Use of the CAS9 protein from the bacterium Pasteurella pneumophila

Abstract

The present invention describes a novel bacterial nuclease from the CRISPR-Cas9 system of the bacterium Pasteurella pneumotropica (P. pneumotropica), and the use of the nuclease for producing strictly specific double-stranded cuts in DNA molecules. The nuclease has unique properties and can be used to change the genomic DNA sequence in cells of unicellular or multicellular organisms. The present invention thus increases the universality of the available CRISPR-Cas9 system, enabling the use of different Cas9 nuclease variants to cut genomic or plasmid DNA in various organisms in a large number of specific sites and / or under different conditions.

Description

Technical Field

[0001] The present invention relates to biotechnology, in particular to a novel enzyme, the Cas nuclease of the CRISPR-Cas system, which is used to cut DNA and edit the genomes of various organisms. This technology can be used in the future for gene therapy of genetic human diseases, as well as for editing the genomes of other organisms. Background Art

[0002] DNA sequence modification is one of the hot issues in the field of biotechnology today. Editing and modifying the genomes of eukaryotic and prokaryotic organisms, as well as manipulating DNA in vitro, requires the targeted introduction of double-strand breaks in DNA sequences.

[0003] In order to solve this problem, the following technologies are currently used: artificial nuclease systems containing zinc finger domains, TALEN systems, and bacterial CRISPR-Cas systems. The first two technologies require laborious optimization of nuclease amino acid sequences for recognizing specific DNA sequences. In contrast, when it comes to the CRISPR-Cas system, the structure that recognizes the DNA target is not a protein, but a short guide RNA. The cutting of a specific DNA target does not require the synthesis of nucleases or their genes from scratch, but is carried out by using guide RNAs complementary to the target sequence. It makes the CRISPR Cas system a convenient and efficient means for cutting various DNA sequences. This technology allows the use of guide RNAs of different sequences to cut DNA simultaneously at several regions. This method is also used to modify several genes in eukaryotic organisms at the same time.

[0004] By its nature, the CRISPR-Cas system is a prokaryotic immune system capable of introducing breaks into viral genetic material with high specificity (Mojica FJM et al., Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements / / Journal ofmolecular evolution. – 2005. – Vol. 60. – No. 2. – Pages 174-182). The abbreviation CRISPR-Cas stands for "Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated genes" (Jansen R. et al., Identification of genes that are associated with DNA repeats in prokaryotes / / Molecularmicrobiology. – 2002. – Vol. 43. – No. 6. – Pages 1565-1575). All CRISPR-Cas systems consist of CRISPR boxes and genes encoding various Cas proteins (Jansen R. et al., Molecular microbiology. – 2002. – Vol. 43. – No. 6. – Pages 1565-1575). The CRISPR box consists of a spacer region with a unique nucleotide sequence and repeated palindromic repeats (Jansen R. et al., Molecular microbiology. – 2002. – Vol. 43. – No. 6. – Pages 1565-1575). The transcription of the CRISPR box is then processed to form a guide crRNA, which together with the Cas protein forms an effector complex (Brouns SJJ et al., Small CRISPR RNAs guide antiviral defense in prokaryotes / / Science. – 2008. – Vol. 321. – No. 5891. – Pages 960-964). Due to complementary pairing between the crRNA and a target DNA site called the protospacer, the Cas nuclease recognizes the DNA target and introduces a break therein with high specificity.

[0005] Depending on the Cas protein included in the system, the CRISPR-Cas system with a single effector protein is grouped into six different types (types I-VI). In 2013, it was first proposed to use the type II CRISPR-Cas9 system for editing the genomic DNA of human cells (Cong L et al., Multiplex genome engineering using CRISPR / Cas systems. Science. February 15, 2013; 339(6121): 819-23). ​​The type II CRISPR-Cas9 system is characterized by its simple composition and activity mechanism, that is, its function needs to form an effector complex consisting of only one Cas9 protein and the following two short RNAs: crRNA and tracer RNA (tracrRNA). Tracer RNA is complementary to the crRNA region repeated from CRISPR, to form the secondary structure necessary for guide RNA to bind to Cas effectors. Determining the sequence of guide RNA is an important step in characterizing previously unstudied Cas orthologs. The Cas9 effector protein is an RNA-dependent DNA endonuclease with two nuclease domains (HNH and RuvC) that introduce breaks into the complementary strand of the target DNA, thus generating double-stranded DNA breaks (Deltcheva E. et al., CRISPR RNA maturation by trans-encoded small RNA and hostfactor RNase III / / Nature. – 2011. – Vol. 471. – Issue 7340. – Page 602).

[0006] To date, several CRISPR-Cas nucleases are known that can target and specifically introduce double-strand breaks into DNA. CRISPR-Cas9 technology is one of the most modern and fastest-growing technologies for introducing breaks in the DNA of various organisms ranging from bacterial strains to human cells, and in vitro applications are also provided (Song M. The CRISPR / Cas9 system: Their delivery, in vivo and ex vivo applications and clinical development by startups. Biotechnol Prog. 2017 July; 33(4): 1035-1045).

[0007] In addition to the complementarity of crRNA spacer-pre-spacer sequence, the effector ribonucleic acid complex (ribonucleic complex) composed of Cas9 and crRNA / tracrRNA duplex also needs to have PAM (pre-spacer sequence adjacent motif) on the DNA target for recognition and subsequent hydrolysis of DNA (Mojica FJM et al. 2009). PAM is a sequence of several nucleotides located in a strictly limited type II system, which is adjacent to or away from the 3' end of the pre-spacer sequence on the off-target chain by several nucleotides. In the absence of PAM, hydrolysis of DNA bonds and subsequent formation of double-strand breaks do not occur. The need for the presence of PAM sequences on the target increases recognition specificity, but at the same time, restrictions are imposed on the target DNA region selection for introducing breaks. Therefore, the presence of the required PAM sequence from the 3' end flanking the DNA target is a feature that limits the use of CRISPR-Cas systems at any DNA site.

[0008] Different CRISPR-Cas proteins use different, unique PAM sequences for their activities. The use of CRISPR-Cas proteins with novel, various PAM sequences is necessary to enable modification of any DNA region both in vitro and in the genome of a living organism. Modification of eukaryotic genomes also requires the use of small-size nucleases to provide AAV-mediated delivery of the CRISPR-Cas system into cells.

[0009] Although many techniques are known for cleaving DNA and modifying genomic DNA sequences, there remains a need for new and efficient means for modifying DNA in a variety of organisms and at strictly specific sites in DNA sequences. Summary of the invention

[0010] The purpose of the present invention is to provide a novel means of modifying genomic DNA sequences of unicellular or multicellular organisms using the CRISPR-Cas9 system. Currently available systems are of limited use due to the specific PAM sequence that must be present at the 3' end of the DNA region to be modified. The search for new Cas9 enzymes with other PAM sequences will expand the range of available means for forming double-strand breaks at the desired strictly specific sites in DNA molecules of various organisms. To address this issue, the authors characterized a previously uncharacterized double-strand break sequence for Pasteurella pneumophila ( Pasteurella pneumotropica ) (Pasteurella pneumophila( R. pneumotropica)) predicted type II CRISPR nuclease PpCas9, which can be used to introduce targeted modifications into the genome of both the above and other organisms. The invention is characterized by having the following basic characteristics: (a) a short PAM sequence that is different from other known PAM sequences; (b) a relatively small size of the characteristic PpCas9 protein, i.e., 1055 amino acid residues (aar).

[0011] The problem is solved by means of a protein for forming a double-strand break in a DNA molecule located immediately before the nucleotide sequence 5'-NNNN(A / G)TT-3' in the DNA molecule, the protein comprising the amino acid sequence of SEQ ID NO: 1, or comprising an amino acid sequence having at least 95% identity with the amino acid sequence of SEQ ID NO: 1 and differing from SEQ ID NO: 1 only in non-conservative amino acid residues. In some embodiments of the invention, the use is characterized in that the double-strand break in the DNA molecule is formed at a temperature of 35° C. to 45° C. In some embodiments of the invention, the use is characterized in that the double-strand break is formed in the genomic DNA of a mammalian cell. In some embodiments of the invention, the use is characterized in that the formation of the double-strand break in the DNA molecule results in the modification of the genomic DNA of the mammalian cell.

[0012] The problem is further solved by providing a method for modifying a genomic DNA sequence in a cell of a unicellular or multicellular organism, the method comprising introducing into the cell of the organism an effective amount of: a) a protein comprising the amino acid sequence of SEQ ID NO: 1, or a nucleic acid encoding a protein comprising the amino acid sequence of SEQ ID NO: 1, and b) a guide RNA comprising a sequence that forms a duplex with a nucleotide sequence of a genomic DNA region of the organism, or a DNA sequence encoding the guide RNA, the nucleotide sequence being directly adjacent to the nucleotide sequence 5'-NNNN(A / G)TT-3' and interacting with the protein after duplex formation; wherein the interaction of the protein with the guide RNA and the nucleotide sequence 5'-NNNN(A / G)TT-3' results in the formation of a double-stranded break in the genomic DNA sequence immediately adjacent to the sequence 5'-NNNN(A / G)TT-3'.

[0013] In some embodiments of the present invention, the method is characterized in that it further comprises introducing an exogenous DNA sequence simultaneously with the guide RNA. In some embodiments of the present invention, the method is characterized in that the cell is a mammalian cell.

