A genotyping detection method for the E484Q mutation of the SARS-CoV-2 spike protein

Abstract

The present invention relates to the technical field of virus genotyping detection, and specifically relates to a genotyping detection method for the E484Q mutation of the S protein of the novel coronavirus. The present invention designs wild-type and mutant primers for this site respectively. The RPA-ligation-qPCR method can genotype the key mutation E484Q of the novel coronavirus, does not involve expensive NGS equipment, and the whole process can be carried out on common instruments in clinical laboratories. In addition, the whole reaction process takes less than 1.5 hours, greatly shortening the detection time. This method provides a more convenient alternative to NGS for the genotyping of key mutations of the novel coronavirus at present and in the future. Using the RPA-ligation-qPCR technology for the genotyping of the E484Q gene of the S protein of the novel coronavirus has the advantages of high sensitivity and strong specificity.

Description

Technical Field

[0001] The present invention relates to the technical field of viral genotyping detection, and specifically relates to a genotyping detection method for the E484Q mutation of the S protein of the novel coronavirus. Background Art

[0002] Since the COVID-19 pandemic began, the novel coronavirus (SARS-CoV-2) has been constantly mutating. Mutations at key sites on its S protein often endow the virus with stronger infectivity and immune escape ability. For example, variants carrying E484Q can evade the immune effect of vaccines and also have strong resistance to neutralizing antibodies in patients' bodies, which is likely to trigger a second or third wave of infections. Therefore, developing an effective genotyping method for this key mutation E484Q can help with the precise prevention and control and treatment of the epidemic. So far, the genotyping method for key mutations of the novel coronavirus is mainly next-generation sequencing technology (NGS). However, this method has certain limitations, such as being time-consuming and laborious and relying on expensive NGS equipment. In recent years, ligation-based detection technology has been widely used in the field of genotyping. The thermostable ligase from Thermus aquaticus can catalyze the formation of a phosphodiester bond between the 5'-phosphate and 3'-hydroxyl groups of two adjacent oligonucleotide chains hybridized to the same complementary target DNA strand. If there is a single-base mismatch at the junction, the catalytic reaction cannot proceed. The genotyping detection method established based on this property of ligase has advantages such as high sensitivity and strong specificity. Currently, there is no report on applying ligase technology to the genotyping of key mutations of the novel coronavirus. Based on this technology, through a series of optimizations, developing a more simple and efficient method for application in the genotyping detection of the E484Q mutation of the S protein of the novel coronavirus is of great value. Summary of the Invention

[0003] The present invention establishes an RPA-ligation-qPCR technology for genotyping detection of the E484Q mutation of the S protein of the novel coronavirus.

[0004] The present invention provides a genotyping detection method for the E484Q mutation of the S protein of the novel coronavirus, comprising the following steps:

[0005] (1) Using specific amplification primers 1 and 2, amplifying the gene fragment at the E484Q site using an RT-RPA reaction system;

[0006] (2) Using specific amplification primers 3, 4, and 5, processing the amplification product of step (1) using a ligation reaction system;

[0007] (3) Use specific amplification primers 6 and 7, and use the qPCR reaction system to determine the genotyping results of the reaction product in step (2).

[0008] In some embodiments, the primer 1 sequence in step (1) is: ACAGCAAATGGGTCGGGATCCGCTCCAGGGCAAACTGGAA; the primer 2 sequence in step (1) is: GTGGTGGTGGTGGTGCTCGAGGCAACAGGGACTTCTGTGCAG.

[0009] In some embodiments, the primer sequences in step (2) are as follows:

[0010] Primer 3: TCATTCATTTTCCTTTTATCTTCTGATATGAAGTAACAATTAAAACCTTG;

[0011] Primer 4: TCATTCATTTTCCTTTTATCTTCTGATATGAAGTAACAATTAAAACCTTC;

[0012] Primer 5: PHO-AACACCATTACAAGGTGTGCCTGTGTCTGTGTAAATATCGTCTCTTTTTA.

