Co-segregating gene molecular markers, detection primers and detection kits for identifying male sterility in Tagetes erecta
By developing TeGLO, a gene molecular marker for male sterile traits of marigold, the problem of difficulty in applying molecular markers in different groups in the prior art is solved, efficient screening of marigold breeding and improving breeding efficiency.
Patent Information
- Application Number
- CN202110875425.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-07-30
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2041-07-30
AI Technical Summary
The prior art is difficult to effectively apply molecular markers in different male sterile populations of marigolds, resulting in the inability to screen breeding traits early and affect breeding efficiency.
A gene molecular marker TeGLO was developed. By constructing an F2 isolated population of marigold male sterile traits, using the differences in the TeGLO gene sequence, a gene molecular marker co-isolated with the male sterile traits was designed, and corresponding detection primers and PCR detection kits were provided.
The TeGLO gene molecular marker can effectively distinguish the breeding of marigolds with a detection efficiency of 100%. It is used in male sterile F2 population and can accurately distinguish male fertile and sterile plants, shorten the breeding cycle, and save resources.
Smart Images

Figure CN115369180B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to gene molecular markers for identifying plant male sterility traits, in particular to co-segregating gene molecular markers for identifying Tagetes erecta male sterility, primers thereof and applications, belonging to the field of gene molecular markers, detection primers and applications for Tagetes erecta male sterility. Background Art
[0002] Plant male sterility generally refers to pollen grain abortion while the pistil develops normally. Male sterility traits widely exist in angiosperms, and most of the sterility traits are spontaneously mutated in the natural environment. As an effective and economical pollination system, male sterility has been widely applied in the breeding system. In some plants with particularly complex inflorescence structures, using traditional manual emasculation is time-consuming and laborious. Therefore, the emergence of male sterility traits greatly improves the breeding efficiency and saves the expenditure on manual emasculation.
[0003] Compositae plants have extremely complex capitula. The capitulum of Compositae plants is composed of dozens or even hundreds of florets. The outer part is ray florets with three whorls of floral organs (sepals, petals and pistils), and the middle part is disc florets with four complete whorls of floral organs (sepals, petals, stamens and pistils). The complex inflorescence structure of Compositae plants poses challenges to manual emasculation and greatly hinders the breeding process. The development and utilization of male sterile lines effectively solve the difficulty of breeding Compositae plants.
[0004] Tagetes erecta L. is an annual flower of Compositae, with important ornamental and economic values. As early as in the 1960s of the last century, Towner (1961) found male sterile plants mutated in the natural environment. Genetic analysis showed that the sterility trait was controlled by a single nuclear gene. The male sterile dual-purpose line of Tagetes erecta cultivated based on this material has been widely applied to the cultivation of new Tagetes erecta varieties and seed production. However, in the male sterile dual-purpose line, the fertility of plants can only be effectively distinguished and removed until flowering, which greatly occupies the breeding space and is time-consuming, laborious and costly.
[0005] Gene molecular markers are effective gene markers developed based on sequence differences of a certain gene and closely linked to a certain trait. Breeders at home and abroad have adopted marker techniques such as RAPD, AFLP, SRAP, ISSR and SSR to develop molecular markers closely linked to Tagetes erecta male sterility traits for early screening. However, these PCR-based genetic markers all rely on predetermined variations or tandem repeat sequences distributed in the genome. Therefore, these markers cannot be effectively applied in different Tagetes erecta male sterile populations. So far, no molecular markers that can be applied in different Tagetes erecta male sterile segregation populations have been developed. Summary of the Invention
[0006] One of the objectives of the present invention is to provide a gene molecular marker for identifying the male sterility trait of marigold;
[0007] Another objective of the present invention is to provide detection primers for amplifying the gene molecular marker;
[0008] A third objective of the present invention is to apply the gene molecular marker or detection primers to identify the male sterility trait of marigold.
[0009] The above objectives of the present invention are achieved through the following technical solutions:
[0010] The present invention first provides a gene molecular marker for identifying the male sterility trait of marigold, named TeGLO; the nucleotide sequence of the gene molecular marker in homozygous fertile plants of marigold is shown as SEQ ID NO.1, and the nucleotide sequence of the gene molecular marker in sterile plants of marigold is shown as SEQ ID NO.2.
