Rice copper stress response gene OsCORK1 and its encoding protein and its application

By cloning and knocking out the rice copper stress response gene OsCORK1, constructing a recombinant vector and transforming rice, the problem of insufficient rice response mechanism to copper stress was solved, the copper stress resistance of rice was significantly enhanced, rice growth and rice quality were improved, and the risk of heavy metal pollution was reduced.

CN115491381BActive Publication Date: 2025-09-19HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202110678422.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-06-18
Publication Date
2025-09-19
Estimated Expiration
2041-06-18

AI Technical Summary

Technical Problem

In the existing technology, the response mechanism of rice to heavy metal copper stress has not been fully studied, resulting in heavy metal pollution seriously affecting rice growth and development and rice yield, and long-term consumption of contaminated rice is harmful to human health.

Method used

The rice copper stress response gene OsCORK1 was cloned and knocked out, a recombinant vector was constructed and transformed into rice, and the OsCORK1 gene was edited using the CRISPR/Cas9 system to reduce copper stress resistance and enhance rice tolerance to copper.

Benefits of technology

It significantly reduces the amount of copper accumulated in rice, improves the copper tolerance of the plant, and enhances the resistance of rice to copper stress, providing application prospects for rice stress-resistant breeding and reducing agricultural heavy metal pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115491381B_ABST
    Figure CN115491381B_ABST
Patent Text Reader

Abstract

The present invention relates to the rice copper stress response gene OsCORK1 and its encoded protein and application. The present invention constructs a CRISPR / Cas9-OsCORK1 knockout vector and transforms rice using an Agrobacterium-mediated method to obtain an OsCORK1 knockout mutant; and experiments show that after the rice mutant with the OsCORK1 gene knocked out is treated with 10μM CuSO4, the Cu accumulation of the mutant is significantly reduced compared with the wild-type control (P<0.01), which can significantly improve the copper tolerance of the plant; and the aboveground length, root length and fresh weight of the mutant are longer or larger than the wild type (P<0.05), indicating that reducing the expression of the OsCORK1 gene can significantly enhance the resistance of rice to copper stress. The OsCORK1 gene or protein has good application prospects in improving the copper stress resistance of rice or in the breeding of copper stress-resistant rice varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a rice copper stress response gene OsCORK1, an encoded protein and an application thereof. Background Art

[0002] Rice is the world's second-largest staple food crop after corn and my country's largest. Approximately 60% of the population relies on rice as their staple food. However, with the rapid economic and social development and improvements in people's living standards in recent years, heavy metal pollution in agricultural production has become an unavoidable and urgent issue that needs to be addressed. Heavy metal pollution can seriously affect the normal growth and development of plants, leading to reduced rice yields and lower quality. Consuming heavy metal-contaminated rice can lead to the accumulation of heavy metals in the body. Long-term consumption can cause mental and immune system disorders, posing a serious threat to human health and safety.

[0003] Copper is an essential trace element for plant growth and development. It is indispensable for normal plant growth and development and is widely involved in various metabolic reactions in plants. It is of great significance for increasing crop yield and improving crop quality. However, excessive copper accumulation can also severely inhibit normal plant growth and development, especially root growth, and in extreme cases, can cause plant death. Therefore, studying plant responses to heavy metal stress and identifying key genes are crucial for managing heavy metal pollution. Receptor-like kinases (RLKs) are the largest gene family in plants and are widely involved in multiple processes of plant growth and development, such as biotic and abiotic stresses. However, the biological functions of plant RLKs in responding to heavy metal stress signals and regulating heavy metal pollution have not been reported. Summary of the Invention

[0004] The purpose of the present invention is to provide a rice copper stress response gene, OsCORK1 gene.

[0005] The second object of the present invention is to provide a rice copper stress response protein, OsCORK1 protein.

[0006] The third object of the present invention is to provide cloning primers for the above-mentioned OsCORK1 gene.

[0007] The fourth object of the present invention is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium containing the above-mentioned OsCORK1 gene.

[0008] The fifth object of the present invention is to provide applications of the above-mentioned OsCORK1 gene or OsCORK1 protein.

