A method for identifying ophiopogon japonicus and ophiopogon intermedius based on MLPA technology

Abstract

The application discloses a method for identifying Ophiopogon japonicus and Ophiopogon intermedius based on multiple ligation-dependent probe amplification technology, which comprises the following steps: 1) extracting sample genomic DNA; 2) using specific primers to amplify the chloroplast gene fragments of Ophiopogon japonicus and Ophiopogon intermedius with the genomic DNA as a template and purifying the amplification products; 3) hybridizing the MLPA probe with the purified products; 4) using a DNA ligase to ligate the hybridization products; 5) using universal primers to perform qPCR amplification on the ligation products; and 6) collecting the melting curve signal and observing the Tm value. The application can simultaneously identify Ophiopogon japonicus and Ophiopogon intermedius in a very short time, has the advantages of high specificity, high sensitivity and the like, and has a good application prospect in the field of identification of traditional Chinese medicinal materials.

Description

Technical Field

[0001] This invention belongs to the field of identification of Chinese medicinal materials, specifically involving a method for identifying Ophiopogon japonicus and Ophiopogon japonicus based on multiple ligation-dependent probe amplification (MLPA) technology. Background Technology

[0002] Ophiopogon japonicus and Liriope muscari have been used as medicinal plants for thousands of years. The main source of Ophiopogon japonicus is the dried tuberous root of *Ophiopogon japonicus* (Lf) Ker-Gawl., a plant in the Liliaceae family. It has the effects of nourishing yin and promoting body fluid production, moistening the lungs and clearing the heart. It is used for dry cough due to lung dryness, consumptive cough due to yin deficiency, sore throat, thirst due to fluid depletion, internal heat and thirst, irritability and insomnia, and constipation due to intestinal dryness. Ophiopogon japonicus is a traditional Chinese medicine that can be used for both prevention and treatment, as well as in health foods. It is one of the raw materials approved by the Ministry of Health of my country for dual use as medicine and food, and for health foods.

[0003] Currently, various adulterants of Ophiopogon japonicus exist in the market. These adulterants mainly originate from plants in the genera *Liriope* and *Liriope*, with *Liriope spicata* and *Liriope scabra* being the most common. *Liriope spicata* is derived from the dried tuberous roots of *Liriope spicata* (Thunb.) Lour. var. *prolifera* YTMa or *Liriope mus cari* (Decne.) Baily, both belonging to the genus *Liriope* of the Liliaceae family. Both are included in the *Chinese Pharmacopoeia* (2020 edition), which does not merge them. They share similar properties, appearance, functions, and indications, making them easily confused. In the market, most products do not strictly distinguish between Ophiopogon japonicus and *Liriope scabra*, instead using *Liriope scabra* as a substitute and uniformly calling it Ophiopogon japonicus without specifying the variety. Since the efficacy of *Liriope spicata* and Ophiopogon japonicus* is not entirely consistent and their prices differ, mixing them not only affects the medicinal effect but also causes economic losses.

[0004] Sequence alignment screening revealed three stable variation sites between the genera *Ophiopogon japonicus* and *Ophiopogon japonicus* in the chloroplast gene fragment sequence: A / G, A / T, and C / T. These three differential sites can serve as distinguishing sites between the two genera. This also indicates that the gene fragment sequence can be used as a distinguishing marker between *Ophiopogon japonicus* and *Ophiopogon japonicus*. Based on this, this invention utilizes MLPA technology combined with melting curves to design specific probes for amplification of the variation sites. The melting temperature is obtained from the melting curve peaks, and the difference in Tm values ​​is used to distinguish between *Ophiopogon japonicus* and *Ophiopogon japonicus*. Specificity, sensitivity, and adulteration ratio experiments were conducted. This invention constructs a systematic identification system for the original species of *Ophiopogon japonicus* medicinal materials, and establishes a rapid detection and identification method for the mutual adulteration of *Ophiopogon japonicus* and *Ophiopogon japonicus* medicinal materials using molecular biology techniques, providing technical support for the accurate identification of *Ophiopogon japonicus* medicinal materials and ensuring safe clinical use. Summary of the Invention

[0005] This invention employs the MLPA method to design probes targeting chloroplast gene fragment sequences of the traditional Chinese medicinal herbs Ophiopogon japonicus and Ophiopogon japonicus, thereby establishing a method that can simultaneously identify Ophiopogon japonicus and Ophiopogon japonicus.