[0011] There is a 1088bp insertion sequence in the gene molecular marker TeGLO provided by the present invention in the sequence of male sterile marigold. The present invention compares the gene molecular marker TeGLO of a large number of marigold varieties, and the results prove that it co-segregates with the sterile trait, indicating that the gene molecular marker TeGLO provided by the present invention can be used to identify the fertility of marigold with different genotypes.
[0012] The present invention further provides detection primers for detecting the gene molecular marker TeGLO.
[0013] As a preferred specific embodiment, the detection primers are composed of an upstream detection primer shown as SEQ ID NO.3 and a downstream detection primer shown as SEQ ID NO.4.
[0014] The above detection primers provided by the present invention can be used as a primer set for amplifying the TeGLO marker, and further used to identify the male sterility trait of marigold. Therefore, the application of the primer set in identifying the fertility of marigold belongs to the protection scope of the present invention.
[0015] The present invention further provides a PCR detection kit for identifying the fertility of marigold, including: PCR Master Mix (including Taq enzyme, dNTP, Mg 2+ ), deionized water and detection primers; wherein, the detection primers are detection primers designed with the gene TeGLO as the target; as a preferred specific embodiment, the detection primers are composed of an upstream primer shown as SEQ ID NO.3 and a downstream primer shown as SEQ ID NO.4.
[0016] The present invention further provides an application of the gene molecular marker TeGLO in the fertility identification of marigold, which includes the following steps: (1) Extract the DNA of the marigold sample to be tested; (2) Design upstream and downstream primers using the gene molecular marker TeGLO as a target for PCR amplification; (3) If the PCR product shows a single band of 349bp, or simultaneously amplifies two bands of 349bp and 1450bp, then the marigold sample is male fertile, and among them, the marigold plant that can amplify two bands is a heterozygote; if an electrophoretic band of 1450bp is amplified, then the marigold sample is male sterile.
[0017] In the nucleotide sequence of male-sterile marigold, there is an insertion sequence of 1088bp in the specific gene molecular marker TeGLO of the present invention. The DNA amplification product of male-sterile marigold shows a single band of 1450bp, and the DNA amplification product of homozygous male-fertile marigold shows a single band of 349bp; the amplification product of heterozygous male-fertile marigold DNA shows two bands of 349bp and 1450bp. Therefore, the specific gene molecular marker TeGLO provided by the present invention can also be used to detect the homozygosity of marigold materials with respect to the male-fertile genotype, and the application of the specific gene molecular marker TeGLO in identifying the genotype purity of male-fertile traits in marigold is within the protection scope of the present invention.
[0018] As a preferred specific implementation scheme of the present invention, the reaction system for the PCR amplification is as follows: PCR Master Mix 12.5 μl (including Taq enzyme, dNTP, and Mg 2+ ), 1 μl of DNA template, 1 μl of upstream primer, 1 μl of downstream primer, and 9.5 μl of deionized water.
[0019] As a preferred specific implementation scheme of the present invention, the reaction program for the PCR amplification is: 94°C for 4 min; 94°C for 30 sec, 61°C for 30 sec, 72°C for 2 min, for a total of 35 cycles; 72°C for 10 min; keep at 4°C for 10 min.
[0020] The object of the present invention is to obtain a gene molecular marker co-segregating with the male-sterile trait of marigold. By constructing an F2 segregation population of the male-sterile trait of marigold, a gene molecular marker co-segregating with the male-sterile trait of marigold is developed using the TeGLO gene sequence difference. The results show that the gene molecular marker TeGLO can effectively distinguish the fertility of marigold. Male-sterile marigold can amplify a band of 1450bp, while the amplification product of male-fertile marigold is 349bp or 349bp and 1450bp. The detection efficiency of this molecular marker in the male-sterile F2 segregation population of marigold reaches 100%.
[0021] The present invention uses the TeGLO gene molecular marker to verify the cultivated F2 male sterile segregation population and the male sterile F2 population constructed based on 4 marigold commercial varieties. The results show that the TeGLO gene molecular marker can accurately distinguish the fertility of male organs of the plants in the F2 segregation population. That is, in sterile plants, only a single 1450bp band can be detected in the PCR product, while in fertile plants, two amplified bands of 349bp or both 349bp and 1450bp can be detected in the PCR product. This TeGLO gene molecular marker was verified in five marigold male sterile F2 populations. The PCR products of 438 male fertile plants were two amplified bands of 349bp or both 349bp and 1450bp, and the PCR products of 143 male sterile plants were a single 1450bp band. The test results show that the plant phenotype is completely consistent with this gene molecular marker, no crossover occurs, and the detection efficiency reaches 100%.
