Enhancement of extracellular protein transport from the Golgi apparatus to the extracellular space to increase the production of extracellular glucose oxidase in Pichia pastoris

By enhancing the expression of vesicle secretion-promoting factors in yeast cells and optimizing the transport pathway of Golgi to extracellular proteins, the problem of insufficient glucose oxidase production in Pichia yeast is solved, and the efficient expression and secretion of enzymes is achieved.

CN115247135BActive Publication Date: 2025-08-15EAST CHINA UNIV OF SCI & TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202110460521.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-04-27
Publication Date
2025-08-15
Estimated Expiration
2041-04-27

AI Technical Summary

Technical Problem

In the prior art, the low vesicle transport efficiency in Pichia ceramia expression system leads to insufficient production of glucose oxidase, which becomes a bottleneck for the efficient expression of exogenous proteins.

Method used

By enhancing the expression and activity of vesicle secretion-promoting factors in yeast cells, such as VAMP4, SEC4, EXO84P, etc., the Golgi body to extracellular protein transport pathway is optimized, and the expression and activity of glucose oxidase are improved.

Benefits of technology

It significantly improves the total intracellular and extracellular enzyme yield and secretion rate of glucose oxidase, and enhances the GOD production capacity of Pichia cerevisiae.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003042253210000091
    Figure BDA0003042253210000091
  • Figure BDA0003042253210000101
    Figure BDA0003042253210000101
  • Figure BDA0003042253210000102
    Figure BDA0003042253210000102
Patent Text Reader

Abstract

The present invention provides a gene for increasing glucose oxidase (GOD) production in Pichia pastoris and its use. Specifically, the present invention provides a method for constructing a glucose oxidase (GOD)-producing strain, wherein the activity of a vesicle secretion-promoting factor is enhanced or a vesicle secretion-promoting factor is introduced into the starting strain. Experiments have confirmed that co-expression of the VAMP4 gene, which is involved in the vesicle transport pathway from the Golgi apparatus to the plasma membrane, significantly increases extracellular GOD production in Pichia pastoris.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for enhancing the protein transport process from the Golgi apparatus to the extracellular space to increase the extracellular glucose oxidase production of Pichia pastoris. Background Art

[0002] Glucose oxidase (GOD, EC 1.1.3.4) is a flavoglycoprotein. As a homodimeric molecule, it oxidizes β-D-glucose to gluconic acid, using molecular oxygen as an electron acceptor to generate hydrogen peroxide. In recent years, GOD, a mature commercial industrial enzyme, has been increasingly used in industries such as food and textile dyeing, and has also found widespread application in emerging industries such as glucose biosensors and environmentally friendly fuels. However, the low production of commercial GOD has been a major limitation to its large-scale industrial application.

[0003] As a foreign protein expression system, the Pichia pastoris system offers advantages such as post-translational processing of expressed proteins, easy purification of foreign proteins, high-density fermentation, and low culture costs. Therefore, Pichia pastoris has been a common expression host of choice for GOD in recent years. However, a growing number of studies have shown that obstacles in the yeast secretory pathway have become a bottleneck for achieving efficient foreign protein expression. Proteins require vesicle transport from the endoplasmic reticulum to the Golgi apparatus and then from the Golgi apparatus to the plasma membrane. However, inefficient vesicle transport can cause some foreign proteins to accumulate intracellularly.

[0004] In summary, there is an urgent need in the art to provide a method for improving vesicle transport efficiency and increasing glucose oxidase production. Summary of the Invention

[0005] The object of the present invention is to provide a method for enhancing the protein transport process from the Golgi apparatus to the extracellular space and increasing the production of extracellular glucose oxidase in Pichia pastoris.

[0006] In a first aspect of the present invention, a method for increasing the expression and / or activity of glucose oxidase (GOD) in yeast cells is provided, comprising the following steps:

[0007] In the starting strain, the expression and / or activity of the yeast cell vesicle secretion promoting factor or its gene is enhanced, thereby obtaining a yeast cell glucose oxidase (GOD) production strain with improved expression and / or activity of the yeast cell glucose oxidase (GOD), wherein:

[0008] The vesicle secretory promoting factor comprises one or more proteins selected from the following group:

[0009] (1) A protein having an amino acid sequence as shown in any one of SEQ ID NOs.: 1-6;

[0010] (2) a protein derived from (1) having vesicle secretory factor activity, formed by substituting, deleting or adding one or more amino acid residues in the amino acid sequence of any one of SEQ ID NOs.: 1-6; and / or

[0011] (3) A protein having an amino acid sequence homology ≥85% (preferably ≥90%, 95%, and more preferably ≥98%) to any one of SEQ ID NOs.: 1-6, and having vesicle secretory factor activity.

[0012] In another preferred embodiment, the vesicle secretagogue comprises a protein derived from (1) having vesicle secretagogue activity, formed by adding 1 to 5 amino acid residues to both ends of the amino acid sequence shown in any one of SEQ ID NOs.: 1 to 6.

[0013] In another preferred embodiment, the vesicle secretory promoting factor at least includes a protein having an amino acid sequence as shown in SEQ ID NO.: 1.

[0014] In another preferred embodiment, the vesicle secretory promoting factor comprises at least 2 (preferably 3, 4, or 5) proteins having an amino acid sequence as shown in any one of SEQ ID NOs.: 1-6.

[0015] In another preferred embodiment, the vesicle secretory promoting factor is selected from one or more proteins with amino acid sequences as shown in SEQ ID NO.: 1, 2 and / or 5.

[0016] In another preferred embodiment, the vesicle secretagogue is selected from one or more of the following groups: VAMP4, SEC4, EXO84P, EXO70P, STX1-4, and YPT32; preferably, selected from VAMP4, SEC4, and EXO84P.

[0017] In another preferred embodiment, the activity of the vesicle secretory factor is enhanced by:

[0018] (1) increasing the expression level of vesicle secretory factors and / or the activity of the protein itself; and / or

[0019] (2) Reduce the degradation and / or inactivation of vesicle secretory factors.

[0020] In another preferred embodiment, increasing the expression level of the vesicle secretion-promoting factor includes: up-regulating the expression of the gene encoding the vesicle secretion-promoting factor.

[0021] In another preferred embodiment, the vesicle secretory promoting factor is exogenous or endogenous.

[0022] In another preferred embodiment, the vesicle secretagogue is endogenous.

[0023] In another preferred embodiment, the gene encoding the vesicle secretory promoting factor is selected from the following group: cDNA sequence, genomic sequence, or a combination thereof.

[0024] In another preferred example, upregulating the expression of the gene encoding the vesicle secretory promoting factor includes upregulating the transcription level and / or translation level of the gene encoding the gene.

[0025] In another preferred example, the activity of the vesicle secretory factor can be enhanced by one or a combination of the following methods: expressing homologous or heterologous coding genes of the protein, and / or increasing the copy number of the coding gene in the strain, and / or modifying the regulatory sequence (such as the promoter) of the coding gene to enhance the transcription speed (such as the transcription initiation speed), and / or modifying the translation regulatory region of the messenger RNA carrying the coding gene to enhance the translation intensity, and / or modifying the coding gene itself to enhance mRNA stability, protein stability, and relieve protein feedback inhibition.

[0026] In another preferred embodiment, said enhancing the activity of the vesicle secretion-promoting factor comprises overexpressing the vesicle secretion-promoting factor in a strain.

[0027] In another preferred embodiment, compared with the starting strain, the content and / or activity of the vesicle secretory factor in the GOD production strain is increased by at least 20%, preferably, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 200%.

[0028] In another preferred embodiment, compared with the starting strain, the total intracellular and extracellular enzyme content (or yield) and / or activity of GOD in the GOD-producing strain is increased by at least 2%, preferably, by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 200%.

[0029] In another preferred embodiment, the GOD extracellular enzyme content (or yield) and / or activity of the GOD producing strain is increased by at least 3%, preferably by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 200%, compared to the starting strain.

[0030] In another preferred embodiment, compared with the starting strain, the secretion rate of GOD in the GOD-producing strain is increased by at least 5%, preferably, by at least 10%, 20%, 30%, 40%, 50%, 60%, 80%, 90% or 100%.

[0031] In another preferred embodiment, the construction method comprises the steps of:

[0032] (a1) providing an expression vector carrying a gene encoding a vesicle secretory promoting factor;

[0033] (b1) transferring the expression vector into the starting strain to obtain a recombinant strain; and

[0034] (c1) cultivating the recombinant strain.

[0035] In another preferred embodiment, the method further comprises determining the GOD yield of the obtained strain.

[0036] In another preferred embodiment, the starting strain is a yeast cell.

[0037] In another preferred embodiment, the yeast cell is selected from Pichia pastoris and Saccharomyces cerevisiae.

[0038] In another preferred embodiment, the yeast cell is Pichia pastoris.

[0039] In another preferred embodiment, the starting strain is Pichia pastoris GS115.

[0040] In another preferred embodiment, the starting strain expresses wild-type GOD or a mutant thereof.

[0041] In another preferred embodiment, a GOD expression cassette is integrated downstream of the AOX promoter in the genome of the starting strain.

[0042] In another preferred embodiment, the GOD expression cassette further includes a signal peptide and / or a promoter.

[0043] In another preferred embodiment, the gene sequence of the GOD mutant is shown in positions 33-615 of SEQ ID NO.: 7.

[0044] In another preferred embodiment, each corresponding GOD protein encoding gene has at least 92%, preferably at least 95%, more preferably at least 98% or 99% homology among the genomes of the starting strains.

[0045] In another preferred embodiment, the GOD-producing strain is a GOD-high-yielding strain.

[0046] In another preferred embodiment, the "high yield" means that the expression level or production capacity of the GOD protein of the strain is increased by at least 20% compared with its starting strain, preferably, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 200%.

