Mouse IgM monoclonal antibodies and affinity purification reagents

Abstract

The present invention provides a rabbit anti-mouse IgM monoclonal antibody and a corresponding affinity purification reagent. The monoclonal antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region sequence is shown in SEQ ID NO.2, and the light chain variable region sequence is shown in SEQ ID NO.3. The present invention obtains a rabbit monoclonal antibody with high affinity and good specificity, and the immunosorbent prepared thereby has a good purification effect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to mouse IgM monoclonal antibodies for affinity purification.

[0002] The present invention also relates to affinity purification reagents containing the said monoclonal antibody. Background Technology

[0003] Mouse IgM monoclonal antibodies can be classified into pentamers containing the J chain (capable of binding to 10 antigens) and hexamers without the J chain (capable of binding to 12 antigens). IgM monoclonal antibodies possess multivalent antigen-binding capabilities, thus exhibiting higher affinity compared to IgG, giving them an advantage in diagnostics. However, the purification of IgM monoclonal antibodies has always been a challenging problem. Currently, there are no commercially available purification reagents specifically for mouse IgM monoclonal antibodies. Because IgM monoclonal antibodies cannot bind to Protein A, they cannot be purified using traditional methods for IgG purification. Furthermore, the narrow solubility range of IgM antibodies makes purification difficult. Early IgM antibody purification primarily involved isoelectric point precipitation combined with gel chromatography. Molecular sieving can also be used for purification, but the purity and activity vary. No affinity purification reagents using rabbit anti-mouse IgM μ-chain protein monoclonal antibodies coupled with agarose gels have been found. Summary of the Invention

[0004] One object of the present invention is to provide a rabbit monoclonal antibody against mouse IgM antibodies.

[0005] Another object of the present invention is an affinity purification reagent for mouse IgM antibodies.

[0006] According to one aspect of the present invention, the present invention provides a monoclonal antibody against rabbit anti-mouse IgM μ chain protein.

[0007] Rabbits were immunized with synthesized mouse IgM μ-chain protein. The rabbit serum titer was measured to be over one million. Peripheral blood was collected from rabbits, and leukocytes were separated. Positive clones were specifically screened using mouse IgM μ-chain protein-conjugated magnetic beads and then cultured. Mouse IgM monoclonal antibody was coated onto an ELISA plate, and the expression supernatant of the cultured rabbit cells was added. Finally, mouse anti-rabbit IgG-HRP was added for cell selection, thereby identifying cell lines with strong positive monoclonal antibodies against mouse IgM μ-chain protein. These selected positive cells were then retested. The specific binding of rabbit monoclonal antibody to mouse IgM monoclonal antibody in the cell expression supernatant was disrupted by adding 3M MgCl2, thus selecting positive monoclonal antibody cell lines that could both specifically bind to mouse IgM monoclonal antibody and be eluted by 3M MgCl2. This ultimately achieved a specific affinity purification reagent for mouse IgM monoclonal antibody.

[0008] After screening, a cell line secreting a monoclonal antibody was obtained and named 3C5. Sequencing of this cell line yielded the sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody, as shown in SEQ ID NO.2 and SEQ ID NO.3, respectively. Finally, heavy chain and light chain expression vectors were constructed. These vectors were then transformed into DH5α cells for long-term preservation.

[0009] 293F cells were cultured and transfected with the light and heavy chain expression vectors of the above 3C5 cell line to express rabbit monoclonal antibodies, which were then purified and their activity was identified.

[0010] According to another aspect of the present invention, the present invention provides an affinity purification reagent for mouse IgM monoclonal antibodies, which is generated by conjugating the rabbit monoclonal antibody obtained above with agarose gel.

[0011] According to another aspect of the present invention, a method for purifying IgM monoclonal antibodies is provided, comprising the following steps:

[0012] 1) Provide an agarose-antibody conjugate, wherein the antibody is the monoclonal antibody as described in claim 1;

[0013] 2) Contact the IgM monoclonal antibody to be purified with the agarose-antibody conjugate described in step 1);

[0014] 3) Elute and collect the target protein.

[0015] Preferably, in the method described in step 3), the eluent contains MgCl2.