[0009] In order to achieve the above object, the present invention adopts the following technical solutions:

[0010] The rice copper stress response gene is the OsCORK1 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1, or the amino acid sequence of the protein encoded by it is shown in SEQ ID NO: 2.

[0011] The rice copper stress response protein is OsCORK1 protein, and its amino acid sequence is shown in SEQ ID NO: 2.

[0012] The present invention provides a rice copper stress response gene and its encoded protein. The gene is derived from rice and is named OsCORK1 (Copper Related Receptor-Like Kinase 1). The encoded corresponding protein is named OsCORK1. The OsCORK1 gene sequence is 1992 bp in length, and the exon CDS sequence is 1767 bp in length, encoding 588 amino acids.

[0013] The primers for cloning the above-mentioned OsCORK1 gene have nucleotide sequences shown in SEQ ID NOs: 3-4.

[0014] An expression cassette, recombinant vector, recombinant cell or recombinant bacterium containing the OsCORK1 gene according to claim 1.

[0015] When constructing a recombinant expression vector using the OsCORK1 gene provided by the present invention and introducing it into plant cells to obtain improved rice copper stress-responsive plants, any constitutive promoter, enhanced promoter, or inducible promoter can be added before the transcription start nucleotide. To facilitate the identification and screening of transgenic plants or transgenic plant cells, the vector used can be appropriately processed, such as by adding a selectable marker (GUS gene, GFP, YFP, and luciferase gene, etc.) or an antibiotic marker gene with resistance (hygromycin resistance, herbicide resistance, Basta, etc.). For the safety of transgenic plant release, the plant expression vector can also be constructed without carrying any marker gene, and specific PCR molecular marker screening can be performed at the seedling stage. The expression vector containing the OsCORK1 gene of the present invention can be transformed into plant cells or tissues by conventional biological methods such as microinjection, Agrobacterium tumefaciens mediation, or gene gun, and the transformed plant tissue can be cultivated into plants.

[0016] The application of the OsCORK1 gene or OsCORK1 protein is any of the following:

[0017] 1) Application in improving copper stress resistance in rice;

[0018] 2) Application in the breeding of copper stress-resistant rice varieties;

[0019] 3) Application in reducing heavy metal pollution in rice production, wherein the heavy metal is copper.

[0020] Preferably, plants with improved resistance to copper stress are obtained by knocking out the OsCORK1 gene.

[0021] Preferably, the OsCORK1 gene is knocked out by CRISPR-Cas9.

[0022] Further preferably, the method further comprises the steps of extracting genomic DNA of the OsCORK1 gene knockout mutant for PCR amplification, and sequencing the amplified product to identify the type of gene mutation; wherein the nucleotide sequences of the primers for PCR amplification are shown in SEQ ID NOs: 5-6.

[0023] The beneficial effects achieved by the present invention are:

[0024] The present invention provides the rice copper stress response gene OsCORK1 and its encoded protein, and further provides the use of the OsCORK1 gene or protein in improving rice copper stress resistance or in breeding rice copper stress-resistant varieties. The present invention constructs a CRISPR / Cas9-OsCORK1 knockout vector and transforms rice using Agrobacterium-mediated method to obtain OsCORK1 knockout mutants. Experiments show that after the rice mutants with the OsCORK1 gene knocked out are treated with 10μM CuSO4, the Cu accumulation of the mutants is significantly reduced compared with the wild-type control (P<0.01), which can significantly improve the copper tolerance of the plants. In addition, the aboveground length, root length and fresh weight of the mutants are longer or larger than those of the wild type (P<0.05), indicating that reducing the expression of the OsCORK1 gene can significantly enhance the resistance of rice to copper stress. The OsCORK1 gene provides an excellent candidate gene for molecular breeding of copper tolerance in rice and has good application prospects in rice stress resistance breeding and reducing heavy metal pollution in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 For the cloning of OsCORK1 gene;

[0026] Figure 2 Domain prediction for the protein encoded by OsCORK1;

[0027] Figure 3 For the expression pattern analysis of OsCORK1 gene;

