A gene for promoting ripening of tomato fruits and a method for regulating the same

Abstract

The application discloses a gene for promoting tomato fruit ripening and a regulation method thereof, wherein the nucleotide sequence of the gene is shown as Seq No. 1. SlDCD2 The complete coding sequence of the gene is obtained from tomatoes, a target is designed, the target is connected to a CRIPSR-Cas9 vector, a plant is transformed by using an agrobacterium infection method, a gene editing plant is obtained, and the gene editing plant is analyzed, and the result shows that the gene editing can accelerate the ripening of tomato fruits.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and relates to a gene that promotes tomato fruit ripening and its regulation method, particularly a gene encoding tomato D-cysteine ​​desulfurization enzyme. SlDCD2 The application of this gene in promoting tomato fruit ripening. Background Technology

[0002] Tomato (scientific name: *Solanum lycopersicum*), commonly known as tomato, is an annual or perennial herbaceous plant belonging to the Solanaceae family and the *Solanum* genus. Native to South America, tomatoes are widely cultivated in both northern and southern China. Tomato fruits are rich in nutrients and have a distinctive flavor. Hydrogen sulfide (H2S) is the third endogenous gaseous signaling molecule after NO and CO. In plants, H2S participates in regulating physiological processes such as stomatal closure, seed germination, root development, photosynthesis, and biotic and abiotic stresses. The D-cysteine ​​desulfatase DCD2 breaks down D-cysteine ​​to produce H2S; its mechanism of action in tomatoes is currently unclear.

[0003] The synthesis of carotenoids, degradation of chlorophyll, cell wall degradation, and the synthesis and translocation of ethylene in tomato fruits are closely related to fruit ripening. As a typical climacteric fruit, tomatoes undergo significant changes in sensory attributes such as color, texture, flavor, and taste during the ripening stage. Currently, several genes have been identified that control fruit ripening. For example, activation of the S-adenosine-Met synthase 1 gene (SlSAMS1) leads to S-adenosine-Met accumulation, increased ethylene production, and accelerated fruit ripening. The expression level of the cell wall hydrolase β-galactosidase gene DkGAL1 increased 25.01-fold during fruit ripening, and overexpression of this gene in tomatoes reduced fruit firmness by 23.83%. Knockout of chloroplast metalloproteinase L2 inhibits chloroplast development, resulting in white fruits in the early stages and slow accumulation of carotenoids and lycopene. Finding new functional genes involved in regulating fruit ripening remains an important goal in horticulture, contributing to improving the commercial value of crops.

[0004] Although the cultivation area of ​​tomatoes is constantly expanding, the consumption of tomatoes in many regions is still limited by factors such as transportation, storage, and sales. August and September are the peak ripening season for tomatoes. During this period, the supply exceeds demand, and slow sales lead to many tomatoes becoming moldy and rotten, affecting their quality. This not only wastes resources but also causes economic losses for producers. Breeding early-maturing tomato varieties can reduce these losses. Early-maturing tomatoes have a shorter growth cycle, faster coloring, and earlier fruit ripening, allowing them to be marketed earlier. This not only improves the marketability of tomatoes but also increases the economic benefits for growers and regulates market supply during the off-season.

[0005] The CRISPR / Cas system consists of two parts: clustered regularly spaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas). This system requires sgRNA (small guide RNA) and PAM structures (5′-NGG) on the gene sequence to guide the Cas protein in its endonuclease function. Currently, there are many known Cas proteins, with Cas9 being the most widely used, belonging to the type II system: Cas9 binds to sgRNA to form a complex, undergoing a conformational change. Guided by the sgRNA, this complex recognizes PAM sites on the gene sequence and anchors to the target site. Under the action of the Cas protein endonuclease, a precise double-strand break occurs at the target site, initiating the cell's self-repair mechanism. The target gene is genetically modified through non-homologous end joining or homologous recombination. Summary of the Invention

[0006] The purpose of this invention is to provide a gene that promotes the ripening of tomato fruit and its regulation method.

[0007] To achieve the above and other related objectives, the technical solution provided by the present invention is: a gene that promotes the ripening of tomato fruits, the nucleotide sequence of which is shown in Seq No. 1.

[0008] To achieve the above and other related objectives, the present invention provides a method for regulating the ripening of tomato fruits, comprising the following steps:

[0009] Step 1: Mix and dilute the target-1 forward primer-F1, target-1 reverse primer-R1, target-2 forward primer-F2, and target-2 reverse primer-R2 with sterile ddH2O to a concentration of 1 μM. Then place the mixture in a PCR instrument and treat it at 88-92℃ for 25-35 s. After that, cool it to room temperature to complete the target primer annealing and obtain the target adapter primer mixture.

[0010] Target 1 forward primer-F1: 5'-GTCACAATGGCAGCAGCCAAGAAA-3';

[0011] Target-1 reverse primer-R1: 5'-AAACTTTCTTGGCTGCTGCCATTG-3';

[0012] Target 2 forward primer-F2: 5'-GTCAGGATGCACTACTCCCTCTCT-3';

[0013] Target 2 reverse primer-R2: 5'-AAACAGAGAGGGAGTAGTGCATCC-3';

[0014] Step 2: Prepare an enzyme digestion and ligation reaction solution containing the target adapter primer mixture from Step 1. Use the digestion-ligation method to ligate the target adapter to the gRNA expression cassette and amplify the gRNA expression cassette.

[0015] Step 3: Using the product obtained in Step 2 as a template, perform the first round of PCR amplification;

[0016] Step 4: Using the first-round PCR amplification product obtained in Step 3 as a template, perform the second round of PCR amplification, and estimate the product concentration after the amplification is completed;

[0017] Step 5: Mix the two second-round PCR products obtained in Step 4 in equal amounts, purify them with a DNA product purification kit, and take 2 μL of the purified product for agarose gel electrophoresis to check the purification effect. If the concentration is not less than 5 ng / μL, proceed to the next step.