[0016] Because the activity and yield of mouse IgM monoclonal antibodies are difficult to stabilize after purification, the rabbit monoclonal antibody affinity purification reagent for rabbit anti-mouse IgM μ chain protein prepared in this invention can solve this problem well. The affinity purification reagent of this invention can be used to purify mouse IgM monoclonal antibodies, making the purification of mouse IgM monoclonal antibodies more convenient and faster. Attached Figure Description

[0017] Figure 1 The results of Western blotting validation after vector expression are as follows:

[0018] MouseμS represents the expression supernatant of mouse IgM μ chain protein, MouseμL represents the cell lysate of mouse IgM μ chain protein, PCL represents the cell lysate of the positive control, NC represents the negative control, and Mouseμ chain protein is approximately 50 kDa. Detailed Implementation

[0019] The following examples illustrate the invention and should not be construed as limiting it. Unless otherwise specified, all experimental materials used were commercially available.

[0020] [Example 1] Preparation of rabbit anti-mouse IgM μ protein monoclonal antibody expression vector

[0021]

[0022] An xhoI restriction site was introduced upstream of the gene, and a BamhI restriction site was introduced downstream; the gene length was 1368 bp; the gene was optimized and synthesized by Sangon Biotech (Shanghai) Co., Ltd., and provided in the form of plasmid pUC57-Mouse-IgM-μ. The expression vector information is shown in Table 1.

[0023] Table 1 Expression vectors

[0024]

[0025] Expression vector double digestion conditions: 100 μL system, 1 μg plasmid, 1 μL restriction endonuclease xhoI, 1 μL BamhI, 10 μL Cutsmart Buffer (10×), ddH2O to 100 μL, 37℃ for 4 h. Gene double digestion conditions: 50 μL system, 6 μg gene, 4 μL restriction endonuclease xhoI, 4 μL BamhI, 5 μL Cutsmart Buffer (10×), ddH2O to 50 μL, 37℃ for 4 h. Expression vector and gene ligation conditions: 5 μL system, 1 μL plasmid double digestion product, 3 μL gene double digestion product, 0.5 μL T4 DNA ligase, 0.5 μL T4 DNA ligase buffer, ligation overnight at 16℃. Transformation: The ligation product was added to 25 μL LDH5α competent cells and incubated on ice for 30 min; heat-shocked at 42℃ for 45 s; incubated on ice for 2 min; added 500 μL SOC medium and incubated at 37℃ on a shaker at 200 rpm for 1 h; centrifuged at 10000 rpm for 1 min; discarded 400 μL of supernatant and resuspended the cells; spread on LB solid medium containing Amp; incubated upside down at 37℃ for approximately 12 h. Bacteria were picked and sent for sequencing. Sequencing results were compared, and the cells were preserved and plasmids extracted according to the OMEGA plasmid mini-prep kit instructions.

[0026] Low-level expression of mouse IgM μ-chain protein: Low-level expression was achieved by transient transfection of 293T17 cells with recombinant plasmid. After culturing 293T17 cells to the logarithmic growth phase, the expression was further reduced by 2 × 10⁻⁶ cells / mL. 5 Cells were seeded at a density of [number] cells / mL in 24-well cell culture plates. Transfection was performed when the confluence reached approximately 70%. Transfection was carried out according to the Lipofectamine 3000 manufacturer's instructions. After 4-6 hours of transfection, the medium was changed by replacing the serum-containing medium with serum-free FreeStyle medium, and the cells were cultured at 37°C. Samples were collected 48 hours after transfection. Western blotting was used to verify expression and determine the optimal expression vector.

[0027] The results are as follows Figure 1MouseμS represents the expression supernatant of mouse IgM μ chain protein, MouseμL represents the cell lysate of mouse IgM μ chain protein, PCL represents the cell lysate of the positive control, and NC represents the negative control. Mouse μ chain protein is approximately 50 kDa.

[0028] According to the Western blot results, mouse IgMμ protein was not expressed in the cell supernatant but was expressed in the lysate. Mouse-IgMμ-pEVL9.4 was selected as the most suitable expression vector.

[0029] Large-scale expression of mouse IgM μ-chain protein: Based on the results of Western blot experiments using low-level expression, plasmids were extracted from the corresponding expression vector according to the OMEGA plasmid large-scale extraction kit instructions. PEI was used as the transfection reagent for large-scale transfection. The recombinant plasmid was transfected into suspension cells 293F. The culture conditions for 293F cells were: 37℃, 8% CO2, 120 rpm. The transfection process was as follows: The cell density was adjusted to 5 × 10⁶ cells / day before transfection. 5 Cells / mL were collected, and 600 mL of cells were placed in a 3 L conical flask for cell culture. The cells were cultured until the cell density reached 1 × 10⁶ cells / mL the next day. 6 Transfect when the number of cells / mL is approximately 100 μg; take 600 μg of plasmid into a 50 mL centrifuge tube; add 60 mL of D-PBS, mix gently three times, 6 s apart each time; add 1.8 mL of PEI (1 mg / mL), mix well as described above, and let stand for 20-30 min; drop into a cell shaker flask and continue culturing until the sample is collected.