[0028] Figure 4 Analysis of CRISPR / Cas9 target sequence sites for the OsCORK1 gene;

[0029] Figure 5 Sequencing analysis of Cas9-OsCORK1 knockout rice mutant materials;

[0030] Figure 6 10 μM Cu 2+ Copper content analysis of two-week-old OsCORK1 knockout rice mutant and wild-type control Kitaake seedlings after 3-day treatment;

[0031] Figure 7 Analysis of copper stress resistance of OsCORK1 loss-of-function mutants;

[0032] Figure A shows the expression of WT and OsCORK1 loss-of-function mutant in 10 μM Cu 2+ Phenotype after treatment; B shows WT and OsCORK1 loss-of-function mutant in 10 μM Cu 2+ Comparison of shoot length after treatment; C is the comparison of WT and OsCORK1 loss-of-function mutant under 10 μm Cu 2+ Comparison of main root length after treatment; D is the comparison of WT and OsCORK1 loss-of-function mutant under 10 μm Cu 2+ Comparison of fresh weight after treatment.

[0033] Figure 8 Analysis of OsCORK1 gene expression in Cas9-OsCORK1 knockout rice mutant material. DETAILED DESCRIPTION

[0034] The present invention will be further described below in conjunction with specific embodiments, but the scope of protection of the present invention is not limited thereto; the instruments and equipment involved in the following embodiments are all conventional instruments and equipment unless otherwise specified; the reagents involved are all commercially available conventional reagents unless otherwise specified; the test methods involved are all conventional methods unless otherwise specified.

[0035] Example 1 Cloning of OsCORK1 gene

[0036] (1) RNA extraction from wild-type rice Nipponbare

[0037] Take an appropriate amount of fresh rice Nipponbare leaf tissue sample and place it in a 2mL RNAase-free centrifuge tube filled with steel balls, freeze it in liquid nitrogen for 1-2 minutes, and grind it into a homogenous paste in a pre-cooled plant tissue grinder. Add 1ml TRIzol TMReagent, vortex for 15s, mix thoroughly, and let stand on ice for 10 minutes; centrifuge at 12,000rpm at 4℃ for 10 minutes; aspirate about 600μL supernatant into a new 1.5mL RNAase-free centrifuge tube, add 200μL chloroform, mix thoroughly by upside down, and let stand at room temperature for 3-5 minutes; centrifuge at 12,000rpm at 4℃ for 15 minutes. After centrifugation, the liquid is divided into three layers: organic phase, middle layer and colorless upper aqueous phase, and the total RNA is dissolved in the aqueous phase; aspirate 500μL colorless upper aqueous phase into a new 1.5mL RNAase-free centrifuge tube, add an equal volume of pre-cooled isopropanol, mix thoroughly by upside down, and place in a -20℃ refrigerator for precipitation for more than 30 minutes; centrifuge at 12,000rpm at 4℃ for 10 minutes, discard the supernatant, add 75% ethanol prepared with 1mL RNAase-free ddH2O to wash the precipitate twice; discard the supernatant and place in a clean bench to air-dry the residual anhydrous ethanol; add 50μL Dissolve RNA in RNAase-free ddH2O to obtain a total RNA solution. Measure and record the RNA concentration.

[0038] (2) RNA reverse transcription into cDNA

[0039] The first-strand cDNA was synthesized using the Tiangen FastKing RT Kit (With gDNase). The steps were carried out according to the instructions. The total reaction system for RNA reverse transcription was 20 μL. The specific steps were as follows:

[0040] To a 200μL RNAase-free centrifuge tube, add 1μg total RNA and 2μL 5×gDNA Buffer in sequence, and make up to 10μL; flick gently to mix thoroughly, centrifuge briefly, incubate in a 42℃ water bath for 3 minutes, remove and quickly ice bath; then add 2μL 10×King RT Buffer, 1μL FastKing RT Enzyme Mix, and 2μL FQ-RT Primer Mix to the above centrifuge tube in sequence, and finally add RNAase-free ddH2O to make up to 20μL, flick gently to mix thoroughly, and centrifuge briefly; incubate in a 42℃ water bath for 15 minutes, and finally at 95℃ for 3 minutes; finally, dilute to 200μL with RNAase-free ddH2O, and store the obtained cDNA at -80℃ for later use.

