A computer-aided design-based sideflow chromatography test strip

Abstract

This invention discloses a computer-aided design-based lateral flow chromatography test strip. The test strip includes a backing layer, on which a sample pad, a conjugation pad, a chromatographic membrane, and an absorption pad are sequentially and partially overlapped from one end to the other. The test strip identifies samples based on ligand enzymes, preferably using colloidal gold chromatography. RNA adapter probes are designed at both ends of the ligand enzyme using computer-aided design based on secondary structure prediction. Biotin on both the colloidal gold and the chromatographic membrane is coupled with oligonucleotide sequences that are complementary to the RNA adapter probes at both ends of the ligand enzyme, thereby achieving lateral flow chromatography detection of the sample. The chromatographic test strip of this invention is highly efficient and rapid, simplifies the screening process, reduces the number of probe optimization designs, reduces product variability, improves the versatility of the test strip platform, and improves detection sensitivity compared to existing methods.

Description

Technical Field

[0001] This invention relates to the field of lateral flow chromatography detection, and more particularly to a lateral flow chromatography test strip based on computer-aided design. Background Technology

[0002] Lateral flow chromatography (LFA) is a paper-based detection platform characterized by low cost, ease of development and production, and rapid results delivery. It is widely used in on-site testing and has broad applications in food safety, environmental monitoring, and clinical diagnostics. The test strip consists of five parts: a sample pad, an absorbent pad, a binding pad, a chromatographic membrane, and a backing layer. The detection zone, including the test line (T line) and control line (C line), is fixed onto a chromatographic membrane (NC membrane), typically made of nitrocellulose. A dispenser is used to spray the captured biological receptors onto the chromatographic membrane, generating the T line and C line. The sample extract is placed on the sample pad and moves towards the absorbent pad by capillary action. During this process, the molecule of interest reacts with the recognition and signaling elements. Qualitative or quantitative analysis is based on the presence, color density, or signal intensity of the T line, which can be determined visually or with a bar scanner reader. The principle and form of LFA vary depending on the analyte and target. Detection methods can be competitive (inhibition) or direct (sandwich) and should be adaptable to qualitative, semi-quantitative, and quantitative assays.

[0003] Self-cleaving nucleoligands are cleavage-type ribozymes that are self-catalyzed in nature, such as hammerhead ribozymes in plant viroids, viruses, and satellite RNA. They can be obtained by in vitro screening techniques—Systematic evolution of ligands by exponential enrichment (SELEX) or de novo rapid in vitro evolution of RNA biosensors (DRIVER)—to obtain a short structured oligonucleotide sequence (RNA or DNA). These sequences can bind to corresponding target molecules (proteins, heavy metal ions, small molecule compounds, etc.) with high affinity and strong specificity.

[0004] Currently, there is limited research on colloidal gold side-flow chromatography test strip development platforms based on ligand enzyme recognition of small molecule compounds in the environment. For a specific target molecule, the ligand enzyme needs to undergo a lengthy screening process, and the probes on the test strip need to be repeatedly optimized and designed. The test strip has poor versatility and the detection sensitivity needs to be improved.

[0005] Currently, the application of self-cleaving ligand enzyme colloidal gold lateral chromatography test strips in small molecule detection is limited both domestically and internationally. However, the detection of target molecules using self-cleaving ligand enzymes has been achieved in the laboratory through other techniques such as colorimetric detection. In the literature (Colorimetric detection of proteins based on target-induced activation of aptazyme. Anal Chim Acta. 2016; 942:68-73. doi:10.1016 / j.aca.2016.09.010), a colorimetric method for protein assay based on target-triggered aptamer activation was employed. The conformational change of the aptamer induced by the target protein was designed to be associated with aptamer activation. Therefore, in the presence of the target protein, the designed DNA linker will be cleaved into two fragments (GNPs) that cannot crosslink gold nanoparticles, thus the GNP solution remains red. In the absence of the target, the color changes. Taking the detection of vascular endothelial growth factor (VEGF) as an example, it can exhibit analytical performance with a detection limit as low as 0.1 nM, spanning a detection range of three orders of magnitude. However, colorimetric methods require a longer incubation time, are more complex, and are less intuitive than LFA.