[0006] A method for identifying Ophiopogon japonicus and Ophiopogon japonicus based on multiplex ligation probe amplification technology includes the following steps:

[0007] 1) Extract genomic DNA from the sample;

[0008] 2) Using the extracted genomic DNA as a template, chloroplast gene fragments of Ophiopogon japonicus and Liriope muscari were amplified using specific primers and the amplified products were purified.

[0009] 3) Hybridize the MLPA probe with the purified product;

[0010] 4) Use DNA ligase to ligate the hybridization products from step 3);

[0011] 5) Perform qPCR amplification on the ligation product from step 4) using universal primers;

[0012] 6) Collect melting curve signals and observe the Tm value.

[0013] The MLPA probe consists of three probes: two left probes and one right probe. The probe sequence is as follows:

[0014] Left probe of Ophiopogon japonicus: GGGTTCCCTAAGGGTTGGACAAGTATTTAGTCTTTGTAATTTCCATAGATACAAATAT (SEQ ID NO:1);

[0015] Left probe of Ophiopogon japonicus: GGGTTCCCTAAGGGTTGGACCGCACGATTTAGTCTTTGTAATTTCCATAGATACAAATAC (SEQ ID NO:2);

[0016] Common right probe: TCGGCTAGTATGATGCGCGGGAAATGTCTAGATTGGATCTTGCTGGCAC (SEQ ID NO:3).

[0017] Among them, the probe group consisting of the left probe of Ophiopogon japonicus and the common right probe can be used alone to identify Ophiopogon japonicus;

[0018] The probe group consisting of the left probe and the common right probe of Ophiopogon japonicus can be used alone to identify Ophiopogon japonicus;

[0019] A mixed system consisting of the left probe of Ophiopogon japonicus, ... and the common right probe can be used for the individual identification of Ophiopogon japonicus and Ophiopogon japonicus, as well as the identification of mixed samples.

[0020] When identifying unknown samples, the MLPA probe set is used simultaneously rather than split.

[0021] The nucleotide sequences of the chloroplast gene fragments from *Ophiopogon japonicus* and *Ophiopogon japonicus* are shown in SEQ ID NO:8 and 9, respectively. The specific upstream and downstream primer sequences used to amplify the chloroplast gene fragments are shown in SEQ ID NO:4 and 5, respectively.

[0022] The universal primer sequences are shown in SEQ ID NO:6 and 7.

[0023] The DNA ligase is a 9°N DNA ligase.

[0024] Preferably, in the MLPA probe, the volume ratio of the left probe of Ophiopogon japonicus, the left probe of Ophiopogon japonicus, and the common right probe is 0.6:1.0:1.6.

[0025] Preferably, the hybridization temperature is 72°C.

[0026] Preferably, the qPCR amplification cycle is 28 times.

[0027] Preferably, in step 6), the sample is identified by observing the melting curve peak and Tm value. If the sample has a single melting curve peak and a Tm value of 78.98℃±0.1℃, it is Ophiopogon japonicus; if the sample has a single melting curve peak and a Tm value of 80.57℃±0.1℃, it is Ophiopogon japonicus var. sarcodactylis; if the sample has two melting curve peaks and melting peak Tm values ​​of 78.98℃±0.1℃ and 80.57℃±0.1℃, it is a mixed sample of Ophiopogon japonicus and Ophiopogon japonicus var. sarcodactylis.

[0028] The beneficial effects of this invention are:

[0029] This invention can simultaneously identify Ophiopogon japonicus and Ophiopogon japonicus in a very short time. The method has the advantages of high specificity and high sensitivity, and has a good application prospect in the field of identification of the authenticity of Chinese medicinal materials. Attached Figure Description

[0030] Figure 1 It is a screening of the hybridization temperature for MLPA reaction.

[0031] Figure 2 It is a screening of the number of MLPA reaction cycles.

[0032] Figure 3 This is the screening results for MLPA reaction mixed probe sets.

[0033] Figure 4 These are MLPA-specific results for Ophiopogon japonicus and Liriope muscari. The figures show melting curves after hybridization of single and mixed probes with chloroplast gene fragments from Ophiopogon japonicus and Liriope muscari, respectively.

[0034] Figure 5 This is the melting curve experimental spectrum of the sensitivity test of a single sample of Ophiopogon japonicus using a mixed probe.

[0035] Figure 6 This is the melting curve experimental spectrum of the sensitivity test of a single sample of Ophiopogon japonicus using a mixed probe.

[0036] Figure 7 This is an experimental graph showing the melting curve after hybridization of DNA from a mixed sample of Ophiopogon japonicus and Ligusticum striatum using a mixed probe. Detailed Implementation

[0037] The technical solution of the present invention will be described in detail below through specific embodiments.

