solution of the present invention has the following advantages over the prior art:

[0027] The effects of combined exposure to tritiated water and genistein are more severe than those of either alone, primarily in terms of mortality, malformation rates, and cardiac development. The present invention uses zebrafish as a model. After combined exposure to tritiated water and genistein, a large number of differentially expressed genes appeared in 96hpf zebrafish larvae, primarily including ECM-receptor interactions, cell senescence, and the P53 signaling pathway. Co-exposure to tritiated water and genistein increased their toxicity to zebrafish embryos, inducing upregulation of cyp19a1b in zebrafish, thereby causing abnormalities in estrogen synthesis in the body, leading to hormone receptor activation and increased cyp1a expression, ultimately leading to abnormalities in zebrafish heart and neural development, resulting in limited motor function. Therefore, the present invention discovered a biomarker for combined exposure to tritiated water and genistein, which can be used to prepare preventive and therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0029] Figure 1 This is a diagram showing the effect of different groups on the deformity rate of zebrafish at 120 hpf according to the present invention.

[0030] Figure 2 Figure 2 shows the deformity of zebrafish embryos in different groups of the present invention; A is the control group, B is the tritium water group, C is the genistein group, and D is the combined exposure group (Note: SC is spinal curvature, YSE is yolk sac edema, and PE is pericardial cyst).

[0031] Figure 3 This is a diagram showing the effects of different groups on the heart rate of zebrafish embryos at different developmental times of the present invention.

[0032] Figure 4 Results of zebrafish body length changes in different groups.

[0033] Figure 5 Effects of combined exposure to tritiated water and genistein on the spontaneous movement of the zebrafish embryo's tail.

[0034] Figure 6This is a diagram of apoptosis in 96hpf zebrafish larvae of the present invention; wherein A is the control group, B is the combined exposure group, and C is the fluorescence intensity analysis.

[0035] Figure 7 Graph showing the expression of apoptosis-related genes in zebrafish larvae (96 hpf) in each group of the present invention.

[0036] Figure 8 This is a diagram showing the RT-qPCR verification results of the genes related to the present invention.

[0037] Figure 9 These are the RT-qPCR test results of zebrafish larvae that developed to 96 hpf after microinjection of zebrafish eggs.

[0038] Figure 10 This shows the growth and development of zebrafish after cyp19a1b gene knockout in different groups. DETAILED DESCRIPTION

[0039] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0040] experimental animals

[0041] Adult zebrafish of different sexes were housed separately in a thermostatic recirculating water system (purchased from Qingdao Jinshui Marine Biological Equipment Co., Ltd.), maintained at 28 ± 1°C with a 14:10 light-dark cycle. Juvenile zebrafish were cultured in still water and fed a juvenile-specific feed starting five days after hatching. They were then fed brine shrimp starting around ten days old, twice daily, with water changes every other day. Adult zebrafish were fed three times daily, with hatched brine shrimp in the morning and evening, and feed at noon. On the first evening, healthy females and males were placed in a baffled spawning tank at a 1:1 or 1:2 ratio of male to female. The next morning, the plastic panel was removed and the fish were allowed to mate freely under light. Eggs were collected within 30 minutes.

[0042] Data Description

[0043] *p<0.05, **p<0.01, ***p<0.001, ****P<0.0001 indicate statistically significant differences between the control group and the treated group.

[0044] Example 1 Effects of combined exposure to tritiated water and genistein on the growth and development of zebrafish

[0045] 1. Zebrafish infection culture

[0046] 2hpf zebrafish eggs were randomly divided into 4 groups and exposed to E3 solution, 3.7*10 2Bq / mL tritium aqueous solution (tritium aqueous solution is made by diluting 97% pure tritium water with E3 solution to a concentration of 3.7*10 5 The experiments were performed in triplicate, with 50 fish eggs per dish placed in a constant temperature chamber. Three replicates were set up for each group. The experiment was repeated three times. E3 solution (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4, 0.01% methylene blue) was used.