[0018] Step 6: Ligate the gRNA expression cassette to the Cas9 plasmid using the cut-and-ligate method;

[0019] Step 7: After ligation, the ligation product from Step 6 is used to transform E. coli DH5α using the chemical heat shock method, plasmid is extracted, and sequencing is performed.

[0020] Step 8: Add CRISPR / Cas9- SlDCD2 Plasmid was transformed into EHA105 Agrobacterium competent cells;

[0021] Step 9: Add the CRISPR / Cas9- SlDCD2 Agrobacterium tumefaciens plasmid EHA105 infected tomato cotyledons and obtained transgenic positive seedlings. dcd2 .

[0022] The preferred technical solution is as follows: In step 2, the enzyme digestion and ligation reaction solution is: 1 μL of 10×cutsmart buffer, 20 ng of pYLgRNA-AtU# plasmid, 0.5 μL of target adapter primer, 0.4 μL of BsaI, 0.1 μL of T4 DNA ligase, 0.4 μL of T4 DNA ligase buffer, and ddH2O to a final volume of 10 μL; the PCR amplification parameters are: 37℃, 5 min; 20℃, 5 min; 5 cycles.

[0023] The preferred technical solution is as follows: Step 3 includes two PCR amplification reactions. The first round of PCR amplification consists of a 50 μL reaction system: 1 μL of the digestion-ligation product, 4 μL of primer pair UF / Rn (reaction 1), 1 μL of dNTPs, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5× Super-Fidelity DNA Polymerase buffer, and 33 μL of ddH2O; PCR conditions: 95℃, 1 min; 95℃, 10 s; 60℃, 15 s; 72℃, 15 s; 25 cycles; 72℃, 10 min; 4℃, ∞; The second round of PCR amplification consists of a 50 μL reaction system: 1 μL of the digestion-ligation product, 4 μL of primer pair F n / gRNA-R (reaction 2), 1 μL dNTPs, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5× Super-Fidelity DNA Polymerase buffer, 33 μL ddH2O; PCR conditions: 95℃, 1 min; 95℃, 10 s; 60℃, 15 s; 72℃, 15 s; 25 cycles; 72℃, 10 min; 4℃, ∞.

[0024] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0025] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

[0026] The preferred technical solution is as follows: the position-specific primer pairs are mixed in advance to form a 10× working solution, each at 1.5 μM: PT1 = 1.5 μL B1' + 1.5 μL B2 + 7 μL ddH2O, PT2L = 1.5 μL B2' + 1.5 μL BL + 7 μL ddH2O. The reaction system for target one consisted of: 1 μL each of the two target one PCR products from one round of PCR amplification, 3 μL of primer combination working solution PT1, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O. The reaction system for target two consisted of: 1 μL each of the two target two PCR products from one round of PCR amplification, 3 μL of primer combination working solution PT2, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O. After mixing, the mixture was placed in a PCR instrument. The PCR reaction conditions were: 95℃ for 1 min; 95℃ for 10 s, 60℃ for 15 s, 72℃ for 15 s, 18 cycles; 72℃ for 10 min. min; 4℃, ∞.

[0027] B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3';

[0028] B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3';

[0029] B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3';

[0030] BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'.

[0031] The preferred technical solution is as follows: Take 20-70 ng of the second-round purified product, add 80-100 ng of undigested pYLCRISPR / Cas9-DN plasmid, 1.5 μL of 10×cutsmart buffer, 0.5 μL of BsaI restriction enzyme, and add ddH2O to make up the volume to 15 μL. After mixing, place in a PCR instrument at 37℃ for 10 min to digest the pYLCRISPR / Cas9-DN plasmid. Add 0.4 μL of 10×T4 DNA ligase buffer and 0.1 μL of T4 DNA ligase to the digested reaction system. After mixing again, place in a PCR instrument and perform the reaction under the following conditions: 37℃ for 2 min, 10℃ for 3 min, 20℃ for 5 min, 13 cycles; 37℃ for 2 min; 4℃ at ∞.

[0032] The preferred technical solution is as follows: In step 7, 1 μL of the ligation product obtained in step 7 is added to 100 µL of *E. coli* DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, and then incubated on ice for 2-3 min; 700 µL of LB liquid medium is added to a centrifuge tube and cultured at 37℃ and 200 rpm for 60 min; the cultured bacterial solution is centrifuged at 5000 rpm for 2 min, 600 µL of supernatant is discarded, and the remaining bacterial solution is evenly spread on LB solid medium containing kanamycin (500 µL of 10 mg / mL kanamycin per 100 mL of LB solid medium), and incubated upside down at 37℃ for 16 h; single colonies are picked, mixed with 10 µL of sterile water by pipetting, and 2 µL of bacterial solution is taken for colony identification. The colony PCR system is 25 μL: 2 μL bacterial solution, 1 μL each of primer pairs SP-DL / SP-R on a 10 μM binary vector, and 2×Rapid Taq. 12.5 μL of Master Mix and 8.5 μL of ddH2O were mixed and placed in a PCR instrument. PCR conditions were as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, 32 cycles; final extension at 72℃ for 5 min; 4℃ infinity. After the reaction, the PCR product band size was checked on an agarose gel to see if it met the theoretical value. The remaining bacterial culture with the correct band size was transferred to 4 mL of LB liquid medium containing kanamycin and cultured at 37℃ / 200 rpm for 16 h. Plasmids were extracted using a plasmid miniprep kit and run on an agarose gel to verify successful extraction. The extracted plasmids were sent to a biotechnology company for further sequencing and identification.

[0033] SP-DL: 5'-GTCGTGTCCACATGTTGACCGG-3';

[0034] SP-R: 5'-CCCGACATAGATGCAATAACTTC-3'.

[0035] The preferred technical solution is as follows: In step 8, take 100 μL of Agrobacterium competent cells EHA105, thaw them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently tap the bottom of the centrifuge tube to mix, and incubate in sequence on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min; add 700 μL of antibiotic-free LB liquid medium, and culture at 28℃ with shaking for 2-3 h; centrifuge at 6000 rpm for 1 min to collect the bacteria, collect about 100 μL of supernatant, mix and resuspend the bacteria, spread on LB-Kana / Rif solid medium, and incubate upside down in a 28℃ incubator for 2-3 days.