[0047] In a second aspect of the present invention, a GOD-producing strain is provided, wherein the activity of a vesicle secretion-promoting factor in the strain is enhanced, wherein the vesicle secretion-promoting factor comprises one or more proteins selected from the group consisting of:

[0048] (1) A protein having an amino acid sequence as shown in any one of SEQ ID NOs.: 1-6;

[0049] (2) a protein derived from (1) having vesicle secretory factor activity, formed by substituting, deleting or adding one or more amino acid residues in the amino acid sequence of any one of SEQ ID NOs.: 1-6; and / or

[0050] (3) A protein having an amino acid sequence homology ≥85% (preferably ≥90%, 95%, and more preferably ≥98%) to any one of SEQ ID NOs.: 1-6, and having vesicle secretory factor activity.

[0051] In another preferred embodiment, the GOD-producing strain is prepared by the method described in the first aspect of the present invention.

[0052] In another preferred embodiment, the GOD-producing strain is used to produce GOD and / or downstream products using GOD as a precursor.

[0053] In another preferred embodiment, the GOD producing strain expresses wild-type GOD or a GOD mutant.

[0054] In another preferred embodiment, a GOD expression cassette is integrated downstream of the AOX promoter in the genome of the GOD-producing strain.

[0055] In another preferred embodiment, the GOD expression cassette further includes a signal peptide and / or a promoter.

[0056] In another preferred embodiment, the gene sequence of the GOD mutant is shown in positions 33-615 of SEQ ID NO.: 7.

[0057] In another preferred embodiment, each corresponding GOD protein encoding gene has at least 92%, preferably at least 95%, more preferably at least 98% or 99% homology among the genomes of the starting strains.

[0058] In another preferred embodiment, the GOD-producing strain is a GOD-high-yielding strain.

[0059] In another preferred embodiment, the "high yield" means that the expression level or production capacity of the GOD protein of the strain is increased by at least 20% compared with its starting strain, preferably, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 200%.

[0060] In the third aspect of the present invention, there is provided a use of the GOD-producing strain according to the second aspect of the present invention for producing GOD and / or downstream products using GOD as a precursor.

[0061] In a fourth aspect of the present invention, a method for preparing GOD protein is provided, comprising the steps of:

[0062] 1) fermenting and culturing the GOD-producing strain according to claim 3 to obtain GOD protein; and

[0063] 2) Optionally, obtaining GOD protein from the fermentation culture system of 1).

[0064] In a fifth aspect of the present invention, a method for enhancing the GOD protein production capacity of a strain is provided, comprising the steps of:

[0065] In the starting strain, the activity of the vesicle secretion-promoting factor is enhanced, wherein the vesicle secretion-promoting factor comprises one or more proteins selected from the following group:

[0066] (1) A protein having an amino acid sequence as shown in any one of SEQ ID NOs.: 1-6;

[0067] (2) a protein derived from (1) having vesicle secretory factor activity, formed by substituting, deleting or adding one or more amino acid residues in the amino acid sequence of any one of SEQ ID NOs.: 1-6; and / or

[0068] (3) A protein having an amino acid sequence homology ≥85% (preferably ≥90%, 95%, and more preferably ≥98%) to any one of SEQ ID NOs.: 1-6, and having vesicle secretory factor activity.

[0069] In another preferred embodiment, the method comprises the step of up-regulating the expression of a gene encoding a vesicle secretion-promoting factor in the starting strain.

[0070] In another preferred embodiment, the vesicle secretagogue is selected from one or more of the following groups: VAMP4, SEC4, EXO84P, EXO70P, STX1-4, and YPT32; preferably, selected from VAMP4, SEC4, and EXO84P.

[0071] In a sixth aspect of the present invention, there is provided a use of a vesicle secretion promoting factor or a gene promoter thereof for enhancing the GOD protein production capacity of a strain, wherein the vesicle secretion promoting factor comprises one or more proteins selected from the following group:

[0072] (1) A protein having an amino acid sequence as shown in any one of SEQ ID NOs.: 1-6;

[0073] (2) a protein derived from (1) having vesicle secretory factor activity, formed by substituting, deleting or adding one or more amino acid residues in the amino acid sequence of any one of SEQ ID NOs.: 1-6; and / or

[0074] (3) A protein having an amino acid sequence homology ≥85% (preferably ≥90%, 95%, and more preferably ≥98%) to any one of SEQ ID NOs.: 1-6, and having vesicle secretory factor activity.

[0075] In another preferred embodiment, the promoter is selected from the following group: small molecule compounds, nucleic acid molecules, polypeptides, small molecule ligands, or a combination thereof.

[0076] In another preferred embodiment, the nucleic acid molecule is selected from the group consisting of miRNA, shRNA, siRNA, or a combination thereof.

[0077] In another preferred embodiment, the strain is Pichia pastoris.

[0078] In a seventh aspect of the present invention, a vesicle secretion promoting factor is provided, wherein the vesicle secretion promoting factor is one or more proteins selected from the following group:

[0079] (1) A protein having an amino acid sequence as shown in any one of SEQ ID NOs.: 1-6;

[0080] (2) a protein derived from (1) having vesicle secretory factor activity, formed by substituting, deleting or adding one or more amino acid residues in the amino acid sequence of any one of SEQ ID NOs.: 1-6; and / or

[0081] (3) A protein having an amino acid sequence homology ≥85% (preferably ≥90%, 95%, and more preferably ≥98%) to any one of SEQ ID NOs.: 1-6, and having vesicle secretory factor activity.

[0082] In another preferred embodiment, the vesicle secretory promoting factor at least includes a protein having an amino acid sequence as shown in SEQ ID NO.: 1.

[0083] In another preferred embodiment, the vesicle secretory promoting factor comprises at least 2 (preferably 3, 4, or 5) proteins having an amino acid sequence as shown in any one of SEQ ID NOs.: 1-6.

[0084] In another preferred embodiment, the vesicle secretory promoting factor is selected from proteins with amino acid sequences shown in SEQ ID NO.: 1, 2 and / or 5.

[0085] In the eighth aspect of the present invention, a polynucleotide encoding a vesicle secretion-promoting factor is provided. The polynucleotide encodes the vesicle secretion-promoting factor as described in the seventh aspect of the present invention.

[0086] In the ninth aspect of the present invention, a vector is provided, wherein the vector contains the polynucleotide according to the eighth aspect of the present invention.

[0087] In the tenth aspect of the present invention, a use of the vesicle secretion promoting factor as described in the seventh aspect of the present invention, the polynucleotide encoding the vesicle secretion promoting factor as described in the eighth aspect of the present invention, and the vector as described in the ninth aspect of the present invention is provided for preparing the GOD production strain as described in the second aspect of the present invention.

[0088] In another preferred embodiment, the strain is Pichia pastoris.

[0089] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Figure 1 The schematic diagram of the construction of the pAOX-UH-SEC4 / EXO84P / EXO70P / STX1-4 / YPT32 plasmid is shown. "Inserted genes" represent the SEC4, EXO84P, EXO70P, STX1-4, and YPT32 genes, respectively.

[0091] Figure 2 A schematic diagram of the pAOX-UH-VAMP4 plasmid construction is shown.

[0092] Figure 3 The diagram shows the construction process of the recombinant strain E5-VAMP4 / SEC4 / EXO84P / EXO70P / STX1-4 / YPT32. "Inserted genes" represent the sequences of VAMP4, SEC4, EXO84P, EXO70P, STX1-4, and YPT32, respectively.

[0093] Figure 4The electrophoresis diagram of PCR products of six target genes is shown. M: DL15000 DNA Marker; Lane 1: VAMP4; Lane 2: SEC4; Lane 3: EXO84P; Lane 4: EXO70P; Lane 5: STX1-4; Lane 6: YPT32.

[0094] Figure 5 Shown are (A) the growth curve of each recombinant bacterium in a shake flask and (B) the extracellular GOD production of each recombinant bacterium at 144 h of induction.

[0095] Figure 6 The total intracellular and extracellular (A) GOD production and (B) secretion rate of each recombinant strain after 144 h of induction are shown. DETAILED DESCRIPTION

[0096] The present inventor has studied extensively and deeply, and through a large number of experiments, found that increasing the expression of specific vesicle secretion promoting factors in Pichia pastoris can greatly improve the enzyme yield of Pichia pastoris GOD production strains. Specifically, overexpressing vesicle secretion promoting factors that participate in the Golgi apparatus to plasma membrane vesicle transport pathway, such as vesicle secretion promoting factors such as VAMP4, SEC4, and EXO84P, in the GOD production strain can significantly improve the total extracellular and extracellular enzyme output and secretion rate of GOD. Experiments show that the extracellular enzyme output of the GOD production strain that overexpresses the secretion promoting gene VAMP4 improves by 24.1% compared to the starting strain E5. On this basis, the present invention has been completed.

[0097] the term

[0098] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0099] As used herein, when used in reference to a specific recited value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0100] As used herein, the terms "comprising" or "including" may be open, semi-closed, or closed. In other words, the terms also include "consisting essentially of" or "consisting of."

[0101] As used herein, the term "exogenous" refers to the inclusion of substances not originally present in a system. For example, exogenous genes or sequences generally refer to genes or fragments not present in the strain's chromosomes or plasmids. If a gene encoding a gene not originally present in a strain is introduced into the strain through transformation or other methods, the gene is considered "exogenous" to that strain. "Non-endogenous" genes or sequences generally refer to specific genes or sequences present in the chromosomes of the same or different strains, but not in the chromosomes of the specific wild-type or mutant strain serving as the host cell.

[0102] As used herein, "nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or portions thereof, and may also refer to genomic or synthetic DNA or RNA, which may be single-stranded or double-stranded, representing the sense strand or the antisense strand.