[0030] Purification, concentration, and concentration determination of mouse IgM μ-chain protein: Approximately 5 mL of S-tag packing material was bound to cell lysate expressing the target protein and mixed by rotation at 4°C for at least 2 hours. The mixture was manually passed through a column, collecting the packing material and filtrate separately. The column was washed with approximately 10 column volumes of Binding / Wash Buffer. A certain volume of 3M MgCl2 was added to the packing material to elute the target protein. After standing for 10 minutes, the column was centrifuged at 500g for 5 minutes. The eluent was collected, and the elution was repeated five times. The packing material was then added back to the filtrate for binding and purification again. This purification process was repeated two to three times. Concentration: The purified eluent was added to an ultrafiltration tube and centrifuged at 4°C, 4000 rpm for 40-60 minutes. The filtrate in the ultrafiltration tube was discarded, and the remaining eluent was added to the tube. Centrifugation was continued until all eluent was added. When the eluent was concentrated to approximately 1 mL, an appropriate amount of PBS was added to the top, and the tube was centrifuged at 4°C, 4000 rpm for 30-40 minutes. Repeat the addition of PBS three to five times to reduce the salt concentration in the solution, ensuring the protein is ultimately preserved in PBS. Finally, concentrate the protein to approximately 2 mL. Dilute the resulting protein three to four times according to Invitrogen's formula. The protein concentration was determined according to the instructions of the 2.0 fluorescence quantitative instrument, and the protein concentration was found to be 3.45 mg / ml.

[0031] The obtained protein was used to immunize rabbits, and the immunization routes are shown in Table 2:

[0032] Table 2. Immunization routes for rabbits

[0033]

[0034]

[0035] The rabbits with good immunity were entrusted to Suzhou Dima Biotechnology Co., Ltd. to prepare rabbit monoclonal antibodies: peripheral blood of rabbits was collected, positive B cells were sorted by magnetic beads and cultured.

[0036] Cell line screening: ELISA plates were coated with mouse IgM monoclonal antibody, and cultured cell supernatant was added. The plates were incubated at 37°C for 40 min, washed, and then mouse anti-rabbit HRP was added. The plates were incubated at 37°C for 30 min, washed, and the cells were developed. Cell supernatant from the developed cells was picked for repeat testing. Alternatively, ELISA plates were coated with mouse IgM monoclonal antibody, and cultured cell supernatant (in four wells) was added. The plates were incubated at 37°C for 40 min, washed, and two wells were added with a positive diluent (PBS solution containing 15% FCS). Two wells were added with 3M MgCl2. The plates were incubated at room temperature for 20 min, washed, and then mouse anti-rabbit HRP was added. The plates were incubated at 37°C for 30 min, washed, and the cells were developed. Cell lines showing strong staining with a positive diluent but weak staining with 3M MgCl2 were selected.

[0037] Suzhou Dma Biotechnology Co., Ltd. was commissioned to sequence the selected cell lines and construct heavy and light chain expression vectors respectively. Sequencing results: The heavy chain variable region sequence is shown in SEQ ID NO.2:

[0038] CAGTCGGTGGAGGAGTCCGGGGGTCGCCTGGTCACGCCTGGGACACCCCTGACACTCACCTGCACAGTCTCTGGATTCTCCCTCTCCTCATATCCAATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAATGGATCGGGATCATTAGTTCGAGTGGTTCCACGTACTACGCGAG CTGGGCGAAAGGCCGTTTCACCATCTCCAAAACCTCGACCACGGTGGATCTGAAAATCACCAGTCCGACAACCGAGGACACGGCCACCTATTTCTGTGCCAGACCTATTGGTGCTGGTAGTGGTGGTTTTAGTAGTTTCTTGTGGGGCCCAGGCACCCTGGTCACCGTCTCCTCA(SEQ ID NO.2).