[0041] (3) Gene cloning

[0042] The obtained Nipponbare cDNA was used as a template to clone the gene using TAKARA's high-fidelity enzyme and gene-specific primers (OsCORK1-F: ATGTCTCCACTCGACGGC; OsCORK1-R: ATTGTTGCCTAATACTATTT TTTCA).

[0043] PCR cloning system (50 μL):

[0044] Note that the template cDNA concentration in the system is less than 200 ng / 50 μL.

[0045]

[0046] PCR amplification procedure:

[0047] The annealing temperature was set according to the primers, annealing temperature was 60°C, time was 5s; extension time was 2min.

[0048]

[0049]

[0050] After amplification, the PCR products were subjected to agarose gel electrophoresis. Figure 1 As shown, the fragment size is 1767 bp, and lanes 1 and 2 are two replicates.

[0051] The target band was recovered from agarose gel to obtain a purified target fragment, which was then sequenced for verification. The nucleotide sequence of the OsCORK1 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.

[0052] Figure 2 The domain structure prediction of the protein encoded by OsCORK1 showed that OsCORK1 has a Lectin domain at the N-terminus and a Pkinase domain at the C-terminus.

[0053] Example 2 CRISPR / Cas9-OsCORK1 vector construction

[0054] The CRISPR-Cas9 system was used to knock out the OsCORK1 gene. The CRISPR-Cas9 vector preserved in the previous laboratory was used to construct a CRISPR-Cas9-OsCORK1 vector with a specific mutation site in the OsCORK1 gene. The successfully constructed vector was transferred into wild-type rice for genetic transformation, thereby editing the OsCORK1 gene. The resulting rice seedlings were then sequenced and compared to determine the mutation site of the OsCORK1 gene.

[0055] (1) PAM sequence design

[0056] Using the target gene nucleotide sequence verified by sequencing, find the appropriate PAM sequence (i.e., NGG type) close to the ATG end in the CDS of the target gene. Figure 4 Schematic diagram of the OsCORK1 knockout site. The first 20 bases of the PAM sequence are the sequence of primer F (Cas9-OsCORK1-F: GGCAGACCAGAGCAGCGACCACAT). Be careful not to cross exon regions. The R primer sequence (Cas9-OsCORK1-R: AAACATGTGGTCGCTGCTCTGGTC) is the reverse complement of primer F. When synthesizing primers, add the corresponding restriction sites before the primers: GGCA before the F primer and AAAC before the R primer.

[0057] (2) Construction of intermediate vector sgRNA

[0058] First, the intermediate vector is digested by enzyme and recovered by gel.

[0059] sgRNA digestion system (50 μL):

[0060]

[0061] Next, dilute the designed primers F and R to 100 μM / L and use a PCR instrument to connect the two strands to obtain the target fragment. The program settings are: 37°C for 5 minutes, 95°C for 5 minutes, ramp down to 25°C, 5°C / min.

[0062] Ligation system of primers F and R (10 μL):

[0063]

[0064] Finally, the target fragment was diluted 200-fold and ligated to the intermediate vector sgRNA at 25°C for 5 minutes. DH5α was transformed and colony PCR was performed using the U3-F primer (U3F: AGCACAGGACAGGCGTCTTCT) and the R primer (Cas9-OsCORK1-R: AAACATGTGGTCGCTGCTCTGGTC). The cells were shaken and sent for sequencing to obtain the correct intermediate vector.

[0065] Target fragment and sgRNA ligation system (10 μL):

[0066]

[0067] (3) Construction of the Cas9-OsCORK1 final vector

[0068] The correctly sequenced intermediate vector and the final Cas9 vector were subjected to LR recombination at 25°C for 1 hour. The reaction was terminated by adding 1 μL of Proteinase K and incubating at 37°C for 10 minutes. The ligation buffer was added and incubated at 4°C overnight for transformation into DB3.1. Colony PCR was performed using primers U3-F and R, and the cells were shaken and sequenced to verify the positive Cas9-OsCORK1 vector.