[0103] As used herein, a "derivative" of a protein or polynucleotide refers to an amino acid sequence or a polynucleotide sequence encoding it that has one or more amino acid or nucleotide changes. The changes may include deletions, insertions, or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Derivatives may have "conservative" changes, wherein the replaced amino acid has a similar structure or chemical properties as the original amino acid, such as replacing isoleucine with leucine. Derivatives may also have non-conservative changes, such as replacing glycine with tryptophan. As used herein, "insertion" or "addition" refers to a change in an amino acid sequence or nucleotide sequence that results in an increase of one or more amino acids or nucleotides compared to the naturally occurring molecule. "Substitution" refers to the replacement of one or more amino acids or nucleotides by a different amino acid or nucleotide.

[0104] As used herein, "complementary" or "complementarity" refers to the natural binding of polynucleotides through base pairing under permissive salt concentration and temperature conditions. For example, the sequence "CTGA" will bind to the complementary sequence "GACT." The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization between nucleic acid strands.

[0105] As used herein, "homology" refers to the degree of complementarity, which can be partial homology or complete homology. "Partial homology" refers to a partially complementary sequence that can at least partially inhibit the hybridization of a completely complementary sequence with a target nucleic acid. This inhibition of hybridization can be detected by hybridization (Southern blot or Northern blot, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions of reduced stringency allow non-specific binding, because conditions of reduced stringency require that the binding of the two sequences to each other is a specific or selective interaction.

[0106] Sequence identity is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0107] As used herein, "isolate" refers to the separation of a substance from its original environment (in the case of a naturally occurring substance, the original environment is the natural environment). For example, polynucleotides and proteins in their natural state within living cells are not isolated and purified. However, the same polynucleotides or proteins are isolated and purified if they are separated from other substances with which they are naturally present.

[0108] The term "polynucleotide encoding a protein" refers to a polynucleotide that includes the polynucleotide encoding the protein and includes additional coding and / or non-coding sequences.

[0109] Vesicle secretagogues and their encoding genes

[0110] As used herein, "vesicle secretagogue" and "vesicle secretagogue of the present invention" refer to proteins that promote the transport of vesicles from the Golgi apparatus to the plasma membrane, such as VAMP4, SEC4, EXO84P, EXO70P, STX1-4, and YPT32 (see Table 1 for details).

[0111] The vesicle-associated membrane protein (VAMP4) gene encodes a vesicle-associated membrane protein that is a v-SNARE (synaptic vesicle receptor) required for the fusion of secretory vesicles with the plasma membrane. Studies have shown that after extracellular fusion, they are internalized from the plasma membrane by vesicles and then recycled into new secretory vesicles through endosomes and the Golgi apparatus. Therefore, in the process of promoting protein secretion to the extracellular space, the v-SNARE protein encoded by VAMP4 plays an important role in membrane fusion and transport between different vesicles and the plasma membrane. The GTP-binding protein encoded by SEC4 also plays a crucial role in the final stage of secretion. In a stable state, it exists in the cell in a soluble form, can bind to post-Golgi secretory vesicles, and participate in fusion with the plasma membrane. According to relevant literature reports, the proteins encoded by STX1-4 can also participate in plasma membrane fusion. EXO84P and EXO70P are essential components of the final stage of the yeast secretory pathway. EXO84P is an essential protein that plays a dual role in spliceosome assembly and exocytosis, mediating secretory vesicle polarization and targeting to the active site of exocytosis. EXO70P, on the other hand, can localize to extracellular sites independent of actin function by directly binding to polarity determinants in the cell cortex. The protein encoded by YPT32 is essential for secretory pathway trafficking and may be involved in the formation of secretory vesicles in the trans-Golgi apparatus.

[0112] Table 1 Information and amino acid sequences of six secretagogue genes

[0113]

[0114] Glucose oxidase (GOD)

[0115] Glucose oxidase can catalyze the oxidation of glucose to produce hydrogen peroxide and glucono-δ-lactone, or gluconic acid. Therefore, the glucose oxidase mutants of the present invention can be applied in a wide range of fields, including but not limited to: producing gluconic acid; being used as food preservatives and color stabilizers; producing hydrogen peroxide for textile bleaching; and manufacturing blood glucose meters to detect blood glucose concentrations in diabetic patients. They have more ideal enzyme activity, catalytic efficiency, or substrate affinity than the wild-type. The method of the present invention for increasing the expression and / or activity of yeast cell glucose oxidase (GOD) can increase the expression level of wild-type GOD or its mutant protein, wherein the sequence of the mutant protein has at least 92%, preferably at least 95%, and more preferably at least 98% or 99% homology to the sequence of the wild-type GOD protein.

[0116] The amino acid sequence of a wild-type GOD from Aspergillus niger is shown in SEQ ID NO.: 22.

[0117]

[0118] The GOD-producing bacteria of the present invention carry eight copies of the V20W+T30V mutant GOD gene (GOD gene numbered EC1.1.3.4). The amino acid sequence of the mutant GOD (GOD mutant) is shown at positions 33-615 of SEQ ID NO.: 7. The V20W+T30V mutation means that the amino acid at position 20 in the wild-type GOD amino acid sequence is mutated from Val to Trp, and the amino acid at position 30 is mutated from Thr to Val.

[0119]

[0120] Note: The underlined part is the GAS' signal peptide sequence (amino acids 1-32).

[0121] The construction of a GOD-producing strain containing a glucose oxidase mutant can be found in patent application CN 110628738 B.

[0122] Construction method of the present invention

[0123] In the present invention, genetic engineering methods are used to select and strengthen the relevant factors in the transport from the Golgi apparatus to the plasma membrane vesicles in Pichia pastoris to transform its secretion pathway, thereby increasing the secretion yield of GOD.

[0124] The present invention further provides a method for constructing a GOD production strain, which comprises: enhancing the activity of a vesicle secretion-promoting factor in the starting strain.

[0125] In another preferred embodiment, the construction method comprises the steps of:

[0126] (a1) providing an expression vector carrying a gene encoding a vesicle secretory promoting factor;

[0127] (b1) transferring the expression vector into the starting strain to obtain a recombinant strain; and

[0128] (c1) cultivating the recombinant strain.

[0129] The term "enhancement" as used herein refers to increasing, improving, enlarging or elevating a certain protein, such as the expression level and / or activity of a protein. In the present invention, the enhancement of the activity of a protein related to spinosyn synthesis may include increasing the expression level of the protein related to spinosyn synthesis and / or the activity of the protein itself, and / or reducing the degradation of the protein related to spinosyn synthesis. In view of the teachings of the present invention and the prior art, it will be readily understood by those skilled in the art that "enhancement" as used herein may also include enhancing the activity of a protein by expressing an exogenous gene encoding the protein.

[0130] In a specific embodiment, the activity of a protein can be enhanced by exogenously adding a substance or by mutation to enhance the protein's own activity.

[0131] In a specific embodiment, enhancing the activity of a protein includes increasing the content of the protein in the strain, which can be achieved by expressing an endogenous or heterologous coding gene for the protein, and / or increasing the copy number of the coding gene, and / or modifying the regulatory sequence of the coding gene (for example, modifying the promoter of the coding gene to enhance the transcription initiation rate), and / or modifying the translation regulatory region or rare codons of the messenger RNA carrying the coding gene to enhance the translation intensity, and / or modifying the coding gene itself to enhance mRNA stability, protein stability, relieve protein feedback inhibition, and the like.

[0132] As described above, regulatory sequences include a promoter capable of initiating transcription, any operator sequence for transcriptional regulation, a sequence encoding a suitable mRNA ribosome binding domain, and sequences that regulate transcription and translation termination. Modifications to regulatory sequences include, but are not limited to, deletions, insertions, conservative mutations, non-conservative mutations, or combinations thereof, within the polynucleotide sequence. Modifications can also be introduced by replacing the original polynucleotide sequence with a polynucleotide sequence that enhances activity.

[0133] A vector is a DNA construct comprising a polynucleotide sequence encoding a target protein, which is operably linked to a suitable regulatory sequence so that the target protein can be expressed in a host cell. After being introduced into a suitable host cell, the vector can replicate or function independently of the host cell genome, or can be integrated into the host's genome. These vectors are not particularly limited, as long as the vector is replicable in the host cell, and any vector known in the art can be used to construct the vector. Examples of vectors include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pWE15, pET, pUC vectors, etc.

[0134] In addition, by inserting the vector into the chromosome of the host cell, the polynucleotide encoding the endogenous target protein on the chromosome can be replaced with a modified polynucleotide. Insertion of the polynucleotide into the chromosome can be performed using any method known in the art, including but not limited to, for example, by homologous recombination. The polynucleotide includes DNA and RNA encoding the target protein, which can be inserted into the chromosome of the host cell in any form as long as it can be expressed in the host cell. Including but not limited to, for example, the polynucleotide can be introduced into the host cell in its native state and / or in the form of an expression cassette.

[0135] Host cells can be prokaryotes, such as bacteria; lower eukaryotic cells, such as yeast; or higher eukaryotic cells, such as plant cells. Representative examples include Escherichia coli, Streptomyces, and Agrobacterium; fungal cells, such as yeast; and plant cells. When expressing in higher eukaryotic cells, inserting an enhancer sequence into the vector can enhance transcription. Enhancers are cis-acting DNA elements, typically about 10 to 300 base pairs, that act on the promoter to increase gene transcription.

[0136] In a preferred embodiment of the present invention, the polynucleotide is expressed in yeast cells, preferably Pichia pastoris cells. Preferably, the 3' end of the polynucleotide further includes a signal peptide and / or a promoter. The signal peptides include, but are not limited to, the Saccharomyces cerevisiae α-mating factor (α-MF) and Pichia pastoris acid phosphatase (PHO1) signal peptides. The promoters include, but are not limited to, the AOX promoter.

[0137] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0138] The transformants obtained can be cultured using conventional methods to express the protein encoded by the gene of the present invention. Depending on the host cell used, the culture medium used can be selected from various conventional culture media. Culture is carried out under conditions suitable for host cell growth. After the host cells grow to an appropriate cell density, the promoter of choice is induced using a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0139] The recombinant protein in the above method can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art.