[0039] Light chain variable region sequence such as SEQ ID Shown in NO.3: TTGTGAGGTTGTGCTGACCCAGACTCCATCCCCCACGTCTGAAGCTGTGGGAGGCACAGTCACCATCAATTGCCAGGCCAGTCAGAACGTTTACAACAGTTTAGCCTGGTATCAGCAGAAACCAGGGCAGCCTCCCAAGCTCCTGATCTATGATGCATCCGATCTGGAA TCTGGGGTCCCAGCGCGGTTCAAAGGCAGTGGATCTGGGACAGAGTTCACTCTCACCATCAGCGACCTGGAGTGTGCCGATGATGCCACTTACTACTGTCAAAGCTGTTATTATAGTAGTAGTAGTAGTTATGGTTATGGTTTCGGCGGAGGGACCGAGGTGGTGGTCAAA(SEQ ID NO.3).

[0040] The heavy and light chain expression vectors were transformed into DH5α competent cells, respectively, and incubated on ice for 30 min; heat-shocked at 42℃ for 45 s; incubated on ice for 2 min; 500 μL of SOC medium was added, and the cells were incubated at 37℃ on a shaker at 200 rpm for 1 h; centrifuged at 10000 rpm for 1 min; 400 μL of supernatant was discarded, and the cells were resuspended; the cells were spread on LB solid medium containing Amp; and incubated upside down at 37℃ for approximately 12 h. The cells were then picked, shaken, and preserved.

[0041] [Example 2] Preparation of rabbit anti-mouse IgM μ chain protein monoclonal antibody

[0042] The bacterial strain preserved in Example 1 was selected, activated, and cultured on a large scale. Plasmid extraction was performed on the corresponding expression vector according to the OMEGA plasmid extraction kit instructions.

[0043] Preparation of rabbit anti-mouse IgM μ-chain protein monoclonal antibody: PEI was used as the transfection reagent. Heavy chain and light chain plasmids were co-transfected into suspension cells 293F. The transfection process was as follows: The cell density was adjusted to 5 × 10⁶ cells / day before transfection. 5 Cells / mL were collected and placed in a conical shaker flask (4 L total). The cells were cultured until the cell density reached 1 × 10⁶ cells / mL the next day. 6 Transfect when the number of cells / mL is approximately 1000 μg / mL; take 4000 μg of light chain and heavy chain plasmids into a 50 mL centrifuge tube respectively; add D-PBS, mix gently three times, with a 6 s interval between each time; add 12 mL of PEI (1 mg / mL), mix well as described above, and let stand for 20-30 min; drop into a cell shaker flask and continue culturing until the sample is collected.

[0044] Purification, concentration, and concentration determination of mouse IgM μ-chain protein: Protein A was bound to the expression supernatant and mixed by rotation at 4°C for at least 2 hours. The column was manually passed through a column, and the packing material and filtrate were collected separately. The column was washed with pH 8.0 PBS. A certain volume of pH 4.0 citrate buffer was added to elute the target protein, and the eluent was collected. 1M Na₂CO₃ was added to adjust the pH to neutral. Concentration: The purified eluent was added to an ultrafiltration tube and centrifuged at 4°C, 4000 rpm for 20 minutes. The filtrate in the ultrafiltration tube was discarded, and the remaining eluent was added to the tube. Centrifugation was continued until all eluent was added, concentrating the protein to approximately 15 ml. The obtained protein was diluted 21-fold, and the protein concentration was determined using a spectrophotometer. The protein concentration was found to be 6.72 mg / ml, totaling 10⁷ mg.

[0045] [Example 3] Preparation of affinity purification reagent for mouse IgM monoclonal antibody

[0046] Main reagents: Monoclonal antibody purified in Example 2, agarose gel (Sepharose 4B).

[0047] 1. Selection of elution solution

[0048] Different concentrations of MgCl2 (2.5 / 3 / 3.5M) and different pH values ​​of glycine-hydrochloric acid (pH 2.8 and 2.3) were selected. The experiment followed the cell line screening, and the results are shown in Table 3.

[0049] Table 3 Elution effect of glycine-hydrochloric acid at different concentrations of MgCl2 and different pH values

[0050]

[0051] The results above show that the elution effect is better with the increase of MgCl2 concentration. Glycine-hydrochloric acid elution effect is better than MgCl2. However, considering that low pH and high salt will have a certain impact on protein activity, 3M MgCl2 was finally selected as the elution solution.