[0047] 2. Observe survival indicators

[0048] (1) Deformity rate of zebrafish embryos

[0049] Starting from 36hpf, zebrafish embryos were observed and recorded under a stereomicroscope every 24 hours for pericardial cysts, yolk sac edema, spinal curvature and other deformities until 120hpf. In order to facilitate the observation of cardiac malformations, transgenic zebrafish (cmlc-gfp) were constructed. Since the gene related to cardiac development was marked with green fluorescent protein, the larvae of this genotype could observe the changes in cardiac morphology under a fluorescence microscope. The transgenic larvae after being exposed to the poison were placed under a fluorescence microscope and excited with blue light of a wavelength of 488nm. The results are shown in Figure 2. Figure 1 As shown in the figure, no deformities were found in the tritium water group and the control group. Compared with the control group, the deformity rates in the genistein group and the combined poisoning group increased significantly. The deformities mainly manifested as yolk sac edema, spinal curvature, and pericardial edema (such as Figure 2 As shown in the figure, yolk sac abnormality is an important cause of hatching gland hypoplasia. Hatching gland hypoplasia will lead to a decrease in the enzymes synthesized by the hatching gland, thus hindering the hatching process.

[0050] (2) Zebrafish heart rate

[0051] In order to study the effect of poisoning on the heart rate of zebrafish larvae, the heart rate of zebrafish was observed at 48 hpf, 72 hpf, and 96 hpf. Ten larvae were randomly selected from each culture dish and placed under a MoticSMZ-168 stereo microscope for observation. The number of heartbeats within 20 seconds was recorded. The results are as follows: Figure 3 As shown in the figure, starting at 48 hpf, the heart rate of zebrafish embryos in the combined-drug group decreased significantly, and the difference with the control group widened with developmental time. However, there were no significant differences in heart rate between the genistein and tritium water groups and the control group at any time point.

[0052] (3) Zebrafish body length

[0053] Zebrafish body length changes Figure 4 As shown, the body length of the combined poisoning group decreased significantly compared with the control group (p<0.05), while the body length of other groups did not change significantly compared with the control group (****P<0.0001 indicates that the difference between the control group and the treatment group is statistically significant).

[0054] (4) Effects on the locomotion behavior of zebrafish embryos

[0055] Effects of combined exposure to tritiated water and genistein on spontaneous tail movements of zebrafish embryos Figure 5 As shown, compared with the control group, there was no significant change in the spontaneous movement of zebrafish embryos in the genistein group and tritium water group, while the spontaneous movement of the tail of the combined poisoning group increased significantly, and the difference was statistically significant (*P<0.05 indicates that the difference between the control group and the treatment group is statistically significant).

[0056] Spontaneous movement and activity have been shown to begin before responding to sensory stimulation. The first spontaneous movement can be observed in zebrafish embryos at 17 hpf, at which time they are not yet able to receive sensory stimulation. Some studies have suggested that behavioral maturation may be based on spontaneous neural activity during development. Therefore, changes in spontaneous movement of embryos can serve as a toxicological endpoint for the epidemiological phenomenon of chemical-induced neurotoxicity in fish. The results of this experimental observation showed that only the combined exposure group showed changes in spontaneous movement, indicating that the combined exposure of genistein and tritium water may affect the neural activity of the embryos, thereby affecting their spontaneous movement.

[0057] Example 2 Screening of key genes after combined exposure to toxins in zebrafish

[0058] By observing the survival indicators of zebrafish after exposure to poisons, it was found that the combined exposure to poisons had the most obvious effects on the heart development and nervous system development of zebrafish. In order to study its mechanism, samples of zebrafish fry at 96hpf that were jointly exposed to tritiated water and genistein were collected. The key target genes that caused damage to the zebrafish embryonic development were analyzed and screened, and the signal pathways were searched to screen out the key genes of the toxic effects of the combined exposure to tritiated water and genistein.

[0059] (1) Changes in cell apoptosis in zebrafish after combined exposure

[0060] Apoptosis in zebrafish embryos during development was determined by acridine orange (AO) staining. Zebrafish embryos exposed for 96 hours were removed from each culture dish, with 10 in each group. After washing twice with E3 culture medium, they were stained with 5 mg / L AO solution for 1 hour in a dark environment, and then washed three times with E3 culture medium to remove excess AO reagent. After anesthesia with tricaine at a concentration of 0.0016M, they were observed and photographed under a fluorescence microscope. The results are shown in Figure 6. It can be seen from the figure that the cell apoptosis induced by the combined poisoning group is mainly concentrated in the heart and yolk sac areas, and the fluorescence intensity of the combined poisoning group is significantly increased. RT-qPCR analysis of apoptosis-related genes caspase-8, P53, and bax was performed, and the results showed that the above genes were upregulated in the combined poisoning group, while bax and caspase-8 were downregulated and p53 was upregulated in the genistein group. There was no significant change in the above apoptosis-related genes in the tritium water poisoning group (such as Figure 7 shown).