[0014] A mixture of crRNA and tracer RNA (tracrRNA) that can form a complex with the target DNA region and the PpCas9 protein can be used as a guide RNA. In a preferred embodiment of the present invention, a hybrid RNA constructed based on crRNA and tracer RNA can be used as a guide RNA. The method for constructing a hybrid guide RNA is known to technicians (Hsu PD et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. September 2013; 31 (9): 827-32). One of the methods for constructing a hybrid RNA has been disclosed in the following examples.

[0015] The present invention can be used both for cutting target DNA in vitro and for modifying the genome of some living organisms.Genomic DNA can be modified in a direct manner, i.e. by cutting genomic DNA at the corresponding site, and by inserting foreign DNA sequences via homologous repair.

[0016] In addition to the region for administration, any region of double-stranded or single-stranded DNA from the genome of an organism (or a combination of such regions with each other and with other DNA fragments) can be used as an exogenous DNA sequence, wherein the region (or region combination) is expected to be integrated into the position of the double-stranded break in the target DNA induced by the PpCas9 nuclease. In some embodiments of the present invention, a double-stranded DNA region of genomic DNA from an organism that is further modified by mutation (substitution of nucleotides) and by insertion or deletion of one or more nucleotides for introduction of the PpCas9 protein can be used as an exogenous DNA sequence.

[0017] The technical effect of the present invention is to increase the universality of the available CRISPR-Cas9 system, so that the Cas9 nuclease can be used to cut genomic or plasmid DNA at a larger number of specific sites and under specific conditions. The new nuclease can be used in cells of bacteria, mammals or other organisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 . Schematic representation of the gene locus of the CRISPR PpCas9 system. DR (direct repeat) is the regularly repeated region that is part of the CRISPR cassette.

[0019] Figure 2 . In vitro PAM screening. Schematic representation of the experiment.

[0020] Figure 3 . PpCas9 nuclease cleavage of 7N library fragments at different reaction temperatures.

[0021] Figure 4 . (A) Analysis of in vitro screening results of PpCas9 nuclease using calculation of logarithm of proportional change for each specific nucleotide at each PAM (FC) position. (B) PAM logo of PpCas9 nuclease. The occurrence of adenine, cytosine, thymine and guanine is indicated for each position. The height of the letter corresponds to the nucleotide that occurs at a given position of the PAM sequence.

[0022] Figure 5 . Validation of the effect of single nucleotide substitutions at position 1 of the PAM on the efficiency of DNA target cleavage by the PpCas9 nuclease.

[0023] Figure 6 . Validation of the importance of the nucleotide position in the PpCas9 PAM sequence.

[0024] Figure 7 . Validation of the effect of the A to G substitution at position 5 of the PAM on the efficiency of DNA target cleavage by the PpCas9 nuclease.

[0025] Figure 8 . Validation of the effect of a single nucleotide substitution at position 7 of the PAM on the efficiency of DNA target cleavage by the PpCas9 nuclease.

[0026] Fig. 9 PpCas9 protein was used to cleave various DNA sites. Lanes 1 and 2 are positive controls.

[0027] Fig.10 . Validation of the recognition of the PAM sequence CAGCATT by the PpCas9 nuclease. Lanes 1 and 2 are positive controls.

[0028] Fig.11 . Illustration of the DNA cutting tool PpCas9.

[0029] Fig.12 Experiments on DNA target cleavage. Hybrid guide RNAs of different lengths were used.

[0030] Fig.13 . Using NCBI BLASTp software (default parameters), PpCas9 and the Staphylococcus aureus )'s amino acid sequence of the Cas9 protein.

[0031] Fig.14. Modification of genomic DNA of human cells using PpCas9. (A) is a schematic diagram of an experiment to determine the efficiency of modifying genomic DNA of human cells using a plasmid carrying PpCas9. (B) is the result of analysis of nucleotide insertions and deletions within the target site sequence of genomic DNA of human cells (top – reaction products with T7 endonuclease I applied to agarose gel electrophoresis, bottom – examples of insertions and deletions formed by PpCas9 in the EMX1 gene determined by high-throughput sequencing). DETAILED DESCRIPTION

[0032] As used in the specification of the present invention, the terms "includes" and "including" should be interpreted as meaning "including, among others". The terms are not intended to be interpreted as "consisting only of". Unless separately defined, technical and scientific terms in this application have ordinary meanings generally recognized in scientific and technical literature.

[0033] As used herein, the term "percent homology of two sequences" is equivalent to the term "percent identity of two sequences". Sequence identity is determined based on a reference sequence. Algorithms for sequence analysis are known in the art, such as BLAST described in Altschul et al., J. Mol. Biol., 215, pp. 403-10 (1990). For the purposes of the present invention, in order to determine the identity and similarity levels between nucleotide sequences and amino acid sequences, a comparison of nucleotide sequences and amino acid sequences can be used, which is performed using a gap alignment with standard parameters by the BLAST software package provided by the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / blast). Taking into account the number of gaps entered for optimal comparison of the two sequences by alignment and the length of each gap, the percent identity of the two sequences is determined by the number of positions of the same amino acid in the two sequences. The percent identity is equal to the number of identical amino acids at a given position taking into account the alignment of the sequences divided by the total number of positions, multiplied by 100.

[0034] The term "specifically hybridizes" refers to the binding between two single-stranded nucleic acid molecules or sufficiently complementary sequences to allow for such hybridization under predetermined conditions commonly used in the art.

[0035] The phrase "locating the double-strand break immediately before the nucleotide PAM sequence" means that the double-strand break in the target DNA sequence will be generated at a distance of 0 to 25 nucleotides before the nucleotide PAM sequence.

[0036] The exogenous DNA sequence introduced simultaneously with the guide RNA is expected to refer to a DNA sequence specifically prepared for the specific modification of the double-stranded target DNA at the break site determined by the specificity of the guide RNA. Such modification can be, for example, the insertion or deletion of certain nucleotides at the break site in the target DNA. The exogenous DNA can be a DNA region from a different organism or a DNA region from the same organism as the target DNA.

[0037] A protein comprising a specific amino acid sequence is intended to refer to a protein having such an amino acid sequence, which is composed of the amino acid sequence and other sequences that may be connected to the amino acid sequence by a peptide bond. Examples of other sequences may be nuclear localization signals (NLS), or other sequences that provide increased functionality for the amino acid sequence.

[0038] The exogenous DNA sequence introduced simultaneously with the guide RNA is expected to refer to a DNA sequence specifically prepared for the specific modification of the double-stranded target DNA at the break site determined by the specificity of the guide RNA. Such modification can be, for example, the insertion or deletion of certain nucleotides at the break site in the target DNA. The exogenous DNA can be a DNA region from a different organism or a DNA region from the same organism as the target DNA.

[0039] The effective amount of protein and RNA introduced into the cell is intended to refer to the amount of protein and RNA that, when introduced into the cell, is able to form a functional complex, i.e., a complex that specifically binds to the target DNA and produces a double-strand break therein at a site determined by the guide RNA and the PAM sequence on the DNA. The efficiency of this process can be evaluated by analyzing the target DNA isolated from the cell using conventional techniques known to the skilled person.

[0040] Proteins and RNA can be delivered to cells by various techniques. For example, a protein can be delivered as a DNA plasmid encoding a gene for the protein, as an mRNA for translating the protein in the cytoplasm, or as a ribonucleoprotein complex comprising the protein and a guide RNA. Delivery can be performed by various techniques known to the skilled person.

[0041] Nucleic acids encoding components of the system can be introduced into cells directly or indirectly by transfecting or transforming the cells by methods known to the skilled artisan, by using recombinant viruses, by manipulation of cells such as DNA microinjection, and the like.

[0042] The ribonucleic acid complex consisting of the nuclease and guide RNA and exogenous DNA (if necessary) can be delivered by transfecting the complex into the cell, or by mechanically introducing the complex into the cell, for example, via microinjection.

[0043] The nucleic acid molecule encoding the protein to be introduced into the cell can be integrated into the chromosome, or can be an extrachromosomal replicated DNA. In some embodiments, in order to ensure the effective expression of the protein gene introduced into the cell by its DNA, it is necessary to modify the sequence of the DNA according to the cell type so that the codon is optimized for expression, because the frequency of the occurrence of synonymous codons in the coding region of the genome of various organisms is not equal. Codon optimization is necessary for increasing the expression in animals, plants, fungi or microbial cells.

[0044] For a protein having a sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 1 to function in a eukaryotic cell, it is necessary that the protein terminates in the nucleus of such a cell. Therefore, in some embodiments of the present invention, a protein having a sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 1 and further modified by adding one or more nuclear localization signals at one or both ends is used to form a double-strand break in the target DNA. For example, a nuclear localization signal from the SV40 virus can be used. In order to provide effective delivery to the nucleus, the nuclear localization signal can be separated from the main protein sequence by a spacer sequence, which is described, for example, in Shen B et al., "Generation of gene-modified mice via Cas9 / RNA-mediated gene targeting", Cell Res. 2013 May; 23(5): 720-3. Further, in other embodiments, different nuclear localization signals or alternative methods for delivering the protein to the nucleus can be used.

[0045] The present invention includes the use of proteins from Pasteurella pneumophila organisms to introduce double-strand breaks into DNA molecules at strictly specified positions, and the proteins are homologous to the previously characterized Cas9 proteins. There are many advantages to using CRISPR nucleases to introduce targeted modifications into the genome. First, the specificity of the system's activity is determined by the crRNA sequence, which allows the use of one type of nuclease for all target loci. Secondly, the technology enables several guide RNAs complementary to different gene targets to be delivered into cells at one time, thereby enabling several genes to be modified simultaneously at one time.