[0052] 2. Agarose gel and monoclonal antibody pretreatment

[0053] Take the agarose gel, wash the gel with pure water, remove the gel preservation solution, add a certain volume of pure water and place it at 4℃ for later use.

[0054] The purified monoclonal antibody was dialyzed in PBS, and then dialyzed in 0.1M NaHCO2 solution.

[0055] 3. Activation of agarose gel

[0056] 3.1 Take the agarose gel washed with pure water from step 1, add 5M alkaline potassium phosphate solution to it, and mix well.

[0057] 3.2 Add 10% CNBr solution to the solution in 1.2.1, react in ice water, and mix well for 10 minutes. (CNBr solution is highly toxic; this process should be carried out in a fume hood.)

[0058] 3.3 The agarose gel obtained in 1.2.2 was placed in a Buchner funnel and filtered. The gel was washed with 0.1M NaHCO2 solution and dried to obtain the activated agarose gel.

[0059] 4. Conjugation of agarose gel with monoclonal antibodies

[0060] Add the monoclonal antibody treated in step 1.1 to the activated agarose gel, mix by rotation at 4°C, and incubate overnight.

[0061] 5. Pretreatment of affinity purification reagents

[0062] 5.1 Take the agarose gel conjugated with the antibody from step 4, pack it into a column, and collect the eluent. Wash the column with PBS.

[0063] 5.2 Add 1M ethanolamine to the column to wash the column and block for 2 hours.

[0064] 5.3 The column was washed sequentially with 0.1 M HAc-NaHAc, 0.01 M boric acid-borax, 3 M MgCl2, and PBS. Finally, it was stored at 4 °C.

[0065] 6. Affinity purification reagent for mouse IgM monoclonal antibodies: purifying mouse IgM monoclonal antibodies.

[0066] 6.1 Add the affinity purification reagent to the dilution buffer of the mouse IgM monoclonal antibody to be purified and bind at 4°C for two hours.

[0067] 6.2 Take the mixture from 6.1, pass it through a column, collect the filtrate and purification reagent separately, and wash the column with PBS.

[0068] 6.3 Add 3M MgCl2 to the purification reagent to elute the target protein, centrifuge and collect the eluent, repeat five times.

[0069] 6.4 Add the purified eluent to an ultrafiltration tube, centrifuge at 4000 rpm for 20 min at 4℃, pour out the filtrate from the ultrafiltration tube, add the remaining eluent to the tube, and continue centrifuging until all the eluent has been added, concentrating the protein to approximately 2 ml. Add an appropriate amount of PBS to the top, centrifuge at 4000 rpm for 30-40 min at 4℃. Repeat the addition of PBS three to five times to reduce the salt concentration in the solution, ensuring the protein is ultimately preserved in PBS. The protein concentration was determined using a spectrophotometer; the purified protein concentration was 3.46 mg / ml, totaling 20 mg. The results of the activity comparison experiment before and after purification are shown in Table 4.

[0070] Table 4 Protein activity before and after purification

[0071] 1ug / ml 500ng / ml 250ng / ml 125ng / ml 62.5 ng / ml 31ng / ml 15.5 ng / ml 7.5ng / ml Before adsorption 2.557 2.163 1.849 1.174 0.697 0.455 0.352 0.22 After adsorption 0.87 0.394 0.323 0.203 0.138 0.124 0.106 0.103 After purification 2.552 2.629 2.569 2.182 2.221 1.873 1.267 0.829