[0140] In a specific embodiment, the construction method of the starting strain (recombinant strain E5 expressing GOD) of the present invention is as follows:

[0141] The GOD gene containing V20W+T30V mutations and linked to the signal peptide GAS' was inserted downstream of the pAOX promoter in the pPIC9K vector to construct the plasmid pGG30B.

[0142] The plasmid pGG30B was integrated into the His site of the genome of Pichia pastoris GS115, and the recombinant Pichia pastoris E5 (kan) containing 8 copies of the GOD gene was obtained by screening with antibiotic concentration gradients. R HIS4).

[0143] In a specific embodiment, the genes for six vesicle secretion-promoting factors, VAMP4, SEC4, EXO84P, EXO70P, STX1-4, and YPT32, involved in the Golgi-to-cytoplasmic membrane vesicle trafficking pathway, were inserted into the pAOX-UH vector downstream of the pAOX promoter to generate a co-expression vector. The vector was then integrated into the genome of the recombinant strain E5 via homologous recombination to construct a strain that co-expressed the vesicle factors.

[0144] It should be understood that the vesicular secretion promoting factor of the present invention can be exogenous or endogenous, and there is no particular limitation as long as it can promote the extracellular enzyme production of GOD in the GOD-producing strain. In addition, the vesicular secretion promoting factor of the present invention can also be a protein having vesicular secretion promoting factor activity, which is obtained through gene mutation or other genetic engineering methods, and has a sequence homology of ≥85% (preferably ≥90%, 95%, and more preferably ≥98%) to any of the sequences shown in SEQ ID NOs.: 1-6.

[0145] In a preferred embodiment of the present invention, the vesicle secretion-promoting factor is derived from the GOD-producing strain Pichia pastoris, and a production strain co-expressing the vesicle secretion-promoting factor and GOD is constructed through genetic recombination. It should be understood that the GOD-producing strain can express one or more vesicle secretion-promoting factors, including but not limited to VAMP4, SEC4, and EXO84P, through genetic recombination or other genetic engineering methods, thereby increasing the yield, activity, and / or secretion rate of GOD.

[0146] The main advantages of the present invention include

[0147] (1) The present invention unexpectedly discovered for the first time that enhancing the activity of a specific vesicle secretion-promoting factor in Pichia pastoris (e.g., increasing the expression level of the vesicle secretion-promoting factor) can greatly increase the total protein production of GOD inside and outside the Pichia pastoris, especially the extracellular GOD production.

[0148] (2) The GOD production of the GOD producing strain prepared by the construction method of the present invention is significantly improved compared with the starting strain.

[0149] (3) The extracellular GOD production of the GOD-producing strain prepared by the construction method of the present invention is significantly increased compared with the starting strain.

[0150] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which detailed conditions are not specified, were generally performed under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0151] Materials and Methods

[0152] 1.1 Materials

[0153] 1.1.1 Strains and vectors

[0154] The recombinant bacteria E5 (GOD gene number EC 1.1.3.4) that secretes and expresses GOD and the expression vector pAOX-UH were constructed and preserved in the laboratory. E5 is a recombinant Pichia pastoris (kan) with GS115 as the starting bacteria and 8 copies of the V20W+T30V mutant GOD gene and a signal peptide of GAS'. R Pichia pastoris GS115 and Escherichia coli DH5α were preserved in the laboratory.

[0155] 1.1.2 Main reagents and instruments

[0156] All enzymes used in the experiment, including Exnase II, restriction endonucleases (SalI, NdeI, etc.), and standard nucleic acid molecular weight markers, were purchased from Dalian TaKaRa Biotechnology Co., Ltd. All molecular cloning kits, including plasmid extraction kits, PCR purification kits, and yeast genomic DNA extraction kits, were purchased from Axygen. A 721 visible light spectrophotometer was purchased from Shanghai Third Analytical Instrument Factory; a TS-S200B thermostatic shaker was purchased from Shanghai Tiancheng Laboratory Instrument Manufacturing Co., Ltd.

[0157] 1.1.3 Culture medium

[0158] For the configuration of YPD liquid medium, BMGY liquid medium, and BMMY liquid medium, please refer to the Pichia pastoris operation manual of Invitrogen.

[0159] 1.2 Methods

[0160] 1.2.1 Construction of recombinant plasmids and corresponding recombinant bacteria

[0161] 1.2.1.1 Construction of 6 recombinant plasmids pAOX-UH-VAMP4 / SEC4 / EXO84P / EXO70P / STX1-4 / YPT32

[0162] The NCBI database numbers of the gene sequences of the six secretagogue factors VAMP4, SEC4, EXO84P, EXO70P, STX1-4 and YPT32 in the transport pathway from the Golgi apparatus to the plasma membrane vesicles are:

[0163] VAMP4(PAS_FragB_0011, 333bp);

[0164] SEC4(PAS_chr3_0143, 615bp);

[0165] EXO84P(PAS_chr4_0078, 2181bp);

[0166] EXO70P (PAS_chr4_0695, 1866bp);

[0167] STX1-4(PAS_chr1-4_0294, 861bp);

[0168] YPT32 (PAS_chr1-4_0528, 663bp).

[0169] Using G / GS115 genomic DNA as a template, six target genes were amplified. The PCR amplification primers for each gene are shown in Table 2.

[0170] Table 2 Primers

[0171]

[0172]

[0173] Since Not I and Xba I restriction sites were introduced upstream and downstream of SEC4, EXO84P, EXO70P, STX1-4 and YPT32 genes, the amplified target gene fragments were purified by double digestion with Not I and Xba I, and then ligated with the linearized vector pAOX-UH that was also purified by double digestion with Not I / Xba I (see Figure 1 , where "insert fragment" represents five different genes, SEC4, EXO84P, EXO70P, STX1-4, and YPT32. The constructed recombinant plasmid was heat-shock transformed into Escherichia coli DH5α. Single colonies were picked on LB plates, and positive transformants were verified by colony PCR using primers AOX-F / AOXTT-R2. The verified strain was sent for sequencing.

[0174] Because the VAMP4 gene fragment contains a Not I restriction site, it is not possible to construct a gene co-expression vector by introducing a Not I / XbaI restriction site into the gene fragment and connecting it to a linearized vector. Therefore, the ClonExpress II One Step Cloning Kit method can be used to connect VAMP4 with the plasmid pAOX-UH linearized with Sal I to construct a recombinant plasmid. The construction method is as follows: Figure 2 The constructed recombinant plasmid was heat-shock transformed into Escherichia coli DH5α, and single colonies were picked on LB plates. Positive transformants were verified by colony PCR using primers AOX-F / AOXTT-R2. The correct strain was then sent for sequencing.

[0175] 1.2.1.2 Construction of 6-gene co-expression strain

[0176] The co-expression vector pAOX-UH-VAMP4 / SEC4 / EXO84P / EXO70P / STX1-4 / YPT32 was linearized by double enzyme digestion with BlnI / XhoI, and then transformed into competent cells of the recombinant strain E5 by electroporation. The cells were plated on YPD plates containing hygromycin (final concentration of 100 μg / mL) and cultured for 48 hours. Positive transformants were screened and named E5-VAMP4, E5-SEC4, E5-EXO84P, E5-EXO70P, E5-STX1-4, and E5-YPT32, respectively. The linearized fragment can be integrated into the genome of the recombinant strain E5 by homologous recombination ( Figure 3 ).

[0177] 1.2.2 Inducible expression and related analysis of six secretion-promoting recombinant bacteria

[0178] 1.2.2.1 Shake flask fermentation of six secretion-promoting recombinant bacteria

[0179] The six recombinant bacteria were inoculated into YPD medium respectively. After culturing for 20 h, a small amount of bacterial solution was transferred to BMGY medium and cultured for about 18 h until the OD 600 =4-6, collect the cells by centrifugation, and resuspend them in BMMY medium until OD 600 =1.2 for induction culture, and 1 mL of sample was taken every 24 h. 1% methanol was added at the same time, and the dry weight of the bacteria and the intracellular and extracellular enzyme production levels of the recombinant bacteria were measured, with E5 as the control.

[0180] 1.2.2.2 Determination of dry cell weight (DCW)

[0181] Take the fermentation liquid, dilute it to a certain multiple, and measure the OD of the bacteria 600 , according to OD 600Relationship with dry weight: DCW (g / L) = 0.24 × OD 600 +1.23(R 2 =0.994), and calculate DCW.

[0182] 1.2.2.3 Determination of intracellular and extracellular enzyme production of recombinant bacteria

[0183] Fermentation broth treatment: 1 mL of fresh fermentation broth removed from the shake flask was centrifuged at 12,000 rpm for 3 minutes. The supernatant was transferred to a 1.5 mL EP tube for determination of extracellular enzyme production (A2). 500 μL of fresh fermentation broth removed from the shake flask was washed with Breaking Buffer, resuspended, and centrifuged at 12,000 rpm for 5 minutes. The supernatant was discarded. An additional 500 μL of Breaking Buffer was added to resuspend the cells, followed by an equal volume (500 μL) of 0.5 mm acid-washed glass beads. The cells were disrupted using a cryo-grinder and centrifuged at 12,000 rpm for 10 minutes. The supernatant was transferred to a new 1.5 mL centrifuge tube for determination of intracellular enzyme production (A1).

[0184] The volumetric enzyme activity of GOD was determined by the endpoint method: 2.5 mL of o-dianisidine, 0.3 mL of 18% glucose, and 0.1 mL of 90 U / mL horseradish peroxide were added to a 10 mL centrifuge tube in sequence. After incubation at 37°C for 5 minutes, the supernatant enzyme solution after centrifugation was added to 5 centrifuge tubes respectively. After reacting for 3 minutes, 2 mL of sulfuric acid was added to terminate the reaction. The reaction without enzyme solution was used as a control to measure OD. 530 The absorbance value.

