A kit for extracting fecal intestinal exfoliative cell nucleic acid and a nucleic acid extraction method

Abstract

The present application relates to a kind of fecal intestinal exfoliative cell nucleic acid extraction kit and nucleic acid extraction method, belong to molecular biology field.The present application provides a kind of simple, fast extraction human fecal exfoliative cell nucleic acid extraction kit, including the following components: fecal preservative, lysing solution, washing liquid 1, washing liquid 2 and magnetic bead.The nucleic acid extraction kit and nucleic acid extraction method disclosed in the present application can ensure the quality of DNA while simplifying the operation steps, shortening the operation time, and have a wide market application prospect.The development of fecal intestinal exfoliative cell nucleic acid automatic extraction process is of great significance.

Description

Technical Field

[0001] This invention relates to a kit and method for extracting nucleic acid from fecal intestinal exfoliated cells, belonging to the field of molecular biology. Background Technology

[0002] Feces are formed in the intestines and contain many shed intestinal cells during excretion. A normal person contains approximately 10 cells per gram of fecal sample. 6 Intestinal exfoliated cells are abundant, and colorectal cancer patients have even more exfoliated cells. Therefore, extracting DNA from exfoliated intestinal cells in feces and detecting the extracted DNA using relevant markers can predict a person's health status, such as the risk of colorectal cancer. Many DNA testing methods exist, but the accuracy is closely related to the methods used for fecal collection and extraction. Effective DNA extraction from feces is fundamental for downstream testing; only high-quality fecal exfoliated intestinal cell DNA can ensure the success of subsequent experiments. However, feces have a complex composition, containing not only exfoliated intestinal cells but also humic acid, microorganisms, proteins, inorganic salts, fats, and undigested dietary fiber. Extracting intestinal exfoliated cell DNA from such a complex composition is not easy.

[0003] Currently, commonly used fecal exfoliated cell nucleic acid kits and extraction methods on the market yield DNA of inconsistent quality. Some components are quite viscous and easily adhere to the pipette tip during operation. Furthermore, the DNA is difficult to elute from the magnetic beads. The viscous nature of the extracted components significantly prolongs the extraction time, hindering automated extraction. This viscous composition also results in a large amount of magnetic bead residue remaining during the final DNA elution step, affecting subsequent experiments. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides a kit for extracting nucleic acid from fecal exfoliated intestinal cells. Using this kit, DNA from exfoliated intestinal cells can be extracted simply and quickly from feces.

[0005] This invention also provides a nucleic acid extraction method using a kit for extracting nucleic acid from fecal intestinal exfoliated cells. The method is simple to operate, saves time, and is of great significance for the development of an automated process for extracting nucleic acid from fecal intestinal exfoliated cells.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A kit for extracting nucleic acids from fecal intestinal exfoliated cells includes the following components: fecal preservation solution, lysis buffer, washing buffer 1, washing buffer 2, and magnetic beads; the fecal preservation solution includes the following components at working concentrations: 1-5M guanidine thiocyanate, 0.05-0.1M Tris-HCl, 0.15M NaCl, 2-10mM EDTA, 0.1-1% Triton X-100, and 0.1%-1% Tween-20.

[0008] This kit for extracting nucleic acid from exfoliated fecal intestinal cells ensures the quality of the extracted DNA while adjusting some components. The components in the extraction process are all non-viscous, guaranteeing a smooth experimental procedure and preventing the solution from sticking to the pipette tip and becoming difficult to dissipate. It is also easy to operate and saves time during manual extraction.

[0009] Preferably, the pH of the fecal preservation solution is 7.5 ± 0.5.

[0010] Preferably, the lysis buffer comprises the following components at working concentrations: 5%-10% SDS and 2-4 mM EDTA.

[0011] More preferably, the pH of the lysis solution is 7.50 ± 0.50.

[0012] Preferably, the washing solution 1 comprises the following components at working concentrations: 60%-80% (v / v) ethanol, 0.05M Tris-HCl, and 0.15M NaCl.