[0046] PpCas9 is an important marker for the development of ATCS 35149 Cas nucleases found in Pasteurella pneumophila, a rodent pathogen that lives in the lungs of animals. Pasteurella pneumotropica ) (Pasteurella pneumophila (P. pneumotropica)) The CRISPR Cas9 system (hereinafter referred to as CRISPR PpCas9) belongs to the type II-C CRISPR Cas system and consists of a CRISPR box carrying four direct repeats (DR) with the sequence 5'ATTATAGCACTGCGAAATGAAAAAGGGAGCTACAAC3', separated by sequences of unique spacers. None of the spacers of this system are identical in sequence to currently known bacteriophages or plasmids, a fact that makes it impossible to determine the target PpCas9 PAM by bioinformatics analysis. Adjacent to the CRISPR box is the gene for the effector Cas9 protein PpCas9, as well as the genes for the Cas1 and Cas2 proteins involved in the adaptation and integration of the new spacers. Near the Cas gene, a sequence complementary to the direct repeats and folded into a characteristic secondary structure is found, which is considered to be the tracer RNA (tracrRNA) ( Figure 1 ).

[0047] Knowledge of the characteristic architecture of the RNA-Cas protein complex of type II-C systems enables prediction of the transcription direction of the CRISPR cassette: the pre-crRNA is transcribed in the opposite direction to the Cas gene ( Figure 1 ).

[0048] Therefore, sequence analysis of the PpCas9 locus enabled prediction of the sequences of the tracer and guide RNA (Table 1).

[0049] Table 1. Sequences of guide RNAs for the CRISPR PpCas9 system determined by bioinformatics methods. Bold indicates the sequence of the direct repeat, DR.

[0050]

[0051] To verify the activity of the PpCas9 nuclease and determine the target PpCas9 PAM, we performed experiments on reconstructing the DNA cleavage reaction in vitro. In order to determine the PAM sequence of the PpCas9 protein, in vitro cleavage of a double-stranded PAM library was used. To do this, it is necessary to obtain all the components of the PpCas9 effector complex as follows: a guide RNA and a nuclease in recombinant form. Determination of the guide RNA sequence enables the synthesis of crRNA and tracrRNA molecules in vitro. Synthesis was performed using the NEB HiScribe T7 RNA Synthesis Kit. The double-stranded DNA library is a fragment of 374 base pairs (bp) containing a pre-spacer sequence of seven nucleotides (5'-NNNNNNN-3') flanked by randomization from the 3' end: 5'-

[0052] cccggggtaccacggagagatggtggaaatcatctttctcgtgggcatccttgatggccacctcgtcggaagtgcccacgaggatgacagcaatgccaatgctgggggggctcttctgagaacgagctctgctgcctgacacggccaggacggccaacaccaaccagaacttgggagaacagcactc cgctctgggcttcatcttcaactcgtcgactccctgcaaacacaaagaaagagcatgttaaaaataggatctacatcacgtaacctgtcttagaagaggctagatactgcaattcaaggaccttatctcctttcattgagcacNNNNNNNaactccatctaccagcctactctcttatctctggtatt -3'

[0053] To cleave this target, a guide RNA of the following sequence was used:

[0054] tracrRNA:

[0055] 5'GCGAAATGAAAAACGUUGUUACAAUAAGAGAUGAAUUUCUCGCAAAGCTCUGCCUCUUGAAAUUUCGGUUUCAAGAGGCAUCUUUUU

[0056] and crRNA: 5'

[0057] uaucuccuuucauugagcacGUUGUAGCUCCCUUUUUCAUUUCGC.

[0058] The crRNA sequence complementary to the protospacer sequence (target DNA sequence) is indicated in bold.

[0059] To produce the recombinant PpCas9 protein, its gene was cloned into the plasmid pET21a. DNA synthesized by Integrated DNA Technologies (IDT) was used as the DNA encoding the gene. The sequence was codon optimized to exclude rare codons found in the genome of Pasteurella pneumophila. Escherichia coli Rosetta cells were transformed with the resulting plasmid рЕТ21a-6xHis-PpCas9.

[0060] 500 μl of the overnight culture was diluted in 500 ml of LB medium, and the cells were grown at 37°C until an optical density of 0.6 Ru was obtained. Synthesis of the target protein was induced by adding IPTG to a concentration of 1 mM, and the cells were then incubated at 20°C for 6 hours. The cells were then centrifuged at 5,000 g for 30 minutes, and the resulting cell pellet was frozen at -20°C.

[0061] The precipitate was thawed on ice for 30 minutes, resuspended in 15 ml lysis buffer (Tris-HCl 50 mM pH 8, 500 mM NaCl, β-mercaptoethanol 1 mM, imidazole 10 mM) supplemented with 15 mg lysozyme, and incubated on ice for another 30 minutes. The cells were then disrupted by ultrasonic treatment for 30 minutes and centrifuged at 16,000 g for 40 minutes. The resulting supernatant was passed through a 0.2 μm filter and applied to a HisTrap HP 1 mL column (GE Healthcare) at 1 ml / min.

[0062] Chromatography was performed using an AKTA FPLC chromatograph (GE Healthcare) at 1 ml / min. The column with the applied protein was washed with 20 ml of lysis buffer supplemented with 30 mM imidazole, after which the protein was washed off with lysis buffer supplemented with 300 mM imidazole.

[0063] The protein fractions obtained during affinity chromatography were then passed through a Superdex 200 10 / 300 GL gel filtration column (24 ml) equilibrated with the following buffer: Tris-HCl 50 mM pH 8, 500 mM NaCl, 1 mM DTT. The fractions corresponding to the monomeric form of the PpCas9 protein were concentrated to 3 mg / ml using an Amicon concentrator (with a 30 kDa filter), after which the purified protein was stored at -80°C in a buffer containing 10% glycerol.

[0064] The in vitro reaction for cutting the linear PAM library was performed in a volume of 20 μl under the following conditions. The reaction mixture consisted of: 1X CutSmart buffer (NEB), 5 mM DTT, 100 nM PAM library, 2 μM trRNA / crRNA, 400 nM PpCas9 protein. As a control, samples without RNA were prepared in a similar manner. The samples were incubated at different temperatures and analyzed by gel electrophoresis in a 2% agarose gel. In the case where the DNA is correctly recognized and specifically cut by the PpCas9 protein, two DNA fragments of approximately 326 and 48 base pairs should be generated (see Figure 2).

[0065] The experimental results showed that PpCas9 has nuclease activity and cuts a portion of the PAM library fragment. Figure 3 ) showed that the protein was active in the temperature range of 35-45°C. The study then used a temperature of 42°C as the working temperature.

[0066] The library cutting reaction was repeated under the selected conditions. The reaction products were applied to a 1.5% agarose gel and subjected to electrophoresis. Uncut DNA fragments of 374 bp in length were extracted from the gel and prepared for high-throughput sequencing using the NEB NextUltra II kit. The samples were sequenced on the lllumina platform and then sequenced using bioinformatics methods: We used the method described in (Maxwell CS et al., A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs. Methods. 2018 July 1; 143: 48-57) to determine the differences in nucleotides appearing at various positions of PAM (NNNNNNN) compared to the control sample. In addition, a PAM marker (logo) was constructed to analyze the results ( Figure 4 ).

[0067] Two methods of data analysis ( Figure 4 ) all indicate the importance of PAM positions 5, 6 and 7. Thus, in vitro analysis allowed the establishment of the following putative PAM sequence for PpCas9: NNNNATT. However, given the inaccurate results obtained by the screening method for determining the PAM, this sequence is only putative.

[0068] In this regard, the importance of the position of each PAM sequence was verified for a more precise determination of the sequence. To this end, we performed in vitro reactions for the cleavage of a DNA fragment containing the DNA target 5′-atctcctttcattgagcac-3′ flanked by the PAM sequence CAACATT (or its derivatives): 5′-cccggggtaccacggagagatggtggaaatcatctttctcgtgggcatccttgatggccacctcgtcggaagtgcccacgaggatgacagcaatgccaatgctgggggggctcttctgagaacgagctctgctgcctgacacggccaggacggccaacaccaaccagaacttgggagaacagcactccgctctgggcttcatcttcaactcgtcgactccctgcaaacacaaagaaagagcatgttaaaataggatctacatcacgtaacctgtcttagaagaggctagatactgcaattcaaggacctt atctcctttcattgagcac CAACATTaactccatcta ccagcctactctcttatctctggtatt- 3'

[0069] All DNA cleavage reactions were performed under the following conditions:

[0070] 1xCutSmart Buffer

[0071] 400 nM PpCas9

[0072] 20 nM DNA

[0073] 2 µM crRNA

[0074] 2 µM tracrRNA

[0075] Incubation time - 30 minutes, reaction temperature - 42°C.

[0076] Substitution of PAM position 1 with all four possible nucleotide variants did not affect the efficiency of protein activity ( Figure 5 ).

[0077] The predicted importance of positions 5 and 6 was experimentally confirmed by single nucleotide substitutions in each of the PAM positions (purines replaced by pyrimidines and vice versa). When substitutions occurred at positions 5 and 6, the protein virtually ceased its activity. The fact that the efficiency of PpCas9 activity was reduced by a factor of 2 when substitutions occurred at position 7 reflects the reduced requirement for a nucleotide at this position ( Figure 6 ). Therefore, according to the in vitro PAM screening results of PpCas9 nuclease, the most likely nucleotide at position 5 of PAM is adenine or guanine, which is experimentally confirmed ( Figure 7 ). The substitution from A to G did not reduce the cleavage efficiency of the fragment.