[0038] Example 1: Preparation of Ophiopogon japonicus and Ligusticum striatum templates

[0039] 1. Extraction of genomic DNA from Ophiopogon japonicus and Ligusticum striatum

[0040] Genomic DNA was extracted from Ophiopogon japonicus and Liriope muscari using the Tiangen plant genomic DNA extraction kit.

[0041] 1) Take 30mg of medicinal powder, add 1ml of nuclear separation buffer and mix thoroughly. Centrifuge at 12,000rpm for 5min in a refrigerated high-speed centrifuge, discard the supernatant, and repeat this step twice.

[0042] 2) Add 700 μL of buffer GP1 to the sample after it has been treated with nuclear separation buffer, and incubate in a water bath at 65°C for 2 hours. During the water bath, invert the centrifuge tube several times to mix the sample.

[0043] 3) After the sample has been thoroughly water bathed, add 700 μL of chloroform to the mixture of lysed tissue samples, mix thoroughly, and centrifuge at 12,000 rpm for 5 min in a refrigerated high-speed centrifuge. Transfer the supernatant obtained from centrifugation to a new centrifuge tube.

[0044] 4) Add 700 μL of buffer GP2 to the supernatant, invert and mix thoroughly, then transfer to the adsorption column and centrifuge at 12,000 rpm for 30 s in a refrigerated high-speed centrifuge. Discard the waste liquid.

[0045] 5) Add 500 μL of buffer GD to the adsorption column, centrifuge at 12,000 rpm for 30 s in a refrigerated high-speed centrifuge, and discard the waste liquid;

[0046] 6) Add 600 μL of PW washing solution to the adsorption column, centrifuge at 12,000 rpm for 30 s in a refrigerated high-speed centrifuge, discard the waste liquid, and repeat this step once.

[0047] 7) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 minutes in a refrigerated high-speed centrifuge, transfer the adsorption column to a new centrifuge tube, and thoroughly dry the washing solution in the adsorption column.

[0048] 8) Add 50 μL of elution buffer TE to the center of the adsorption column membrane, and let it stand at room temperature for 5 min to allow the elution buffer TE to fully wet the adsorption column membrane. Centrifuge at 12,000 rpm for 2 min in a refrigerated high-speed centrifuge and collect the solution into a centrifuge tube.

[0049] 2. PCR amplification

[0050] Based on chloroplast gene fragments from *Ophiopogon japonicus*, *Ophiopogon hupehensis*, and *Ophiopogon scutellaria*, PCR amplification primers were designed using Primer 3 software (http: / / primer3.ut.ee / ) targeting conserved regions of these fragments.

[0051] Primers for Ophiopogon japonicus and Ligusticum striatum:

[0052] tMD-F:CAATAAAAAGCCCATTTTACTTCT(SEQ ID NO:4)

[0053] tMD-R:GGTGACACGAGGATTTTCAGT(SEQ ID NO:5)

[0054] Reaction system: 21 μL Gold Mix, 1 μL tMD-F primer, 1 μL tMD-R primer, 1 μL DNA template

[0055] Amplification program: 98℃ denaturation for 5 min; 98℃ denaturation for 10 s, 56℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles; 72℃ extension for 10 min.

[0056] The nucleotide sequence of the target fragment amplified from Ophiopogon japonicus is shown in SEQ ID NO:8:

[0057] CAATAAAAAGCCCATTTTACTTCTTAACTATTTAGTTATTCTCTTTTTTTTTCATAAGAAGTTCAAAGAAAATTCAATATCTTTCTCATTCATTCTACTCTTTCACAAACG G ATCCGAACAGAAATCTTTTGATCTTATCCTAATTTGGTTTGAATAGATACGATACCTGTACAAATAAAACATATATAATTGACATAATTGAAGTCCATATCACTTATAACTTACATTCAAAAAGAAAGTCTTCTTTTTGAAGATCTAAGAAATTCGGGGACTAGGTCAAATTTTTGAATACTTTTTTTAGTCT T TGTAATTTCCATAGATACAAATA T TCCGCTAGTATGATGCGCGGGAAATGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACC

[0058] The nucleotide sequence of the target fragment amplified from *Ophiopogon japonicus* (Hubei Ophiopogon japonicus and *Ophiopogon japonicus breviscapus*) is shown in SEQ ID NO:9:

[0059] CAATAAAAAGCCCATTTTACTTCTTAACTATTTAGTTATTCTCTTTTTTTTTCATAAGAAGTTCAAAGAAAATTCAATATCTTTCTCATTCATTCTACTCTTTCACAAACG A ATCCGAACAGAAATCTTTTGATCTTATCCTAATTTGGTTTGAATAGATACGATACCTGTACAAATAAAACATATATAATTGACATAATTGAAGTCCATATCACTTATAACTTACATTCAAAAAGAAAGTCTTCTTTTTGAAGATCTAAGAAATTCGGGGACTAGGTCAAATTTTTGAATACTTTTTTTAGTCTA TGTAATTTCCATAGATACAAATA C TCCGCTAGTATGATGCGCGGGAAATGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACC

[0060] 3. Purify the amplification product to obtain template DNA

[0061] 1) Estimate the volume of the PCR reaction solution, add 4 times the volume of the binding solution, and mix thoroughly.

[0062] 2) Add the solution obtained in the previous step to an adsorption column (place the adsorption column in the collection tube), let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0063] 3) Add 700 μL of washing solution to the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the adsorption column into a collection tube. Repeat once.

[0064] 5) Centrifuge at 12000 rpm for 2 minutes to remove as much of the washing solution as possible. Place the adsorption column open at room temperature or in a 50°C incubator for several minutes to remove any remaining washing solution and prevent the ethanol in the washing solution from affecting subsequent experiments.

[0065] 6) Place the adsorption column into a clean centrifuge tube, add an appropriate amount of elution buffer preheated to 65°C in a water bath to the center of the adsorption membrane, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes to collect the DNA solution, and store at -20°C for later use.

[0066] Example 2 Probe Design and Preparation

[0067] The chloroplast gene fragments of *Ophiopogon japonicus*, *Ophiopogon hupehensis*, and *Ophiopogon breviscapus* were amplified using primers designed in Example 1. MEGA 6.05 was used to align all sequences, revealing several differentially expressed sites: G / A at position 112, T / A at position 305, and T / C at position 329. Based on the sequence alignment results, six sets of MLPA probes were designed. To avoid cross-reactivity, BLAST search was used to evaluate the specificity of the probe sequences, and DNA Folding Form was used to analyze the secondary structure of the probe sequences. The length, GC content, and Tm value of the probe sequences were predicted using the RAW program. Filler sequences were appropriately added to ensure that the predicted Tm values ​​of the three sequences differed by at least 1.6°C. The probes were purified by HPLC, and the 5' end of the right probe was phosphorylated.

[0068] The specific requirements are as follows: (1) The GC% content of the left and right hybridization sequences should be between 40% and 60%. (2) The 3' end of the designed left probe and the 5' end of the right probe should be directly connected in position, while avoiding C / G aggregation. (3) For left and right probe hybridization sequences of 23-25 ​​bp, the Tm in RaW Probe should be greater than 72.5℃; for 26-35 bp, the Tm should be greater than 71℃; for 36-41 bp, the Tm should be greater than 70℃; and for greater than 40 bp, the Tm should be greater than 68℃. (4) The secondary structure and ΔG value of the left and right probe sequences of each species under experimental reaction conditions should be detected on the mfold Web Server website, and the best structure probe should be screened. (5) The free energy of the left and right probes should be greater than 0.

[0069] The status of the 6 probes is as follows:

[0070]

[0071]

[0072] Based on the secondary structure of the six probes, the specific requirements are: the looping part of the left probe is not on the left primer and is far from the 3' end of the left probe; the looping part of the right probe is not on the right primer and is far from the 5' end of the right probe; and the looping part of the two probes after they are connected together is not at the connection point between the left and right probes.

[0073] Probe preparation: Prepare a 10 μM stock solution for the probes, and dilute it to a 1 μM working solution before use. Take 0.8 μL each of the left and right probes from each MLPA probe, and add TE to a final volume of 600 μL to prepare the Ophiopogon japonicus (mountain ophiopogon) probe solution. That is, 0.8 μL of Ophiopogon japonicus (mountain ophiopogon) left probe + 0.8 μL of Ophiopogon japonicus (mountain ophiopogon) right probe + 598.4 μL of TE, and store at 4℃ for later use.

[0074] Hybridization: The purified products of Ophiopogon japonicus and Ophiopogon japonicus were hybridized with Ophiopogon japonicus and Ophiopogon japonicus probes, respectively. An 8 μL hybridization system was prepared (1.5 μL probe, 1 μL template, 5.5 μL TE). The reaction program was: denaturation at 98℃ for 5 min, hybridization at 72℃ for 20 min.

[0075] Ligation reaction: Take 1.28 μL of hybridization product into the ligation system (9°N). TM DNA Ligase 0.32 μL, NE Buffer for 9°N DNA Ligase 0.8 μL, ddH2O 5.6 μL). Ligate left and right probes at 45℃ for 15 min, then inactivate the ligase at 98℃ for 5 min.