[0061] (2) Real-time fluorescence quantitative PCR verification (RT-qPCR)

[0062] RNA was extracted from about 40 zebrafish larvae in the culture dishes exposed to the combined toxins, reverse transcribed into cDNA, and stored at -20°C for RT-qPCR. RT-qPCR identification was performed using Norvegic ChamQ Universal SYBR qPCR Master Mix, and primers were selected from the NCBI website. The damage to zebrafish caused by the combined toxins was mainly manifested in neural development, lipid metabolism, and redox processes. Related genes were screened and verified by RT-qPCR. The results are shown in Figure 2. Figure 8 It showed that after combined exposure, the genes f13a1a.1, cyp19a1b, fam20cl, and ghrh were upregulated, among which cyp19a1b, which is involved in many functions such as development and metabolism, was upregulated most significantly, upregulated 91 times compared with the control group.

[0063] Example 3 Effects of cyp19a1b on zebrafish in different exposure groups

[0064] 1. CRISPR sequence design

[0065] The primers for PCR amplification were determined from the NCBI website and are shown in Table 1.

[0066] Table 1 PCR primers

[0067]

[0068] Use the forward primer and universal reverse primer R-Common in Table 2:

[0069] sgRNA was obtained by PCR using AAAAAAAGCACCGACTCGGTGCCAC as a template.

[0070] Table 2 sgRNA forward primer series

[0071]

[0072]

[0073] Note: The bold part is the T7 promoter, the underline is the CRISPR sequence, and the lowercase letters are part of the sgRNA backbone template.

[0074] The PCR reaction system included 40 μL of 2*mastermin, 37.5 μL of ultrapure water, 1 μL of forward and reverse primers, and 0.5 μL of pYSY-sgRNA plasmid (10 ng / μL). The reaction conditions were: 95°C for 3 min, followed by 35 cycles of 95°C for 30 s, 52°C for 30 s, and 68°C for 30 s, and 68°C for 10 min.

[0075] The PCR product was collected using a PCR cleanup kit and the recovery solvent was ultrapure water free of nuclease contamination. The recovery volume was 25 μL. The recovered template was transcribed in vitro using T7 RNA polymerase. Using the RNA in vivo transcription kit, according to the manufacturer's instructions, 4 μL of 10× Transcription Buffer, 2 μL of 10 mM ATP, 2 μL of 10 mM CTP, 2 μL of 10 mM GTP, 2 μL of 10 mM UTP, 4 μL of T7 RNA polymerase mix, and 24 μL of template DNA were added, followed by gentle flicking and centrifugation. The mixture was then incubated at 37°C for 2 hours. 1.5 μL of DNase I was added, and the mixture was incubated at 37°C for 15 minutes to remove the template. The volume was then adjusted to 200 μL with 160 μL of DEPC water. 20 μL of nuclease-free 3 M sodium acetate and 3 volumes of anhydrous ethanol were also added. The mixture was mixed and precipitated overnight at -80°C. The next day, the mixture was centrifuged at 12,000 g for 20 min at 4°C. After removing the supernatant, 75% ethanol prepared with DEPC water was added and the mixture was centrifuged at 12,000 g for 20 min at 4°C. After removing the supernatant, excess water was removed with a 1 μL pipette, and the mixture was dried in a fume hood. After dissolving the mixture in 20 μL DEPC water, the mixture was placed in a -80°C refrigerator for later use.

[0076] The obtained sgRNAs were mixed in equal amounts according to the cyp19a1b-sgRNA (1, 5) group, cyp19a1b-sgRNA (2, 6) group, cyp19a1b-sgRNA (3, 7) group, and cyp19a1b-sgRNA (4, 8) group, and 0.5 μL was taken for agarose gel electrophoresis (1%) to identify their integrity.