[0185] Enzyme yield by volume and OD 530 The volumetric enzyme activity was calculated by the relationship: GOD volumetric enzyme yield (U / mL) = (0.1578 × OD 530 —0.0033)×V / V0, where V is the total reaction volume and V0 is the volume of the added enzyme solution.

[0186] The unit bacterial enzyme yield of GOD (U / g.DCW) = volume enzyme yield / DCW×1000, where DCW refers to the dry weight of the bacteria.

[0187] (GOD enzyme activity definition: The amount of enzyme that catalyzes 1 μmol of β-D-glucose to produce gluconic acid per minute at 37°C is one enzyme activity unit (U).

[0188] The total intracellular and extracellular enzyme production A0 per unit cell is the sum of the intracellular enzyme production A1 and the extracellular enzyme production A2.

[0189] Example 1 Construction of recombinant plasmids and corresponding recombinant bacteria

[0190] Using G / GS115 genomic DNA as a template, PCR amplification obtained six target genes, VAMP4 (333 bp), SEC4 (615 bp), EXO84P (2181 bp), EXO70P (1866 bp); STX1-4 (861 bp), YPT32 (663 bp). The amplification results are as follows: Figure 4 The fragment lengths were as expected. The six target genes were ligated into the linearized vector pAOX-UH to generate six secretion-promoting recombinant plasmids. Sequencing results confirmed that all six recombinant plasmids were successfully constructed. Each recombinant plasmid was then electroporated into E5 cells, and positive transformants were screened.

[0191] Example 2 Induced expression and related analysis of six secretion-promoting recombinant bacteria

[0192] 2.1 Growth curves and enzyme production curves of six secretion-promoting recombinant bacteria

[0193] Depend on Figure 5 As shown in Figure 3, the growth trend of the secretion-promoting recombinant bacteria E5-VAMP4 / SEC4 / EXO84P / EXO70P / STX1-4 / YPT32 was basically consistent with that of the control bacteria E5, indicating that overexpression of the secretion-promoting genes VAMP4, SEC4, EXO84P, EXO70P, STX1-4 and YPT32 had almost no obvious effect on bacterial growth.

[0194] Determine the extracellular enzyme production A2 of different recombinant bacteria, such as Figure 5 As shown in Table B, except for the three secretion-promoting recombinant strains E5-VAMP4 / SEC4 / EX084P, which had higher extracellular enzyme yields per unit of cell than the control strain E5, the enzyme yields of the remaining recombinant strains failed to reach the level of extracellular enzyme yield of the control strain E5. As shown in Table 3, after 144 hours of methanol induction, the extracellular enzyme yield per unit of cell of E5-VAMP4 reached a maximum of 28053.3 U / g.DCW, which is 1.24 times the extracellular enzyme yield per unit of cell of the starting strain E5 and a 24.1% increase over the starting strain E5. Furthermore, the extracellular enzyme yields per unit of cell of the recombinant strains E5-SEC4 and E5-EX084P also increased, reaching 23705.4 and 23200.8 U / g.DCW, respectively, representing increases of 4.9% and 2.6% over the starting strain E5.

[0195] 2.2 Comparison of total intracellular and extracellular enzyme production and secretion rates of six secretion-promoting recombinant bacteria

[0196] The total extracellular and extracellular enzyme production per unit cell A0, the intracellular enzyme production per unit cell A1 and the secretion rate (=extracellular enzyme production A2 / total extracellular and extracellular enzyme production A0×100%) of each recombinant bacterium after 144 h of induction were calculated.

[0197] Depend on Figure 6 A. Figure 6 As shown in Figure 2 and Table 3, at 144 hours of induction, the total intracellular and extracellular enzyme yield (A0) of E5-VAMP4 was 36,222.5 U / g.DCW, 1.11 times that of the control strain E5, representing an 11.3% increase in A0 relative to the control strain E5. The intracellular enzyme yield of E5-VAMP4 was 0.82 times that of the control strain E5, a 17.8% decrease in A1 relative to the control strain E5. Furthermore, the secretion rate of E5-VAMP4 was 77.4%, an improvement of approximately 1.11 times the secretion rate of the control strain E5 (69.50%).

[0198] These results suggest that co-expression of the VAMP4 gene not only increases total enzyme production within and outside the cells, but also enhances the secretion rate of the recombinant bacteria, effectively secreting the GOD enzyme produced intracellularly. Therefore, the experimental results demonstrate that overexpression of the VAMP4 gene, which is involved in the transport pathway from the Golgi apparatus to the plasma membrane vesicles, significantly promotes the increase in GOD enzyme production in Pichia pastoris.

[0199] After 144 hours of induction, the total intracellular and extracellular enzyme production of E5-EX084P and E5-SEC4 were 33073.6 and 34218.8 U / g.DCW, respectively, which were 1.6% and 5.1% higher than those of the control bacteria E5; their secretion rates were basically the same as those of the control bacteria E5, so the extracellular enzyme production levels of these two recombinant bacteria were not significantly improved.

[0200] The other recombinant strains E5-EXO70P / STX1-4 / YPT32 did not show an increase in total intracellular and extracellular enzyme production compared to the control strain E5. Figure 5 As shown in B, its secretion rate is also slightly lower than that of the control strain E5, indicating that the obstacle of the secretion pathway is still one of the bottlenecks limiting the enzyme production level of these recombinant strains.

[0201] Table 3. Unit enzyme production of recombinant bacteria (methanol induction for 144 h)

[0202]

[0203]

[0204] in conclusion

[0205] The present invention overexpresses VAMP4, SEC4, EXO84P, EXO70P, STX1-4 and YPT32 genes on the basis of an 8-copy recombinant bacterium E5 that secretes and expresses GOD. Among them, the extracellular GOD enzyme yield of the fermentation supernatant of E5-VAMP4 / SEC4 / EXO84P is increased at the shake flask fermentation level. The recombinant bacterium integrated with the VAMP4 gene has the most obvious increase, reaching 24.1%. Compared with the control bacterium E5, the remaining E5-EXO70P / STX1-4 / YPT32 gene co-expressing bacteria have no increase.