[0006] A similar implementation currently available is a universal ligand-enzyme colloidal gold lateral flow chromatography test strip for detecting small molecules (patent application number: CN202110660432.5). This strip utilizes nucleic acid ligand enzymes to detect small molecule compounds such as kanamycin or OTA. It uses polyA-DNA as an anchor block, anchored onto gold nanoparticles as a probe, and employs AuNPs@poly-DNA to rapidly and sensitively capture the ligand enzyme. Furthermore, the partially complementary nucleic acid chains of SA and DNA sprayed in the test and control areas do not need to be altered; only the nucleic acid chain on the probe needs to be changed to detect another substance. However, it uses universal complementary nucleic acid chains, which may partially hybridize with the selected ligand enzyme recognition sequence, affecting the detection results.

[0007] In summary, existing probe designs are difficult to implement, requiring repeated optimization of probe designs on test strips. They also have poor versatility, while universal probes may interfere with the recognition sequence, resulting in low detection sensitivity. Furthermore, the detection cost is high, and there are significant batch-to-batch variations in products.

[0008] Therefore, those skilled in the art are dedicated to developing an efficient and rapid lateral flow chromatography test strip to simplify the screening process, reduce the number of probe design optimizations, reduce product variability, improve the versatility of the test strip platform, and enhance detection sensitivity compared to existing solutions. Summary of the Invention

[0009] In view of the above-mentioned deficiencies of the prior art, the present invention develops a side-flow chromatography test strip that is efficient, convenient, has a simple process, reduces product variability, and improves versatility and sensitivity.

[0010] To achieve the above objectives, the present invention provides a computer-aided design-based lateral flow chromatography test strip, characterized in that the test strip includes a backing layer, on which a sample pad, a conjugate pad, a chromatographic membrane, and an absorbent pad are sequentially and partially overlapped from one end to the other. The sample pad is partially overlapped on the conjugate pad, and the conjugate pad is partially overlapped on the chromatographic membrane. The chromatographic membrane is located at the bottom layer, closely attached to the backing layer. One end of the absorbent pad is partially overlapped on the chromatographic membrane. In use, the lateral flow chromatography test strip is co-incubated with the sample using a pre-transcribed ligand enzyme. The ligand enzyme recognizes the target molecules in the sample and is then dropped onto the sample pad.

[0011] In a preferred embodiment of the present invention, the test strip is a colloidal gold lateral flow chromatography test strip, the chromatographic membrane is an NC membrane, the binding pad is added with an oligomeric conjugate solution of colloidal gold particles and then dried, the colloidal gold is coupled with thiol-modified oligonucleotides, and the test area and control area of ​​the NC membrane are respectively dispensed with biotin-oligonucleotide-T and biotin-oligonucleotide-C solutions and then dried.

[0012] In another preferred embodiment of the present invention, the preparation process of colloidal gold particles in the pad is as follows: colloidal gold particles are obtained by reducing chloroauric acid solution with sodium citrate and incubating with thiol-modified oligonucleotides, and uncoupled colloidal gold particles are precipitated by adding NaCl, and the coupled colloidal gold particles are taken out for use in test strips.

[0013] In another preferred embodiment of the present invention, before adding biotin-oligonucleotide-T and biotin-oligonucleotide-C, streptavidin is added to biotin-oligonucleotide-T and biotin-oligonucleotide-C in a certain proportion.

[0014] In another preferred embodiment of the present invention, RNA adapter probes are respectively attached to the 5' prefix end and the 3' suffix end of the ligand enzyme.

[0015] In another preferred embodiment of the present invention, the design process of the RNA adapter probe is as follows: a specific computer algorithm is used to explore the sequence space of the RNA adapter probe of the selected ligand enzyme, and secondary structure prediction is performed on all selected ligand enzymes and selected ligand enzymes with RNA adapter probes attached to the 5' prefix and 3' suffix ends. The structure prediction information is then used to evaluate and screen the RNA adapter probes, and the probe with the least impact on the spatial structure of the selected ligand enzyme is selected.

[0016] In another preferred embodiment of the present invention, the specific computer algorithm is a random sampling or full sampling algorithm.