[0022] The detection method established using the gene molecular marker of the present invention can directly use the PCR product to quickly screen the fertility of marigold male organs, and the initial screening can be carried out at the seedling stage, greatly shortening the breeding cycle and saving the cost. It has great theoretical and practical significance for cultivating new marigold varieties.
[0023] The present invention relates to key term definitions and abbreviations
[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described.
[0025] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides in single-stranded or double-stranded form, and their polymers. Unless specifically restricted, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically restricted, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as the explicitly specified sequence. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Cassol et al., (1992); Rossolini et al., Mol Cell. Probes 8:91-98 (1994)).
[0026] Gene molecular marker: An effective gene marker closely linked to a certain trait developed based on the sequence differences of a certain gene.
[0027] Plant male sterility: It refers to the abortion of pollen grains while the pistils develop normally. Description of the Drawings
[0028] Figure 1 Male-fertile and male-sterile marigolds; a is the fertile plant f5, and b is the sterile plant M525A.
[0029] Figure 2 Heat map analysis of the marigold transcriptome.
[0030] Figure 3 Comparison of the gDNA structures of TeGLO and teglo; the black boxes are exon regions.
[0031] Figure 4 Verification result diagram of the specific gene molecular marker TeGLO in marigold parents, F1 generation, and F2 population; f5 is the male parent (male-fertile), 'M525A' is the female parent (male-sterile), F1 is the F1 hybrid, 1-8 are male-sterile marigolds in the F2 population, and 9-21 are male-fertile marigolds in the F2 population; plants with 2 bands in the figure represent heterozygous plants.
[0032] Figure 5Verification results of the specific gene molecular marker TeGLO in the male sterile F2 populations of 4 commercial marigold varieties; a 'MB', b 'HY', c 'CH', d 'XC'; 1-16 are male fertile marigold plants, 17-24 are male sterile marigold plants. Detailed implementation manners
[0033] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that the details and forms of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements all fall within the protection scope of the present invention.
[0034] Example 1 Preliminary identification of gene molecular markers co-segregating with the male sterile trait of marigold
[0035] 1. Transcriptome analysis of sterile and fertile flower buds of marigold
[0036] Differential expression analysis of MADS-box genes in the flower buds of fertile and sterile marigold plants was performed using transcriptome technology. The results showed that the expression levels of seven genes, namely comp46023_com, comp62794_coB, comp42748_coB, comp53189_co, comp38236_co, comp51402_co, and comp58880_co, were significantly different between the flower buds of sterile and fertile plants ( Figure 2 ).
[0037] 2. Cloning and sequence structure difference analysis of PI / GLO-like genes in sterile and fertile marigold plants
[0038] The cDNA sequences of the differentially expressed genes in the transcriptomes of sterile and fertile marigold plants were cloned. The results showed that only the comp62794_co gene sequence was different between sterile and fertile plants. Multiple sequence alignment and phylogenetic tree analysis showed that the comp62794_co gene belongs to the PI / GLO-like gene, so it was named TeGLO. Further analysis of the full-length genomic sequence of the comp62794_co gene found that a 1088bp transposon was inserted into the 3rd intron of TeGLO in male sterile marigold plants ( Figure 3) The mutated TeGLO gene was named teglo. According to the gDNA sequence differences of the TeGLO gene in the male-fertile plant f5 and male-sterile plant M525A of marigold (shown in SEQ ID NO.1 and SEQ ID NO.2), gene marker primers (TeGLO-F and TeGLO-R) were designed using Primer Premier5.0 software, and the marker sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0039] 3. Construction of the segregating population of male sterility traits in marigold
[0040] In this example, male-sterile marigold M525A was used as the female parent, and male-fertile marigold f5 was used as the male parent ( Figure 1 ), and F1 was obtained by hybridization. The F1 individual plants were self-crossed to obtain the F2 segregating population.