[0013] In some embodiments, the primer sequences in step (3) are as follows:

[0014] Primer 6: TAAAAAGAGACGATATTTACACAGACACAG;

[0015] Primer 7: TCATTCATTTTCCTTTTATCTTCTGATATG.

[0016] In some embodiments, in the RT-RPA reaction system of step (1), the concentrations of primer 1 and primer 2 are 10 μM, and the volume ratio of the template to primer 1 and primer 2 is 1:2:2, and the template is the gene fragment at the E484Q site.

[0017] In some embodiments, the RT-RPA reaction in step (1) is initiated by adding 2.5 μL of magnesium acetate with a concentration of 280 mM and incubated at 42 °C for 30 min.

[0018] In some embodiments, the RT-RPA reaction steps in step (1) are as follows: Add 41.5 μL of A Buffer, 2 μL each of primer 1 and 2 (concentration 10 μM), 10 51 μL of template RNA at copies / μL. Next, add 2.5 μL of magnesium acetate (280 mM) to the lid of the detection unit tube to initiate the reaction. After mixing and centrifuging, incubate at 42 °C for 30 min.

[0019] In some embodiments, in the ligation reaction system of step (2), the concentrations of primers 3, 4, and 5 are 20 nM, and the mixing volume ratio of the RT-RPA amplification product to primers 3, 4, and 5 is 1:1:1:1.

[0020] In some embodiments, the ligation reaction procedure of step (2) is: after transient centrifugation of the mixed reactants, first denature at 95 °C for 3 min, and then ligate at 60 °C for 3 min.

[0021] In some embodiments, the ligation reaction steps of step (2) are: sequentially add 5.75 μL of ultrapure water, 1 μL of primer 5 (20 nM), 1 μL of 10× Taq DNA Ligase Buffer, 0.25 μL of Taq DNA Ligase (40 U / μL), and 1 μL of the RT-RPA amplification product into two 200 μL tubes. Then, add 1 μL of primer 3 (20 nM) to one tube and 1 μL of primer 4 (20 nM) to the other tube. After transient centrifugation of the mixed reactants, first denature at 95 °C for 3 min, and then ligate at 60 °C for 3 min.

[0022] In some embodiments, in the qPCR reaction system of step (3), the concentrations of primers 6 and 7 are 10 μM, and the mixing ratio of the ligation reaction product to primers 6 and 7 is 1:0.4:0.4.

[0023] In some embodiments, the qPCR reaction procedure of step (3) is: denature at 95 °C for 15 s, anneal and extend at 60 °C for 30 s, for 45 cycles.

[0024] In some embodiments, the qPCR reaction procedure of step (3) is: the total qPCR reaction system is 20 μL. First, add 10 μL of Universal SYBR qPCR Master Mix, 0.4 μL of primer 6, 0.4 μL of primer 7, with the concentrations of primers 6 and 7 being 10 μM, and 8.2 μL of ultrapure water into the qPCR eight-strip tube. Then, add 1 μL of the ligation reaction product. After transient centrifugation of the mixed reactants, set the qPCR reaction procedure as: denature at 95 °C for 15 s, anneal and extend at 60 °C for 30 s, for 45 cycles, and detect the fluorescence intensity in real time.

[0025] The specific principle of the present invention is as follows: the sample RNA is amplified by RT-RPA reaction, and the specific DNA sequence is ligated by ligation reaction, so as to generate the difference in the amount between different DNAs. The qPCR reaction is used to further amplify this difference in amount and perform quantitative and qualitative analysis, thereby obtaining the genotyping conclusion.

[0026] The beneficial effects of the present invention: The RPA-ligation-qPCR method can genotype the key mutation E484Q of the novel coronavirus, without involving expensive NGS equipment, and the whole process can be carried out on common instruments in clinical laboratories. In addition, the whole reaction process takes less than 1.5 hours, greatly shortening the detection time. This method provides a more convenient alternative to NGS for the genotyping of current and future key mutations of the novel coronavirus.