[0078] According to the results of the in vitro screening, fragments with a "T" or "S" at position 7 should be recognized more efficiently. Additional experiments were performed to explicitly verify the importance of the nucleotide at this position. The results of the in vitro tests showed that replacing the nucleotide "T" at position 7 with A or G reduced the cleavage efficiency by 40-50% ( Figure 8 ). Therefore, PAM position 7 is less conserved compared to positions 5 and 6: the purine at position 7 reduces recognition efficiency but does not prevent the PpCas9 protein from introducing double-strand breaks into the DNA.

[0079] The results are as follows: The PAM recognized by the PpCas9 nuclease corresponds to the following formula 5'-NNNN(A / G)TT-3'. Position 7 is less conserved.

[0080] The following exemplary embodiments of the method are given for the purpose of disclosing the characteristics of the present invention and should not be construed as limiting the scope of the present invention in any way.

[0081] Example 1. Testing the activity of PpCas9 protein in cleavage of various DNA targets.

[0082] To examine the ability of PpCas9 to recognize various DNA sequences flanked by the sequence 5'-NNNN(A / G)TT-3', in vitro cleavage experiments on a DNA target from the human grin2b gene sequence were performed (see Table 2).

[0083] Table 2. DNA targets from the human GRIN2B gene.

[0084]

[0085] According to the PAM consensus sequence 5'-NNNN(A / G)TT-3', PCR fragments of the grin2b gene carrying recognition sites (Table 2) likely to be recognized by PpCas9 were used as targets in the cleavage reaction. CrRNAs that guide PpCas9 to these sites were synthesized to recognize these sequences.

[0086] The cleavage reaction was performed under conditions selected for PpCas9; the results are shown in Fig. 9 middle. Fig. 9 The PpCas9 enzyme was shown to successfully cleave three of the four targets with appropriate PAMs.

[0087] The target in lane 6 has the PAM sequence CAGCATT, which should be efficiently recognized by this protein according to predictions based on the results of the depletion analysis. However, recognition of this fragment did not occur in this experiment.

[0088] Therefore, the PAM CAGCATT was additionally validated on another protospacer target constrained by the same PAM ( Fig.10 ). In this case, the PAM is effectively recognized, which results in the cleavage of the DNA. Therefore, this protein has some further preference for the DNA target sequence. This preference is likely related to the secondary structure of the DNA.

[0089] Our studies thus showed the presence of nuclease activity in PpCas9 and also allowed the determination of its PAM sequence and verification of the sequence of the guide RNA.

[0090] The PpCas9 ribonucleoprotein complex specifically introduces breaks from the 5' end of the protospacer sequence in a target constrained by the PAM 5'-NNNN(A / G)TT -3'. A schematic diagram of the PpCas9 / RNA complex is shown in Fig.11 middle.

[0091] Example 2. Use of hybrid guide RNA for cleavage of DNA targets.

[0092] sgRNA is a form of guide RNA that is a fusion of tracrRNA (tracer RNA) and crRNA. To select the best sgRNA, we constructed three variants of this sequence that differed in the length of the tracrRNA-crRNA duplex. RNA was synthesized in vitro and experiments involving it were performed on cleavage of DNA targets ( Fig.12 ).

[0093] The following RNA sequence was used as hybrid RNA:

[0094] 1 - sgRNA1 25DR: UAUCUCCUUUCAUUGAGCACGUUGUAGCUCCCUUUUUCAUUUCGCGAAAGCGAAAUGAAAAACGUUGUUACAAUAAGAGAUGAAUUUCUCGCAAAGCTCTGCCUCUUGAAAUUUCGGUUUCAAGAGGCAUCUUUUU

[0095] 2 - sgRNA2 36DR

[0096] The bold indicates the 20 nucleotide sequence that provides pairing with the DNA target (the variable part of the sgRNA). In addition, this experiment used a control sample without RNA and a positive control, which was target cleavage using crRNA+trRNA.

[0097] Contains recognition sites 5' tatctcctttcattgagcac 3' and the corresponding consensus sequence PAM The sequence of CAACATT is used as the DNA target: 5'-cccggggtaccacggagagatggtggaaatcatctttctcgtgggcatccttgatggccacctcgtcggaagtgccca cgaggatgacagcaatgccaatgctgggggggctcttctgagaacgagctctgctgcctgacacggccaggacggccaacaccaaccagaacttggggag aacagcactccgctctgggcttcatcttcaactcgtcgactccctgcaaacacaaagaaagagcatgttaaaaataggatctacatcacgtaacctgtcttagaagaggctagatactgcaattcaaggaccttatctcctttcattgagcacCAACATTcaactccatctaccagcctactctctttatctctggtatt – 3'

[0098] Bold indicates recognition site, capital letters represent PAM.

[0099] The reaction was performed under the following conditions: the concentration of the DNA sequence containing the PAM (CAACATT) was 20 nM, the protein concentration was 400 nM, and the RNA concentration was 2 μM; the incubation time was 30 min and the incubation temperature was 37°C.

[0100] The selected sgRNA1 and sgRNA2 were found to be as effective as the natural tracrRNA and crRNA sequences: cleavage occurred in more than 80% of the DNA targets ( Fig.12 ).

[0101] After modification of the sequence that directly pairs with the DNA target, these hybrid RNA variants can be used to cleave any other target DNA.

[0102] Example 3. Cas9 proteins from closely related organisms belonging to Pasteurella pneumophila.

[0103] To date, no CRISPR-Cas9 enzyme has been characterized in Pasteurella pneumophila. The comparable Cas9 protein from Staphylococcus aureus is 28% identical to PpCas9 in terms of size (( Fig.13 , the degree of identity was calculated using BLASTp software with default parameters). Similar degrees of identity exist in other known Cas9 proteins (not shown).

[0104] Therefore, the PpCas9 protein differs significantly in its amino acid sequence from other Cas9 proteins studied to date.

[0105] Those skilled in the art of genetic engineering will appreciate that the PpCas9 protein sequence variants obtained and characterized by the applicant in this specification can be modified without changing the function of the protein itself (e.g., by directed mutagenesis of amino acid residues that do not directly affect functional activity) (Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp. 15.3-15.108)). In particular, the skilled person will recognize that non-conservative amino acid residues can be modified without affecting the residues responsible for protein functionality (determining protein function or structure). Examples of such modifications include replacing non-conservative amino acid residues with homologous amino acid residues. Some regions containing non-conservative amino acid residues are shown in Fig.12In some embodiments of the invention, it is possible to use a protein comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and differs from SEQ ID NO: 1 only in non-conserved amino acid residues to form a double-stranded break in a DNA molecule located immediately before the nucleotide sequence 5'-NNNN(A / G)TT-3' in the DNA molecule. Homologous proteins can be obtained by mutagenesis (e.g., site-directed or PCR-mediated mutagenesis) of the corresponding nucleic acid molecule, followed by testing the encoded modified Cas9 protein for preservation of its function according to the functional assays described herein.

[0106] Example 4. Using PpCas9 to modify genomic DNA of human cells.

[0107] In order to modify the genomic DNA of human cells, the PpCas9 nuclease gene is cloned into a eukaryotic plasmid vector under the control of a CMV promoter. The sequence encoding the nuclear localization signal is added to the 5' and 3' ends of the PpCas9 gene, and the nuclear localization signal ensures that the nuclease is delivered to the nucleus. The sgRNA sequence is cloned into a vector under the control of a U6 promoter. In order to test the activity of the system, an sgRNA with a sequence complementary to a target DNA of 20 and 24 nucleotides in length is used. Similar plasmids with a genomic DNA modification system based on SpCas9 known in the prior art are used as positive controls. In order to evaluate the effectiveness of transfection, the plasmid is further provided with a GFP (green fluorescent protein) gene. The following regions of human genomic DNA are used as DNA targets (Table 3).

[0108] Table 3. DNA targets of human EMX1 and GRIN2B genes.

[0109] Nuclease Site name Target sequence PAM PpCas9 EMX1.1 sg20 GCCCTTCCTCCTCCAGCTTC GTT PpCas9 EMX1.1 sg24 ТСAGGCCCTТССТССТССAGCTТС GTT FpCas9 EMX1.2 sg20 GGAGGTGACATCGATGTCCT ATT FpCas9 EMX1.2 sg24 CATTGGAGGTGACATCGATGTCCT ATT PpCas9 GRIN2B1.1sg20 CAGCTGAAGTAATGTTAGAG ATT PpCas9 GRIN2B1.1 sg24 TTAGCAGCTGAAGTAATGTTAGAG ATT PpCas9 GRIN2B1.2sg20 AATAAGAAAAACATTATTAT ATT PpCas9 GRIN2B1.2 sg24 ATAAAATAAGAAAAACATTATTAT ATT SpCas9 EMX1 sg20 GAGTCCGAGCAGAAGAAGAA GGG SpCas9 GRIN2B sg20 ACCTTTTATTGCCTTGTTCA AGG

[0110] EMX1.1 and EMX1.2 are two different modification sites in the EMX1 gene; similarly, GRIN2B1.1 and GRIN2B1.2 are two different modification sites in the GRIN2B gene.

[0111] The 3′ end of the DNA target is flanked by the PAM sequence of PpCas9 5′-NNNNRTT -3′ or SpCas9 5′-NGG -3′.