[0076] The ligation product was used as a template for quantitative real-time PCR amplification. The quantitative real-time PCR reaction system was as follows: 10 μL of 2×T5 FastqPCR Mix, 0.8 μL (10 μM) of upstream primer, 0.8 μL (10 μM) of downstream primer, 0.4 μL of 50×ROX Reference DyeI, and 3 μL of ddH2O. The reaction program was 95℃ for 1 min; 95℃ for 10 s, 60℃ for 5 s, 72℃ for 10 s, for 40 cycles; 72℃ for 5 min. The melting curve was obtained at 98℃ for 3 min, and 45℃-97℃ (0.05℃ / s).

[0077] The results of specific probe screening are as follows: Ophiopogon japonicus and Ophiopogon japonicus template DNA were hybridized, ligated, and amplified by quantitative real-time PCR with Ophiopogon japonicus and Ophiopogon japonicus probes prepared in probe group 1, respectively. The results showed that the Ophiopogon japonicus probe only produced a single melting curve peak with Ophiopogon japonicus, while the Ophiopogon japonicus probe only showed an amplification curve with the Ophiopogon japonicus probe. Cross-reaction only appeared after 35 cycles, which could be eliminated by reducing the number of amplification cycles. The results of probe group 2 showed that the Ophiopogon japonicus probe did not cross-react with Ophiopogon japonicus DNA, while the Ophiopogon japonicus probe did cross-react with Ophiopogon japonicus DNA. Furthermore, the peak times for non-specific and specific amplification were the same, indicating that probe behavior could be optimized by optimizing the filler sequence. The results showed that the MLPA probe designed with the T / C variant at position 329 had good specificity and could be used to distinguish between Ophiopogon japonicus and Ophiopogon japonicus. The remaining four probe groups all showed strong non-specificity, especially the A / T variant at position 305, resulting in poor specificity.

[0078] Therefore, the first probe group was selected as the probe used in this study.

[0079] Example 3: Selection of MLPA Reaction Conditions

[0080] The mlpa reaction consists of three parts: hybridization, ligation, and mlpa amplification. This part involves screening for the optimal hybridization temperature, the optimal number of cycles, and the optimal ratio of mixed probes during the mlpa amplification process.

[0081] 1) Screening for hybridization temperature

[0082] Prepare the probe according to the requirements of Example 2.

[0083] DNA denaturation and hybridization: Take approximately 100 ng of purified Ophiopogon japonicus and Ligusticum striatum, add 1.5 μL of probe, and bring the volume to 8 μL with TE buffer. Use 8 μL of TE buffer as a negative control. Denature at 98℃ for 5 min, and hybridize at different temperatures (62℃, 64℃, 66℃, 68℃, 70℃, 72℃) for 20 min for verification.

[0084] Ligation reaction: Take 1.28 μL of hybridization product into the ligation system (9°N). TM DNA Ligase 0.32 μL, NE Buffer for 9°N DNA Ligase 0.8 μL, ddH2O 5.6 μL). Ligate left and right probes at 45℃ for 15 min, then inactivate the ligase at 98℃ for 5 min.

[0085] Real-time PCR amplification was performed using the ligation product as a template.

[0086] The quantitative PCR reaction system was as follows: 10 μL of 2×T5 Fast qPCR Mix, 0.8 μL (10 μM) of upstream primer, 0.8 μL (10 μM) of downstream primer, 0.4 μL of 50×ROX Reference Dye I, and 3 μL of ddH2O. The reaction program was 95℃ for 1 min; 95℃ for 10 s, 60℃ for 5 s, 72℃ for 10 s, for 35 cycles; 72℃ for 5 min. The melting curve was obtained at 98℃ for 3 min, followed by a cycle of 45℃-97℃ (0.05℃ / s).

[0087] Based on the height of the melting curve peaks in non-specific amplification (as shown in the attached figure) Figure 1 The optimal hybridization temperature was selected as 72℃.

[0088] 2) Determination of cycle number for quantitative real-time PCR

[0089] Prepare the probe according to the requirements of Example 2.

[0090] The purified products of Ophiopogon japonicus and Ophiopogon japonicus were hybridized with Ophiopogon japonicus probe, Ophiopogon japonicus probe and mixed probe respectively. An 8 μL hybridization system was prepared (1.5 μL probe, 1 μL template, 5.5 μL TE). The reaction program was: denaturation at 98℃ for 5 min, hybridization at 72℃ for 20 min.

