A primer set, kit, method and application for detecting infectious spleen and kidney necrosis virus

Abstract

The application discloses a primer group, a kit, a method and application thereof for detecting infectious spleen and kidney necrosis virus. The primer group for detecting the infectious spleen and kidney necrosis virus comprises an upstream primer F1 and a downstream primer R, wherein the nucleotide sequence of the upstream primer F1 is shown as SEQ ID NO. 2, and the downstream primer R is selected from any one of R1, R2 and R3, and the primer group can specifically recognize the ORF70L gene sequence of the infectious spleen and kidney necrosis virus. In addition, the method for detecting the infectious spleen and kidney necrosis virus has the advantages of fast speed, strong specificity, on-site detection, no need of large equipment and low detection cost, can realize rapid detection on site, and can generate a detection result on a mobile phone after an imaging result is transmitted to a cloud for processing.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to a primer set for detecting an infection spleen and kidney necrosis virus, a kit, a method and application thereof. BACKGROUND

[0002] The infection spleen and kidney necrosis virus (ISKNV) belongs to the iridovirus family and the megalocytivirus genus, is an important pathogen causing the outbreak of death of aquatic animals, and causes serious economic losses to the aquatic animal breeding industry. Therefore, an efficient and accurate detection method is an important means for preventing the infection of the infection spleen and kidney necrosis virus in advance.

[0003] In the related art, there are three types of detection methods for different biomolecules of viruses. The first type is a virus itself detection, i.e., a virus isolation and extraction method. By obtaining a sample, the virus in the sample is isolated, and the infection and infection degree are diagnosed by observing the pathogenic effect of the virus on the parasitic cell. This method not only needs to be implemented by professional personnel under strict biological safety conditions, but also takes a long time, often several days to obtain results, which is not conducive to virus screening and epidemic control. The second type is a virus protein detection. The protein coat is an important component of the virus, which wraps the genetic material (RNA or DNA) to protect it and has an important influence on entering the parasitic cell. Therefore, the detection of virus protein components in the sample also indicates the infection of the virus. In addition, after being infected by the virus, antigen-antibody reaction often occurs, and the detection of the corresponding virus antigen or antibody in the blood sample can also prove the infection of the virus. Therefore, immunological chemical detection methods, such as enzyme-linked immunosorbent assay (ELISA) and fluorescent antibody detection method, have also become one of the virus detection methods. Although such methods are currently widely used for virus detection, their sensitivity is low, and virus proteins or corresponding antigens and antibodies need to reach a certain level to be detected. In the early stage of virus infection, the content of antigens and antibodies often does not reach the detection level, so false negatives often occur, which hinders the control of the epidemic. The third type is a virus nucleic acid detection, mainly including genome sequencing and nucleic acid amplification method. Genome sequencing is the gold standard for virus type qualification. According to the homology of the genome, the virus can be classified through genetic tracing, such as the classification of SARS-CoV-2. Although it is accurate, such method takes a long time and needs expensive sequencing instruments and professional technicians to perform experimental operation and data analysis. Therefore, it cannot meet the requirements of high-throughput screening and on-site detection. Nucleic acid amplification method is the most commonly used virus detection method, mainly including polymerase chain reaction (PCR), recombinase polymerase amplification (RPA), and loop-mediated isothermal amplification (LAMP) technology. Such methods are all based on virus nucleic acid sequences to design corresponding primers to realize the amplification of virus nucleic acid under corresponding reaction conditions. Among them, PCR technology needs a PCR instrument to adjust the reaction temperature to realize amplification, while RPA and LAMP can complete nucleic acid amplification under constant temperature conditions without complex instruments and reaction conditions. However, during the nucleic acid amplification process, primer mismatch and distortion of amplification products often occur, which leads to false positives.Therefore, these methods have more limitations for high-throughput on-site detection screening of patients infected with viruses.