[0112] For the effective activity of PpCas9 nuclease in eukaryotic cells, it is necessary to import the protein into the nucleus of eukaryotic cells. This can be accomplished by using a nuclear localization signal from the SV40 T antigen (Lanford et al., Cell, 1986, 46: 575–582), which is connected to the PpCas9 sequence via the spacer sequence described in Shen B et al. "Generation of gene-modified mice viaCas9 / RNA-mediated gene targeting", Cell Res. 2013 May; 23(5): 720-3 or without the spacer sequence.

[0113] In the given example, the complete amino acid sequence of the nuclease transported inside the nucleus of a human cell is the following sequence:

[0114]

[0115] The plasmid used in this experiment has the following sequence:

[0116]

[0117] The following parts are distinguished in the plasmid sequence: U6 promoter (first region, uppercase letters), sequence complementary to the pre-spacer sequence ("XXX-XXX"), conserved part of sgRNA (third region, uppercase letters), PpCas9 gene (highlighted in bold), GFP gene (last region, uppercase letters).

[0118] Using Lipofectamine 2000 reagent, plasmids with PpCas9 or SpCas9 are transfected into human HEK293T cell cultures. Cells are lysed 72 hours after transfection, and the resulting lysate is subjected to PCR to generate regions of target modification sites including genomic DNA. The resulting PCR fragments are subjected to in vitro reaction with T7 endonuclease I to determine the insertion and deletion frequencies in the target sites of genomic DNA. The reaction products are applied to agarose gels and subjected to electrophoresis. Fig.14 A shows that PpCas9 actively introduces modifications to the EMX1 and GRIN2b genes with an efficiency similar to that of the SpCas9 nuclease described in the prior art.

[0119] This experiment showed that, in order to efficiently modify genomic DNA, PpCas9 requires an extended sgRNA compared to SpCas9: in the given example, the efficiency of genetic modification was higher when using an sgRNA with a sequence complementary to a DNA target of 24 nucleotides in length (compared to a length of 20 nucleotides).

[0120] High-throughput sequencing confirmed the modifications introduced in the target DNA sites. Fig.14 B shows examples of detectable modifications to the nucleotide sequence of the EMX1 gene.

[0121] Delivery in the form of ribonucleic acid complexes can also be used to deliver NLS_PpCas9_NLS to human cells. It is carried out by incubating the recombinant form of PpCas9 NLS with guide RNA in CutSmart buffer (NEB). The recombinant protein is produced by bacterial production cells by purifying the recombinant protein via affinity chromatography (NiNTA, Qiagen) and size exclusion (Superdex 200).

[0122] Protein was mixed with RNA at a ratio of 1:2 (PpCas9 NLS: sgRNA), and the mixture was incubated at room temperature for 10 minutes before transfection into cells.

[0123] Next, DNA extracted therefrom is analyzed for insertion / deletion at the target DNA site (as described above).

[0124] The PpCas9 nuclease from the bacterium Pasteurella pneumophila characterized in the present invention can be delivered to cells of various origins for modification of DNA using standard approaches and methods known to the skilled person. PpCas9 has many advantages over previously characterized Cas9 proteins.

[0125] PpCas9 has a short two-letter PAM that is different from other known Cas nucleases and is required for the system to function. The present invention has shown that the presence of a short PAM (RTT) located 4 nucleotides away from the pre-spacer sequence is sufficient for PpCas9 to function successfully in vivo.

[0126] Many of the small-sized Cas nucleases known to date that are capable of introducing double-strand breaks into DNA have complex multi-letter PAM sequences, limiting the choice of sequences suitable for cleavage. Of the Cas nucleases that recognize short PAMs studied to date, only PpCas9 is able to recognize sequences flanked by RTT motifs.

[0127] The second advantage of PpCas9 is the small size of the protein (1055 aar). So far, it is the only small protein with a three-letter RTT РАМ sequence studied.

[0128] PpCas9 is a novel, small-sized Cas nuclease with a short, easy-to-use PAM that is different from the PAM sequences of other nucleases currently known. The PpCas9 protein cleaves various DNA targets with high efficiency at 37°C, including genomic DNA in human cells, and may become the basis for new genome editing tools.

[0129] Although the present invention has been described with reference to the disclosed embodiments, it will be appreciated by those skilled in the art that the specific embodiments described in detail are provided for the purpose of illustrating the present invention and should not be interpreted as limiting the scope of the present invention in any way. It should be understood that various modifications can be made without departing from the spirit of the present invention.

[0130] Sequence Listing

[0131] <110> Autonomous non-profit educational organization of the Skolkovo Institute of Higher Education

[0132] <120> Use of the CAS9 protein from the bacterium Pasteurella pneumophila

[0133] <130> 424316

[0134] <150> RU 2019136164

[0135] <151> 2019-11-11

[0136] <160> 2

[0137] <210> 1

[0138] <211> 1055

[0139] <212> PRT

[0140] <213> Pasteurella multocida

[0141] <220>

[0142] <223> A protein homologous to Cas9

[0143] <400> 1

[0144] Met Gln Asn Asn Pro Leu Asn Tyr Ile Leu Gly Leu Asp Leu Gly Ile 1 5 10 15

[0146] Ala Ser Ile Gly Trp Ala Val Val Glu Ile Asp Glu Glu Ser Ser Pro 20 25 30

[0148] Ile Arg Leu Ile Asp Val Gly Val Arg Thr Phe Glu Arg Ala Glu Val 35 40 45

[0150] Ala Lys Thr Gly Glu Ser Leu Ala Leu Ser Arg Arg Leu Ala Arg Ser 50 55 60

[0152] Ser Arg Arg Leu Ile Lys Arg Arg Ala Glu Arg Leu Lys Lys Ala Lys 65 70 75 80

[0154] Arg Leu Leu Lys Ala Glu Lys Ile Leu His Ser Ile Asp Glu Lys Leu 85 90 95

[0156] Pro Ile Asn Val Trp Gln Leu Arg Val Lys Gly Leu Lys Glu Lys Leu 100 105 110

[0158] Glu Arg Gln Glu Trp Ala Ala Val Leu Leu His Leu Ser Lys His Arg 115 120 125

[0160] Gly Tyr Leu Ser Gln Arg Lys Asn Glu Gly Lys Ser Asp Asn Lys Glu 130 135 140

[0162] Leu Gly Ala Leu Leu Ser Gly Ile Ala Ser Asn His Gln Met Leu Gln 145 150 155 160

[0164] Ser Ser Glu Tyr Arg Thr Pro Ala Glu Ile Ala Val Lys Lys Phe Gln 165 170 175

[0166] Val Glu Glu Gly His Ile Arg Asn Gln Arg Gly Ser Tyr Thr His Thr 180 185 190

[0168] Phe Ser Arg Leu Asp Leu Leu Ala Glu Met Glu Leu Leu Phe Gln Arg 195 200 205

[0170] Gln Ala Glu Leu Gly Asn Ser Tyr Thr Ser Thr Thr Leu Leu Glu Asn 210 215 220

[0172] Leu Thr Ala Leu Leu Met Trp Gln Lys Pro Ala Leu Ala Gly Asp Ala 225 230 235 240

[0174] Ile Leu Lys Met Leu Gly Lys Cys Thr Phe Glu Pro Ser Glu Tyr Lys 245 250 255

[0176] Ala Ala Lys Asn Ser Tyr Ser Ala Glu Arg Phe Val Trp Leu Thr Lys 260 265 270

[0178] Leu Asn Asn Leu Arg Ile Leu Glu Asn Gly Thr Glu Arg Ala Leu Asn 275 280 285

[0180] Asp Asn Glu Arg Phe Ala Leu Leu Glu Gln Pro Tyr Glu Lys Ser Lys 290 295 300

[0182] Leu Thr Tyr Ala Gln Val Arg Ala Met Leu Ala Leu Ser Asp Asn Ala 305 310 315 320

[0184] Ile Phe Lys Gly Val Arg Tyr Leu Gly Glu Asp Lys Lys Thr Val Glu 325 330 335

[0186] Ser Lys Thr Thr Leu Ile Glu Met Lys Phe Tyr His Gln Ile Arg Lys 340 345 350

[0188] Thr Leu Gly Ser Ala Glu Leu Lys Lys Glu Trp Asn Glu Leu Lys Gly 355 360 365

[0190] Asn Ser Asp Leu Leu Asp Glu Ile Gly Thr Ala Phe Ser Leu Tyr Lys 370 375 380

[0192] Thr Asp Asp Asp Ile Cys Arg Tyr Leu Glu Gly Lys Leu Pro Glu Arg 385 390 395 400

[0194] Val Leu Asn Ala Leu Leu Glu Asn Leu Asn Phe Asp Lys Phe Ile Gln 405 410 415

[0196] Leu Ser Leu Lys Ala Leu His Gln Ile Leu Pro Leu Met Leu Gln Gly 420 425 430

[0198] Gln Arg Tyr Asp Glu Ala Val Ser Ala Ile Tyr Gly Asp His Tyr Gly 435 440 445

[0200] Lys Lys Ser Thr Glu Thr Thr Arg Leu Leu Pro Thr Ile Pro Ala Asp 450 455 460

[0202] Glu Ile Arg Asn Pro Val Val Leu Arg Thr Leu Thr Gln Ala Arg Lys 465 470 475 480

[0204] Val Ile Asn Ala Val Val Arg Leu Tyr Gly Ser Pro Ala Arg Ile His 485 490 495