[0069] LR reconstitution system (10 μL):

[0070]

[0071] Example 3 OsCORK1 knockout mutant

[0072] The Cas9-OsCORK1 vector that was positive for sequencing verification was transformed into rice using the Agrobacterium-mediated method. Individual T0 generation OsCORK1 knockout transgenic plants were sampled and genomic DNA was extracted. The PAM sequence was used to design identification primers of about 300 bp containing the PAM sequence; the identification primer sequences were F: 5'-CCTGTCACCCTATCCGTCAA-3', and R: 5'-AACCATCGGCTCGGTGAC-3'. Using the wild-type rice variety Kitaake as a control, PCR amplification of the OsCORK1 knockout mutant transgenic material was performed, and the amplified fragment was about 250 bp. The amplified product was excised from the gel and recovered before sequencing.

[0073] The sequencing results are as follows Figure 5 As shown, three different types of OsCORK1 knockout mutants were obtained: the Cas9-6 strain was a homozygous mutant lacking a single base A (AGTGGGACCAGAGCAGCGACC-CATCG), the Cas9-12 strain was a homozygous mutant lacking two bases A and C (AGTGGGACCAGAGCAGCGACC--ATCG), and the Cas9-16 strain was a homozygous mutant with a single base A inserted (AGTGGGACCAGAGCAGCGACCAACATCG).

[0074] Example 4 Detection of OsCORK1 gene expression by real-time fluorescence quantitative PCR

[0075] Take rice tissue samples at different stages ( Figure 3 Expression pattern analysis of OsCORK1 gene) or rice tissue samples of different materials ( Figure 8Analysis of OsCORK1 gene expression in Cas9-OsCORK1 knockout rice mutant material) was performed. The samples were quickly frozen in liquid nitrogen and stored in a -80°C ultra-low temperature freezer. The extraction of rice total RNA and RNA reverse transcription steps were as described in 1 and 2 of Example 1. The obtained cDNA product was diluted 10 times for fluorescence quantitative qRT-PCR. The real-time quantitative PCR system was prepared using the qPCR Master Mix kit (Promega) [qPCR-F (10 μM), 0.4 μl; qPCR-R (10 μM), 0.4 μl; qPCR Master Mix, 10 μl; cDNA template, 5 μl; RNAase-free water, 4.2 μl], and real-time fluorescence quantitative PCR was performed using the CFX96 Real-Time System (Bio-Rad). -ΔΔc(t) Methods Average relative gene expression levels were calculated (Livak & Schmittgen, 2001). All reactions were performed with three biological replicates and three technical replicates, and OsActin1 was used as the endogenous reference gene.

[0076] The results are as follows Figure 3 and Figure 8 As shown, Figure 3 The expression pattern of OsCORK1 gene was analyzed by Figure 3 It can be seen that the expression level of the gene OsCORK1 is higher in the aboveground part during the seedling stage, and higher in the roots and leaves during the mature stage. Figure 8 The OsCORK1 gene expression level analysis of Cas9-OsCORK1 knockout rice mutant material was carried out by Figure 8 It was found that in the two lines of Cas9-OsCORK1 knockout rice mutant materials, the expression level of the OsCORK1 gene was significantly reduced compared with that in the wild type (Kitaake).

[0077] Example 5 Determination of copper content in OsCORK1 knockout mutants under copper stress conditions

[0078] To determine the effect of OsCORK1 gene loss on copper accumulation in rice, two knockout lines, Cas9-6 and Cas9-12, were selected, using the wild-type rice variety Kitaake as a control. After 14 days of normal culture, the plants were treated with 10 μM CuSO₄. Three days after treatment, the whole plants were dried and the Cu content was determined.