[0013] Specifically, 60%-80% (v / v) ethanol can be added before use.

[0014] Preferably, the washing solution 2 comprises the following components at working concentrations: 0.05-0.1M Tris-HCl and 60-70% (v / v) ethanol.

[0015] Specifically, 60-70% (v / v) ethanol can be added before use.

[0016] A nucleic acid extraction method using a kit for extracting nucleic acid from fecal intestinal exfoliated cells, the specific operation steps of which are as follows:

[0017] Step 1) Preserve the fecal sample in fecal preservation solution, centrifuge and collect the supernatant in a clean centrifuge tube;

[0018] Step 2) Add lysis buffer and magnetic beads to the supernatant, mix well, and incubate at 70-90℃ for 8-12 min;

[0019] Step 3) Shake the centrifuge tube to mix well, cool to room temperature, place it on a magnetic rack for 1-2 minutes, and discard the supernatant;

[0020] Step 4) Add washing solution 1 to the centrifuge tube, mix well, place it on a magnetic rack for 1-2 minutes to adsorb, and discard the supernatant;

[0021] Step 5) Add washing solution 2 to the centrifuge tube, mix well, place it on a magnetic rack for 1-2 minutes to adsorb, and discard the supernatant;

[0022] Step 6) Repeat step 5);

[0023] Step 7) Add anhydrous ethanol to the centrifuge tube, transfer the magnetic bead-ethanol mixture to a new clean centrifuge tube, place it on a magnetic rack for 1-2 minutes to adsorb, and discard the supernatant;

[0024] Step 8) Dry at room temperature for several minutes, then add H2O and elute by shaking;

[0025] Step 9) Place the centrifuge tube on a magnetic rack for 1-2 minutes to allow it to absorb the supernatant. Transfer the supernatant to a new centrifuge tube. This supernatant is the extracted genomic DNA.

[0026] Specifically, the adsorption time and final elution volume (H2O) in the specific operational steps of the experiment can be optimized according to the specific experimental conditions.

[0027] The method described above is used to extract DNA from exfoliated intestinal cells in feces. While ensuring the quality of the extracted DNA, the extraction process is simplified. The entire extraction process is simple, fast, and less time-consuming, making it more conducive to automated extraction.

[0028] Preferably, in step 1), 10 ml of fecal preservation solution is added for every 1 g of fecal sample.

[0029] Preferably, in step 2), 3 ml of lysis buffer and 50 μl of magnetic beads are added to every 5 ml of supernatant. Attached Figure Description

[0030] Figure 1 This is the result of real-time PCR in Experimental Example 1 of this invention. Detailed Implementation

[0031] The present invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments, experimental examples and comparative examples are all commercially available.

[0032] The following is a brief introduction to some of the biological materials, experimental reagents, and experimental equipment involved in the following examples and experimental cases:

[0033] Biomaterials:

[0034] The fecal samples were obtained from the inventors of this invention. The three samples used in the examples and comparative examples were all from the same batch.

[0035] Experimental reagents:

[0036] The real-time PCR detection reagent was purchased from Kangwei Century, catalog number: CW0932M; the comparative fecal nucleic acid extraction kit was purchased from Beaver Biotechnology, catalog number: 70411-100.

[0037] Experimental apparatus:

[0038] The real-time PCR instrument was purchased from Shanghai Hongshi Medical Technology Co., Ltd.; the MVM25 multi-tube shaker was purchased from Dalongxingchuang Experimental Instrument Co., Ltd.

[0039] Example 1: A kit and method for extracting nucleic acid from fecal intestinal exfoliated cells.

[0040] The kit for extracting nucleic acid from fecal intestinal exfoliated cells in this embodiment includes the following components: fecal preservation solution, lysis buffer, washing buffer 1, washing buffer 2, and magnetic beads. The formulations of each component are as follows:

[0041] The components of the fecal preservation solution are: 2.5M guanidine thiocyanate, 0.1M Tris-HCl, 0.15M NaCl, 5mM EDTA, 0.5% Triton X-100, 0.5% Tween-20, and pH 7.5.