[0004] Overall, these methods are lacking in accuracy, timeliness and sensitivity, and require expensive detection instruments, professional technicians and a large number of samples, or have problems such as long detection time, slow detection speed, relatively harsh reaction conditions, low sensitivity and poor anti-interference. Therefore, the detection methods currently used still need to be improved in terms of detection accuracy and detection efficiency. SUMMARY

[0005] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application provides a primer set for detecting infectious spleen and kidney necrosis virus, which can efficiently and accurately detect infectious spleen and kidney necrosis virus.

[0006] The present application also provides a kit comprising the primer set.

[0007] The present application also provides a method for detecting infectious spleen and kidney necrosis virus for non-diagnostic purposes.

[0008] The present application also provides a detection system comprising the kit.

[0009] The present application also provides a use of the primer set or the kit in the preparation of a detection reagent for infectious spleen and kidney necrosis virus.

[0010] In a first aspect of the present application, a primer set for detecting infectious spleen and kidney necrosis virus is provided, comprising: an upstream primer F1 and a downstream primer R;

[0011] The nucleotide sequence of the upstream primer F1 is shown in SEQ ID NO. 2;

[0012] The downstream primer R is selected from any one of R1, R2 and R3;

[0013] The nucleotide sequence of R1 is shown in SEQ ID NO. 5, the nucleotide sequence of R2 is shown in SEQ ID NO. 6, and the nucleotide sequence of R3 is shown in SEQ ID NO. 7.

[0014] In the embodiments of the present application, at least the following beneficial effects are achieved: the primer set of the present application is used to detect infectious spleen and kidney necrosis virus, has high detection rate and good specificity, can effectively improve the accuracy of detection of infectious spleen and kidney necrosis virus (ISKNV), and can effectively avoid detection of some unclassified viruses.

[0015] According to some embodiments of the present application, a primer set for detecting infectious spleen and kidney necrosis virus is provided, comprising: an upstream primer F1 and a downstream primer R1;

[0016] The nucleotide sequence of the upstream primer F1 is shown as SEQ ID NO. 2.

[0017] The nucleotide sequence of the downstream primer R1 is shown as SEQ ID NO. 5.

[0018] According to some embodiments of the present application, a primer set for detecting infectious spleen and kidney necrosis virus is provided, comprising: an upstream primer F1 and a downstream primer R2;

[0019] The nucleotide sequence of the upstream primer F1 is shown as SEQ ID NO. 2.

[0020] The nucleotide sequence of the downstream primer R2 is shown as SEQ ID NO. 6.

[0021] According to some embodiments of the present application, the sequence amplified by the upstream primer F1 and the downstream primer R2 is the ORF70L gene sequence, and the specific nucleotide sequence is as follows:

[0022] ATGGCATGCACCGCGCTCTTGCAGTGCCACCTCGTTCGGCGCCACAAAGTACAGCATCTTATCCTCAAGGTCAAAGCGATACACGGCCAATGTTTGTTCGCATCTAATAAGGATGTCACGGCTGTGCTCAAAGATGACGGCACACAGAGGATTCATTGTCACCCGCTGCGGCAGGAAGCACGTGTTCCATTTATCCTGCCACTCGGCACATATGGACATCTCTTCAGATGA (SEQ ID NO. 1).

[0023] The gene sequence is highly conserved in infectious spleen and kidney necrosis virus (ISKNV) and can be used to effectively distinguish infectious spleen and kidney necrosis virus (ISKNV) from other viruses.

[0024] In a second aspect of the present application, a kit for detecting infectious spleen and kidney necrosis virus is provided, comprising the primer set and crRNA described above.

[0025] The crRNA comprises an anchor sequence and a guide sequence, wherein the anchor sequence is specifically recognized by a Cas protein, and the guide sequence is specifically recognized by a target sequence of the infectious spleen and kidney necrosis virus;

[0026] The anchor sequence of the crRNA is shown as SEQ ID NO. 10.

[0027] The guide sequence of the crRNA is shown as SEQ ID NO. 11.

[0028] According to some embodiments of the present application, the sequence of the crRNA is shown as SEQ ID NO. 9.

[0029] According to some embodiments of the present application, the kit further comprises a cas protein and a signal reporter probe.