[0091] Ligation reaction: Take 1.28 μL of hybridization product into the ligation system (9°N). TM DNA Ligase 0.32 μL, NE Buffer for 9°N DNA Ligase 0.8 μL, ddH2O 5.6 μL). Ligate left and right probes at 45℃ for 15 min, then inactivate the ligase at 98℃ for 5 min.

[0092] Real-time PCR amplification was performed using the ligation product as a template.

[0093] The quantitative PCR reaction system was as follows: 10 μL of 2×T5 Fast qPCR Mix, 0.8 μL (10 μM) of upstream primer, 0.8 μL (10 μM) of downstream primer, 0.4 μL of 50×ROX Reference Dye I, and 3 μL of ddH2O. The reaction program was 95℃ for 1 min; 95℃ for 10 s, 60℃ for 5 s, 72℃ for 10 s, for 40 cycles; 72℃ for 5 min. The melting curve was obtained at 98℃ for 3 min, and then at 45℃-97℃ (0.05℃ / s).

[0094] Set the number of cycles: 40cycle, 35cycle, 30cycle, 28cycle, 25cycle.

[0095] Based on the amplification curves indicating nonspecific amplification, the number of cycles in the quantitative PCR reaction was reduced to prevent nonspecific amplification. Ultimately, 28 cycles were determined to be the optimal number of cycles for quantitative PCR amplification (see attached figure). Figure 2 ).

[0096] 3) Screening for the optimal probe mixing ratio

[0097] The probes were prepared as a 10 μM storage solution and diluted to a 1 μM working solution before use. Mixtures were prepared as follows: 1.2 μL of Ophiopogon japonicus left probe + 0.4 μL of Ophiopogon japonicus left probe + 1.6 μL of common right probe + 596.8 μL TE, labeled as mixed probe A; 1.1 μL of Ophiopogon japonicus left probe + 0.5 μL of Ophiopogon japonicus left probe + 1.6 μL of common right probe + 596.8 μL TE, labeled as mixed probe B; 1.0 μL of Ophiopogon japonicus left probe + 0.6 μL of Ophiopogon japonicus left probe + 1.6 μL of common right probe + 596.8 μL TE, labeled as mixed probe C; 0.8 μL of Ophiopogon japonicus left probe + 0.8 μL of Ophiopogon japonicus left probe + 1.6 μL of common right probe + 596.8 μL TE, labeled as mixed probe D; 0.6 μL of Ophiopogon japonicus left probe + 1.0 μL of Ophiopogon japonicus left probe + 1.6 μL of common right probe + 596.8 μL TE. TE is labeled as mixed probe E; 0.4 μL of Ophiopogon japonicus left probe + 1.2 μL of Ophiopogon japonicus left probe + 1.6 μL of common right probe + 596.8 μl of TE is labeled as mixed probe F.

[0098] Take 1 μL each of the purified products of Ophiopogon japonicus and Ophiopogon japonicus and mix them with the mixed probe to prepare an 8 μL hybridization system (1.5 μL probe, 1 μL template, 5.5 μL TE). The reaction program is: denaturation at 98℃ for 5 min, hybridization at 72℃ for 20 min.

[0099] Ligation reaction: Take 1.28 μL of hybridization product into the ligation system (9°N). TMDNA Ligase 0.32 μL, NE Buffer for 9°N DNA Ligase 0.8 μL, ddH2O 5.6 μL). Ligate left and right probes at 45℃ for 15 min, then inactivate the ligase at 98℃ for 5 min.

[0100] Real-time PCR amplification was performed using the ligation product as a template.

[0101] The quantitative PCR reaction system was as follows: 10 μL of 2×T5 Fast qPCR Mix, 0.8 μL (10 μM) of upstream primer, 0.8 μL (10 μM) of downstream primer, 0.4 μL of 50×ROX Reference Dye I, and 3 μL of ddH2O. The reaction program was 95℃ for 1 min; 95℃ for 10 s, 60℃ for 5 s, 72℃ for 10 s, for 28 cycles; 72℃ for 5 min. The melting curve was obtained at 98℃ for 3 min, followed by a cycle of 45℃-97℃ (0.05℃ / s).

[0102] The optimal probe ratio was selected based on the melting curve peaks observed during amplification. In the case of mixed probe E, the mixed system of Ophiopogon japonicus and Ophiopogon japonicus showed two peaks of similar height (see attached figure). Figure 3 ).