[0206] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto. Sequence Listing <110> East China University of Science and Technology <120> Enhancement of extracellular protein transport from the Golgi apparatus to the extracellular space to increase the production of extracellular glucose oxidase in Pichia pastoris <130> P2021-0155 <160> twenty two <170> SIPOSequenceListing 1.0 <210> 1 <211> 110 <212> PRT <213> Artificial Sequence <400> 1 Met Ser Ser Ser Val Pro Tyr Asp Pro Tyr Ile Pro Ala Gln Gly Ser 1 5 10 15 Glu Ala Ala Ala Pro Lys Thr Gln Asp Ile Gln Asn Gln Ile Asp Ala 20 25 30 Thr Val Gly Ile Met Lys Asp Asn Ile Asn Lys Val Ala Gln Arg Gly 35 40 45 Glu Arg Leu Glu Ser Ile Gln Asp Lys Ala Asp Ser Leu Ala Val Asn 50 55 60 Ala Gln Gly Phe Arg Arg Gly Ala Asn Arg Val Arg Lys Gln Met Trp 65 70 75 80 Trp Lys Asp Met Lys Met Arg Met Cys Ile Ile Leu Gly Ile Val Ile 85 90 95 Leu Leu Ile Val Ile Ile Val Pro Ile Val Val His Phe Thr 100 105 110 <210> 2 <211> 726 <212> PRT <213> Artificial Sequence <400> 2 Met Gly Gly Asp Tyr Ser Leu Arg Lys Ser Arg Ala Pro Lys Gly Asp 1 5 10 15 Trp Lys Gln Tyr Glu Pro Asp Ala Ser Leu Pro Tyr His Lys Gly Gln 20 25 30 Asp Gln Gly Ala Thr Asn Glu Leu Arg Lys Ile Ser Thr Asn Ala Ser 35 40 45 Thr Arg Val Gln Arg Arg Leu Ser Val Lys Leu Asn Ser Thr Pro Met 50 55 60 Thr Thr Phe Thr Pro His Asn Ala Pro Ser Leu Pro Gly Asn Met His 65 70 75 80 Asp Leu Trp Thr Asn Asp Val Ala Ala Val Thr Asn Asp Asn Leu Leu 85 90 95 Thr Val Pro His Thr Thr Lys Pro Arg Arg Arg Gly Phe Ser Asn Leu 100 105 110 Ser Ala Arg Ser Phe Asp Phe Asp Ala Asp Pro Glu Ala Ala Gln Thr 115 120 125 Leu Pro Asn Leu Leu Ala Gln Ser Asp Phe Asp Cys Val Glu Tyr Val 130 135 140 Arg Lys Glu Leu Ala Asn Ala Asp Ala Gln Lys Ile Asp Glu Phe Ala 145 150 155 160 Asn Asn Leu Leu His Leu Gln Lys Lys Ala Glu Ala Asp Phe Lys Ile 165 170 175 Ser Val Ala Lys Ser Glu His Glu Ile Val Gln Ile Lys Asp Asp Ile 180 185 190 Leu Glu Thr Lys His Gln Leu Lys Asp Leu Gly Ser Ser Ile Asn Glu 195 200 205 Leu Tyr Leu Ile Ser Gly Gln Leu Gln Ser Ile Ala Leu Lys Lys Leu 210 215 220 His Glu Glu Glu Ala Asn Asn Gln Gln Ser Thr Gln His Asn Thr Ser 225 230 235 240 Pro Thr Lys Asn Phe Ser Arg Thr Gly Ser Val Leu Asn Arg Lys Arg 245 250 255 Asp Arg Ser Ser Ile Leu Met Val Glu Lys Leu Trp Gln Val Gln Met 260 265 270 Asn Glu Leu Phe Lys Gln Ile Glu Gly Ile Gln Lys Phe Leu Ser Phe 275 280 285 Asn Pro Gly Arg His Ile Ile Ala Glu Ser Ser Arg Trp Phe Glu Leu 290 295 300 Asn Ser Ala Thr Met Lys Pro Leu Gln Pro Ala His Leu Phe Ile Leu 305 310 315 320 Asn Asp His Val Leu Ile Ala Thr Arg Lys Lys Leu Lys Thr Lys Ile 325 330 335 Asn Glu Thr Gly Asn Gln Val Gly Asn Lys Ser Leu Lys Gln Leu Ile 340 345 350 Ala Thr Gln Cys Trp Pro Ile Arg Asp Leu Ser Val Lys Lys Leu Glu 355 360 365 Leu Lys Lys Phe Thr Asp Ala Lys Thr Phe Thr Ile Ala Leu Glu Tyr 370 375 380 Lys Lys Met Ser Phe Ile Tyr Gln Thr Asp Arg Gln Glu Pro Leu Asp 385 390 395 400 Leu Ile Val Gly Ser Phe Arg Arg Thr Lys Asp Asp Leu Ser Asp Phe 405 410 415 Ile Glu Gln Gln Arg Gln Asn Thr Glu Ser Leu Arg Asn Ser Met Ser 420 425 430 Arg Leu Ser Ile Ser Glu Asp Ser Ile Arg Arg His Ser Ser Lys Leu 435 440 445 His Asp Leu Ser His Lys Val His Ser Arg Asn Arg Ser Met Glu His 450 455 460 Gly Ser Gln Asp Lys Ile Lys Leu Ser Ser Ser Met Gly Asn Met Gly 465 470 475 480 Gln Asp Glu Leu Asp Phe Arg Thr Glu Gly Leu Leu Pro Ser Pro Ser 485 490 495 His Ser Lys Ala Ile Ile Glu Lys Leu Thr Gly Leu Glu Asp Thr Leu 500 505 510 Asp Glu Val Asp Ile His Leu Val His Gln Gln Phe Pro Asp Ala Val 515 520 525 Asp Ser Leu Lys Gln Leu Ser Ser Gln Leu Asn Ser Ile Leu Pro Thr 530 535 540 Ile Asn Leu Asn Asp Lys Leu Ser Glu Gly Thr Val Leu Phe Asp Leu 545 550 555 560 Leu Lys Val Lys Leu Thr Met Arg Gln Glu Ser Ile Ile Lys Ser Leu 565 570 575 Asn Phe Glu Leu Asn Arg Pro Ser Ile Ser Asp Glu Lys Val Tyr Gln 580 585 590 Ile Val Gln Leu Leu Ser Ser Leu Asp Leu Glu Lys Ile Ala Arg Asp 595 600 605 Ser Leu Phe Glu Ser Lys Ala Asn Leu Ile Glu Lys Leu Asn Arg Ser 610 615 620 Val Val Phe Glu Gly Asp Ile Pro Ser Tyr Val Ser Gln Leu Thr Ile 625 630 635 640 Ile Arg Phe Gln Thr Leu Lys Ala Thr Cys Gln Leu Tyr Arg Arg Cys 645 650 655 Phe Pro Asn Lys Glu Met Asn Cys Tyr Leu Ile Glu Phe Val Thr Asn 660 665 670 Gln Ile Asn Gln His Ala Asp Ile Leu Lys Arg Gln Leu Lys Gly Val 675 680 685 Asp Glu Lys Ser Ser Ser Tyr Ile Asp Cys Leu Glu Ile Thr Lys Ser 690 695 700 Gln Ser Asn Glu Leu Lys Glu Ile Gly Val Asn Val Asp Phe Leu Met 705 710 715 720 Glu Asp Thr Tyr Ala Phe 725 <210> 3 <211> 621 <212> PRT <213> Artificial Sequence(Artificial Sequence) <400> 3 Met Gln Arg Ile Pro Ile Asp Leu Asp Glu Ala Glu Ser Thr Val Leu 1 5 10 15 Asp Asp Ser Leu Asn Lys Thr Asn Thr Ile Ser Val Ala Ile Ser Lys 20 25 30 Lys Leu Asn Asp Ile Ser Tyr Lys Ser Thr Leu Ser Ala Lys Lys Leu 35 40 45 Lys Pro Leu Ile Ser Asp Ile Asp Ala Leu Lys Ile Tyr Asn Asp Asn 50 55 60 Ile Asp Asn Met Met Leu Ile Leu Arg Asp Val Lys Asp Tyr Ala Lys 65 70 75 80 Glu Ala Ser Gln Tyr Gln Thr Thr Leu Asn Arg Ile Gly Ser Ile Asp 85 90 95 Asn Ala Asn Asp Cys Lys Lys Tyr Ile Ser Ser Ile Asp Gln Ala Arg 100 105 110 Ser Thr Leu Asn Asn Gln Asp Gln Ser Gln Glu Gly Gly Ile Phe Lys 115 120 125 Gly Val Asn Ser Ser Leu Ile Arg Ser Ile Asn Asp Ala Glu Leu His 130 135 140 Leu Ile Thr Thr Phe Arg Asn Leu Leu Ile Glu Asn Ser Lys Pro Phe 145 150 155 160 Asp Pro Gln Met Phe Met Thr Lys Arg Glu Ala Phe Pro Phe Phe Glu 165 170 175 Glu Glu Thr Val Gly Ile Leu Arg Leu Ile Phe Ala Tyr Phe Glu Arg 180 185 190 Arg Asn Gln Asp Ala Lys Leu Val Arg Val Val Val Glu Gln Arg Phe 195 200 205 Arg Leu Val Tyr Glu Ser Met Glu Arg Leu Glu Met Phe Val Lys Pro 210 215 220 Thr Leu Asn Ser Lys Thr Tyr Glu Lys Asn Ser Asn Gly Val Ser Asn 225 230 235 240 Tyr Ser Glu Ala Phe Ile Ser Phe Ile Thr Asn Glu Asn Ala Phe Tyr 245 250 255 Glu Glu Leu Phe Glu Ser Ser Arg Asn Lys Ser Gln Leu Ile Ser Asp 260 265 270 Thr Leu Val Ala Val Phe Glu Lys Leu Ile Asp Asn Phe Ile Arg Leu 275 280 285 Ile Lys Glu Leu Thr Asp Phe Ile Glu Thr His Leu Asp Thr His Gly 290 295 300 Phe Leu Ser Phe Glu Val Ile Glu Ser Cys Gln Asn Val Arg Lys Tyr 305 310 315 320 Cys His Asp Tyr Asp Leu Asp Ser Cys Ile Ser Ser Gln Ala Glu Gln 325 330 335 Met Leu Asn Leu Ile Lys Asn Gln Pro Ile Lys Val Phe Ser Asn Ile 340 345 350 Leu Arg Asp Ile Asp Asn Gly Tyr Leu His Leu Ser Ser Leu Pro Thr 355 360 365 Asp Pro Thr Thr Ile Val Arg Pro Ile Ser Glu Leu Thr Asn Lys Leu 370 375 380 Lys Arg Ile Asn Asp Asn Lys Glu Ser Cys Trp Leu Val Met Gln Asp 385 390 395 400 Ile Gly Pro Lys Asn Trp Leu Pro Leu Asn Thr Ala Asn Thr Pro Glu 405 410 415 Trp Arg Lys Asp Asn Ile Tyr Leu Lys Glu Asn Leu Glu Pro Ser Lys 420 425 430 Asp Ser Lys Leu Asn Leu Ala Lys Phe Val Cys His Cys Ile Glu Cys 435 440 445 Ala Ile Ile Asn Leu His Ile Lys Gly Lys Glu Leu Lys Tyr Asn Gly 450 455 460 Leu Gly Val Leu Val Tyr Ser Asn Phe Tyr Phe Leu Glu Glu Phe Ile 465 470 475 480 His Arg Ser Asn Ile Glu Arg Ile Leu Gly Ser Tyr Gly Glu Thr Arg 485 490 495 Leu Gln Lys Leu Glu Lys Lys Asn Ser Ile Ile Val Thr Asn Asp Trp 500 505 510 Met Thr Val Thr Gln Pro Leu Ile Asp Gln Thr Ile Ile Thr Gly Thr 515 520 525 Gln Met Gln Asp Asn Leu Ser Thr Ser Lys Gly Arg Asp Ala Ile Lys 530 535 540 Glu Arg Phe Lys Thr Phe Asn Gln Glu Phe Glu Lys Ile Val Gln Arg 545 550 555 560 Tyr Lys Asn Tyr Asn Ile Thr Asp Pro Thr Leu Lys Lys Lys Leu Leu 565 570 575 Ser Ser Ile Val Ala Met Ala Pro Leu Tyr Tyr Arg Phe Tyr Asp Lys 580 585 590 Tyr Asn Val Pro Gln Phe Leu Lys His Gly Gly Ser Lys Val Ile Lys 595 600 605 Tyr Asp Lys Ser Gly Phe Asp Arg Met Leu Asp Ser Ile 610 615 620 <210> 4 <211> 286 <212> PRT <213> Artificial Sequence <400> 4 Met Ser Asn Gln Tyr Asn Pro Tyr Glu Gln Asn Gln Ser Tyr Glu Leu 1 5 10 15 Pro Ser Tyr Lys Gly Gly Asn Asn Asp Asp Phe Val Lys Phe Met Asn 20 25 30 Glu Ile Ala Asp Ile Asn Ala Asn Leu Asp Asn Tyr Glu Glu Leu Val 35 40 45 [[ID=३३]]Lys Ile Ile Glu Gln Lys Gln Thr Gln Leu Val Asn Glu Val Asn Pro 50 55 60 Asp Gln Glu Asn Ser Leu Lys Arg Gln Leu Asp Ser Leu Ile Ser Glu 65 70 75 80 Ser Ser Ser Leu Gln Leu Ser Leu Lys Ser Lys Ile Lys Asn Ala Gln 85 90 95 Gln Leu Ala Ile Gly Asp Ser Ala Lys Val Gly Gln Ala Glu Thr Ser 100 105 110 Arg Gln Arg Phe Leu Gln Ala Ile Gln Asp Tyr Arg Ile Ile Glu Ser 115 120 125 Asn Tyr Arg Glu Gln Gln Arg Val Gln Ala Glu Arg Gln Tyr Arg Val 130 135 140 Val Lys Pro Asp Ala Ser Pro Glu Glu Val Arg Asp Ala Ile Asp Asp 145 150 155 160 Leu Gly Gly Gln Gln Val Phe Ser Thr Ala Leu Leu Asn Ala Asn Arg 165 170 175 Arg Gly Glu Ala Lys Thr Ala Leu Gln Glu Val Gln Ser Arg His Arg 180 185 190 Glu Leu Gln Arg Leu Glu Lys Thr Met Ala Glu Leu Thr Gln Leu Phe 195 200 205 His Asp Met Glu Glu Met Val Val Glu Gln Asp Gln His Val Gln Glu 210 215 220 Thr Glu Asn Leu Val Asp Thr Ala Gln Gln Asp Ile Glu Lys Ala Val 225 230 235 240 Gly His Thr Asp Lys Ala Leu Thr Ser Ala Lys Lys Ala Arg Arg Lys 245 250 255 Lys Cys Ile Cys Phe Trp Ile Cys Val Leu Ile Ile Cys Ile Leu Ala 260 265 270 Leu Ile Leu Gly Leu Gly Phe Gly Val Gly Asn Trp Gly Arg 275 280 285 <210> 5 <211> 204 <212> PRT <213> Artificial Sequence <400> 5 Met Ala Ser Arg Gly Thr Ser Arg