[0030] According to some embodiments of the present application, the cas protein is Cas12a.

[0031] According to some embodiments of the present application, the signal reporter probe comprises a nucleic acid sequence, the nucleic acid sequence is shown as SEQ ID NO. 8.

[0032] One end of the nucleic acid sequence is labeled with a fluorescent reporter group, and the other end is labeled with a quenched reporter group.

[0033] According to some embodiments of the present application, the fluorescent reporter group is selected from any one of FAM, HEX, TET, TAMRA; and the quenched reporter group is selected from any one of BHQ1, BHQ2, BHQ3.

[0034] Preferably, the fluorescent reporter group is TAMRA; and the quenched reporter group is BHQ2.

[0035] After adding the fluorescein-labeled probe in the reaction system, due to the short sequence of the probe, one end of which is connected with a fluorescent group and the other end is connected with a quenched group. Before being cut by cas12a enzyme, the fluorescent group and the quenched group are close to each other and cannot emit fluorescence. When being cut by cas12a enzyme, the distance between them is increased, so that the fluorescence signal can be detected.

[0036] According to some embodiments of the present application, the kit further comprises E-Mix Reaction Buffer, RPA buffer, MgCl2, Cas protein solution buffer and infectious spleen and kidney necrosis virus standard.

[0037] Preferably, the E-Mix Reaction Buffer comprises UvsX enzyme, UvsY enzyme, Gp32 enzyme and Bsu enzyme.

[0038] Preferably, the weight ratio of the UvsX enzyme:UvsY enzyme:Gp32 enzyme:Bsu enzyme is 13:4.4:12.7:4.5.

[0039] In the embodiment of the present application, at least the following beneficial effects are achieved: the present application optimizes the proportion of enzymes in the E-Mix Reaction Buffer, which can effectively improve the amplification efficiency; in addition, the present application combines the recombinase polymerase amplification reaction with the CRISPR / Cas12a protease detection reaction, which is conducive to further improving the detection efficiency and increasing the visualization of the reaction results.

[0040] In a third aspect of the present application, a method for detecting infectious spleen and kidney necrosis virus for non-diagnostic purposes is provided, comprising the following steps:

[0041] Step S1: extracting DNA of the sample to be detected;

[0042] Step S2: sequentially performing RPA amplification reaction and Cas protease detection reaction on the DNA of the sample to be detected extracted in step S1 using the kit, and reading the detection signal.

[0043] In the embodiment of the present application, at least the following beneficial effects are achieved: in the present application, the recombinase polymerase amplification reaction and the CRISPR-Cas12a protease detection reaction are combined to detect the infectious spleen and kidney necrosis virus, which does not require the use of large equipment and can realize on-site rapid detection, and has the advantages of fast detection efficiency, good specificity, high accuracy, etc.

[0044] According to some embodiments of the present application, the condition of the RPA amplification reaction is 36-38℃ for 25-30min.

[0045] Preferably, the condition of the RPA amplification reaction is 37℃ for 30min.

[0046] According to some embodiments of the present application, the condition of the Cas protease detection reaction is 36-38℃ for 25-30min.

[0047] Preferably, the condition of the Cas protease detection reaction is 37℃ for 30min.

[0048] According to some embodiments of the present application, the method for reading the detection signal comprises: judging the amplification result according to the fluorescence change of the amplification product, if the amplification curve appears, it is determined as positive; if there is no amplification curve, it is determined as negative.

[0049] According to some embodiments of the present application, the method for reading the detection signal further comprises: using a mobile phone to detect the product in combination with an imaging system, if fluorescence is observed by imaging, it is determined as positive; if no fluorescence is observed by imaging, it is determined as negative.

[0050] The product is detected by using a mobile phone matched with an imaging system, real-time detection can be performed on site, the process of transporting samples is saved, degradation and pollution of samples in the transportation process can be effectively avoided, and the detection efficiency is improved.

[0051] In a fourth aspect, the application provides a detection system comprising the kit and a detection instrument, wherein the detection instrument comprises a mobile phone with a shooting function.