[0079] Weigh 0.3-0.5g of dried OsCORK1 knockout transgenic material and wild-type control sample into a polytetrafluoroethylene digestion tank and soak overnight in 5mL of nitric acid. Cover the inner lid, tighten the stainless steel outer cover, and place in a constant temperature drying oven at 160°C for 4 hours. Cool naturally to room temperature in the oven. Open the oven and heat to remove the acid until nearly dry. Aspirate the digestion solution into a 25mL volumetric flask. Wash the inner tank and inner lid three times with a small amount of 1% nitric acid solution. Combine the washings into the volumetric flask and dilute to the mark with 1% nitric acid. Mix thoroughly and set aside. Simultaneously perform a reagent blank test. Measure the copper content of the test solution on a microprocessor.

[0080] The results are as follows Figure 6 As shown in the results, under normal culture conditions, there was no significant difference in Cu accumulation between wild-type and transgenic rice; however, under CuSO4 treatment, the Cu accumulation in the knockout mutant was significantly lower than that in the wild-type control, with a decrease of about 19%-30%, and the statistical analysis showed a significant difference (P < 0.01).

[0081] Example 6 Phenotypic Analysis of OsCORK1 Knockout Mutants under Copper Stress

[0082] To determine the effect of OsCORK1 gene loss on copper stress resistance in rice, two knockout lines, Cas9-6 and Cas9-12, were selected, using the wild-type rice variety Kitaake as a control. After seed germination, the lines were treated with 10 μM CuSO₄ for one week, and phenotypes were analyzed.