[0041] 4. Analysis of the genetic law of male sterility traits in marigold
[0042] The male sterility traits of the F2 segregating population were statistically analyzed. There were 374 fertile plants and 111 sterile plants. According to the chi-square test, the ratio of fertile plants to sterile plants was approximately 3:1, which conformed to Mendel's genetic law, indicating that the male sterility trait of marigold was controlled by a single gene. Among them, male fertility was the dominant trait, and male sterility was the recessive trait.
[0043] 5. Verification of the gene molecular marker TeGLO in the F2 population
[0044] Detection of the TeGLO gene molecular marker in the above F2 segregating population showed that the TeGLO gene molecular marker co-segregated with the fertility trait. There was a 1450bp band in the PCR amplification products of male-sterile marigolds, and there was a 349bp band or two bands of 349bp and 1450bp in the PCR amplification products of male-fertile marigolds.
[0045] 6. Gene molecular marker TeGLO and PCR amplification system and procedure
[0046] The total volume of the PCR reaction system was 25 μl, containing 1 μl of 100 ng / μl template DNA, 12.5 μl of PCR Master Mix (containing Taq enzyme, dNTP, Mg 2+ ), 1 μl each of 10 μmol / L upstream primer and downstream primer, and 9.5 μl of ddH2O.
[0047] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 sec, annealing at 61°C for 30 sec, extension at 72°C for 2 min, for 35 cycles; final extension at 72°C for 10 min; incubation at 4°C for 10 min. The amplified products were detected by 1% agarose gel electrophoresis.
[0048] Test Example 1 Verification Test of Marigold Fertility Using Gene Molecular Marker TeGLO
[0049] 1. Test Method
[0050] (1). Take 4 - 5 fresh young leaves of marigold, extract the genomic DNA of the marigold to be detected by the 2×CTAB method, detect the DNA quality by 1% agarose gel, and detect the DNA concentration using a UV spectrophotometer. Then dilute the extracted DNA to 100 ng / ul and dispense for use.
[0051] (2). Using the genomic DNA of the marigold to be detected as a template and the TeGLO gene as a target, design upstream and downstream primers. The base sequences of the upstream and downstream primers are as follows:
[0052] TeGLO-F (upstream primer): GCTTCTTTATAGCATCCACCTCTG (SEQ ID NO.3)
[0053] TeGLO-R (downstream primer): GGCGTCCATTTTCCAGTGC (SEQ ID NO.4)
[0054] (3). The PCR reaction system was as follows: 1 μl of 100 ng / μl DNA template, 12.5 μl of PCR Master Mix (containing Taq enzyme, dNTP, Mg 2+ ), 1 μl of upstream primer, 1 μl of downstream primer, 9.5 μl of ddH2O.
[0055] (4). The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 sec, annealing at 61°C for 30 sec, extension at 72°C for 2 min, for 35 cycles; final extension at 72°C for 10 min; incubation at 4°C for 10 min.
[0056] (5). Detect the amplified products by 1% agarose gel electrophoresis. If the PCR product can only amplify a single 1450 bp band, it is male-sterile marigold; if a 349 bp band is amplified after agarose gel detection or both a 349 bp and a 1450 bp band are amplified simultaneously, it is male-fertile marigold. Among them, the plants that can amplify both 349 bp and 1450 bp bands are heterozygotes.
[0057] 2. Test Results
[0058] The gene molecular marker TeGLO was used to verify the F2 male sterile segregation population cultivated by the research group of the present inventors and the male sterile F2 population constructed based on 4 commercial marigold varieties. The results showed that the gene molecular marker TeGLO could accurately distinguish the male organ fertility of the plants in the F2 segregation population. That is, only a single 1450bp band could be detected in the PCR products of sterile plants, while one 349bp amplification band or two amplification bands of 349bp and 1450bp could be detected in the PCR products of fertile plants ( Figure 4 and Figure 5 ). The gene molecular marker TeGLO was used to verify in five male sterile F2 populations of marigold. The PCR products of 438 male fertile plants were 349bp or two amplification bands of 349bp and 1450bp were amplified simultaneously, and the PCR products of 143 male sterile plants were a single 1450bp band. The detection results showed that the phenotype of marigold plants was completely consistent with the gene molecular marker TeGLO, no crossover occurred, and the detection efficiency reached 100%.