[0052] According to some embodiments of the application, the detection system further comprises an LED light source, an aspherical lens, an achromatic lens (f=50mm), a dichroic mirror, a filter, a stage and a three-glued lens.

[0053] The detection system has at least the following beneficial effects:

[0054] The detection system can be used for real-time detection on site, the process of transporting samples is saved, degradation and pollution of samples in the transportation process can be effectively avoided, and the detection efficiency is improved.

[0055] In a fifth aspect, the application provides a use of the primer set or the kit in the preparation of an infectious spleen and kidney necrosis virus detection reagent.

[0056] According to some embodiments of the application, at least the following beneficial effects are achieved:

[0057] The detection sequence (ORF70L gene) of the application can be used for detecting infectious spleen and kidney necrosis virus, which can effectively improve the accuracy of infectious spleen and kidney necrosis virus (ISKNV) detection and avoid detecting some unclassified viruses.

[0058] In addition, the detection system has the advantages of fast speed, strong specificity, on-site detection, no need for large equipment and low detection cost, and can be used for rapid detection on site. BRIEF DESCRIPTION OF DRAWINGS

[0059] The application will be further described below in combination with the drawings and examples, wherein:

[0060] Figure 1 The application is a general flowchart.

[0061] Figure 2 The RPA amplification result diagram shown by agarose gel electrophoresis of the embodiment 2 of the application.

[0062] Figure 3 The light path design diagram of the application.

[0063] Figure 4 The imaging result diagram of the detection example of the application. DETAILED DESCRIPTION

[0064] The concept and technical effects of the application will be described below in combination with embodiments to fully understand the purpose, features and effects of the application. Obviously, the described embodiments are only a part of the embodiments of the application, but not all the embodiments. Based on the embodiments of the application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the application.

[0065] The materials, reagents and the like used in the embodiments are commercially available reagents and materials unless otherwise specified.

[0066] The general concept of the application: first, search the gene sequence of infectious spleen and kidney necrosis virus (ISKNV) in the Genebank database (website: https: / / www.ncbi.nlm.nih.gov / nuccore / ), find the conserved segment through sequence alignment and design reaction primers, then use recombinase polymerase amplification reaction to amplify the virus nucleic acid in vitro. The recombinase polymerase amplification reaction can exponentially amplify the extracted virus nucleic acid DNA under constant temperature conditions (37℃). After obtaining the amplified virus nucleic acid, CRISPR / Cas12a protease is used for reaction. The above reaction can be carried out on a slide. Then, a smart phone is used in combination with a self-built light path to image it. Then, the image is processed. When the concentration of the detection sample is high, the detection result can be preliminarily judged by directly observing the change of the fluorescence intensity of the picture. When the concentration of the detection sample is low, the picture gray value can be extracted through professional picture processing software, then compared with the control group and judged. The specific process of detection is as shown in Figure 1

[0067] Embodiment 1: Extraction of infectious spleen and kidney necrosis virus DNA

[0068] Take the sample to be tested (fish infected with infectious spleen and kidney necrosis virus) spleen and kidney tissue, grind to the size of soybeans, add an equal volume of PINDBK lysis buffer (pathogen inactivation extraction buffer, purchased from Shenzhen Yibaozhizhixuesheng Technology Co., Ltd.), mix well, react at 95℃ for 5 minutes to release the DNA of the sample to be tested, and take the supernatant for direct use in the subsequent detection reaction. ​

[0069] Example 2: Design and screening of recombinase polymerase amplification primers

[0070] Firstly, the gene sequence of infectious spleen and kidney necrosis virus (ISKNV) was searched in the Genebank database (website: https: / / www.ncbi.nlm.nih.gov / nuccore / ), and the multiple sequences were aligned using DNAMAN 10.0 software to find the conserved region (ORF70L gene). The nucleotide sequence information of the ORF70L gene is as follows:

[0071] ATGGCATGCACCGCGCTCTTGCAGTGCCACCTCGTTCGGCGCCACAAAGTACAGCATCTTATCCTCAAGGTCAAAGCGATACACGGCCAATGTTTGTTCGCATCTAATAAGGATGTCACGGCTGTGCTCAAAGATGACGGCACACAGAGGATTCATTGTCACCCGCTGCGGCAGGAAGCACGTGTTCCATTTATCCTGCCACTCGGCACATATGGACATCTCTTCAGATGA (SEQ ID NO. 1).