[0042] The components of the lysis buffer are: 7.5% SDS, 3mM EDTA, and pH 7.50.

[0043] The components of washing solution 1 are: 70% (v / v) ethanol, 0.05M Tris-HCl, and 0.15M NaCl;

[0044] The components of the washing solution 2 are: 0.075M Tris-HCl and 65% (v / v) ethanol.

[0045] The nucleic acid extraction method in this embodiment uses the kit from Example 1 to extract nucleic acid from exfoliated intestinal cells in fecal samples. The specific method is as follows:

[0046] 1) 2.5 Preservation of fecal samples: Place 25 ml of fecal preservation solution in a handheld mixer to thoroughly mix the fecal sample. Centrifuge at 4500 rpm for 2 minutes, and transfer 5 ml of the supernatant to a 15 ml centrifuge tube.

[0047] 2) Add 3 ml of lysis buffer and 50 μl of magnetic beads to the supernatant, mix well and 80 °C for 10 min;

[0048] 3) Place the centrifuge tube on a multi-tube mixer and shake at 1700 rpm for 10 min. Cool to room temperature, place the 15 ml centrifuge tube on a magnetic rack for 1 min, and discard the supernatant.

[0049] 4) Add 4 ml of washing solution 1 to a 15 ml centrifuge tube, mix well, place on a magnetic rack for 1 min, and discard the supernatant.

[0050] 5) Add 4 ml of washing solution 2 to a 15 ml centrifuge tube, mix well, place on a magnetic rack for 1 min, and discard the supernatant;

[0051] 6) Repeat step 5);

[0052] 7) Add 1.5 ml of anhydrous ethanol to a 15 ml centrifuge tube, transfer the mixture to a 2 ml centrifuge tube, place it on a magnetic rack for 1 min, and discard the supernatant.

[0053] 8) Dry at room temperature for 5 min, add 50 μl H2O, and elute by shaking in a mixer for 2 min;

[0054] 9) Place the centrifuge tube on a magnetic rack for 1 minute to allow it to absorb the supernatant. Transfer the supernatant to a new centrifuge tube. This supernatant is the extracted genomic DNA.

[0055] Example 2: A kit and method for extracting nucleic acid from fecal intestinal exfoliated cells.

[0056] The kit for extracting nucleic acid from fecal intestinal exfoliated cells in this embodiment includes the following components: fecal preservation solution, lysis buffer, washing buffer 1, washing buffer 2, and magnetic beads. The formulations of each component are as follows:

[0057] The components of the fecal preservation solution are: 5M guanidine thiocyanate, 0.1M Tris-HCl, 10mM EDTA, 0.15M NaCl, 1% Triton X-100, 1% Tween-20, and pH 8.0.

[0058] The components of the lysis buffer are: 10% SDS, 4mM EDTA, and pH 8.0.

[0059] The components of washing solution 1 are: 80% (v / v) ethanol, 0.05M Tris-HCl, and 0.15M NaCl;

[0060] The components of the washing solution 2 are: 0.1M Tris-HCl and 70% (v / v) ethanol.

[0061] The nucleic acid extraction method in this embodiment uses the kit from Example 2 to extract nucleic acid from exfoliated intestinal cells in fecal samples. The specific method is as follows:

[0062] 1) 2.5 Preservation of fecal samples: Place 25 ml of fecal preservation solution in a handheld mixer to thoroughly mix the fecal sample. Centrifuge at 4500 rpm for 2 minutes, and transfer 5 ml of the supernatant to a 15 ml centrifuge tube.

[0063] 2) Add 3 ml of lysis buffer and 50 μl of magnetic beads to the supernatant, mix well, and refrigerate at 90 °C for 8 min;

[0064] 3) Place the centrifuge tube on a multi-tube mixer and shake at 1700 rpm for 10 min. Cool to room temperature, place the 15 ml centrifuge tube on a magnetic rack for 1 min, and discard the supernatant.