[0027] Using the RPA-ligation-qPCR technology for genotyping the E484Q gene of the S protein of the novel coronavirus has the advantages of high sensitivity and strong specificity.

[0028] Related definitions

[0029] RT-RPA: Reverse transcription recombinase polymerase isothermal nucleic acid amplification technology

[0030] ligation: Ligation enzyme technology

[0031] qPCR: Real-time fluorescence quantitative PCR Description of the drawings

[0032] Figure 1 qPCR fluorescence curves of the RPA-ligation-qPCR method for detecting E484Q mutant (A) and wild-type (B) RNA standards

[0033] Figure 2 Sensitivity of the RPA-ligation-qPCR method

[0034] Figure 3 Verification of the RPA-ligation-qPCR method using SARS-CoV-2-MT-B.1.617 pseudovirus (E484Q) Specific implementation examples

[0035] The following further illustrates the present invention in conjunction with specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the examples given do not limit the present invention.

[0036] 1. Reagents and instruments

[0037] The TIANamp Virus RNA Kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; the T7 High Efficiency Transcription Kit was purchased from Beijing TransGen Biotech Co., Ltd.; the RT-RPA nucleic acid amplification kit was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; the Universal SYBR qPCR Master Mix was purchased from Nanjing Novoprotein Biotechnology Co., Ltd.; Taq DNA Ligase was purchased from Sangon Biotech (Shanghai) Co., Ltd.; the SARS-CoV-2-MT-B.1.617 pseudovirus was purchased from Fubio (Suzhou) Biotechnology Co., Ltd.; the Qubit 4 fluorometer was purchased from Thermo Fisher Scientific (China) Co., Ltd.; the Roche LightCycler 480 II qPCR instrument was purchased from Roche, Switzerland.

[0038] 2. Primer and Probe Design

[0039] Primers and probes were designed using Geneious software based on the sequence of the E484Q mutation site. The primers and probes were synthesized by General Biosystems (Anhui) Co., Ltd., and the sequences are shown in Table 1.

[0040] Table 1 Primer Sequences

[0041]

[0042] Example 1 Construction of RNA Standards

[0043] Based on the wild-type GenBank number NC_045512.2 of the novel coronavirus, a 638-nt fragment of the SARS-CoV-2 S gene sequence containing the E484 mutation site was designed, synthesized, and constructed between the restriction enzyme cleavage sites BamHI and XhoI downstream of the T7 promoter on the pET28b(+) vector to form a standard plasmid. The wild-type (WT) plasmid and the mutant-type (MT) plasmid were constructed respectively, and the plasmids were confirmed by DNA sequencing (Sangon Biotech (Shanghai) Co., Ltd.). The wild-type and mutant-type plasmids were transcribed in vitro using the T7 High Efficiency Transcription Kit and quantified using a Qubit 4 fluorometer. The in vitro transcribed wild-type and mutant-type RNA standards were stored at -80 °C.

[0044] Example 2 RT-RPA Reaction System

[0045] RT-RPA amplification was carried out according to the instructions of the RT-RPA nucleic acid amplification kit. 41.5 μL of A Buffer, 2 μL each of primers 1 and 2 (concentration 10 μM), and 105 1 μL of template RNA at copies / μL. Next, 2.5 μL of magnesium acetate (280 mM) was added to the lid of the detection unit tube to initiate the reaction. After mixing and centrifuging, it was incubated at 42 °C for 30 min. A buffer was provided by this kit of Hangzhou Zhongce Biotechnology Co., Ltd.