[0072] Three groups of primers were designed in the above-mentioned conserved region, and BLAST alignment was performed in the NCBI database (website: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The specific primer sequences are shown in Table 1.

[0073] Table 1: Primer sequences for recombinase polymerase amplification reaction

[0074] Primer name Sequence information (5'-3') F1 ATGGCATGCACCGCGCTCTTGCAGTGCCACCTC (SEQ ID NO. 2) F2 GCATGCACCGCGCTCTTGCAGTGCCACCTCGTTC (SEQ ID NO. 3) F3 ATGCACCGCGCTCTTGCAGTGCCACCTCGTTCGG (SEQ ID NO. 4) R1 TCATCTGAAGAGATGTCCATATGTGCCGAGTGGCA (SEQ ID NO. 5) R2 TCTGAAGAGATGTCCATATGTGCCGAGTGGCAGGA (SEQ ID NO. 6) R3 TGAAGAGATGTCCATATGTGCCGAGTGGCAGGAT (SEQ ID NO. 7)

[0075] wherein F1, F2 and F3 are upstream primers, and R1, R2 and R3 are downstream primers. The present application designs 9 pairs of primer groups, which are F1R1 primer group, F1R2 primer group, F1R3 primer group, F2R1 primer group, F2R2 primer group, F2R3 primer group, F3R1 primer group, F3R2 primer group and F3R3 primer group, respectively. The spleen and kidney necrosis virus DNA extracted in Example 1 is used as a template, and the above-mentioned primer groups are used for recombinase polymerase amplification, and the amplification efficiency is detected. The recombinase polymerase amplification reaction system is shown in Table 2.

[0076] Table 2: Recombinase polymerase amplification reaction system (total system is 43 μL)

[0077] Component Volume 5x Reaction Buffer 10.0 μL 1x E-Mix Reaction Buffer 18.4 μL Upstream primer (100 μM) 0.2 μL Downstream primer (100 μM) 0.2 μL Template (100 ng) 1.0 μL Ultra-pure water 13.2 μL

[0078] The composition of the 5× reaction buffer is shown in Table 3.

[0079] Table 3: 5× reaction buffer (total volume 1 mL)

[0080] Each component Added amount Source PEG 20000 114 mg Sigma (P8280) ATP (100 mM) 125 μL Sigma (PC2301) dNTPs (25 mM) 48 μL Sigma (PC2500) Tris-HCl (1 M) 125 μL Sigma (T1150) DTT (1 M) 125 μL Sigma (D8220) Phosphocreatine (1 M) 250 μL Sigma (C9921) Creatine kinase (10 ug / uL) 50 μL Sigma (C9470) Ultra-pure water Balance -

[0081] Table 2 shows the specific ratios of the four enzymes in the 1×E-Mix Reaction Buffer, which are shown in Table 4.

[0082] Table 4: 1×E-Mix Reaction Buffer (Store at -20℃)

[0083]

[0084]

[0085] The weight ratio of UvsX enzyme:UvsY enzyme:Gp32 enzyme:Bsu enzyme in 1×E-Mix Reaction Buffer is 13:4.4:12.7:4.5.

[0086] After mixing the above recombinase polymerase amplification reaction system, add 7 μL of MgCl2 (100 mM) to the reaction system to start the RPA amplification reaction. Incubate at 37℃ for 30 min. After the recombinase polymerase amplification reaction, the amplification products are detected by agarose gel electrophoresis. The detection results are as follows: Figure 2 As shown.