[0083] The results are as follows Figure 7 As shown in the data, under normal culture conditions, there was no significant difference in the aboveground length, root length and fresh weight between wild-type and transgenic rice; however, under CuSO4 treatment, the aboveground length, root length and fresh weight of the OsCORK1 knockout mutant were longer or larger than those of the wild-type (P < 0.05), indicating that reducing the expression of the OsCORK1 gene can significantly enhance the resistance of rice to copper stress. <110> Henan Agricultural University <120> Rice copper stress response gene OsCORK1 and its encoding protein and its application <160> 9 <170> PatentIn version 3.5 <210> 1 <211> 1767 <212> DNA <213> Rice (Oryza sativa L.) <221> OsCORK1 gene <400> 1 atgtctccac tcgacggcgg tggattgctc ggcgtcttca ccaacagcac tggcatgaat 60 ccgtccgccg ccgccccgat cgtcgcggtg gagttcgaca cgttccaaaa tgagtgggac 120 cagagcagcg accacatcgg catcgacgtc aactccatca actcgaccgc ggtgaagttg 180 ctgtctgacc gcagcctctc caacgtcacc gagccgatgg ttgcgtcggt gagctacaac 240 aacagcacaa ggatgctggc cgtcatgctg cagatggccc cccaagatgg cggcaagagg 300 tacgagctca acagcacggt tgacctcaag agcttgctcc ccgcgcaggt ggccatcgga 360 ttctcggcgg cgagcgggtg gtccgaggag cggcaccaag tactcacctg gtctttcaat 420 tcgacattgg tggcgtctga agaacggaga gaaaacgcaa cgcgaggtag gccggccgct 480 gcggtgcttg caggtgtcgt tgtagcatcc gtcgtcgtcg tcggggcctc gatctgtttg 540 tttgtaatga tcaggcggcg taggatatct cgccggcgga cgagagaaga gtacgagatg 600 ggcggctccg acgacttcga catgaacgat gagttcgagc aaggcaccgg tccgaggcga 660 tttctgtaca gccaactggc caccgcgacg aacgacttct ccgaggacgg gaagctcggg 720 gagggtggct tcgggtcggt gtacaggggc gtcttgagcg aaccggccgg cgtccacgtc 780 gccgtcaaga ggatctccaa gacctccaag caggggagga aggagtacgc ctccgaggtg 840 agcatcatca gccgcctccg gcaccggaac ctggtgcagc tcgtcggctg gtgccacggc 900 cgcggcgact tcctcctcgt ctacgagctg gtgcccaacg gtagcctcga cgcgcacctc 960 tacggcggcg gcgcgacgct gccgtggccg accaggtacg agatcgcgct cgggctcggc 1020 tcggcgctgc tctacctgca ctccggctac gagaagtgcg tggtgcacag ggacatcaag 1080 cccagcaaca tcatgctcga ctccgccttc gccgccaagc tcggcgactt cgggctggcg 1140 aagctcgtcg accacggcga cgcctcgcag acgacggcgg tcctggcggg gacgatgggg 1200 tacatggacc cggagtacgc ggcctccggc aaggcgagca ccgcgtccga cgtctacagc 1260 ttcggcatcg tgctgctgga gatgtgctgc gggaggaggc ccgtgctgct ccaagaacaa 1320 tccatcaggt cccgcctcct cgagtgggtc tgggacctcc acggccgcgg cgccatcctc 1380 gaggcggccg acgagcggct gcgcggcggc gagctcgagc tcgacgcgaa gcaggtggag 1440 tgcgtgatgg tcgtggggct ctggtgcgcg cacccggacc gcggcgtgcg gccgtccatc 1500 aagcaggcgc tcgccgcgct ccagttcgag gctccgctgc cggctcttcc tccgacgatg 1560 cccgtgccga cgtactcctc cttgccgagc cttgcattgt actgcgacgc ggcggcagct 1620 agctcgtcgt catccagtgc agggttttct tcttccacga gtggcgagcg ttcgtcgacg 1680 agctcctctg cagcaaccgc cgagtcgtcg tggctactta agcacaacaa caggggcagt 1740 gaaaaaatag tattaggcaa caattga 1767 <210> 2 <211> 588 <212> PRT <213> Rice (Oryza sativa L.) <221> OsCORK1 protein <400> 2 Met Ser Pro Leu Asp Gly Gly Gly Leu Leu Gly Val Phe Thr Asn Ser 1 5 10 15 Thr Gly Met Asn Pro Ser Ala Ala Ala Pro Ile Val Ala Val Glu Phe 20 25 30 Asp Thr Phe Gln Asn Glu Trp Asp Gln Ser Ser Asp His Ile Gly Ile 35 40 45 Asp Val Asn Ser Ile Asn Ser Thr Ala Val Lys Leu Leu Ser Asp Arg 50 55 60 Ser Leu Ser Asn Val Thr Glu Pro Met Val Ala Ser Val Ser Tyr Asn 65 70 75 80 Asn Ser Thr Arg Met Leu Ala Val Met Leu Gln Met Ala Pro Gln Asp 85 90 95 Gly Gly Lys Arg Tyr Glu Leu Asn Ser Thr Val Asp Leu Lys Ser Leu 100 105 110 Leu Pro Ala Gln Val Ala Ile Gly Phe Ser Ala Ala Ser Gly Trp Ser 115 120 125 Glu Glu Arg His Gln Val Leu Thr Trp Ser Phe Asn Ser Thr Leu Val 130 135 140 Ala Ser Glu Glu Arg Arg Glu Asn Ala Thr Arg Gly Arg Pro Ala Ala 145 150 