[0036] The preferred technical solution is as follows: In step 9, a single colony of Agrobacterium tumefaciens containing the Cas9 vector constructed in step 9 is picked and placed in 3 mL of LB liquid medium containing Kana and Rif. After incubation at 200 rpm and 28℃ for 12-16 h, 300 µL is taken and placed in 20 mL of LB liquid medium containing Kana and Rif. The culture is then incubated with shaking at 200 rpm and 28℃ for 6-7 h. The OD of the bacterial culture is then measured using a spectrophotometer. 600 Centrifuge at 5000 rpm for 10 min at room temperature to a final concentration of 0.5-0.6 to collect bacterial cells. Dilute the bacterial cells with sterile water to a final concentration of 0.5-0.6. 600 =0.1-0.2, freshly prepared and used immediately. Tomato cotyledons and stem segments were pre-cultured in the dark for 2 days, then immersed in diluted Agrobacterium infection solution, shaken, and inoculated for 5 minutes. The infection solution was then discarded, and excess solution was aspirated with a pipette tip. The cotyledons and stem segments were then subjected to germination, shoot elongation, and rooting processes on culture media containing different plant hormones. Rooted explants were transferred to nutrient soil for subsequent sequencing and identification, resulting in transformed tomato plants. Subsequently, upstream and downstream primers were designed to extract DNA from the transgenic tomato plants, which was then amplified by PCR and sequenced for identification and analysis. SlDCD2 Whether gene editing has occurred.

[0037] Due to the application of the above technical solution, the advantages of this invention compared with the prior art are:

[0038] This invention obtains from tomatoes SlDCD2 The complete coding sequence of the gene was obtained, a target was designed, and the target was linked to the vector CRIPSR-Cas9. Plants were transformed using Agrobacterium tumefaciens infection to obtain gene-edited plants. The gene-edited plants were analyzed, and the results showed that gene editing could accelerate the ripening of tomato fruits. Attached Figure Description

[0039] Figure 1The sequence identification diagram of the CRIPSR-Cas9-SlDCD2 plasmid shows the target sequence in yellow and the gRNA expression cassette sequence in green, indicating that the gene editing vector was successfully constructed.

[0040] Figure 2 The target site identification diagram for plants with SlDCD2 gene editing shows that the SlDCD2 gene was successfully mutated.

[0041] Figure 3 Tomato fruit ripening time in plants with WT and SlDCD2 gene editing.

[0042] Figure 4 Chlorophyll and carotenoid content in tomato fruits from plants with WT and SlDCD2 gene editing.

[0043] Figure 5 Expression levels of chlorophyll degradation-related genes in tomato fruits from plants with WT and SlDCD2 gene editing.

[0044] Figure 6 Expression levels of carotenoid synthesis-related genes in tomato fruits from plants with WT and SlDCD2 gene editing.

[0045] Figure 7 Expression levels of cell wall metabolism-related genes in tomato fruits from plants with WT and SlDCD2 gene editing.

[0046] Figure 8 Ethylene synthesis and response-related gene expression levels in tomato fruits from plants with WT and SlDCD2 gene editing. Detailed Implementation

[0047] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification.

[0048] Please see Figure 1-8 It should be noted that the structures, proportions, sizes, etc., illustrated in the accompanying drawings are merely for illustrative purposes and to aid those skilled in the art in understanding and reading the invention. They are not intended to limit the scope of the invention and therefore have no substantial technical significance. Any modifications to the structure, changes in proportions, or adjustments to the size are not permitted. The following embodiments are provided to better understand the invention, but are not intended to limit it. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0049] Example 1: A gene that promotes tomato fruit ripening and its regulation method

[0050] A gene that promotes the ripening of tomato fruit, the nucleotide sequence of which is shown in Seq No. 1.

[0051] A gene regulation method for promoting tomato fruit ripening includes the following steps:

[0052] Step 1: Download tomatoes from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ). SlDCD2 Genomic sequences were obtained, and candidate gRNA targets were screened using CRISPR direct (http: / / crispr.dbcls.jp / ). Two targets were selected, and two pairs of target adapter primers were designed.

[0053] Target 1 forward primer-F1: 5'-GTCACAATGGCAGCAGCCAAGAAA-3';

[0054] Target-1 reverse primer-R1: 5'-AAACTTTCTTGGCTGCTGCCATTG-3';

[0055] Target 2 forward primer-F2: 5'-GTCAGGATGCACTACTCCCTCTCT-3';

[0056] Target 2 reverse primer-R2: 5'-AAACAGAGAGGGAGTAGTGCATCC-3';

[0057] Step 2: Dissolve and dilute target primers F1, R1, F2, and R2 in sterile ddH2O to prepare a 10 μM stock solution. Take 10 μL of each and add it to 80 μL of sterile ddH2O, then mix and dilute to 1 μM. Place in a PCR instrument at approximately 90℃ for 30 s, then transfer to room temperature to cool and complete the annealing of the target primers.

[0058] Step 3: Prepare 10 μL of enzyme digestion and ligation reaction solution, and use the digestion-ligation method to ligate the target adapter to the gRNA expression cassette, and amplify the gRNA expression cassette (2 rounds of nested PCR).

[0059] Step 4: Using the enzyme digestion and ligation reaction solution from Step 3 as a template, perform the first round of PCR amplification;

[0060] Step 5: Using the first-round PCR amplification product from Step 4 as a template, perform a second-round PCR amplification;

[0061] Step 6: Estimate the concentration of the second round PCR amplification product. Mix the two second round PCR products of the DCD2 gene editing vector at a concentration ratio of 1:1, purify them with a DNA product purification kit, and take 2 μL of the purified product for agarose gel electrophoresis to check the purification effect and estimate the concentration of the purified product. If the concentration is not less than 5 ng / μL, the next experiment can be carried out.