[0103] Example 4 Probe Specificity Verification

[0104] The purified products of Ophiopogon japonicus and Ophiopogon japonicus were hybridized with Ophiopogon japonicus probe, Ophiopogon japonicus probe, and mixed probe E, respectively. An 8 μL hybridization system was prepared (1.5 μL probe, 1 μL template, 5.5 μL TE). The reaction program was: denaturation at 98℃ for 5 min, hybridization at 72℃ for 20 min.

[0105] Ligation reaction: Take 1.28 μL of hybridization product into the ligation system (9°N). TM DNA Ligase 0.32 μL, NE Buffer for 9°N DNA Ligase 0.8 μL, ddH2O 5.6 μL). Ligate left and right probes at 45℃ for 15 min, then inactivate the ligase at 98℃ for 5 min.

[0106] Melting curves were used to determine the Tm value: Real-time quantitative PCR amplification was performed using the ligation product as a template, and the melting curves and corresponding Tm values ​​of *Ophiopogon japonicus* and *Ophiopogon japonicus var. mongolicus* were obtained (see attached). Figure 4 );

[0107] The quantitative PCR reaction system was as follows: 10 μL of 2×T5 Fast qPCR Mix, 0.8 μL (10 μM) of upstream primer, 0.8 μL (10 μM) of downstream primer, 0.4 μL of 50×ROX Reference Dye I, and 3 μL of ddH2O. The reaction program was 95℃ for 1 min; 95℃ for 10 s, 60℃ for 5 s, 72℃ for 10 s, for 28 cycles; 72℃ for 5 min. The melting curve was obtained at 98℃ for 3 min, followed by a cycle of 45℃-97℃ (0.05℃ / s).

[0108] The universal amplification primers are: Primer F: 5′-GGGTTCCCTAAGGGTTGGA-3′ (SEQ ID NO:6); Primer R: 5′-TCTAGATTGGATCTTGCTGGCAC-3′ (SEQ ID NO:7)

[0109] Example 5: Probe Sensitivity Evaluation

[0110] The purified Ophiopogon japonicus product was continuously diluted from high concentration to low concentration, and a certain amount of purified DNA product was taken for the experiment. The sampling amount was divided into 8 gradient levels (100ng, 50ng, 25ng, 10ng, 5ng, 1ng, 0.5ng, 0.1ng) to facilitate its sensitivity measurement.

[0111] Hybridization and ligation reactions were performed according to Example 2, followed by quantitative real-time PCR amplification.

[0112] Sensitivity verification: Based on the melting curve peaks appearing at 78.98℃±0.1℃ and 80.57℃±0.1℃ respectively (as shown in the attached figure). Figure 5 , 6 The sensitivity of the MLPA method for detecting Ophiopogon japonicus mixed probe E was determined based on the following conditions. If Ophiopogon japonicus and Ophiopogon japonicus can still be detected at lower concentrations, it indicates that the method has high sensitivity for detecting Ophiopogon japonicus-type medicinal materials.

[0113] Example 6: Probe Doping Ratio Evaluation

[0114] The adulteration ratio detection involves mixing the purified DNA products of Ophiopogon japonicus and Ophiopogon japonicus, and adulterating them according to the following proportions: 99%, 97%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 3%, and 1% of Ophiopogon japonicus.

[0115] Hybridization and ligation reactions were performed according to Example 2, followed by quantitative real-time PCR amplification.