Gln Gln Tyr Asp Leu Thr Met Lys 1 5 10 15 Leu Leu Leu Val Gly Asp Ser Gly Val Gly Lys Ser Cys Leu Leu Leu 20 25 30 Arg Phe Val Asp Asp Ser Phe Asn Pro Ser Phe Ile Thr Thr Ile Gly 35 40 45 Ile Asp Phe Lys Ile Arg Thr Val Glu Ile Asn Gly Lys Lys Val Lys 50 55 60 Leu Gln Ile Trp Asp Thr Ala Gly Gln Glu Arg Phe Arg Thr Ile Thr 65 70 75 80 Thr Ala Tyr Tyr Arg Gly Ala Met Gly Ile Ile Leu Val Tyr Asp Val 85 90 95 Thr Asp Glu Arg Ser Phe Asn Ser Val His Asn Trp Tyr Gln Thr Leu 100 105 110 Asn Gln His Ala Asn Glu Asp Ala Gln Leu Phe Leu Val Gly Asn Lys 115 120 125 Cys Asp Asp Glu Glu Ser Arg Gln Val Thr Lys Glu Gln Gly Glu Gln 130 135 140 Leu Ala Ser Glu Leu Gly Val Pro Phe Leu Glu Ala Ser Ala Lys Ser 145 150 155 160 Asn Lys Asn Val Asp Ala Ile Phe Leu Glu Leu Ala Lys Arg Phe Glu 165 170 175 Glu Lys Met Arg Asn Thr Gln Gln Gly Pro Gly Ser Ala Gly Ile Asp 180 185 190 Val Asn Ser Ser Asn Asp Thr Lys Ser Ser Cys Cys 195 200<00007M27><210> 6 <211> 220 <212> PRT <213> Artificial Sequence <400> 6 Met Ser Asn Ser Ala Glu Asp Tyr Ser Tyr Asp Tyr Glu Tyr Leu Phe 1 5 10 15 Lys Ile Val Leu Val Gly Glu Ser Ser Val Gly Lys Ser Asn Leu Leu 20 25 30 Ser Arg Phe Thr Arg Asp Glu Phe Asn Ile Glu Ser Lys Thr Thr Ile 35 40 45 Gly Val Glu Phe Ala Thr Arg Thr Ile Glu Val Asp Gly Lys Arg Ile 50 55 60 Lys Ala Gln Ile Trp Asp Thr Ala Gly Gln Glu Arg Tyr Arg Ala Val 65 70 75 80 Thr Ala Ala Tyr Tyr Arg Gly Ala Val Gly Ala Leu Leu Val Tyr Asp 85 90 95 Ile Ser Asn Ser Ser Ser Tyr Glu Gly Ala Ser Arg Trp Leu Ser Glu 100 105 110 Leu Lys Asp His Ala Asp Ala Asn Ile Val Val Glu Leu Val Gly Asn 115 120 125 Lys Ser Asp Leu Asn His Leu Arg Ala Val Pro Thr Asp Glu Ala Lys 130 135 140 Ser Phe Ala Thr Glu Lys Gly Leu Leu Phe Thr Glu Ala Ser Ala Leu 145 150 155 160 Asn Ser Glu Asn Val Glu Leu Ala Phe Gln Gln Leu Ile Lys Ala Ile 165 170 175 Tyr Asp Met Val Ser Lys His Gln Phe Asp Met Asn Asp Tyr Gly Asn 180 185 190 Asp Asn Lys Pro Ile Thr Gly Gly Gln Thr Ile Thr Leu Thr Pro Thr 195 200 205 Pro Lys Asp Ser Lys Ile Lys Lys Asp Ser Cys Cys 210 215 220 <210> 7 <211> 615 <212> PRT <213> Artificial Sequence <400> 7 Met Leu Ser Ile Leu Ser Ala Leu Thr Leu Leu Gly Leu Ser Cys Ala 1 5 10 15 Ser Asp Leu Thr Pro Pro Ile Glu Val Thr Gly Asn Lys Phe Phe Phe 20 25 30 Ser Asn Gly Ile Glu Ala Ser Leu Leu Thr Asp Pro Lys Asp Val Ser 35 40 45 Gly Arg Thr Trp Asp Tyr Ile Ile Ala Gly Gly Gly Leu Val Gly Leu 50 55 60 Thr Thr Ala Ala Arg Leu Thr Glu Asn Pro Asn Ile Ser Val Leu Val 65 70 75 80 Ile Glu Ser Gly Ser Tyr Glu Ser Asp Arg Gly Pro Ile Ile Glu Asp 85 90 95 Leu Asn Ala Tyr Gly Asp Ile Phe Gly Ser Ser Val Asp His Ala Tyr 100 105 1i0 Glu Thr Val Glu Leu Ala Thr Asn Asn Gln Thr Ala Leu Ile Arg Ser 115 120 125 Gly Asn Gly Leu Gly Gly Ser Thr Leu Val Asn Gly Gly Thr Trp Thr 130 135 140 Arg Pro His Lys Ala Gln Val Asp Ser Trp Glu Thr Val Phe Gly Asn 145 150 155 160 Glu Gly Trp Asn Trp Asp Asn Val Ala Ala Tyr Ser Leu Gln Ala Glu 165 170 175 Arg Ala Arg Ala Pro Asn Ala Lys Gln Ile Ala Ala Gly His Tyr Phe 180 185 190 Asn Ala Ser Cys His Gly Val Asn Gly Thr Val His Ala Gly Pro Arg 195 200 205 Asp Thr Gly Asp Asp Tyr Ser Pro Ile Val Lys Ala Leu Met Ser Ala 210 215 220 Val Glu Asp Arg Gly Val Pro Thr Lys Lys Asp Phe Gly Cys Gly Asp 225 230 235 240 Pro His Gly Val Ser Met Phe Pro Asn Thr Leu His Glu Asp Gln Val 245 250 255 Arg Ser Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn Tyr Gln Arg Pro 260 265 270 Asn Leu Gln Val Leu Thr Gly Gln Tyr Val Gly Lys Val Leu Leu Ser 275 280 285 Gln Asn Gly Thr Thr Pro Arg Ala Val Gly Val Glu Phe Gly Thr His 290 295 300 Lys Gly Asn Thr His Asn Val Tyr Ala Lys His Glu Val Leu Leu Ala 305 310 315 320 Ala Gly Ser Ala Val Ser Pro Thr Ile Leu Glu Tyr Ser Gly Ile Gly 325 330 335 Met Lys Ser Ile Leu Glu Pro Leu Gly Ile Asp Thr Val Val Asp Leu 340 345 350 Pro Val Gly Leu Asn Leu Gln Asp Gln Thr Thr Ala Thr Val Arg Ser 355 360 365 Arg Ile Thr Ser Ala Gly Ala Gly Gln Gly Gln Ala Ala Trp Phe Ala 370 375 380 Thr Phe Asn Glu Thr Phe Gly Asp Tyr Ser Glu Lys Ala His Glu Leu 385 390 395 400 Leu Asn Thr Lys Leu Glu Gln Trp Ala Glu Glu Ala Val Ala Arg Gly 405 410 415 Gly Phe His Asn Thr Thr Ala Leu Leu Ile Gln Tyr Glu Asn Tyr Arg 420 425 430 Asp Trp Ile Val Asn His Asn Val Ala Tyr Ser Glu Leu Phe Leu Asp 435 440 445 Thr Ala Gly Val Ala Ser Phe Asp Val Trp Asp Leu Leu Pro Phe Thr 450 455 460 Arg Gly Tyr Val His Ile Leu Asp Lys Asp Pro Tyr Leu His His Phe 465 470 475 480 Ala Tyr Asp Pro Gln Tyr Phe Leu Asn Glu Leu Asp Leu Leu Gly Gln 485 490 495 Ala Ala Ala Thr Gln Leu Ala Arg Asn Ile Ser Asn Ser Gly Ala Met 500 505 510 Gln Thr Tyr Phe Ala Gly Glu Thr Ile Pro Gly Asp Asn Leu Ala Tyr 515 520 525 Asp Ala Asp Leu Ser Ala Trp Thr Glu Tyr Ile Pro Tyr His Phe Arg 530 535 540 Pro Asn Tyr His Gly Val Gly Thr Cys Ser Met Met Pro Lys Glu Met 545 550 555 560 Gly Gly Val Val Asp Asn Ala Ala Arg Val Tyr Gly Val Gln Gly Leu 565 570 575 Arg Val Ile Asp Gly Ser Ile Pro Pro Thr Gln Met Ser Ser His Val 580 585 590 Met Thr Val Phe Tyr Ala Met Ala Leu Lys Ile Ser Asp Ala Ile Leu 595 600 605 Glu Asp Tyr Ala Ser Met Gln<​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​<213> Artificial Sequence <400> 12 ttgcggccgc aaatgggagg ggattactct ttacgaaag 39 <210> 13 <211> 43 <212> DNA <213> Artificial Sequence <400> 13 gctctagagc ttagaaagcg tatgtatcttccattaaaaa gtc 43 <210> 14 <211> 37 <212> DNA <213> Artificial Sequence <400> 14 ttgcggccgc aaatgcaacg aatcccaatt gatttgg 37 <210> 15 <211> 42 <212> DNA <213> Artificial Sequence <400> 15 gctctagagc ttaaatggaa tctagcattc tatcaaaacc gc 42 <210> 16 <211> 42 <212> DNA <213> Artificial Sequence <400> 16 ttgcggccgc aaatgagtaa ccagtataat ccgtatgagc ag 42 <210> 17 <211> 34 <212> DNA <213> Artificial Sequence <400> 17 gctctagagc ctatcttccc cagtttccga cacc 34 <210> 18 <211> 42 <212> DNA <213> Artificial Sequence <400> 18 ttgcggccgc aaatgtcaaa cagtgctgaa gattactctt ac 42 <210> 19 <211> 43 <212> DNA <213> Artificial Sequence <400> 19 gctctagagc ctaacaacat gaatccttct tgattttatact atc 43 <210> 20 <211> twenty four <212> DNA <213> Artificial Sequence <400> 20 ggaagctgcc ctgtcttaaa cctt 24 <210> twenty one <211> twenty three <212> DNA <213> Artificial Sequence <400> twenty one aatgaagcct gcatctctca ggc 23 <210> twenty two <211> 583 <212> PRT <213> Artificial Sequence <400> twenty two Ser Asn Gly Ile Glu Ala Ser Leu Leu Thr Asp Pro Lys Asp Val Ser 1 5 10 15 Gly Arg Thr Val Asp Tyr Ile Ile Ala Gly Gly Gly Leu Thr Gly Leu 20 25 30 Thr Thr Ala Ala Arg Leu Thr Glu Asn Pro Asn Ile Ser Val Leu Val 35 40 45 Ile Glu Ser Gly Ser Tyr Glu Ser Asp Arg Gly Pro Ile Ile Glu Asp 50 55 60 Leu Asn Ala Tyr Gly Asp Ile Phe Gly Ser Ser Val Asp His Ala Tyr 65 70 75 80 Glu Thr Val Glu Leu Ala Thr Asn Asn Gln Thr Ala Leu Ile Arg Ser 85 90 95 Gly Asn Gly Leu Gly Gly Ser Thr Leu Val Asn Gly Gly Thr Trp Thr 100 105 110 Arg Pro His Lys Ala Gln Val Asp Ser Trp Glu Thr Val Phe Gly Asn 115 120 125 Glu Gly Trp Asn Trp Asp Asn Val Ala Ala Tyr Ser Leu Gln Ala Glu 130 135 140 Arg Ala Arg Ala Pro Asn Ala Lys Gln Ile Ala Ala Gly His Tyr Phe 145 150 155 160 Asn Ala Ser Cys His Gly Val Asn Gly Thr Val His Ala Gly Pro Arg 165 170 175 Asp Thr Gly Asp Asp Tyr Ser Pro Ile Val Lys Ala Leu Met Ser Ala 180 185 190 Val Glu Asp Arg Gly Val Pro Thr Lys Lys Asp Phe Gly Cys Gly Asp 195 200 205 Pro His Gly Val Ser Met Phe Pro Asn Thr Leu His Glu Asp Gln Val 210 215 220 Arg Ser Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn Tyr Gln Arg Pro 225 230 235 240 Asn Leu Gln Val Leu Thr Gly Gln Tyr Val Gly Lys Val Leu Leu Ser 245 250 255 Gln Asn Gly Thr Thr Pro Arg Ala Val Gly Val Glu Phe Gly Thr His 260 265 270 Lys Gly Asn Thr His Asn Val Tyr Ala Lys His Glu Val Leu Leu Ala 275 280 285 Ala Gly Ser Ala Val Ser Pro Thr Ile Leu Glu Tyr Ser Gly Ile Gly 290 295 300 Met Lys Ser Ile Leu Glu Pro Leu Gly Ile Asp Thr Val Val Asp Leu 305 310 315 320 Pro Val Gly Leu Asn Leu Gln Asp Gln Thr Thr Ala Thr Val Arg Ser 325 330 335 Arg Ile Thr Ser Ala Gly Ala Gly Gln Gly Gln Ala Ala Trp Phe Ala 340 345 350 Thr Phe Asn Glu Thr Phe Gly Asp Tyr Ser Glu Lys Ala His Glu Leu 355 360 365 Leu Asn Thr Lys Leu Glu Gln Trp Ala Glu Glu Ala Val Ala Arg Gly 370 375 380 Gly Phe His Asn Thr Thr Ala Leu Leu Ile Gln Tyr Glu Asn Tyr Arg 385 390 395 400 Asp Trp Ile Val Asn His Asn Val Ala Tyr Ser Glu Leu Phe Leu Asp 405 410 415 Thr Ala Gly Val Ala Ser Phe Asp Val Trp Asp Leu Leu Pro Phe Thr 420 425 430 Arg Gly Tyr Val His Ile Leu Asp Lys Asp Pro Tyr Leu His His Phe 435 440 445 Ala Tyr Asp Pro Gln Tyr Phe Leu Asn Glu Leu Asp Leu Leu Gly Gln 450 455 460 Ala Ala Ala Thr Gln Leu Ala Arg Asn Ile Ser Asn Ser Gly Ala Met 465 470 475 480 Gln Thr Tyr Phe Ala Gly Glu Thr Ile Pro Gly Asp Asn Leu Ala Tyr 485 490 495 Asp Ala Asp Leu Ser Ala Trp Thr Glu Tyr Ile Pro Tyr His Phe Arg 500 505 510 Pro Asn Tyr His Gly Val Gly Thr Cys Ser Met Met Pro Lys Glu Met 515 520 525 Gly Gly Val Val Asp Asn Ala Ala Arg Val Tyr Gly Val Gln Gly Leu 530 535 540 Arg Val Ile Asp Gly Ser Ile Pro Pro Thr Gln Met Ser Ser His Val 545 550 555 560 Met Thr Val Phe Tyr Ala Met Ala Leu Lys Ile Ser Asp Ala Ile Leu 565 570 575 Glu Asp Tyr Ala Ser Met Gln 580