[0062] Step 7: Ligate the gRNA expression cassette to the Cas9 plasmid using the cut-and-ligate method;

[0063] Step 8: After ligation, the ligation product from Step 7 is used to transform E. coli DH5α using the chemical heat shock method, plasmid is extracted, and sequencing is performed.

[0064] Step 9: Add CRISPR / Cas9- SlDCD2 Plasmid was transformed into EHA105 Agrobacterium competent cells;

[0065] Step 10: Add the CRISPR / Cas9- SlDCD2 Agrobacterium tumefaciens plasmid EHA105 infected tomato cotyledons and obtained transgenic positive seedlings. dcd2 ;

[0066] Step 11: After the tomato material has flowered, mark the date of the blooming flowers and record the WT (Winter Written) and twitch temperature. SlDCD2 Gene-edited plants dcd2 Fruit color changes at 35, 36, 37, 39, 41, 43, 45 and 47 days after flowering;

[0067] Step 12: Determine WT and dcd2 The chlorophyll and carotenoid content of tomato fruits at 36, 39, and 43 days after flowering;

[0068] Step 13: Design Real-Time qPCR primers for each gene using the Products IDT website, and determine WT and dcd2 Genes related to chlorophyll degradation in tomato fruits at 36, 39, and 43 days after flowering. NYC1 , PAO and SGR1 Genes related to carotenoid synthesis PSY1 and PDS Cell wall metabolism-related genes CEL2 and EXP Ethylene synthesis and response-related genes ACO1 , ACS2 and E4 The amount of expression.

[0069] In step 1, to improve mutation efficiency, SlDCD2When screening gene editing vectors, priority is given to targets with high GC content that are close to the transcription start site or gene functional domain.

[0070] In step 3, the enzyme digestion and ligation reaction solution consisted of: 1 μL of 10×cutsmart buffer, 20 ng of pYLgRNA-AtU# plasmid, 0.5 μL of target adapter, 0.4 μL of LBsaI, 0.1 μL of L4 DNA ligase, 0.4 μL of L4 DNA ligase buffer, and ddH2O to a final volume of 10 μL. The PCR amplification parameters were: 37℃ for 5 min, 20℃ for 5 min, for 5 cycles.

[0071] In step 4, the first round of PCR amplification (2 PCR reactions per target site) consists of a 50 μL reaction system: 1 μL of the digestion-ligation product as a template, and 4 μL of primer pair UF / R. n (Reaction 1) or F n / gRNA-R (reaction 2), 1 μL dNTPs, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5× Super-Fidelity DNA Polymerase buffer, 33 μL ddH2O. PCR conditions: 95℃ 1 min; 95℃ 10 s, 60℃ 15 s, 72℃ 15 s, 25 cycles; 72℃ 10 min; 4℃ ∞. Take 2 μL of product and check the product length using 2% agarose gel electrophoresis to see if it meets expectations (reaction 1 product approximately 450 bp, reaction 2 product approximately 140 bp);

[0072] In step 5, the second round of PCR amplification (one PCR reaction per target site): DCD2The gene editing vector has two target sites, and the position-specific primer pairs are PT1 and PT2L. The position-specific primer pairs were pre-mixed into a 10× working solution at 1.5 μM for each: PT1 = 1.5 μL B1' + 1.5 μL B2 + 7 μL ddH2O, PT2L = 1.5 μL B2' + 1.5 μL B1 + 7 μL ddH2O, PT2 = 1.5 μL B2' + 1.5 μL B3 + 7 μL ddH2O, PT3 = 1.5 μL B3' + 1.5 μL B4 + 7 μL ddH2O, PT4L = 1.5 μL B4' + 1.5 μL B1 + 7 μL ddH2O. The first-round PCR product was diluted 10-fold with ddH2O. For each target site, 1 μL of two PCR reactions from one round of PCR amplification were mixed as template, and 3 μL of primer combination working solution, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O were added. The mixture was then placed in a PCR instrument. The PCR reaction conditions were: 95℃ for 1 min; 95℃ for 10 s, 60℃ for 15 s, 72℃ for 15 s, 18 cycles; 72℃ for 10 min; 4℃ infinity. 2 μL of the product was used for agarose gel electrophoresis to check if the product length met expectations and to estimate the product concentration.

[0073] In step 7, take 20-70 ng of the second-round purified product, add 80-100 ng of undigested pYLCRISPR / Cas9-DN plasmid, 1.5 μL of 10×cutsmart buffer, 0.5 μL of BsaI restriction enzyme, and bring the volume to 15 μL with ddH2O. After mixing, place the mixture in a PCR instrument at 37℃ for 10 min to digest the pYLCRISPR / Cas9-DN plasmid. Add 0.4 μL of 10×T4DNA ligase buffer and 0.1 μL of T4DNA ligase to the digested reaction system. After mixing again, place the mixture in a PCR instrument and perform the following reaction conditions: 37℃ for 2 min, 10℃ for 3 min, 20℃ for 5 min, 13 cycles; 37℃ for 2 min; 4℃ at ∞.

[0074] In step 8, 1 μL of the ligation product obtained in step 7 was added to 100 µL of *E. coli* DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, and then incubated on ice for 2-3 min. 700 µL of LB liquid medium was added to a centrifuge tube, and the mixture was incubated at 37℃ and 200 rpm for 60 min. The cultured bacterial solution was centrifuged at 5000 rpm for 2 min, 600 µL of supernatant was discarded, and the remaining bacterial solution was evenly spread onto LB solid medium containing kanamycin (500 µL of 10 mg / mL kanamycin per 100 mL LB solid medium), and incubated upside down at 37℃ for 16 h. Single colonies were picked, mixed with 10 µL of sterile water, and 2 µL of the bacterial solution was used for colony identification. The colony PCR system was 25 µL: 2 µL of bacterial solution, 1 µL each of primer pairs SP-DL / SP-R from the 10 μM binary vector, and 2× Rapid Taq Master Mix. 12.5 μL of ddH2O and 8.5 μL of ddH2O were mixed and placed in a PCR instrument. PCR conditions were as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, 32 cycles; final extension at 72℃ for 5 min; 4℃∞. After the reaction, the PCR product band size was checked on an agarose gel to see if it met the theoretical value. The remaining bacterial culture with the correct band size was transferred to 4 mL of LB liquid medium containing kanamycin and cultured at 37℃ / 200 rpm for 16 h. Plasmids were extracted using a plasmid miniprep kit and run on an agarose gel to verify successful extraction. The extracted plasmids were sent to a biotechnology company for further sequencing and identification.