[0087] Figure 2 In the middle, 1 # For F1R1 primer set; 2 # For F1R2 primer set; 3 # For F1R3 primer set; 4 # For F2R1 primer set; 5 # For F2R2 primer set; 6 # For F2R3 primer set; 7 # For F3R1 primer set, 8 # For F3R2 primer set and 9 # For the F3R3 primer set, from Figure 2 It can be seen that primer set F1R2 at 250bp has the best amplification effect, followed by primer set F1R1 and primer set F1R3. Therefore, primer set F1R2 was selected as the primer set for the recombinase polymerase amplification reaction to detect infectious spleen and kidney necrosis virus.

[0088] Example 3: CRISPR / Cas12a protease detection reaction

[0089] 1. Principle of CRISPR-Cas12a protein cleaving substrate probe

[0090] When there is a sequence with a multi-T structure (TTTX, X can be any base) on the template DNA, the crRNA designed in the application can bind to the reverse complementary DNA strand with the multi-T structure sequence and be cleaved. The crRNA first binds to the cas12a protein, and then guides the binding of the protein to the template DNA. After cleaving the template DNA strand, it has cleavage activity to the single-stranded DNA with the multi-T structure in the system. Therefore, the application adds a fluorescein-labeled probe with a fluorescent group at one end and a quenching group at the other end. At this time, the two groups are very close and cannot emit fluorescence. After the probe is cleaved by cas12a, the distance is increased, and the fluorescent group emits fluorescence that can be detected.

[0091] The specific nucleotide sequence of the above reporter probe is 5'-TTATT-3' (SEQ ID NO. 8), the fluorescent reporter group connected to the 5' end is TAMRA, and the quenching reporter group connected to the 3' end is BHQ2. The structure of the reporter probe is 5'-TAMRA-TTATT-BHQ2-3'.

[0092] 2. crRNA

[0093] The crRNA of the application comprises two parts: an anchor sequence and a guide sequence, wherein the anchor sequence specifically binds to the Cas12a protein, and the guide sequence is complementary to the target sequence of the infectious spleen and kidney necrosis virus.

[0094] The sequence information of the crRNA in the application is shown in Table 5:

[0095] Table 5: Sequence information of crRNA

[0096]

[0097] 3. CRISPR / Cas12a reaction system

[0098] The CRISPR-Cas12a detection reaction is carried out using the above-mentioned recombinase polymerase amplification reaction product with F1R2 as the primer and the crRNA, and the reaction system is shown in Table 6.

[0099] Table 6: CRISPR / Cas12a reaction system (total system is 100 μL)

[0100]

[0101] After reacting at room temperature (37±1℃) for 30 minutes, a mobile phone is used to detect the imaging system.

[0102] 4. Imaging detection

[0103] The application is to image by using a smart phone combined with a self-built optical path, the self-built optical path design is as shown in the figure Figure 3 The light path includes an LED light source, an aspherical lens, an achromatic lens (f=50mm), a dichroic mirror, a filter, an objective lens, a displacement table and a control board. The light source in the light path is an LED laser with a wavelength of 532nm and a power of 1W. During detection, the sample to be detected is placed on the object table, the dichroic mirror is adjusted so that the collimated monochromatic light source passes through the achromatic lens to focus light on the sample to be detected at an illumination angle of 75°, the fluorescence signal in the detection system is excited, then the fluorescence signal emitted by the sample is collected through the three-cemented lens (L2, f=20mm) and an intermediate image is formed in front of the camera lens of the smart phone. Finally, the smart phone is used to detect and take pictures of the fluorescence signal image, and whether the sample to be detected is infected with infectious spleen and kidney necrosis virus is judged according to the fluorescence signal intensity on the picture.

[0104] The method can be used for real-time detection on site, and the process of transporting samples is saved, so that degradation and pollution of the sample during transportation can be effectively avoided, and the detection efficiency is improved.

[0105] In addition, the detection system of the application has the advantages of fast speed, strong specificity, on-site detection, no need for large equipment and low detection cost, and can be used for rapid detection on site. The imaging result taken by the smart phone is transmitted to the cloud for processing, and the detection result is generated on the smart phone.