[0017] In another preferred embodiment of the present invention, the ligand enzyme is Gard-337, and its DNA template sequence is as follows:

[0018] GCUGUCACCGGAAUAGUCGAUGGGUGCCACAUAGCGCCAGAAUCCAGUCUGAUGAGUCUCUCGGCAGGACGAAACAGC.

[0019] In another preferred embodiment of the present invention, the ligand enzyme Gard-337 is coupled with RNA adapter probes at both ends, the sequences of which are as follows:

[0020] The 5' end sequence is GGGUGUAAAACCUCCUCGUGU

[0021] The 3' end sequence is CAGCUCUGACCCUUUUG.

[0022] In another preferred embodiment of the present invention, RNA adapter probes are respectively attached to the 5' prefix end and the 3' suffix end of the ligand enzyme. The probe at the 5' prefix end is complementary to the thiol-modified oligonucleotide sequence coupled to colloidal gold, and the probe at the 3' suffix end is complementary to the biotin-coupled oligonucleotide sequence.

[0023] To address the aforementioned issues, we selected ligand enzymes instead of traditional antibodies in our colloidal gold immunochromatographic assay strips. This invention utilizes an RNA biosensor to achieve rapid de novo in vitro evolution and high-throughput screening of self-cleaving nucleic acid ligand enzymes. Computer algorithms are used to design different adapter sequences for different ligand enzymes, coupling colloidal gold particles without interfering with their secondary structure, achieving the following technical effects:

[0024] 1. Low cost: Ligand enzymes can be artificially amplified, resulting in high yields at low cost;

[0025] 2. Short testing time: Each test takes less than 10 minutes;

[0026] 3. Low batch-to-batch variability: High fidelity of nucleic acid sequences;

[0027] 4. Convenient storage and transportation: Unlike antibody proteins, it does not require long-distance cold chain transportation;

[0028] 5. High versatility: High-quality probes are designed through algorithms to minimize interference and are suitable for different types of ligand enzymes.

[0029] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0030] Figure 1 This is a preferred embodiment of the algorithm flow for computer-aided design of connectors;

[0031] Figure 2 This is a schematic diagram of the predicted secondary structure of a ligand enzyme after computer-aided design, according to a preferred embodiment of the present invention.

[0032] Figure 3 This is a verification diagram of the self-cleavage function of the ligand enzyme Gard337 in a preferred embodiment of the present invention;

[0033] Figure 4 This is a schematic diagram of the structure of a side-flow chromatography test paper according to a preferred embodiment of the present invention;

[0034] Figure 5 This is a schematic diagram illustrating the detection principle of colloidal gold test strips according to a preferred embodiment of the present invention;

[0035] Figure 6 This is a schematic diagram of a preferred embodiment of the colloidal gold test strip for testing the lower limit of detection. Detailed Implementation

[0036] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0037] Example 1: Preparation of test strips based on Gard-337 ligand enzymes

[0038] 1. Selecting ligand enzymes

[0039] Different ligands have the ability to specifically bind to different targets, and the diversity of nucleic acid sequences also gives rise to a vast variety of ligands. First, from the ligand libraries that have been reported in the literature, a known ligand with high selectivity and binding ability is selected as the development target. Based on the target to be detected, the ligand is selected according to the existing literature reports. In this embodiment, the ligand Gard-337 is selected as the verification target, but other types of ligands can also be used.

[0040] 2. Designing ligand-enzyme linker sequences using algorithms

[0041] See the probe design process. Figure 1First, in this embodiment, random sampling or full sampling is preferably used to explore the sequence space of the RNA adapter probes of the selected ligand enzymes (each ligand enzyme has a corresponding probe sequence space), but other algorithms can also be used for design. Then, secondary structure prediction is performed on all selected ligand enzymes and selected ligand enzymes with RNA adapter probes attached to the 5' prefix and 3' suffix, respectively. The structure prediction information is used to evaluate and screen the probes, and finally, the probe with the least impact on the spatial structure of the ligand enzyme is selected.