[0075] SP-DL: 5'-GTCGTGTCCACATGTTGACCGG-3';

[0076] SP-R: 5'-CCCGACATAGATGCAATAACTTC-3'.

[0077] In step 9, take 100 μL of Agrobacterium competent cells EHA105, thaw them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently tap the bottom of the centrifuge tube to mix, and incubate sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min; add 700 μL of antibiotic-free LB liquid medium, and culture at 28℃ with shaking for 2-3 h; centrifuge at 6000 rpm for 1 min to collect the bacteria, collect about 100 μL of supernatant, mix well by pipetting and resuspend the bacterial cells, spread them on LB-Kana / Rif solid medium, and incubate upside down in a 28℃ incubator for 2-3 days.

[0078] In step 10, a single colony of Agrobacterium tumefaciens containing the Cas9 vector constructed in step 9 was picked and placed in 3 mL of LB liquid medium containing Kana and Rif. The culture was incubated at 200 rpm and 28°C for 12-16 h. Then, 300 µL of the culture was transferred to 20 mL of LB liquid medium containing Kana and Rif and incubated with shaking at 200 rpm and 28°C for 6-7 h. The OD of the bacterial culture was then measured using a spectrophotometer. 600 Centrifuge at 5000 rpm for 10 min at room temperature to a final concentration of 0.5-0.6 to collect bacterial cells. Dilute the bacterial cells with sterile water to a final concentration of 0.5-0.6. 600 =0.1-0.2, freshly prepared and used immediately. Tomato cotyledons and stem segments were pre-cultured in the dark for 2 days, then immersed in diluted Agrobacterium infection solution, shaken, and inoculated for 5 minutes. The infection solution was then discarded, and excess solution was aspirated with a pipette tip. The cotyledons and stem segments were then subjected to germination, shoot elongation, and rooting processes on culture media containing different plant hormones. Rooted explants were transferred to nutrient soil for subsequent sequencing and identification, resulting in transformed tomato plants. Subsequently, upstream and downstream primers were designed to extract DNA from the transgenic tomato plants, which was then amplified by PCR and sequenced for identification and analysis. SlDCD2 Whether gene editing has occurred.

[0079] In step 12, the specific method for determining the content of carotenoids and chlorophyll is as follows: Take 0.5 g of fruit and grind it into powder in a mortar with liquid nitrogen. Add 5 mL of anhydrous ethanol and mix thoroughly. Collect the homogenate into a 10 mL centrifuge tube, centrifuge at 4000 rpm for 5 min at room temperature, collect the supernatant, and measure the absorbance of the supernatant at 470 nm, 649 nm, and 665 nm using an ELISA reader. The specific calculation method is as follows:

[0080] Content in sample (mg / g) = (C×V)×10 3 / W, where V is the volume of the extract and W is the fresh weight of the sample;

[0081] Chlorophyll a:C a =13.95хA665-6.88хA649;

[0082] Chlorophyll b: C b =24.96хA649-7.32хA665;

[0083] Total chlorophyll: C = C a + C b ;

[0084] Total carotenoids: C c =(A470×10 3 -2.06C a -114.8C b ) / 245.

[0085] In step 13, RNA was extracted from tomato fruits at different time points (36 DPA, 39 DPA, 43 DPA), and cDNA was synthesized by reverse transcription. Real-Time qPCR was used to detect changes in the expression levels of related genes in the tomato fruits. The reaction system was 10 μL: 5 μL of 2×SYBR® Green Pro Taq HS Premix, 0.8 μL of cDNA, 0.2 μL each of 10 μM F / R, and RNase-free water to a final volume of 10 μL. The reaction program was: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s, 40 cycles, 91℃ for 10 s. 。 Tomato Tubulin Genes are used as internal controls, according to 2 -△△Ct The method calculates the relative expression level.

[0086] Seq No. 1:

[0087]

[0088] Example 2: A gene that promotes tomato fruit ripening and its regulation method

[0089] A gene that promotes the ripening of tomato fruit, the nucleotide sequence of which is shown in Seq No. 1.

[0090] The control methods include the following steps:

[0091] Step 1: Mix and dilute the target-1 forward primer-F1, target-1 reverse primer-R1, target-2 forward primer-F2, and target-2 reverse primer-R2 with sterile ddH2O to a concentration of 1 μM. Then place the mixture in a PCR instrument and treat it at 88-92℃ for 25-35 s. After that, cool it to room temperature to complete the target primer annealing and obtain the target adapter primer mixture.

[0092] Target 1 forward primer-F1: 5'-GTCACAATGGCAGCAGCCAAGAAA-3';

[0093] Target-1 reverse primer-R1: 5'-AAACTTTCTTGGCTGCTGCCATTG-3';

[0094] Target 2 forward primer-F2: 5'-GTCAGGATGCACTACTCCCTCTCT-3';

[0095] Target 2 reverse primer-R2: 5'-AAACAGAGAGGGAGTAGTGCATCC-3';

[0096] Step 2: Prepare an enzyme digestion and ligation reaction solution containing the target adapter primer mixture from Step 1. Use the digestion-ligation method to ligate the target adapter to the gRNA expression cassette and amplify the gRNA expression cassette.