[0065] 4) Add 4 ml of washing solution 1 to a 15 ml centrifuge tube, mix well, place on a magnetic rack for 1 min, and discard the supernatant.

[0066] 5) Add 4 ml of washing solution 2 to a 15 ml centrifuge tube, mix well, place on a magnetic rack for 1 min, and discard the supernatant;

[0067] 6) Repeat step 5);

[0068] 7) Add 1.5 ml of anhydrous ethanol to a 15 ml centrifuge tube, transfer the mixture to a 2 ml centrifuge tube, place it on a magnetic rack for 1 min, and discard the supernatant.

[0069] 8) Dry at room temperature for 5 min, add 50 μl H2O, and elute by shaking in a mixer for 2 min;

[0070] 9) Place the centrifuge tube on a magnetic rack for 1 minute to allow it to absorb the supernatant. Transfer the supernatant to a new centrifuge tube. This supernatant is the extracted genomic DNA.

[0071] Example 3: A kit and method for extracting nucleic acid from fecal intestinal exfoliated cells.

[0072] The kit for extracting nucleic acid from fecal intestinal exfoliated cells in this embodiment includes the following components: fecal preservation solution, lysis buffer, washing buffer 1, washing buffer 2, and magnetic beads. The formulations of each component are as follows:

[0073] The components of the fecal preservation solution are: 1M guanidine thiocyanate, 0.05M Tris-HCl, 2mM EDTA, 0.15M NaCl, 0.1% Triton X-100, 0.1% Tween-20, and pH 7.0.

[0074] The lysis buffer components were: 5% SDS, 2 mM EDTA, and pH 7.0.

[0075] The components of washing solution 1 are: 60% ethanol, 0.05M Tris-HCl, and 0.15M NaCl.

[0076] The components of the washing solution 2 are: 0.05M Tris-HCl and 60% (v / v) ethanol.

[0077] The nucleic acid extraction method in this embodiment uses the kit from Example 3 to extract nucleic acid from exfoliated intestinal cells in fecal samples. The specific method is as follows:

[0078] 1) 2.5 Preservation of fecal samples: Place 25 ml of fecal preservation solution in a handheld mixer to thoroughly mix the fecal sample. Centrifuge at 4500 rpm for 2 minutes, and transfer 5 ml of the supernatant to a 15 ml centrifuge tube.

[0079] 2) Add 3 ml of lysis buffer and 50 μl of magnetic beads to the supernatant, mix well, and refrigerate at 70 °C for 12 min;

[0080] 3) Place the centrifuge tube on a multi-tube mixer and shake at 1700 rpm for 10 min. Cool to room temperature, place the 15 ml centrifuge tube on a magnetic rack for 1 min, and discard the supernatant.

[0081] 4) Add 4 ml of washing solution 1 to a 15 ml centrifuge tube, mix well, place on a magnetic rack for 1 min, and discard the supernatant.

[0082] 5) Add 4 ml of washing solution 2 to a 15 ml centrifuge tube, mix well, place on a magnetic rack for 1 min, and discard the supernatant;

[0083] 6) Repeat step 5);

[0084] 7) Add 1.5 ml of anhydrous ethanol to a 15 ml centrifuge tube, transfer the mixture to a 2 ml centrifuge tube, place it on a magnetic rack for 1 min, and discard the supernatant.

[0085] 8) Dry at room temperature for 5 min, add 50 μl H2O, and elute by shaking in a mixer for 2 min;

[0086] 9) Place the centrifuge tube on a magnetic rack for 1 minute to allow it to absorb the supernatant. Transfer the supernatant to a new centrifuge tube. This supernatant is the extracted genomic DNA.

[0087] Comparative Example 1

[0088] This invention also uses a commercially available fecal nucleic acid extraction kit to extract nucleic acids from the samples. Specific operating instructions are as follows:

[0089] 1) Take 2.5g of fecal sample into a 15ml centrifuge tube;

[0090] 2) Add 3 ml of lysis buffer, then add 100 μl of proteinase K, adjust the speed to a suitable speed and vortex for 1 min to mix thoroughly, then place the centrifuge tube in 70℃ for 20 min and 90℃ for 10 min, shaking to mix three times during the process.