[0106] Detection example

[0107] 1. Test method

[0108] The puc57 plasmid (puc57 vector purchased from Shenguo Bioengineering (Shanghai) Co., Ltd.) containing the ORF70L gene sequence was diluted to 1pM and 10aM as detection samples, the puc57 plasmid containing the ORF70L gene sequence was diluted to 1nM as a positive control, and the cloned plasmid containing the mutant ORF70L gene sequence was diluted to 1pM as a negative control. The mutant ORF70L gene nucleotide sequence information is as follows:

[0109] ATGGCATGCACCGCGCTCTTGCAGTGCCACCTCGTTCGG TCTAC CAAAGTACAGCATCTTATCCTCAAGGTCAAAGCGATACACGGCCAATGTTTGTTCGCATCTAATAAGGATGTCACGGCT CATAC CAAAGATGACGGCACACAGAGGATTCATTGTCACCCGCTGCGGCAGGAAGCACGTGTTCCATTTA CGGACCCACTCGGCACATATGGACATCTCTTCAGATGA (SEQ ID NO. 12).

[0110] Wherein the underlined base is a mutant base, the mutant ORF70L gene sequence is to prove the specificity of the crRNA.

[0111] In this detection example, primer set F1R2 is used as the recombination enzyme polymerase amplification reaction primer, and the recombination enzyme polymerase amplification reaction system is shown in Table 2, wherein the concentration of the template is added according to the concentration described above, and the recombination enzyme polymerase amplification reaction is reacted at 37°C for 30 min, and after the reaction is completed, the imaging detection is carried out according to the CRISPR / Cas12a detection reaction method of Example 3.

[0112] 2, detection results

[0113] In this detection example, the smartphone in Example 3 is combined with the self-built optical path to image, and the imaging results are shown in Figure 4 , wherein Figure 4 In the table, “Positive-Ctrl” is a positive control, and “Negative-Ctrl” is a negative control.

[0114] As can be seen from Figure 4 , when the DNA concentration of the detection sample is 1pM, the field of view is bright, and a higher positive signal can be obtained, when the DNA concentration of the detection sample is 1aM, the light signal is weak, but a weak positive signal can still be detected, and it can be seen that the detection method has high sensitivity.

[0115] Secondly, when the virus genomic DNA containing the mutant ORF70L gene sequence is used as a negative control, no positive signal is detected, which shows that by using the ORF70L gene as a detection sequence and designing specific primer sets and crRNA sequences, the accuracy of detecting infectious spleen and kidney necrosis virus (ISKNV) can be effectively improved.

[0116] In addition, the selection of this segment of virus detection sequence (ORF70L gene) based on the present application is a sequence specific to the same virus genus (ISKNV), which can be accurately detected, and the accuracy of the detection can be effectively improved.

[0117] In summary, the present application designs a system for detecting viruses by using the CRISPR / Cas12a system combined with the RPA system, and then using the self-built optical imaging system to detect viruses, and the whole system has the advantages of high specificity, low cost, simple operation, short time-consuming, and can directly report the detection results of viruses on the mobile phone.

[0118] In addition, the detection sequence (ORF70L gene) of the application can effectively improve the accuracy of detection of infectious spleen and kidney necrosis virus (ISKNV) and avoid detection of some unclassified viruses. Secondly, the screened recombinase polymerase amplification primer and crRNA sequence of the application can improve the sensitivity and specificity of detection, and have good application prospect.