[0059] Table 1 Description of the morphological characteristics of 5 male sterile F2 segregation populations of marigold
[0060] SEQUENCE LISTING <110> Huazhong Agricultural University <120> Co-segregating gene molecular marker, detection primer and detection kit for identifying male sterility of marigold <130> Hb-1004-210705A <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 1480 <212> DNA <213> Tagetes erecta L <400> 1 atggggagag gaaaaattga aatcaaaagg attgaaaaca caagcaacag gcaagtcact 60 tactctaaaa gaaaaaatgg tatcatcaag aaagctaaag aaatcactgt tctttgtgat 120 gctaatgtct ctcttgttat ctatggatct tctggcaaga tgtatgaata ttgcagcccc 180 aaaaccaagt ataaattaat acatacatca ctttttttta ttagggtttt ttttcttttt 240 tttgaatatt atttcttgat cattaattat taatttcttg atatatatat agcttgattg 300 atatgctgga tagatatcaa aggctttctg gaaataagtt gtgggatgct aaacatgagg 360 ttggtttgtt ggtttgtttg tttttgaaat tatatataaa gatcgatctg gttttttaat 420 ttgtttgcta aaaagatgtt aagtaagttg atgtgtgaat tatatgagca gatctagaaa 480 tagctagcat atatgatcat gagatgttac atccatcaac agatctggaa gtaactagtg 540 ttctctcact accctttact tgcaacaacc taggatgtct agtgttttgt gcttgatttt 600 taatacatag caagtcaaat atatatatgc ttgtttatag catccacctc tgacatatat 660 atgtaggtta aacacttgtc tttgtttttt attatttctt tttttgaatg ttgattgata 720 tatacatgtc ttctcttgtg gatcttgcaa tattatagaa tttgcagaat gaaattgaca 780 gaattaagaa agaaaatgag agcatgcaaa ttgagctcag gtatatatat acccctctct 840 ctctctctct atatatatat atatacatat acatatgaac taattatttc cttttaggca 900 cttgaaaggg gaagatataa catctttgaa ctatgaagaa cttatctcat atgaagatgc 960 actggaaaat ggacttacca acattaggga aaaaaaggca attaaactta tttctctctc 1020 tctctctata tatatatata tatatgtgtg tgtgtaatgg gtagttgttt atatatttga 1080 tcatgttctc atgacttgta ttttgaaatc ttgaacagga tgaaatccct aaaatgatga 1140 ggaagcatgt aagtttttaa tagagtgtat gtagttaaag tgaacatgtg taaaatattt 1200 agttagatgt gtttatgatg gatttgtgta tgtgtgtgaa ttaatcagga acaagttcta 1260 gaggaggaga acaagcacct catgtatttg gtggtaagtt tatcatgttt gtatatatgg 1320 taacaagtct ataatatatt gtcatgttct tatttctgat acaatatttg tgtatgtgta 1380 gcaacaaagt gaaatggcag caatgggaga ttaccaaggt catgaaccct tttcgttccg 1440 tgttcaaccg atgcagccca acttgcatga gaggatgtag 1480 <210> 2 <211> 2626 <212> DNA <213> Tagetes erecta L <400> 2 atggggagag gaaaaattga aatcaaaagg attgaaaaca caagcaacag gcaagtcact 60 Met-Gly-Glu-Glu-Lys-Ile-Glu-Ile-Gln-Arg-Ile-Glu-Lys-His-Ser-Thr-Gln-Ala-Ser-His tactctaaaa gaaaaaatgg tatcatcaag aaagctaaag aaatcactgt tctttgtgat 120 Tyr-Ser-Lys-Glu-Lys-Met-Tyr-His-Gln-Lys-Ala-Lys-Lys-Ile-Thr-Val-Ser-Cys-Asp gctaatgtct ctcttgttat ctatggatct tctggcaaga tgtatgaata ttgcagcccc 180 Ala-Asn-Val-Leu-Leu-Val-Tyr-Tyr-Gly-Ser-Ser-Gly-Gln-Asp-Val-Met-Asn-Ile-Ala-Ala-Pro aaaaccaagt ataaatacat ctttcacatc actttttttt tattagggtt tttttttatt 240 Lys-Pro-Ser-Tyr-Lys-Tyr-Ile-Phe-His-Ile-Thr-Phe-Phe-Phe-Phe-Tyr-Arg-Val-Phe-Phe-Ile tgaatattat ttcttgatca ttaattatta ttttcttgat atatatatag cttgattgat 300 Stop-Ile-Tyr-Phe-Leu-Asp-His-Leu-Ile-Ile-Ile-Phe-Leu-Asp-Ile-Tyr-Tyr-Ser-Leu-Asp-Asp atgctggata gatatcaaag gctttctgga aataagttgt gggatgctaa acatgaggtt 360 