[0097] Step 3: Using the product obtained in Step 2 as a template, perform the first round of PCR amplification;

[0098] Step 4: Using the first-round PCR amplification product obtained in Step 3 as a template, perform the second round of PCR amplification, and estimate the product concentration after the amplification is completed;

[0099] Step 5: Mix the two second-round PCR products obtained in Step 4 in equal amounts, purify them with a DNA product purification kit, and take 2 μL of the purified product for agarose gel electrophoresis to check the purification effect. If the concentration is not less than 5 ng / μL, proceed to the next step.

[0100] Step 6: Ligate the gRNA expression cassette to the Cas9 plasmid using the cut-and-ligate method;

[0101] Step 7: After ligation, the ligation product from Step 6 is used to transform E. coli DH5α using the chemical heat shock method, plasmid is extracted, and sequencing is performed.

[0102] Step 8: Add CRISPR / Cas9- SlDCD2 Plasmid was transformed into EHA105 Agrobacterium competent cells;

[0103] Step 9: Add the CRISPR / Cas9- SlDCD2 Agrobacterium tumefaciens plasmid EHA105 infected tomato cotyledons and obtained transgenic positive seedlings. dcd2 .

[0104] The preferred embodiment is as follows: In step 2, the enzyme digestion and ligation reaction solution is: 1 μL of 10×cutsmart buffer, 20 ng of pYLgRNA-AtU# plasmid, 0.5 μL of target adapter primer, 0.4 μL of BsaI, 0.1 μL of T4 DNA ligase, 0.4 μL of T4 DNA ligase buffer, and ddH2O to a final volume of 10 μL; the PCR amplification parameters are: 37℃, 5 min; 20℃, 5 min; 5 cycles.

[0105] The preferred embodiment is as follows: Step 3 includes two PCR amplification reactions. The first round of PCR amplification consists of a 50 μL reaction system: 1 μL of the digestion-ligation product, 4 μL of primer pair UF / Rn (reaction 1), 1 μL of dNTPs, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5× Super-Fidelity DNA Polymerase buffer, and 33 μL of ddH2O; PCR conditions: 95℃, 1 min; 95℃, 10 s; 60℃, 15 s; 72℃, 15 s; 25 cycles; 72℃, 10 min; 4℃, ∞; The second round of PCR amplification consists of a 50 μL reaction system: 1 μL of the digestion-ligation product, 4 μL of primer pair F n / gRNA-R (reaction 2), 1 μL dNTPs, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5× Super-Fidelity DNA Polymerase buffer, 33 μL ddH2O; PCR conditions: 95℃, 1 min; 95℃, 10 s; 60℃, 15 s; 72℃, 15 s; 25 cycles; 72℃, 10 min; 4℃, ∞.

[0106] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0107] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

[0108] A preferred embodiment is as follows: the position-specific primer pairs are mixed in advance to form a 10× working solution, each at 1.5 μM: PT1 = 1.5 μL B1' + 1.5 μL B2 + 7 μL ddH2O, PT2L = 1.5 μL B2' + 1.5 μL BL + 7 μL ddH2O. The reaction system for target one consisted of: 1 μL each of the two target one PCR products from one round of PCR amplification, 3 μL of primer combination working solution PT1, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O. The reaction system for target two consisted of: 1 μL each of the two target two PCR products from one round of PCR amplification, 3 μL of primer combination working solution PT2, 0.6 μL of dNTPs, 0.6 μL of Super-Fidelity DNA Polymerase, 6 μL of 5× Super-Fidelity DNA Polymerase buffer, and 17.8 μL of ddH2O. After mixing, the mixture was placed in a PCR instrument. The PCR reaction conditions were: 95℃ for 1 min; 95℃ for 10 s, 60℃ for 15 s, 72℃ for 15 s, 18 cycles; 72℃ for 10 min. min; 4℃, ∞.

[0109] B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3';

[0110] B2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC

[0111] B2':TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG

[0112] BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC.

[0113] A preferred embodiment is as follows: Take 20-70 ng of the second-round purified product, add 80-100 ng of undigested pYLCRISPR / Cas9-DN plasmid, 1.5 μL of 10×cutsmart buffer, 0.5 μL of BsaI restriction enzyme, and bring the volume to 15 μL with ddH2O. After mixing, place the mixture in a PCR instrument at 37℃ for 10 min to digest the pYLCRISPR / Cas9-DN plasmid. Add 0.4 μL of 10×T4 DNA ligase buffer and 0.1 μL of T4 DNA ligase to the digested reaction system. After mixing again, place the mixture in a PCR instrument and perform the following reaction conditions: 37℃ for 2 min, 10℃ for 3 min, 20℃ for 5 min, 13 cycles; 37℃ for 2 min; 4℃ for ∞.

[0114] The preferred implementation method is as follows: In step 7, 1 μL of the ligation product obtained in step 7 is added to 100 µL of *E. coli* DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, and then incubated on ice for 2-3 min; 700 µL of LB liquid medium is added to a centrifuge tube and cultured at 37℃ and 200 rpm for 60 min; the cultured bacterial solution is centrifuged at 5000 rpm for 2 min, 600 µL of supernatant is discarded, and the remaining bacterial solution is evenly spread on LB solid medium containing kanamycin (500 µL of 10 mg / mL kanamycin per 100 mL of LB solid medium), and incubated upside down at 37℃ for 16 h; single colonies are picked, mixed with 10 µL of sterile water, and 2 µL of bacterial solution is used for colony identification. The colony PCR system is 25 μL: 2 μL bacterial solution, 1 μL each of primer pairs SP-DL / SP-R on a 10 μM binary vector, and 2×Rapid Taq. 12.5 μL of Master Mix and 8.5 μL of ddH2O were mixed and placed in a PCR instrument. PCR conditions were as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, 32 cycles; final extension at 72℃ for 5 min; 4℃ infinity. After the reaction, the PCR product band size was checked on an agarose gel to see if it met the theoretical value. The remaining bacterial culture with the correct band size was transferred to 4 mL of LB liquid medium containing kanamycin and cultured at 37℃ / 200 rpm for 16 h. Plasmids were extracted using a plasmid miniprep kit and run on an agarose gel to verify successful extraction. The extracted plasmids were sent to a biotechnology company for further sequencing and identification.