[0091] 3) Centrifuge at 13000 rpm for 3 min, and transfer 1.5 ml of supernatant to a new 15 ml centrifuge tube;

[0092] 4) Add 1.5 ml of binding solution, 200 μl of isopropanol, and 20 μl of magnetic bead suspension to the 15 ml centrifuge tube above, shake to mix for 30 seconds, bind at room temperature for 5 minutes, inverting twice during the process, place the centrifuge tube on a magnetic separator until the solution is clear, remove the supernatant with a pipette and remove the centrifuge tube.

[0093] 5) Add 4 ml of washing solution A, shake to mix for 30 seconds, let stand at room temperature for 1 minute, invert once during the process, place the centrifuge tube on a magnetic separator until the solution is clear, remove the supernatant with a pipette and remove the centrifuge tube.

[0094] 6) Add 4 ml of washing solution B, vortex and mix for 30 seconds, let stand at room temperature for 1 minute, inverting once during the process, place the centrifuge tube on a magnetic separator until the solution is clear, remove the supernatant with a pipette and remove the centrifuge tube.

[0095] 7) Add 4 ml of washing solution C, shake to mix for 30 seconds, let stand at room temperature for 1 minute, invert once during the process, place the centrifuge tube on a magnetic separator until the solution is clear, remove the supernatant with a pipette and remove the centrifuge tube.

[0096] 8) Repeat step 7) once;

[0097] 9) Keep the centrifuge tubes on the magnetic rack and place them in a clean bench to air dry until the surface of the magnetic beads has no obvious luster (5-7 minutes);

[0098] 10) Add 50 μl of elution buffer preheated to 65℃, shake to mix for 30 seconds, heat at 65℃ for 5 minutes, place the centrifuge tube on a magnetic separator until the solution is clear, transfer the supernatant to a new 1.5 ml centrifuge tube, which is the purified genomic DNA.

[0099] The concentrations of nucleic acids extracted from Examples 1-3 and Comparative Example 1 were measured using Qubit, and the experimental results are shown in Table 1.

[0100] Table 1. Concentration determination results of nucleic acids extracted in Examples 1-3 and Comparative Example 1

[0101] Sample Name Example 1 Example 2 Example 3 Comparative Example 1 Sample 1 10.2ng / ul 9.8ng / ul 10.7ng / ul 5.4ng / ul Sample 2 9.6ng / ul 10.6ng / ul 8.5ng / ul 6.3ng / ul Sample 3 11ng / ul 11.3ng / ul 10.0ng / ul 4.9ng / ul

[0102] As can be seen from the comparison of Examples 1-3 and Comparative Example 1, the fecal intestinal exfoliated cell nucleic acid extraction kit of the present invention has simple operation steps and short operation time. The DNA concentration extracted by the kits in the three specific examples is better than that of the fecal nucleic acid extraction kits commonly used on the market.

[0103] Experimental Example 1: Validation by Real-Time PCR

[0104] Intestinal exfoliated cell DNA extracted in Example 1 was used for quantitative real-time PCR. The specific procedure is as follows:

[0105] 1) The qPCR system is shown in Table 2:

[0106] Table 2 qPCR reaction system

[0107]

[0108]

[0109] 2) The qPCR reaction conditions are shown in Table 3:

[0110] Table 3 qPCR reaction conditions

[0111]

[0112] 3) The primer sequences for the internal reference gene are shown in the table below:

[0113] name sequence ACTB-F (upstream primer) GCCGAGGACTTTGATTGCACA ACTB-R (downstream primer) CTTAGAGAGAAGTGGGGTGGCTT ACTB-P (probe) ACTTCCTGTAACAACGCA

[0114] from Figure 1 As can be seen, the Ct values ​​of the internal reference genes are basically consistent, indicating that the extraction method of the present invention has good reproducibility in extracting DNA from exfoliated intestinal cells.