[0116] The degree of mixing is determined based on the melting curve peaks that appear (as shown in the attached figure). Figure 7The presence of melting curve peaks at 78.98℃±0.1℃ and 80.57℃±0.1℃ simultaneously indicates that the mixed sample contains Ophiopogon japonicus and Ophiopogon japonicus var. mongolicum. Based on the melting curve, this invention can identify a very small amount of DNA from the mixed medicinal materials. <110> Hubei Provincial Institute for Drug Control <120> A method for identifying Ophiopogon japonicus and Ophiopogon japonicus based on MLPA technology <160> 9 <170> SIPOSequenceListing <210> 1 <211> 58 <212> DNA <213> Artificial sequence <400> 1 gggttcccta agggttggac aagtatttag tctttgtaat ttccatagat acaaatat 58 <210> 2 <211> 60 <212> DNA <213> Artificial sequence <400> 2 gggttcccta agggttggac cgcacgattt agtctttgta atttccatag atacaaatac 60 <210> 3 <211> 49 <212> DNA <213> Artificial sequence <400> 3 tcggctagta tgatgcgcgg gaaatgtcta gattggatct tgctggcac 49 <210> 4 <211> twenty four <212> DNA <213> Artificial sequence <400> 4 caataaaaag cccattttac ttct 24 <210> 5 <211> twenty one <212> DNA <213> Artificial sequence <400> 5 ggtgacacga ggattttcag t 21 <210> 6 <211> 19 <212> DNA <213> Artificial sequence <400> 6 gggttcccta agggttgga 19 <210> 7 <211> twenty three <212> DNA <213> Artificial sequence <400> 7 tctagattgg atcttgctgg cac 23 <210> 8 <211> 406 <212> DNA <213> Ophioplocus japonicus <400> 8 caataaaaag cccattttac ttcttaacta tttagttattctctttttttttcataagaa 60 gttcaaagaa aattcaatat ctttctcatt cattctactc tttcacaaac ggatccgaac 120 agaaatcttt tgatctttatc ctaatttggt ttgaatagat acgatacctg tacaaataaa 180 catatataat tgacataatt gaagtccata tcacttataa cttacattca aaaagaaagt 240 cttctttttg aagatctaag aattcgggg actaggtca atttttgaat acttttttta 300 gtctttgtaa tttccataga tacaatatt ccgctagtat gatgcgcggg aaatggtcgg 360 gatagctcag ttggtagagc agaggactga aaatcctcgt gtcacc 406 <210> 9 <211> 406 <212> DNA <213> Liriope muscari <400> 9 caataaaaag cccattttac ttcttaacta tttagttatt ctcttttttt ttcataagaa 60 gttcaagaa attcaat ctttctcatt cattctactc ttccacaac gatccgaac 120 agaaatcttt tgatcttatc ctaatttggt tgaatagat acgatacctg tacaataaa 180 catatataat tgacatatt gaagtccata tcacttataa cttacattca aaagaaagt 240 cttctttttg aagatctaag aattcgggg actaggtca atttttgaat acttttttta 300 gtctatgtaa tttccataga tacaatact ccgctagtat gatgcgcggg aaatggtcgg 360 gatagctcag ttggtagagc agaggactga aaatcctcgt gtcacc 406

Claims

1. A method for identifying Ophiopogon japonicus and Ophiopogon japonicus based on multiplex ligation probe amplification technology, characterized in that... Includes the following steps: 1) Extract genomic DNA from the sample; 2) Using the extracted genomic DNA as a template, chloroplast gene fragments of Ophiopogon japonicus and Ophiopogon japonicus were amplified using specific primers, and the amplification products were purified. The nucleotide sequences of the chloroplast gene fragments of Ophiopogon japonicus and Ophiopogon japonicus are shown in SEQ ID NO:8 and 9, respectively. The specific primer sequences used to amplify the chloroplast gene fragments are as follows: Upstream primer: as shown in SEQ ID NO:4; Downstream primer: as shown in SEQ ID NO:

5. 3) Hybridize the MLPA probe with the purified product; 4) Use DNA ligase to ligate the hybridization products from step 3); 5) Perform qPCR amplification on the ligation product from step 4) using universal primers. The universal primer sequences are as follows: Primer F: as shown in SEQ ID NO: 6; Primer R: as shown in SEQ ID NO: 7; 6) Collect melting curve signals and observe the Tm value. The MLPA probe consists of three probes: two left probes and one right probe. The probe sequence is as follows: Left probe of Ophiopogon japonicus: as shown in SEQ ID NO: 1; Left probe of Ophiopogon japonicus: as shown in SEQ ID NO: 2; Common right probe: as shown in SEQ ID NO: 3; In the MLPA probe, the volume ratio of the left probe of Ophiopogon japonicus, the left probe of Ophiopogon japonicus, and the common right probe is 0.6:1.0:1.6; In step 6), the sample is identified by observing the melting curve peak and Tm value. If the sample has a single melting curve peak and a Tm value of 78.98℃±0.1℃, it is Ophiopogon japonicus; if the sample has a single melting curve peak and a Tm value of 80.57℃±0.1℃, it is Ophiopogon japonicus var. sarcodactylis; if the sample has two melting curve peaks and melting peak Tm values ​​of 78.98℃±0.1℃ and 80.57℃±0.1℃, it is a mixed sample of Ophiopogon japonicus and Ophiopogon japonicus var. sarcodactylis.

2. The method for identifying Ophiopogon japonicus and Ophiopogon japonicus as described in claim 1, characterized in that: The DNA ligase is a 9°N DNA ligase.

3. The method for identifying Ophiopogon japonicus and Ophiopogon japonicus as described in claim 1, characterized in that: The hybridization temperature was 72°C.

4. The method for identifying Ophiopogon japonicus and Ophiopogon japonicus as described in claim 1, characterized in that: The qPCR amplification cycle was 28 times.

Images