155 160 Ala Val Leu Ala Gly Val Val Val Ala Ser Val Val Val Val Gly Ala 165 170 175 Ser Ile Cys Leu Phe Val Met Ile Arg Arg Arg Arg Ile Ser Arg Arg 180 185 190 Arg Thr Arg Glu Glu Tyr Glu Met Gly Gly Ser Asp Asp Phe Asp Met 195 200 205 Asn Asp Glu Phe Glu Gln Gly Thr Gly Pro Arg Arg Phe Leu Tyr Ser 210 215 220 Gln Leu Ala Thr Ala Thr Asn Asp Phe Ser Glu Asp Gly Lys Leu Gly 225 230 235 240 Glu Gly Gly Phe Gly Ser Val Tyr Arg Gly Val Leu Ser Glu Pro Ala 245 250 255 Gly Val His Val Ala Val Lys Arg Ile Ser Lys Thr Ser Lys Gln Gly 260 265 270 Arg Lys Glu Tyr Ala Ser Glu Val Ser Ile Ile Ser Arg Leu Arg His 275 280 285 Arg Asn Leu Val Gln Leu Val Gly Trp Cys His Gly Arg Gly Asp Phe 290 295 300 Leu Leu Val Tyr Glu Leu Val Pro Asn Gly Ser Leu Asp Ala His Leu 305 310 315 320 Tyr Gly Gly Gly Ala Thr Leu Pro Trp Pro Thr Arg Tyr Glu Ile Ala 325 330 335 Leu Gly Leu Gly Ser Ala Leu Leu Tyr Leu His Ser Gly Tyr Glu Lys 340 345 350 Cys Val Val His Arg Asp Ile Lys Pro Ser Asn Ile Met Leu Asp Ser 355 360 365 Ala Phe Ala Ala Lys Leu Gly Asp Phe Gly Leu Ala Lys Leu Val Asp 370 375 380 His Gly Asp Ala Ser Gln Thr Thr Ala Val Leu Ala Gly Thr Met Gly 385 390 395 400 Tyr Met Asp Pro Glu Tyr Ala Ala Ser Gly Lys Ala Ser Thr Ala Ser 405 410 415 Asp Val Tyr Ser Phe Gly Ile Val Leu Leu Glu Met Cys Cys Gly Arg 420 425 430 Arg Pro Val Leu Leu Gln Glu Gln Ser Ile Arg Ser Arg Leu Leu Glu 435 440 445 Trp Val Trp Asp Leu His Gly Arg Gly Ala Ile Leu Glu Ala Ala Asp 450 455 460 Glu Arg Leu Arg Gly Gly Glu Leu Glu Leu Asp Ala Lys Gln Val Glu 465 470 475 480 Cys Val Met Val Val Gly Leu Trp Cys Ala His Pro Asp Arg Gly Val 485 490 495 Arg Pro Ser Ile Lys Gln Ala Leu Ala Ala Leu Gln Phe Glu Ala Pro 500 505 510 Leu Pro Ala Leu Pro Pro Thr Met Pro Val Pro Thr Tyr Ser Ser Leu 515 520 525 Pro Ser Leu Ala Leu Tyr Cys Asp Ala Ala Ala Ala Ser Ser Ser Ser 530 535 540 Ser Ser Ala Gly Phe Ser Ser Ser Thr Ser Gly Glu Arg Ser Ser Thr 545 550 555 560 Ser Ser Ser Ala Ala Thr Ala Glu Ser Ser Trp Leu Leu Lys His Asn 565 570 575 Asn Arg Gly Ser Glu Lys Ile Val Leu Gly Asn Asn 580 585 <210> 3 <211> 18 <212> DNA <213> Artificial sequence <221> OsCORK1-F <400> 3 atgtctccac tcgacggc 18 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <221> OsCORK1-R <400> 4 attgttgcct aatactattttttca 25 <210> 5 <211> twenty four <212> DNA <213> Artificial sequence <221> Cas9-OsCORK1-F <400> 5 ggcagaccag agcagcgacc acat 24 <210> 6 <211> twenty four <212> DNA <213> Artificial sequence <221> Cas9-OsCORK1-R <400> 6 aaacatgtgg tcgctgctct ggtc 24 <210> 7 <211> twenty one <212> DNA <213> Artificial sequence <221> U3F <400> 7 agcacaggac aggcgtcttc t 21 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <221> Identification primer F <400> 8 cctgtcaccc tatccgtcaa 20 <210> 9 <211> 18 <212> DNA <213> Artificial sequence <221> Identification primer R <400> 9 aaccatcggc tcggtgac 18

Claims

1. A knockout OsCORK1 Application of the gene in improving the copper stress resistance of rice, breeding rice copper stress resistant varieties, and reducing the accumulation of heavy metal copper in rice production, OsCORK1 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that Through OsCORK1 The gene was knocked out to obtain plants with improved copper stress resistance.

3. The use according to claim 2, characterized in that Through CRISPR-Cas9 OsCORK1 Gene knockout.

4. The use according to claim 3, characterized in that The following steps are also included: extract OsCORK1 The genomic DNA of the gene knockout mutant is amplified by PCR, and the amplified product is sequenced to identify the type of gene mutation; wherein the nucleotide sequence of the primers for PCR amplification is shown in SEQ ID NO: 5-6.