[0077] 2. Determination of the efficiency of sgRNA-guided Cas9 targeted cleavage of target genomic DNA sequences

[0078] The aforementioned cyp19a1b-sgRNA (1, 5) groups, cyp19a1b-sgRNA (2, 6) groups, cyp19a1b-sgRNA (3, 7) groups, and cyp19a1b-sgRNA (4, 8) groups (each sgRNA at a final concentration of approximately 200 ng / μL) were mixed with Cas9 protein (final concentration of 400 ng / μL) and injected into fertilized zebrafish eggs. When the injected embryos developed to 24 hpf, approximately 12 eggs from each group were removed to prepare DNA templates. The products obtained by PCR amplification were then sent to the company for sequencing using the cyp19a1b-F1n / cyp19a1b-R2n primers.

[0079] The sequencing results showed that in the cyp19a1b-sgRNA (1, 5) group, four valid sequencing results were obtained, of which four had obvious Indel mutations near CRISPR5, and three had mutations near CRISPR1. For the cyp19a1b-sgRNA (2, 6) group, three of the four results had mutations near CRISPR6, and no result showed mutations near CRISPR2. Of the four results in the cyp19a1b-sgRNA (3, 7) group, only one result showed a very weak mutation near CRISPR7, while no gene mutations were found in the sequencing results of the cyp19a1b-sgRNA (4, 8) group. Combined with the above experimental results, sgRNA1, sgRNA5, sgRNA6 and dcas9-mRNA were selected as subsequent tools.

[0080] 3. Microinjection

[0081] Zebrafish eggs within 30 minutes of fertilization were placed neatly on a plate, and then sgRNA and Cas9 were mixed and added to the injection needle. Then, sgRNA was injected into the zebrafish embryos under a microscope, with 1 nL injected into each embryo.

[0082] 4. RT-qPCR verification of injection results

[0083] RT-qPCR was performed on zebrafish larvae that developed to 96 hpf after microinjection of zebrafish eggs. The results are as follows Figure 9 As shown (-) indicates cyp19a1b was knocked out, ***p < 0.001, indicating statistically significant differences between the control and treatment groups). Cyp1a and cyp19a1b were simultaneously enriched in the "Steroid hormone biosynthesis" pathway. RT-qPCR results showed that cyp1a expression levels in non-knockout zebrafish were upregulated after exposure compared to the control group. However, after cyp19a1b gene knockout, cyp1a expression levels in all groups changed before and after treatment. Cyp1a levels decreased in the tritiated water and genistein-exposed groups compared to the non-knockout group, while increased in the combined-exposed group.

[0084] 5. Growth and development of zebrafish after cyp19a1b gene knockout

[0085] The eggs of cyp19a1b gene knockout fish and non-knockout fish were treated with E3, 3.7*10 2 Bq / mL tritium water, 1.4 mg / L genistein, and a mixed solution of tritium water and genistein were treated and their growth and development were observed. The results were as follows Figure 10 Shown are (A: morphological changes in 96 hpf zebrafish larvae; B: deformity rate at 96 hpf; C: heart rate at 96 hpf; D: spontaneous movement of the tail at 24 hpf).

[0086] After knocking out the cyp19a1b gene, zebrafish deformities in the combined treatment group were alleviated, with a significant decrease in the deformity rate. Regarding cardiac function, heart rate increased in the combined treatment group after cyp19a1b knockout, indicating recovery of cardiac function. Spontaneous tail movements increased in all groups after cyp19a1b knockout, suggesting that knocking out this gene may affect nervous system or muscle development.

[0087] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. Application of cyp19a1b as a biomarker for combined exposure to tritiated water and genistein.

2. The use according to claim 1, characterized in that: The cyp19a1b was upregulated in individuals co-exposed to tritiated water and genistein.

3. Use of an antagonist of the cyp19a1b gene in the preparation of a drug for the prevention and treatment of tritium water and genistein combined with poisoning, characterized in that: The drug inhibits the expression of cyp19a1b, and the antagonist is a combination of sgRNA and Cas9 or an antibody.

4. The use according to claim 3, characterized in that: The dosage form of the preventive and therapeutic medicine is an injection or an oral targeted drug.

5. Use of a reagent for detecting cyp19a1b gene expression in the preparation of a kit for detecting the combined toxin of tritiated water and genistein, characterized in that: The cyp19a1b was upregulated in individuals co-exposed to tritiated water and genistein.

Images