[0206] Ile Glu Thr Ala Arg Glu Val Gly Lys Ser Tyr Gln Asp Arg Lys Lys 500 505 510

[0208] Leu Glu Lys Gln Gln Glu Asp Asn Arg Lys Gln Arg Glu Ser Ala Val 515 520 525

[0210] Lys Lys Phe Lys Glu Met Phe Pro His Phe Val Gly Glu Pro Lys Gly 530 535 540

[0212] Lys Asp Ile Leu Lys Met Arg Leu Tyr Glu Leu Gln Gln Ala Lys Cys 545 550 555 560

[0214] Leu Tyr Ser Gly Lys Ser Leu Glu Leu His Arg Leu Leu Glu Lys Gly 565 570 575

[0216] Tyr Val Glu Val Asp His Ala Leu Pro Phe Ser Arg Thr Trp Asp Asp 580 585 590

[0218] Ser Phe Asn Asn Lys Val Leu Val Leu Ala Asn Glu Asn Gln Asn Lys 595 600 605

[0220] Gly Asn Leu Thr Pro Tyr Glu Trp Leu Asp Gly Lys Asn Asn Ser Glu 610 615 620

[0222] Arg Trp Gln His Phe Val Val Arg Val Gln Thr Ser Gly Phe Ser Tyr 625 630 635 640

[0224] Ala Lys Lys Gln Arg Ile Leu Asn His Lys Leu Asp Glu Lys Gly Phe 645 650 655

[0226] Ile Glu Arg Asn Leu Asn Asp Thr Arg Tyr Val Ala Arg Phe Leu Cys 660 665 670

[0228] Asn Phe Ile Ala Asp Asn Met Leu Leu Val Gly Lys Gly Lys Arg Asn 675 680 685

[0230] Val Phe Ala Ser Asn Gly Gln Ile Thr Ala Leu Leu Arg His Arg Trp 690 695 700

[0232] Gly Leu Gln Lys Val Arg Glu Gln Asn Asp Arg His His Ala Leu Asp 705 710 715 720

[0234] Ala Val Val Val Ala Cys Ser Thr Val Ala Met Gln Gln Lys Ile Thr 725 730 735

[0236] Arg Phe Val Arg Tyr Asn Glu Gly Asn Val Phe Ser Gly Glu Arg Ile 740 745 750

[0238] Asp Arg Glu Thr Gly Glu Ile Ile Pro Leu His Phe Pro Ser Pro Trp 755 760 765

[0240] Ala Phe Phe Lys Glu Asn Val Glu Ile Arg Ile Phe Ser Glu Asn Pro 770 775 780

[0242] Lys Leu Glu Leu Glu Asn Arg Leu Pro Asp Tyr Pro Gln Tyr Asn His 785 790 795 800

[0244] Glu Trp Val Gln Pro Leu Phe Val Ser Arg Met Pro Thr Arg Lys Met 805 810 815

[0246] Thr Gly Gln Gly His Met Glu Thr Val Lys Ser Ala Lys Arg Leu Asn 820 825 830

[0248] Glu Gly Leu Ser Val Leu Lys Val Pro Leu Thr Gln Leu Lys Leu Ser 835 840 845

[0250] Asp Leu Glu Arg Met Val Asn Arg Asp Arg Glu Ile Ala Leu Tyr Glu 850 855 860

[0252] Ser Leu Lys Ala Arg Leu Glu Gln Phe Gly Asn Asp Pro Ala Lys Ala 865 870 875 880

[0254] Phe Ala Glu Pro Phe Tyr Lys Lys Gly Gly Ala Leu Val Lys Ala Val 885 890 895

[0256] Arg Leu Glu Gln Thr Gln Lys Ser Gly Val Leu Val Arg Asp Gly Asn 900 905 910

[0258] Gly Val Ala Asp Asn Ala Ser Met Val Arg Val Asp Val Phe Thr Lys 915 920 925

[0260] Gly Gly Lys Tyr Phe Leu Val Pro Ile Tyr Thr Trp Gln Val Ala Lys 930 935 940

[0262] Gly Ile Leu Pro Asn Arg Ala Ala Thr Gln Gly Lys Asp Glu Asn Asp 945 950 955 960

[0264] Trp Asp Ile Met Asp Glu Met Ala Thr Phe Gln Phe Ser Leu Cys Gln 965 970 975

[0266] Asn Asp Leu Ile Lys Leu Val Thr Lys Lys Lys Thr Ile Phe Gly Tyr 980 985 990

[0268] Phe Asn Gly Leu Asn Arg Ala Thr Ser Asn Ile Asn Ile Lys Glu His 995 1000 1005

[0270] Asp Leu Asp Lys Ser Lys Gly Lys Leu Gly Ile Tyr Leu Glu Val Gly 1010 1015 1020

[0272] Val Lys Leu Ala Ile Ser Leu Glu Lys Tyr Gln Val Asp Glu Leu Gly 1025 1030 1035 1040

[0274] Lys Asn Ile Arg Pro Cys Arg Pro Thr Lys Arg Gln His Val Arg 1045 1050 1055