[0072] The results show that the affinity purification reagent has good adsorption and purification effects. SEQUENCE LISTING <110> Wuhan Keyuan Anbo Biotechnology Co., Ltd. <120> Mouse IgM monoclonal antibodies and affinity purification reagents <130> WH3506-22P150701 <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 1368 <212> DNA <213> Mus musculus <400> 1 gagagtcagt ccttcccaaa tgtcttcccc ctcgtctcct gcgagagccc cctgtctgat 60 aagaatctgg tggccatggg ctgcctggcc cgggacttcc tgcccagcac catttccttc 120 acctggaact accagaacaa cactgaagtc atccagggta tcagaacctt cccaacactg 180 aggacagggg gcaagtacct agccacctcg caggtgttgc tgtctcccaa gagcatcctt 240 gaaggttcag atgaatacct tgtatgcaaa atccactacg gaggcaaaaa caaagatctg 300 catgtgccca ttccagctgt cgcagagatg aaccccaatg taaatgtgtt cgtcccacca 360 cgggatggct tctctggccc tgcaccacgc aagtctaaac tcatctgcga ggccacgaac 420 ttcactccaa aaccgatcac agtatcctgg ctaaaggatg ggaagctcgt ggaatctggc 480 ttcaccacag atccggtgac catcgagaac aaaggatcca caccccaaac ctacaaggtc 540 ataagcacac ttaccatctc tgaaatcgac tggctgaacc tgaatgtgta cacctgccgt 600 gtggatcaca ggggtctcac cttcttgaag aacgtgtcct ccacatgtgc tgccagtccc 660 tccacagaca tcctaacctt caccatcccc ccctcctttg ccgacatctt cctcagcaag 720 tccgctaacc tgacctgtct ggtctcaaac ctggcaacct atgaaaccct gaatatctcc 780 tgggctttc aaagtggtga accactggaa accaaatta aaatcatgga aagccatccc 840 aatggcacct tcagtgctaa gggtgtggct agtgtttgtg tggagaactg gaataacagg 900 aaagaatttg tgtgtactgt gactcacagg gatctgcctt caccacagaa gaaattcatc 960 tcaaaaccca atgaggtgca caaacatcca cctgctgtgt acctgctgcc accagctcgt 1020 gagcaactga acctgaggga gtcagccaca gtcacctgcc tggtgaaggg cttctctcct 1080 1140 accagtgccc cgatgccaga gcctggggcc ccaggcttct actttaccca cagcatcctg 1200 actgtgacag aggaggaatg gaactccgga gagacctata cctgtgttgt aggccacgag 1260 gccctgccac acctggtgac cgagaggacc gtggacaagt ccactggtaa acccacactg 1320 tacaatgtct ccctgatcat gtctgacaca ggcgggacct gctattga 1368 <210> 2 <211> 354 <212> DNA <213> artificial <220> <223> Heavy chain variable region <400> 2 cagtcggtgg aggagtccgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 60 tgcacagtct ctggattctc cctctcctca tatccaatga gctgggtccg ccaggctcca 120 gggaaggggc tggaatggat cgggatcatt agttcgagtg gttccacgta ctacgcgagc 180 tgggcgaaag gccgtttcac catctccaaa acctcgacca cggtggatct gaaaatcacc 240 agtccgacaa ccgaggacac ggccacctat ttctgtgcca gacctattgg tgctggtagt 300 ggtggtttta gtagtttctt gtggggccca ggcaccctgg tcaccgtctc ctca 354 <210> 3 <211> 339 <212> DNA <213> artificial <220> <223> Entertainment <400> 3 tgtgaggttg tgctgaccca gactccatcc cccacgtctg aagctgtggg aggcacagtc accatcaatt gccaggccag tcagaacgtt tacaacagtt tagcctggta tcagcagaaa ccagggcagc ctcccaagct cctgatctat gatgcatccg atctggaatc tggggtccca gcgcggttca aaggcagtgg atctgggaca gagttcactc tcaccatcag cgacctggag 240 tgtgccgatg atgccactta ctactgtcaa agctgttatt atagtagtag tagtagttat 300 ggttatggtt tcggcggagg gaccgaggtg gtggtcaaa 339

Claims

1. A rabbit anti-mouse IgM monoclonal antibody, the monoclonal antibody comprising a heavy chain variable region and a light chain variable region, the heavy chain variable region is encoded by a nucleotide sequence as shown in SEQ ID NO.2, and the light chain variable region is encoded by a nucleotide sequence as shown in SEQ ID NO.

3.

2. An expression vector comprising the heavy chain variable region nucleotides as shown in SEQ ID NO.2 and the light chain variable region nucleotides as shown in SEQ ID NO.

3.

3. An affinity purification reagent for purifying IgM monoclonal antibodies, comprising the rabbit anti-mouse IgM monoclonal antibody according to claim 1.

4. The affinity purification reagent according to claim 3, characterized in that The affinity purification reagent comprises agarose-monoclonal antibody conjugate.

5. A method for purifying IgM monoclonal antibodies, comprising the following steps: 1) providing an agarose-antibody conjugate, wherein the antibody is the monoclonal antibody according to claim 1; 2) contacting the IgM monoclonal antibody to be purified with the agarose-antibody conjugate described in step 1); 3) Elute and collect the target protein.

6. The method according to claim 5, characterized in that In the elution in step 3) of the method, the eluent contains MgCl2.

Images