[0115] The preferred implementation method is as follows: In step 8, take 100 μL of Agrobacterium competent cells EHA105, thaw them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently tap the bottom of the centrifuge tube to mix, and incubate in sequence on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min; add 700 μL of antibiotic-free LB liquid medium, and culture at 28℃ with shaking for 2-3 h; centrifuge at 6000 rpm for 1 min to collect the bacteria, collect about 100 μL of supernatant, mix well by pipetting and resuspend the bacterial cells, spread them on LB-Kana / Rif solid medium, and incubate upside down in a 28℃ incubator for 2-3 days.

[0116] The preferred embodiment is as follows: In step 9, a single colony of Agrobacterium tumefaciens containing the Cas9 vector constructed in step 9 is picked and placed in 3 mL of LB liquid medium containing Kana and Rif. After incubation at 200 rpm and 28°C for 12-16 h, 300 µL is taken and placed in 20 mL of LB liquid medium containing Kana and Rif. The culture is then shaken at 200 rpm and 28°C for 6-7 h. The OD of the bacterial culture is detected using a spectrophotometer. 600 Centrifuge at 5000 rpm for 10 min at room temperature to a final concentration of 0.5-0.6 to collect bacterial cells. Dilute the bacterial cells with sterile water to a final concentration of 0.5-0.6. 600 =0.1-0.2, freshly prepared and used immediately. Tomato cotyledons and stem segments were pre-cultured in the dark for 2 days, then immersed in diluted Agrobacterium infection solution, shaken, and inoculated for 5 minutes. The infection solution was then discarded, and excess solution was aspirated with a pipette tip. The cotyledons and stem segments were then subjected to germination, shoot elongation, and rooting processes on culture media containing different plant hormones. Rooted explants were transferred to nutrient soil for subsequent sequencing and identification, resulting in transformed tomato plants. Subsequently, upstream and downstream primers were designed to extract DNA from the transgenic tomato plants, which was then amplified by PCR and sequenced for identification and analysis. SlDCD2 Whether gene editing has occurred.

[0117] The above description is merely a preferred embodiment for explaining the present invention and is not intended to limit the present invention in any way. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included within the scope of protection intended by the present invention.

Claims

1. A method for regulating the ripening of tomato fruits, characterized in that: Includes the following steps: Step 1: Mix and dilute the target-1 forward primer-F1, target-1 reverse primer-R1, target-2 forward primer-F2, and target-2 reverse primer-R2 with sterile ddH2O to a concentration of 1 μM. Then place the mixture in a PCR instrument and treat it at 88-92℃ for 25-35s. Then move it to room temperature to cool and complete the target primer annealing to obtain the target adapter primer mixture. Target 1 forward primer-F1: 5'-GTCACAATGGCAGCAGCCAAGAAA-3'; Target-1 reverse primer-R1: 5'-AAACTTTCTTGGCTGCTGCCATTG-3'; Target 2 forward primer-F2: 5'-GTCAGGATGCACTACTCCCTCTCT-3'; Target 2 reverse primer-R2: 5'-AAACAGAGAGGGAGTAGTGCATCC-3'; Step 2: Prepare an enzyme digestion and ligation reaction solution containing the target adapter primer mixture from Step 1. Use the digestion-ligation method to ligate the target adapter to the gRNA expression cassette and amplify the gRNA expression cassette. Step 3: Using the product obtained in Step 2 as a template, perform the first round of PCR amplification; Step 4: Using the first-round PCR amplification product obtained in Step 3 as a template, perform the second round of PCR amplification, and estimate the product concentration after the amplification is completed; Step 5: Mix the two second-round PCR products obtained in Step 4 in equal amounts, purify them with a DNA product purification kit, and take 2 μL of the purified product for agarose gel electrophoresis to check the purification effect. If the concentration is not less than 5 ng / μL, proceed to the next step. Step 6: Ligate the gRNA expression cassette to the Cas9 plasmid using the cut-and-ligate method; Step 7: After ligation, the ligation product from Step 6 is used to transform E. coli DH5α using the chemical heat shock method, plasmid is extracted, and sequencing is performed. Step 8: Add CRISPR / Cas9- SlDCD2 Plasmid was transformed into EHA105 Agrobacterium competent cells; Step 9: Add the CRISPR / Cas9- SlDCD2 Agrobacterium tumefaciens plasmid EHA105 infected tomato cotyledons and obtained transgenic positive seedlings. dcd2 .

2. The method for regulating tomato fruit ripening according to claim 1, characterized in that: In step 2, the enzyme digestion and ligation reaction solution was: 1 μL of 10×cutsmart buffer, 20 ng of pYLgRNA-AtU# plasmid, 0.5 μL of target adapter primer mixture, 0.4 μL of BsaI, 0.1 μL of T4 DNA ligase, 0.4 μL of T4 DNA ligase buffer, and ddH2O to a final volume of 10 μL. The PCR amplification parameters were: 37℃ for 5 min; 20℃ for 5 min; 5 cycles.