[0276] <210> 2

[0277] <211> 3168

[0278] <212> DNA

[0279] <213>Pasteurella pneumotropica

[0280] <220>

[0281] <223>Protein homologous to Cas9

[0282] <400> 2

[0283] atgcaaaata atccattaaa ttacatttta gggttagatt taggcattgc ttctattggt 60

[0284] tgggcggttg tggaaattga tgaggagagt tcacctattc gcttaattga tgtgggcgtc 120

[0285] cgtacatttg aacgggctga agtcgctaaa accggcgaaa gtttagcatt gtctcgtcgt 180

[0286] ttagctcgtt catcacggcg attaattaaa cgccgagcag agcgattaaa aaaagcaaaa 240

[0287] cgtttattaa aagcagaaaa gattttacat tctattgatg aaaaattacc cattaatgtt 300

[0288] tggcagcttc gagtaaaagg attgaaggaa aaactcgaac gtcaggagtg ggcagcggtt 360

[0289] ttattacatt tgtcaaagca tcgtggctat ttatcacaac gtaaaaatga gggtaaaagt 420

[0290] gataataaag agctgggggc attactttca ggtatcgcaa gtaaccacca aatgttgcaa 480

[0291] tcctccgaat atcgtacccc tgcagaaatt gcagtcaaaa aatttcaagt agaagaagga 540

[0292] catattcgta atcaacgtgg atcttatacc cataccttta gccgtttgga tttgttggca 600

[0293] gaaatggaat tattattca acgccaagct gagttaggca attcttacac gtccaccaca 660

[0294] ttattagaaa atttgacggc gttactaatg tggcaaaagc cagctcttgc gggtgatgcg 720

[0295] atttaaaaa tgttgggcaa gtgtaccttc gaacccagcg aatataaagc cgcaaaaaat 780

[0296] agttattctg ctgaacgttt tgtgtggtta accaagctga ataatttacg cattttagaa 840

[0297] aatggcacgg aaagagcttt aaatgacaat gaacgttttg ctttgcttga gcaaccgtat 900

[0298] gagaaatcaa aattaactta tgctcaagtg agagcaatgc ttgcgttatc tgataatgct 960

[0299] atttcaaag gggttcgtta tttaggcgaa gataaaaaaa cagtagagag caaaactacg 1020

[0300] ttgatagaaa tgaagtttta tcatcaaatc cgcaaaacat taggcagtgc agaattaaaa 1080

[0301] aaggaatgga atgagttaaa aggcaattcc gatttattag atgagattgg cacggcattt 1140

[0302] tcgttgtata aaacggatga tgatatttgc cgttatttag agggaaaact accagaaagg 1200

[0303] gtattaaatg cgttattgga aaatttaaat ttcgataaat ttattcaact ttcacttaaa 1260

[0304] gccttacacc aaattttacc attgatgctg caagggcaac gttatgatga ggcggtttct 1320

[0305] gcgattttatg gtgatcatta tggtaaaaaa tcgacagaaa caacccgctt gttgccgact 1380

[0306] attcctgccg atgaaatccg aaatcctgtg gtattacgca ccctgaccca agcccgtaaa 1440

[0307] gtgatcaatg cggtggtgcg gttatatggt tcgcctgccc gtattcatat tgaaacagcg 1500

[0308] 1560

[0309] cgtaagcaac gtgaaagtgc ggtcaaaaaa tttaaagaaa tgtttccgca ttttgtgggg 1620

[0310] gagccgaaag gtaaaagatat tttaaaaatg cgattgtatg agttacaaca agcgaaatgt 1680

[0311] ttatattctg gaaaatcttt agaacttcat cgtttgcttg agaaggggta tgtagaagtg 1740

[0312] gatcacgctt tgccattttc tcgcacgtgg gatgatagct ttaataataa agtactggtg 1800

[0313] cttgccaacg agaaccaaaa taaaggcaat ttaacgcctt atgaatggtt agatggtaaa 1860

[0314] aataacagtg agcgttggca acattttgtt gtacgagtac aaaccagcgg tttctcttat 1920

[0315] gctaaaaaac aacgcatttt gaaccataaa ttggatgaaa aagggtttat cgaacgtaat 1980

[0316] ttaaacgata ctcgctatgt agctcgtttc ttatgtaact ttattgccga tatatgttg 2040

[0317] ttggttggta aaggcaagcg aaacgtgttt gcttcaaacg ggcaaatcac ggcgttattg 2100

[0318] cggcatcgtt gggcttaca aaaagtgcgt gaacagaatg atcgccacca cgcactggac 2160

[0319] gcggttgtgg tggcttgctc tactgtggca atgcaacaaa aaatcactcg atttgtgaga 2220

[0320] tataacgaag gaaatgtctt tagcggtgaa cgtatcgatc gtgaaactgg cgagattatt 2280

[0321] ccattacatt ttccaagccc ttgggcttt ttcaaagaga atgtggaaat tcgcattttt 2340

[0322] agtgaaaatc caaaattgga attagaaaat cgcctgcctg attatccgca atataatcac 2400

[0323] gaatgggtgc aaccattgtt tgtttcgaga atgccaaccc gaaaaatgac agggcaaggg 2460

[0324] catatggaaa cggtaaaatc cgcaaaacga ttaaatgaag gtttaagtgt gttaaaagtc 2520

[0325] cctttaacac aacttaaatt gagtgattta gaacgaatgg ttaatcgtga tcgtgaaatt 2580

[0326] gcattgtatg aatccttaaa agcacgttta gagcaatttg gtaacgaccc agccaaagcc 2640

[0327] tttgccgaac cattctataa aaagggtggg gcattagtca aagcagtccg attggaacaa 2700

[0328] acacaaaaaat cgggggtatt agtacgtgat ggtaacggtg ttgcggataa tgcttcaatg 2760

[0329] gtacgggttg atgtttttac taaaggtgga aaatatttct tagtgccgat ttatacttgg 2820

[0330] caggtagcga aagggatttt accgaatagg gctgcgacac aaggtaaaga tgaaaatgat 2880

[0331] tgggatatta tggatgaaat ggctactttc caattttctc tatgtcaaaa tgatctaatt 2940

[0332] aaattagtta ccaaaaagaa aacaatcttt ggatatttta atggattaaa tagagctact 3000

[0333] agcaatataa atattaaaga gcatgatcta gataagtcta aagggaaatt aggtatttac 3060

[0334] ttagaagttg gtgtaaaact agctatttcc cttgaaaagt accaagtcga cgaactcggc 3120

[0335] aaaaatatcc gtccttgtcg tccgactaaa cgacagcacg tgcgttaa 3168 Sequence Listing <110> JSC BIOCAD <120> Use of the CAS9 protein from the bacterium Pasteurella pneumophila <150> RU 2019136164 <151> 2019-11-11 <160> 2 <210> 1 <211> 1055 <212> PRT <213> Pasteurella pneumophila <220> <223> Proteins homologous to Cas9 <400> 1 Met Gln Asn Asn Pro Leu Asn Tyr Ile Leu Gly Leu Asp Leu Gly Ile 1 5 10 15 Ala Ser Ile Gly Trp Ala Val Val Glu Ile Asp Glu Glu Ser Ser Pro 20 25 30 Ile Arg Leu Ile Asp Val Gly Val Arg Thr Phe Glu Arg Ala Glu Val 35 40 45 Ala Lys Thr Gly Glu Ser Leu Ala Leu Ser Arg Arg Leu Ala Arg Ser 50 55 60 Ser Arg Arg Leu Ile Lys Arg Arg Ala Glu Arg Leu Lys Lys Ala Lys 65 70 75 80 Arg Leu Leu Lys Ala Glu Lys Ile Leu His Ser Ile Asp Glu Lys Leu 85 90 95 Pro Ile Asn Val Trp Gln Leu Arg Val Lys Gly Leu Lys Glu Lys Leu 100 105 110 Glu Arg Gln Glu Trp Ala Ala Val Leu Leu His Leu Ser Lys His Arg 115 120 125 Gly Tyr Leu Ser Gln Arg Lys Asn Glu Gly Lys Ser Asp Asn Lys Glu 130 135 140 Leu Gly Ala Leu Leu Ser Gly Ile Ala Ser Asn His Gln Met Leu Gln 145 150 155 160 Ser Ser Glu Tyr Arg Thr Pro Ala Glu Ile Ala Val Lys Lys Phe Gln 165 170 175 Val Glu Glu Gly His Ile Arg Asn Gln Arg Gly Ser Tyr Thr His Thr 180 185 190 Phe Ser Arg Leu Asp Leu Leu Ala Glu Met Glu Leu Leu Phe Gln Arg 195 200 205 Gln Ala Glu Leu Gly Asn Ser Tyr Thr Ser Thr Thr Leu Leu Glu Asn 210 215 220 Leu Thr Ala Leu Leu Met Trp Gln Lys Pro Ala Leu Ala Gly Asp Ala 225 230 235 240 Ile Leu Lys Met Leu Gly Lys Cys Thr Phe Glu Pro Ser Glu Tyr Lys 245 250 255 Ala Ala Lys Asn Ser Tyr Ser Ala Glu Arg Phe Val Trp Leu Thr Lys 260 265 270 Leu Asn Asn Leu Arg Ile Leu Glu Asn Gly Thr Glu Arg Ala Leu Asn 275 280 285 Asp Asn Glu Arg Phe Ala Leu Leu Glu Gln Pro Tyr Glu Lys Ser Lys 290 295 300 Leu Thr Tyr Ala Gln Val Arg Ala Met Leu Ala Leu Ser Asp Asn Ala 305 310 315 320 Ile Phe Lys Gly Val Arg Tyr Leu Gly Glu Asp Lys Lys Thr Val Glu 325 330 335 Ser Lys Thr Thr Leu Ile Glu Met Lys Phe Tyr His Gln Ile Arg Lys 340 345 350 Thr Leu Gly Ser Ala Glu Leu Lys Lys Glu Trp Asn Glu Leu Lys Gly 355 360 365 Asn Ser Asp Leu Leu Asp Glu Ile Gly Thr Ala Phe Ser Leu Tyr Lys 370 375 380 Thr Asp Asp Asp Ile Cys Arg Tyr Leu Glu Gly Lys Leu Pro Glu Arg 385 390 395 400 Val Leu Asn Ala Leu Leu Glu Asn Leu Asn Phe Asp Lys Phe Ile Gln 405 410 415 Leu Ser Leu Lys Ala Leu His Gln Ile Leu Pro Leu Met Leu Gln Gly 420 425 430 Gln Arg Tyr Asp Glu Ala Val Ser Ala Ile Tyr Gly Asp His Tyr Gly 435 440 445 Lys Lys Ser Thr Glu Thr Thr Arg Leu Leu Pro Thr Ile Pro Ala Asp 450 455 460 Glu Ile Arg Asn Pro Val Val Leu Arg Thr Leu Thr Gln Ala Arg Lys 465 470 475 480 Val Ile Asn Ala Val Val Arg Leu Tyr Gly Ser Pro Ala Arg Ile His 485 490 495 Ile Glu Thr Ala Arg Glu Val Gly Lys Ser Tyr Gln Asp Arg Lys Lys 500 505 510 Leu Glu Lys Gln Gln Glu Asp Asn Arg Lys Gln Arg Glu Ser Ala Val 515 520 525 Lys Lys Phe Lys Glu Met Phe Pro His Phe Val Gly Glu Pro Lys Gly 530 535 540 Lys Asp Ile Leu Lys Met Arg Leu Tyr Glu Leu Gln Gln Ala Lys Cys 545 550 555 560 Leu Tyr Ser Gly Lys Ser Leu Glu Leu His Arg Leu Leu Glu Lys Gly 565 570 575 Tyr Val Glu Val Asp His Ala Leu Pro Phe Ser Arg Thr Trp Asp Asp 580 585 590 Ser Phe Asn Asn Lys Val Leu Val Leu Ala Asn Glu Asn Gln Asn Lys 595 600 605 Gly Asn Leu Thr Pro Tyr Glu Trp Leu Asp Gly Lys Asn Asn Ser Glu 610 615 620 Arg Trp Gln His Phe Val Val Arg Val Gln Thr Ser Gly Phe Ser Tyr 625 630 635 640 Ala Lys