[0119] The above embodiments of the application are described in detail in combination with the drawings, but the application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the application. In addition, the embodiments of the application and the features in the embodiments can be combined with each other without conflict. SEQUENCE LISTING <110> Tsinghua-Berkeley Shenzhen Institute <120> A primer set, kit for detecting infectious spleen and kidney necrosis virus, method and application thereof <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 231 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 atggcatgca ccgcgctctt gcagtgccac ctcgttcggc gccacaaagt acagcatctt 60 atcctcaagg tcaaagcgat acacggccaa tgtttgttcg catctaataa ggatgtcacg 120 gctgtgctca aagatgacgg cacacagagg attcattgtc acccgctgcg gcaggaagca 180 cgtgttccat ttatcctgcc actcggcaca tatggacatc tcttcagatg a 231 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 2 atggcatgca ccgcgctctt gcagtgccac ctc 33 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <400> 3 gcatgcaccg cgctcttgca gtgccacctc gttc 34 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <400> 4 atgcaccgcg ctcttgcagt gccacctcgt tcgg 34 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <400> 5 tcatctgaag agatgtccat atgtgccgag tggca 35 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <400> 6 tctgaagaga tgtccatatg tgccgagtgg cagga 35 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <400> 7 tgaagagatg tccatatgtg ccgagtggca ggat 34 <210> 8 <211> 5 <212> DNA <213> Artificial Sequence <400> 8 ttatt 5 <210> 9 <211> 48 <212> RNA <213> Artificial Sequence <400> 9 uaauuucuac uaaguguaga uuuugagcac agccgugaca uccuuauu 48 <210> 10 <211> 21 <212> RNA <213> Artificial Sequence <400> 10 uaauuucuac uaaguguaga u 21 <210> 11 <211> 27 <212> RNA <213> Artificial Sequence <400> 11 uuugagcaca gccgugacau ccuuauu 27 <210> 12 <211> 231 <212> DNA <213> Artificial Sequence <400> 12 atggcatgca ccgcgctctt gcagtgccac ctcgttcggt ctaccaaagt acagcatctt 60 atcctcaagg tcaaagcgat acacggccaa tgtttgttcg catctaataa ggatgtcacg 120 GCTC ATACCA AAGATGACGG CACACAGAGG ATTC ATTGTC ACCCGCTGCG GCAGGAAGCA 180 Cgtgttccatttacggacccactcggcaca tatggacatctcttcagatga 231

Claims

1. A primer set for detecting infectious spleen and kidney necrosis virus, comprising an upstream primer F1 and a downstream primer R, wherein: The nucleotide sequence of the upstream primer F1 is shown in SEQ ID NO.2; The downstream primer R is selected from any one of R1, R2, and R3; The nucleotide sequence of R1 is shown in SEQ ID NO.5, the nucleotide sequence of R2 is shown in SEQ ID NO.6, and the nucleotide sequence of R3 is shown in SEQ ID NO.

7.

2. A kit for detecting infectious spleen and kidney necrosis virus, comprising the primer set and crRNA as described in claim 1; The crRNA contains an anchor sequence and a guide sequence, wherein the anchor sequence specifically recognizes the Cas protein and the guide sequence specifically recognizes the target sequence of the infectious spleen and kidney necrosis virus. The anchoring sequence of the crRNA is shown in SEQ ID NO.10; The guide sequence of the crRNA is shown in SEQ ID NO.

11.

3. The reagent kit according to claim 2, characterized in that, The kit also contains the Cas protein and a signal reporter probe.

4. The reagent kit according to claim 3, characterized in that, The Cas protein is Cas12a; The signal reporting probe contains a nucleic acid sequence as shown in SEQ ID NO. 8; One end of the nucleic acid sequence is labeled with a fluorescent reporter group, and the other end is labeled with a quencher reporter group.

5. The reagent kit according to claim 4, characterized in that, The fluorescent reporter group is selected from any one of FAM, HEX, TET, and TAMRA; the quenching reporter group is selected from any one of BHQ1, BHQ2, and BHQ3.

6. The reagent kit according to claim 2, characterized in that, The kit also contains E-Mix Reaction Buffer, RPA buffer, MgCl2, Cas protein digestion buffer, and infectious spleen and kidney necrosis virus standards.

7. A detection system, characterized in that, The kit and testing instrument according to any one of claims 2-6, wherein the testing instrument includes a mobile phone with a camera function.

8. The use of the primer set as described in claim 1 or the kit as described in any one of claims 2-6 in the preparation of a reagent for detecting infectious spleen and kidney necrosis virus.

Images