3. The method for regulating tomato fruit ripening according to claim 1, characterized in that: Step 3 includes two PCR amplification reactions. The first round of PCR amplification uses a 50 μL reaction system: 1 μL of digestion-ligation product, 4 μL of primer pair UF / Rn, 1 μL of dNTPs, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5× Super-Fidelity DNA Polymerase buffer, and 33 μL of ddH2O. PCR conditions: 95℃, 1 min; 95℃, 10 s; 60℃, 15 s; 72℃, 15 s; 25 cycles; 72℃, 10 min; 4℃, ∞. The second round of PCR amplification uses a 50 μL reaction system: 1 μL of digestion-ligation product, 4 μL of primer pair F... n / gRNA-R, 1 μL dNTPs, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5× Super-Fidelity DNA Polymerase buffer, 33 μL ddH2O; PCR conditions: 95℃, 1 min; 95℃, 10 s; 60℃, 15 s; 72℃, 15 s; 25 cycles; 72℃, 10 min; 4℃, ∞; UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

4. The method for regulating tomato fruit ripening according to claim 1, characterized in that: Pre-mix position-specific primer pairs into a 10× working solution, each at 1.5 μM: PT1 = 1.5 μL B1' + 1.5 μL B2 + 7 μL ddH2O, PT2L = 1.5 μL B2' + 1.5 μL BL + 7 μL ddH2O; Target 1 reaction system: 1 μL each of the two target 1 PCR products from one round of PCR amplification, 3 μL primer combination working solution PT1, 0.6 μL dNTPs, 0.6 μL Super-Fidelity DNA Polymerase, 6 μL 5× Super-Fidelity DNA Polymerase buffer, 17.8 μL ddH2O; Target 2 reaction system: 1 μL each of the two target 2 PCR products from one round of PCR amplification, 3 μL primer combination working solution PT2L, 0.6 μL dNTPs, 0.6 μL Super-Fidelity DNA Polymerase, 6 μL 5× Super-Fidelity DNA Polymerase buffer, 17.8 μL ddH2O; Mix μL of 5×Super-Fidelity DNAPolymerase buffer with 17.8 μL of ddH2O and place in a PCR instrument; PCR reaction conditions are: 95℃, 1 min; 95℃, 10 s, 60℃, 15 s, 72℃, 15 s, 18 cycles; 72℃, 10 min; 4℃, ∞. B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3'; B2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC; B2':TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG; BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC.

5. The method for regulating tomato fruit ripening according to claim 1, characterized in that: Take 20-70 ng of the second-round purified product, add 80-100 ng of undigested pYLCRISPR / Cas9-DN plasmid, 1.5 μL of 10×cutsmart buffer, 0.5 μL of BsaI restriction enzyme, and add ddH2O to make up the volume to 15 μL; after mixing, place in a PCR instrument at 37℃ for 10 min to digest the pYLCRISPR / Cas9-DN plasmid; add 0.4 μL of 10×T4 DNA ligase buffer and 0.1 μL of T4 DNA ligase to the digested reaction system; after mixing again, place in a PCR instrument and perform the reaction under the following conditions: 37℃ for 2 min, 10℃ for 3 min, 20℃ for 5 min, 13 cycles; 37℃ for 2 min; 4℃ infinity.

6. The method for regulating tomato fruit ripening according to claim 1, characterized in that: In step 7, 1 μL of the ligation product obtained in step 6 was added to 100 µL of *E. coli* DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, and then incubated on ice for 2-3 min. 700 µL of LB liquid medium was added to a centrifuge tube and incubated at 37℃ and 200 rpm for 60 min. The resulting bacterial culture was centrifuged at 5000 rpm for 2 min, 600 µL of supernatant was discarded, and the remaining bacterial culture was evenly spread onto LB solid medium containing kanamycin and incubated upside down at 37℃ for 16 h. Single colonies were picked, mixed with 10 µL of sterile water, and 2 µL of the bacterial culture was used for colony identification. The colony PCR system was 25 μL: 2 μL bacterial culture, 1 μL each of primer pairs SP-DL / SP-R from the 10 μM binary vector, 12.5 μL of 2×Rapid Taq Master Mix, and 8.5 μL of ddH2O. μL, mixed well and placed in a PCR instrument; PCR conditions: pre-denaturation 95℃ 3min; denaturation 95℃ 15s, annealing 55℃ 1min, extension 72℃ 45s, 32 cycles; complete extension 72℃ 5min; 4℃ ∞; after the reaction, check whether the PCR product band size meets the theoretical value on an agarose gel. Transfer the remaining bacterial culture with the correct band size to 4 mL of LB liquid medium containing kanamycin and culture in a shaker at 37℃ / 200 rpm for 16 h. Extract plasmids using a plasmid miniprep kit and run on an agarose gel to verify the success of plasmid extraction. Send the extracted plasmids to a biotechnology company for further sequencing and identification.

7. The method for regulating tomato fruit ripening according to claim 1, characterized in that: In step 8, take 100 μL of Agrobacterium competent cells EHA105, thaw them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently tap the bottom of the centrifuge tube to mix, and incubate sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min; add 700 μL of antibiotic-free LB liquid medium, and incubate at 28℃ with shaking for 2-3 h; centrifuge at 6000 rpm for 1 min to collect the bacteria, collect about 100 μL of supernatant, mix well by pipetting and resuspend the bacterial cells, spread them on LB-Kana / Rif solid medium, and incubate upside down in a 28℃ incubator for 2-3 days.

8. The method for regulating tomato fruit ripening according to claim 1, characterized in that: In step 9, a single colony of Agrobacterium tumefaciens containing the Cas9 vector constructed in step 8 was picked and placed in 3 mL of LB broth containing Kana and Rif. The culture was incubated at 28°C for 12-16 h at 200 rpm. Then, 300 µL of the culture was transferred to 20 mL of LB broth containing Kana and Rif and incubated with shaking at 28°C for 6-7 h at 200 rpm. The OD of the bacterial culture was then measured using a spectrophotometer. 600 Centrifuge at 5000 rpm for 10 min at room temperature to collect bacterial cells, and dilute the bacterial cells with sterile water to 0.5-0.6 OD. 600 =0.1-0.2, prepare and use immediately; after pre-culturing tomato cotyledons and stem segments in the dark for 2 days, soak them in diluted Agrobacterium infection solution, shake, infect for 5 minutes, pour off the infection solution, and remove excess infection solution with a pipette tip. Then, let the cotyledons and stem segments germinate, elongate, and root on culture media containing different plant hormones. Transfer the rooted explants to nutrient soil for subsequent sequencing and identification to obtain transformed tomato plants; Subsequently, upstream and downstream primers were designed to target the genetically modified tomato plants, DNA was extracted, amplified by PCR, and sequenced for identification and analysis. SlDCD2 Whether gene editing has occurred.

Images