Met-Ala-Gly-Asp-Asp-Ile-Lys-Ala-Phe-Ser-Glu-Ile-Lys-Leu-Gly-Met-Ala-Asn-His-Glu-Val ggtttgttgg tttgtttgtt tttgaaatta tatataaaga tctggttttt tgtttgctaa 420 Gly-Phe-Val-Gly-Phe-Val-Phe-Val-Phe-Glu-Ile-Tyr-Tyr-Lys-Asp-Leu-Gly-Phe-Val-Ala-Lys aaagatgtta agtaagttga tgtgtgaatt atatgagcag atctagaaat agctagcata 480 Lys-Asp-Val-Ser-Ser-Val-Asp-Cys-Val-Glu-Tyr-Tyr-Glu-Gln-Asp-Leu-Glu-Asn-Ala-Ala-Ile tatgatcatg agatgttaca tccatcaaca gatctggaag taactagtgt tctctcacta 540 Tyr-Asp-His-Met-Glu-Met-Val-Thr-His-Gln-Thr-Asp-Leu-Glu-Val-Thr-Ser-Val-Ser-Ser-Thr ccctttactt gcaacaacct aggatgtcta gtgttttgtg cttaattgat ttataataca 600 Pro-Phe-Thr-Leu-Ala-Thr-Pro-Arg-Asp-Val-Ser-Val-Phe-Val-Leu-Ile-Asp-Phe-Tyr-Asn-Thr tagcaagtca aatatatata tgcttgttta tagcatccac ctctgacata tatatatgta 660 Ser-Ala-Ser-Gln-Ile-Tyr-Tyr-Cys-Leu-Phe-Ile-Ala-Pro-His-Leu-Asp-Ile-Tyr-Tyr-Cys tgtaggttaa acacttgtct ttgtttttta ttatttcttt tttttgaatg ttgattgata 720 Cys-Arg-Val-Lys-Thr-Leu-Val-Phe-Val-Phe-Phe-Tyr-Phe-Phe-Phe-Phe-Glu-Met-Val-Asp-Asp tgtcttctct tgtggatctt gcaatattat agaatttgca gaatgaaatt gacagaatta 780 agaaagaaaa tgagagcatg caaattgagc tcaggtatat atatatacct ctctctatat 840 atatatatat atacacatgc catatacata tgaactaatt atttcctttt aggcacttga 900 tcaaggcata agatcaatga acaatgaata actttattat tgcaagagaa aactcactca 960 aaaactcgtt acaataattc tctattgttt gtccatgcta aagcctctac ataagcctta 1020 tatttatagt tctaacctac acgtgttaga ctataataca aatagctaaa tctaggttaa 1080 ttcctaaata ttagggattt gacataactt gtcgtatcct actcaaactc taccgacttg 1140 tggatttggt ttaggaaatt actccaacaa tcaccccctt aatttctaaa ccaaattaag 1200 cggactctta actccaacca tgtttctttg atctcgattc ttcttaagct ttccttgatc 1260 ttgattcatc ttcggtaacc atgactcgat tatccacttg aattcacgat ctttggcagc 1320 tcattaaaga aacataattg acttctaaaa cgaggttgga atgcgatccg agttcatgat 1380 tgtattcctt aaactttagc taatctgaat ttgcgacaaa aacgacttta tggtcgcaag 1440 gctttggctt tggttcgtgg ttcccggaat tgataaacaa gatcagcagc ggcttcatga 1500 agcaattgcc cgacgtccct agttggatct tccttggcct cttctatcga ttgcccatag 1560 atcttacttg gtcgacttca ttcggcctta gatctctcct tggcaaaaac gattggccct 1620 agatctcttc acgacaacga caagcttcct tgcggcggct agatcttgaa tcaatcccgg 1680 gtacctagaa cttggatctt gattcgacca agctctgata ccacttcaag gcataagatc 1740 aatgaacaat gaataacttt attattgcaa gagaaaactc actcaaaaac tcgttacaat 1800 aattctctat tgtttgtcca tgctaaagcc tctacataag ccttatattt atagttctaa 1860 cctacacgtg ttagactata atacaaatag ctaaatctag gttaattcct aaatattagg 1920 gatttgacat aacttgtcgt atcctactca aactctaccg acttgtggat ttggtttagg 1980 aaattactcc aacacttgaa aggggaagat ataacatctt tgaactatga agaacttatc 2040 tcatatgaag atgcactgga aaatggactt accaacatta gggaaaaaaa ggcaattcaa 2100 cttatttctc tctctatata tatatgtgtg tgtgtgtgtg tgtctcatta gttgtttata 2160 tatttgatca tgttctcatg acttgtattt tgaaattttg aacaggatga aatccctaaa 2220 atgatgagga agcatgtaag tttatagtag agtgtatgta gttaaagtta acatgtgtaa 2280 aatatttagt tagatgtgtt tatgatggat ttgtgtatgt gtgtgaatta atcaggaaca 2340 agttctagag gaggagaaca agcacctaat gtatttggtg gtaagtttag catgtttgta 2400 tatatggtaa caagtctata atatattgtc atgtttttat ttctgataca tttgtgtata 2460 tatatatggt aacaagtata ttgtcatgtt cttaattatt tctgatacaa tatttgtgta 2520 tgtgtagcaa caaagtgaaa tggcagcaat gggagattat caaggtcatg aacccttttc 2580 gttccgtgtt caaccgatgc agcccaactt gcatgaaagg atgtag 2626 <210> 3 <211> 24 <212> DNA <213> Artifical sequence <400> 3 gcttgtttat agcatccacc tctg 24 <210> 4 <211> 19 <212> DNA <213> Artifical sequence <400> 4 ggcgtccatt ttccagtgc 19