[0046] Example 3 ligation reaction system

[0047] The total ligation reaction system was 10 μL. First, 5.75 μL of ultrapure water, 1 μL of primer 5 (20 nM), 1 μL of 10× Taq DNA Ligase Buffer, 0.25 μL of Taq DNA Ligase (40 U / μL), and 1 μL of RT-RPA amplification product were sequentially added to two 200 μL tubes. Then, 1 μL of primer 3 (20 nM) was added to one tube, and 1 μL of primer 4 (20 nM) was added to the other tube. After the mixed reactants were centrifuged instantaneously, they were first denatured at 95 °C for 3 min, and then ligated at 60 °C for 3 min.

[0048] Example 4 qPCR reaction system

[0049] The total qPCR reaction system was 20 μL. First, 10 μL of Universal SYBR qPCR Master Mix, 0.4 μL of primer 6, 0.4 μL of primer 7, the concentrations of primer 6 and primer 7 were 10 μM, and 8.2 μL of ultrapure water were added to the qPCR eight-strip tubes. Then, 1 μL of the ligation reaction product was added. After the mixed reactants were centrifuged instantaneously, the qPCR reaction program was set as: denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 30 s, 45 cycles, and the fluorescence intensity was detected in real time.

[0050] Example 5 Feasibility of the RPA-ligation-qPCR method

[0051] To evaluate the feasibility of the method for genotyping the E484Q mutation of the SARS-CoV-2 S protein gene, 10 5 copies / μL of in vitro transcribed wild-type and mutant RNA standards were used as templates. Two groups of probes of primer 4 and primer 3 (primer 4: primer 4 + primer 5; primer 3: primer 3 + primer 5) were added to each of the two templates. The results showed that for the mutant RNA template, the primer 3 that was completely matched with it would produce a fluorescence signal first, and the primer 4 that was not matched with it would produce a fluorescence signal later ( Figure 1 A). For the wild-type RNA template, the primer 4 that was completely matched with it would produce a fluorescence signal first, and the primer 3 that was not matched with it would produce a fluorescence signal later ( Figure 1B). The results showed that the established RPA-ligation-qPCR method could genotype E484Q.

[0052] Example 6 Sensitivity of the RPA-ligation-qPCR method

[0053] The viral load during the actual detection process can affect the detection results. Therefore, it is necessary to evaluate the sensitivity of the method. The in vitro transcribed wild-type and mutant RNA standards were serially diluted 10-fold to 10 5 , 10 3 , 10 2 copies / μL, and the established method was used to evaluate the sensitivity. The results showed that the lowest detection limit of the established RPA-ligation-qPCR method was 10 2 copies / μL ( Figure 2 A-F).

[0054] Example 7 Verification of the method using SARS-CoV-2-MT-B.1.617 pseudovirus

[0055] The method was verified using the SARS-CoV-2-MT-B.1.617 pseudovirus containing the E484Q mutation. RNA was extracted using the TIANamp Virus RNA Kit, and the concentration was adjusted to 10 2 copies / μL for detection. The results showed that RPA-ligation-qPCR could genotype the E484Q mutation present in the pseudovirus ( Figure 3 ).

Claims

1. A set of primer pairs for genotyping detection of the E484Q mutation of the SARS-CoV-2 S protein, including primer 1 to primer 7, and the sequences of primer 1 to primer 7 are as follows: Primer 1: ACAGCAAATGGGTCGGGATCCGCTCCAGGGCAAACTGGAA; Primer 2: GTGGTGGTGGTGGTGCTCGAGGCAACAGGGACTTCTGTGCAG; Primer 3: TCATTCATTTTCCTTTTATCTTCTGATATGAAGTAACAATTAAAACCTTG; Primer 4: TCATTCATTTTCCTTTTATCTTCTGATATGAAGTAACAATTAAAACCTTC; Primer 5: PHO-AACACCATTACAAGGTGTGCCTGTGTCTGTGTAAATATCGTCTCTTTTTA; Primer 6: TAAAAAGAGACGATATTTACACAGACACAG; Primer 7: TCATTCATTTTCCTTTTATCTTCTGATATG.

Images