Lys Gln Arg Ile Leu Asn His Lys Leu Asp Glu Lys Gly Phe 645 650 655 Ile Glu Arg Asn Leu Asn Asp Thr Arg Tyr Val Ala Arg Phe Leu Cys 660 665 670 Asn Phe Ile Ala Asp Asn Met Leu Leu Val Gly Lys Gly Lys Arg Asn 675 680 685 Val Phe Ala Ser Asn Gly Gln Ile Thr Ala Leu Leu Arg His Arg Trp 690 695 700 Gly Leu Gln Lys Val Arg Glu Gln Asn Asp Arg His His Ala Leu Asp 705 710 715 720 Ala Val Val Val Ala Cys Ser Thr Val Ala Met Gln Gln Lys Ile Thr 725 730 735 Arg Phe Val Arg Tyr Asn Glu Gly Asn Val Phe Ser Gly Glu Arg Ile 740 745 750 Asp Arg Glu Thr Gly Glu Ile Ile Pro Leu His Phe Pro Ser Pro Trp 755 760 765 Ala Phe Phe Lys Glu Asn Val Glu Ile Arg Ile Phe Ser Glu Asn Pro 770 775 780 Lys Leu Glu Leu Glu Asn Arg Leu Pro Asp Tyr Pro Gln Tyr Asn His 785 790 795 800 Glu Trp Val Gln Pro Leu Phe Val Ser Arg Met Pro Thr Arg Lys Met 805 810 815 Thr Gly Gln Gly His Met Glu Thr Val Lys Ser Ala Lys Arg Leu Asn 820 825 830 Glu Gly Leu Ser Val Leu Lys Val Pro Leu Thr Gln Leu Lys Leu Ser 835 840 845 Asp Leu Glu Arg Met Val Asn Arg Asp Arg Glu Ile Ala Leu Tyr Glu 850 855 860 Ser Leu Lys Ala Arg Leu Glu Gln Phe Gly Asn Asp Pro Ala Lys Ala 865 870 875 880 Phe Ala Glu Pro Phe Tyr Lys Lys Gly Gly Ala Leu Val Lys Ala Val 885 890 895 Arg Leu Glu Gln Thr Gln Lys Ser Gly Val Leu Val Arg Asp Gly Asn 900 905 910 Gly Val Ala Asp Asn Ala Ser Met Val Arg Val Asp Val Phe Thr Lys 915 920 925 Gly Gly Lys Tyr Phe Leu Val Pro Ile Tyr Thr Trp Gln Val Ala Lys 930 935 940 Gly Ile Leu Pro Asn Arg Ala Ala Thr Gln Gly Lys Asp Glu Asn Asp 945 950 955 960 Trp Asp Ile Met Asp Glu Met Ala Thr Phe Gln Phe Ser Leu Cys Gln 965 970 975 Asn Asp Leu Ile Lys Leu Val Thr Lys Lys Lys Thr Ile Phe Gly Tyr 980 985 990 Phe Asn Gly Leu Asn Arg Ala Thr Ser Asn Ile Asn Ile Lys Glu His 995 1000 1005 Asp Leu Asp Lys Ser Lys Gly Lys Leu Gly Ile Tyr Leu Glu Val Gly 1010 1015 1020 Val Lys Leu Ala Ile Ser Leu Glu Lys Tyr Gln Val Asp Glu Leu Gly 1025 1030 1035 1040 Lys Asn Ile Arg Pro Cys Arg Pro Thr Lys Arg Gln His Val Arg 1045 1050 1055 <210> 2 <211> 3168 <212> DNA <213> Pasteurella multocida <220> <223> Protein homologous to Cas9 <400> 2 atgcaaaata atccattaaa ttacatttta gggttagatt taggcattgc ttctattggt 60 tgggcggttg tggaaattga tgaggagagt tcacctattc gcttaattga tgtgggcgtc 120 cgtacatttg aacgggctga agtcgctaaa accggcgaaa gtttagcatt gtctcgtcgt 180 ttagctcgtt catcacggcg attaattaaa cgccgagcag agcgattaaa aaaagcaaaa 240 cgtttattaa aagcagaaaa gattttacat tctattgatg aaaaattacc cattaatgtt 300 tggcagcttc gagtaaaagg attgaaggaa aaactcgaac gtcaggagtg ggcagcggtt 360 ttattacatt tgtcaaagca tcgtggctat tttcacaac gtaaaaatga gggtaaaagt 420 gataataaag agctgggggc attactttca ggtatcgcaa gtaaccacca aatgttgcaa 480 tcctccgaat atcgtacccc tgcagaaatt gcagtcaaaa aatttcaagt agaagaagga 540 catattcgta atcaacgtgg atcttatacc cataccttta gccgtttgga tttgttggca 600 gaaatggaat tattattca acgccaagct gagttaggca attcttacac gtccaccaca 660 ttattagaaa atttgacggc gttactaatg tggcaaaagc cagctcttgc gggtgatgcg 720 atttaaaaa tgttgggcaa gtgtaccttc gaacccagcg aatataaagc cgcaaaaaat 780 agttattctg ctgaacgttt tgtgtggtta accaagctga ataatttacg cattttagaa 840 aatggcacgg aaagagcttt aaatgacaat gaacgttttg ctttgcttga gcaaccgtat 900 gagaaatcaa aattaactta tgctcaagtg agagcaatgc ttgcgttatc tgataatgct 960 atttcaaag gggttcgtta tttaggcgaa gataaaaaaa cagtagagag caaaactacg 1020 ttgatagaaa tgaagtttta tcatcaaatc cgcaaaacat taggcagtgc agaattaaaa 1080 aaaggaatgga atgagttaaa aggcaattcc gatttattag atgagattgg cacggcattt 1140 tcgttgtata aaacggatga tgatatttgc cgttatttag agggaaaact accagaaagg 1200 gtattaaatg cgttattgga aaatttaaat ttcgataaat ttattcaact ttcacttaaa 1260 gccttacacc aaattttacc attgatgctg caagggcaac gttatgatga ggcggtttct 1320 gcgattttatg gtgatcatta tggtaaaaaa tcgacagaaa caacccgctt gttgccgact 1380 attcctgccg atgaaatccg aaatcctgtg gtattacgca ccctgaccca agcccgtaaa 1440 gtgatcaatg cggtggtgcg gttatatggt tcgcctgccc gtattcatat tgaaacagcg 1500 1560 cgtaagcaac gtgaaagtgc ggtcaaaaaa tttaaagaaa tgtttccgca ttttgtgggg 1620 gagccgaaag gtaaaagatat tttaaaaatg cgattgtatg agttacaaca agcgaaatgt 1680 ttatattctg gaaaatcttt agaacttcat cgtttgcttg agaaggggta tgtagaagtg 1740 gatcacgctt tgccattttc tcgcacgtgg gatgatagct ttaataataa agtactggtg 1800 cttgccaacg agaaccaaaa taaaggcaat ttaacgcctt atgaatggtt agatggtaaa 1860 aataacagtg agcgttggca acattttgtt gtacgagtac aaaccagcgg tttctcttat 1920 gctaaaaaac aacgcatttt gaaccataaa ttggatgaaa aagggtttat cgaacgtaat 1980 ttaaacgata ctcgctatgt agctcgtttc ttatgtaact ttattgccga tatatgttg 2040 ttggttggta aaggcaagcg aaacgtgttt gcttcaaacg ggcaaatcac ggcgttattg 2100 cggcatcgtt gggcttaca aaaagtgcgt gaacagaatg atcgccacca cgcactggac 2160 gcggttgtgg tggcttgctc tactgtggca atgcaacaaa aaatcactcg atttgtgaga 2220 tataacgaag gaaatgtctt tagcggtgaa cgtatcgatc gtgaaactgg cgagattatt 2280 ccattacatt ttccaagccc ttgggcttt ttcaaagaga atgtggaaat tcgcattttt 2340 agtgaaaatc caaaattgga attagaaaat cgcctgcctg attatccgca atataatcac 2400 gaatgggtgc aaccattgtt tgttcgaga atgccaaccc gaaaaatgac agggcaaggg 2460 catatggaaa cggtaaaatc cgcaaaacga ttaaatgaag gtttaagtgt gttaaaagtc 2520 cctttaacac aacttaaatt gagtgattta gaacgaatgg ttaatcgtga tcgtgaaatt 2580 gcattgtatg aatccttaaa agcacgttta gagcaatttg gtaacgaccc agccaaagcc 2640 tttgccgaac cattctataa aaagggtggg gcattagtca aagcagtccg attggaacaa 2700 acacaaaaat cgggggtatt agtacgtgat ggtaacggtg ttgcggataa tgcttcaatg 2760 gtacgggttg atgtttttac taaaggtgga aaatatttct tagtgccgat ttatacttgg 2820 caggtagcga aagggatttt accgaatagg gctgcgacac aaggtaaaga tgaaaatgat 2880 tgggatatta tggatgaaat ggctactttc caattttctc tatgtcaaaa tgatctaatt 2940 aaattagtta ccaaaaagaa aacaatcttt ggatatttta atggattaaa tagagctact 3000 agcaatataa atattaaaga gcatgatcta gataagtcta aagggaaatt aggtatttac 3060 ttagaagttg gtgtaaaact agctatttcc cttgaaaagt accaagtcga cgaactcggc 3120 aaaaattcc gtccttgtcg tccgactaaa cgacagcacg tgcgttaa 3168

Claims

1. A protein for forming a double-strand break located immediately before the nucleotide sequence 5'-NNNN(A / G)TT-3' in a DNA molecule, wherein the protein is as shown in the amino acid sequence of SEQ ID NO: 1, characterized in that The double-strand breaks in the DNA molecules are formed at a temperature of 35°C to 45°C.

2. The use according to claim 1, characterized in that The double-strand breaks in the DNA molecules are formed in the genomic DNA of mammalian cells.

3. The use according to claim 2, characterized in that Double-strand breaks in the DNA molecules result in modifications of the genomic DNA of the mammalian cells.

4. A method for modifying a genomic DNA sequence in a cell of a unicellular or multicellular organism comprising genomic DNA, the method comprising introducing into the cell of the organism an effective amount of: a) a protein as shown in the amino acid sequence of SEQ ID NO: 1, or a nucleic acid encoding the protein as shown in the amino acid sequence of SEQ ID NO: 1, and b) a guide RNA comprising a sequence that forms a duplex with a nucleotide sequence of a genomic DNA region of the organism, or a DNA sequence encoding the guide RNA, the nucleotide sequence being immediately adjacent to the nucleotide sequence 5'-NNNN(A / G)TT-3' and interacting with the protein after duplex formation; The interaction of the protein with the guide RNA and the nucleotide sequence 5'-NNNN(A / G)TT-3' results in the formation of a double-stranded break in the genomic DNA sequence immediately adjacent to the sequence 5'-NNNN(A / G)TT-3'.

5. The method according to claim 4, further comprising introducing an exogenous DNA sequence simultaneously with the guide RNA.

6. The method according to claim 4, characterized in that The cells are mammalian cells.

Images