Claims

1. A method for increasing the expression of glucose oxidase (GOD) in Pichia pastoris cells, characterized in that: The following steps are involved: In the starting strain, the expression of a vesicle secretion-promoting factor of Pichia pastoris cells is enhanced, thereby obtaining a Pichia pastoris GOD-producing strain with increased expression of GOD, wherein the vesicle secretion-promoting factor is selected from one or more proteins with amino acid sequences shown in SEQ ID NOs.: 1, 2 and / or 5.

2. The method according to claim 1, wherein The vesicle secretory promoting factor is selected from one of the proteins with amino acid sequences shown in SEQ ID NO.: 1, 2 and / or 5.

3. The method according to claim 1, wherein The vesicle secretory promoting factor is VAMP4 as shown in SEQ ID NO.:

1.

4. The method according to claim 1, wherein The vesicle secretory promoting factor is EXO84P as shown in SEQ ID NO.:

2.

5. The method according to claim 1, wherein The vesicle secretion promoting factor is SEC4 as shown in SEQ ID NO.:

5.

6. A glucose oxidase (GOD) producing strain, characterized in that: The expression of the vesicle secretion-promoting factor in the strain is enhanced, wherein the vesicle secretion-promoting factor is selected from one or more proteins with amino acid sequences shown in SEQ ID NO.: 1, 2 and / or 5; and the strain is Pichia pastoris.

7. The strain according to claim 6, characterized in that The GOD expression cassette is integrated downstream of the AOX promoter in the genome of the GOD-producing strain.

8. The strain according to claim 6, characterized in that The GOD-producing strain expresses wild-type GOD or GOD mutants.

9. The strain according to claim 8, characterized in that The gene sequence of the GOD mutant is shown in positions 33-615 in SEQ ID NO.:

7.

10. A method for preparing glucose oxidase (GOD) protein, characterized in that: Including steps: 1) fermenting and culturing the strain according to claim 6 to obtain GOD protein; and 2) Obtaining GOD protein from the fermentation culture system of 1).

11. A method for enhancing the glucose oxidase (GOD) protein production capacity of a strain, characterized in that: Including steps: In the starting strain, the expression of a vesicle secretion-promoting factor is enhanced, wherein the vesicle secretion-promoting factor is selected from one or more proteins with amino acid sequences as shown in SEQ ID NO.: 1, 2 and / or 5; and the starting strain is Pichia pastoris; wherein the production capacity refers to the extracellular yield and / or secretion amount.

12. A use of a vesicle secretion promoting factor, characterized in that: Used to enhance the extracellular production and / or secretion of glucose oxidase (GOD) protein of a strain, the vesicle secretion-promoting factor is selected from one or more proteins with amino acid sequences as shown in SEQ ID NO.: 1, 2 and / or 5; and the strain is Pichia pastoris.

Citation Information

Patent Citations

  • Methods to enhance glucose oxidase activity, mutants and their applications

    CN110628738B