[0115] In summary, the fecal intestinal exfoliated cell nucleic acid extraction kit of the present invention simplifies the operation process while ensuring the quality of the extracted DNA, and is more conducive to achieving automated extraction.

[0116] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A kit for extracting nucleic acid from fecal intestinal exfoliated cells, characterized in that: The kit comprises the following components: fecal preservation solution, lysis buffer, washing buffer 1, washing buffer 2, and magnetic beads; the fecal preservation solution comprises the following components at working concentrations: 1-5M guanidine thiocyanate, 0.05-0.1M Tris-HCl, 0.15M NaCl, 2-10 mM EDTA, 0.1-1% Triton X-100, and 0.1%-1% Tween-20; the pH of the fecal preservation solution is 7.5±0.50; the lysis buffer comprises the following components at working concentrations: 5%-10% SDS and 2-4 mM EDTA; the pH of the lysis buffer is 7.50±0.50; washing buffer 1 comprises the following components at working concentrations: 60%-80% (v / v) ethanol, 0.05M Tris-HCl, and 0.15M NaCl; washing buffer 2 comprises the following components at working concentrations: 0.05-0.1M... Tris-HCl, 60-70% (v / v) ethanol; when using, the fecal sample is stored in the fecal preservation solution, mixed and centrifuged to obtain the supernatant, then the lysis buffer and magnetic beads are added, mixed and incubated at 70-90℃ for 8-12 min.

2. The kit for extracting nucleic acid from fecal intestinal exfoliated cells as described in claim 1, characterized in that: The pH of the fecal preservation solution is 7-7.

5.

3. The kit for extracting nucleic acid from fecal intestinal exfoliated cells as described in claim 1, characterized in that: The pH of the lysis solution is 7~7.

5.

4. The kit for extracting nucleic acid from fecal intestinal exfoliated cells as described in claim 1, characterized in that: The washing solution 1 is composed of the following components at working concentrations: 60%-70% (v / v) ethanol, 0.05M Tris-HCl, and 0.15M NaCl.

5. The kit for extracting nucleic acid from fecal intestinal exfoliated cells as described in claim 1, characterized in that: The washing solution 2 is composed of components with the following working concentrations: 0.05-0.075M Tris-HCl and 60-70% (v / v) ethanol.

6. A nucleic acid extraction method using the kit for extracting nucleic acid from fecal intestinal exfoliated cells as described in claim 1, characterized in that: The specific operating method is as follows: Step 1) Preserve the fecal sample in fecal preservation solution, centrifuge and collect the supernatant in a clean centrifuge tube; Step 2) Add lysis buffer and magnetic beads to the supernatant, mix well, and incubate at 70-90℃ for 8-12 min; Step 3) Shake the centrifuge tube to mix well, cool to room temperature, place it on a magnetic rack for 1-2 minutes, and discard the supernatant; Step 4) Add washing solution 1 to the centrifuge tube, mix well, place it on a magnetic rack for 1-2 minutes to adsorb, and discard the supernatant; Step 5) Add washing solution 2 to the centrifuge tube, mix well, place it on a magnetic rack for 1-2 minutes to adsorb, and discard the supernatant; Step 6) Repeat step 5). Step 7) Add anhydrous ethanol to the centrifuge tube, transfer the magnetic bead-ethanol mixture to a new clean centrifuge tube, place it on a magnetic rack for 1-2 minutes to adsorb, and discard the supernatant; Step 8) Dry at room temperature for several minutes, then add H2O and elute by shaking; Step 9) Place the centrifuge tube on a magnetic rack for 1-2 minutes to allow it to absorb the supernatant. Transfer the supernatant to a new centrifuge tube. This supernatant is the extracted genomic DNA.

7. The nucleic acid extraction method as described in claim 6, characterized in that: In step 1), add 10 ml of fecal preservation solution to each 1 g fecal sample.

8. The nucleic acid extraction method as described in claim 6, characterized in that: In step 2), add 3 ml of lysis buffer and 50 μl of magnetic beads to every 5 ml of supernatant.

Images