Claims
1. The molecular marker TeGLO for identifying the male sterility trait of marigold, characterized in that, The nucleotide sequence of the molecular marker TeGLO in the fertile marigold plant is shown in SEQ ID NO.1; the nucleotide sequence of the molecular marker TeGLO in the male sterile marigold plant is shown in SEQ ID NO.
2.
2. The detection primer obtained by using the molecular marker TeGLO described in claim 1 as the target gene, characterized in that, The detection primers consist of an upstream primer whose nucleotide sequence is shown in SEQ ID NO.3 and a downstream primer whose nucleotide sequence is shown in SEQ ID NO.
4.
3. A PCR detection kit for identifying the male sterility trait of marigold, comprising: PCR Master Mix, deionized water, and detection primers; characterized in that the detection primers are the detection primers described in claim 2.
4. The application of the detection primer described in claim 2 in the breeding of male sterility trait of marigold or the detection of genotype purity of male fertile trait.
5. The application according to claim 4, characterized in that, include: (1) extracting DNA from marigold samples to be tested; (2) Using the molecular marker TeGLO as the target gene, design upstream and downstream primers for PCR amplification; (3) If the PCR amplification product is a single band of 349 bp or two bands of 349 bp and 1450 bp are amplified simultaneously, the marigold sample is a male fertile marigold; if the PCR amplification product is a single electrophoresis band of 1450 bp, the marigold sample is a male sterile marigold.
6. The application according to claim 5, characterized in that, The marigold samples that can amplify two bands of 349 bp and 1450 bp are heterozygous fertile marigolds.
7. The application according to claim 5, characterized in that, The upstream primer and the downstream primer are the upstream primer and the downstream primer according to claim 2.
8. The application according to claim 5, characterized in that, The reaction system for the PCR amplification is as follows: 12.5 μl of PCR Master Mix, 1 μl of DNA template, 1 μl of upstream primer, 1 μl of downstream primer, and 9.5 μl of deionized water; The reaction procedure of the PCR amplification is: 94°C for 4 min; 94°C for 30 sec, 61°C for 30 sec, 72°C for 2 min, for a total of 35 cycles; 72°C for 10 min; and keeping warm at 4°C for 10 min.
Citation Information
Patent Citations
Molecular marker related to ms k (nuclear-genetic male sterility gene) and certification method using same
WO2011081502A2
Use of maize gene zmabcg20 in regulating crop male fertility and DNA molecular markers associated with maize male fertility and use thereof
WO2019062895A1