[0042] The screening and evaluation process is as follows: A random sampling procedure with specific filtering steps (i.e., randomly generated RNA sequences as probes) is used to generate a ligand enzyme probe with a total length of approximately 40 nt. This filtering step can filter out 10-20% of the sequences obtained from random or full sampling, saving computational resources to some extent: CG content: between 40% and 60%; Repeat restrictions: Single-base repeats: 4 consecutive Gs and 5 consecutive A / C / Us are not allowed; Double-base repeats: 5-nucleotide dinucleotides are not allowed. Then, existing software (deploying the Vienna RNA package) is used to predict the RNA secondary structure, and the prediction results are output in bracket notation (.dbn file). The Vienna web server predicts the secondary structure of single-stranded RNA sequences. For partition function calculations, the maximum length is limited to 7,500 nt, and the prediction results are sorted according to free energy; the smaller the free energy, the higher the score. Finally, the RNA adapter probe with the highest score, containing the 5' prefix and 3' suffix of the selected ligand enzyme, is used.

[0043] Preferably, a ligand enzyme probe with a total length of approximately 40 nt is designed, thus the probe sequence has 4 degrees of freedom in space. 40 The degree of freedom at this point is too large to traverse all sequences. Therefore, given this situation, an efficient sampling method is needed to reduce time costs. Exhaustive sampling, sequence evolution, and MCMC sampling were tried, and random sampling (i.e., randomly generated RNA sequences as probes) was ultimately chosen. Simultaneously, a full sampling function was implemented, allowing it to be used when the spatial degree of freedom of the probe sequences is not too large. Furthermore, to reduce the burden on the model in the structure prediction part, a filtering step was designed based on several basic principles of probe design. This step can filter out 10-20% of the sequences obtained from random sampling or full sampling, saving computational resources to some extent: CG content: between 40% and 60%; Repeat restrictions: Single base repeats: 4 consecutive Gs and 5 consecutive A / C / Us cannot appear; Double base repeats: 5 consecutive dinucleotides cannot appear. The preferred RNA adapter sequence for the ligand enzyme Gard-337 is as follows:

[0044] The 5' end sequence is GGGUGUAAAACCUCCUCGUGU

[0045] The 3' end sequence is CAGCUCUGACCCUUUUG.

[0046] Using existing software to predict RNA secondary structure, such as Figure 2 As shown. The Vienna RNA Package, a basic RNA secondary structure analysis software, was deployed. This software outputs structure prediction results in dotted bracket notation (.dbn files). The software's effectiveness was tested using tRNA structure data from tRNAdb (transfer RNA database). A total of 601 tRNAs were included in the experiment, and the secondary structure prediction accuracy was over 80%.

[0047] The steps for synthesizing ligand enzymes are as follows:

[0048] (1) First, DNA templates for the ligand enzyme Gard-337 were synthesized on plasmid pUC-57, with or without a adapter. (GCUGUCACCGGAAUAGUCGAUGGGUGCCACAUAGCGCCAGAA UCCAGUCUGAUGAGUCUCUCGGCAGGACGAAACAGC, the above is the sequence without the adapter) The inactive form (with G12A mutation) was obtained by the Hieff Mut™ Multisite Directed Mutagenesis Kit (11004ES10, Yeason). These products were transformed into E. coli, and plasmids (DC201-01, Vazyme) were extracted from single-clone colonies and amplified before sequencing to confirm the mutation.

[0049] (2) Transcribe the ligand enzyme Gard-337 and verify the autocleavage activity of the ligand enzyme Gard-337.

[0050] Based on existing methods for characterizing ribozyme self-cleavage, an experiment based on urea-denaturing polyacrylamide gel electrophoresis was designed. The excised sequence occurs during ligand enzyme self-cleavage, and the band positions change during electrophoresis. Using templates from different aptamers in in vitro T7 transcription reactions, and excess target molecules determined in the literature based on the change in cleavage fraction with ligand concentration, two bands were observed representing self-cleaved aptamers and non-cleaved aptamers. To obtain higher resolution, cleaved and uncleaved ligand enzymes were separated using 10% urea-denaturing TBE PAGE gels, such as... Figure 3 As shown.

[0051] 3. Preparation of colloidal gold particles

[0052] This embodiment preferably uses colloidal gold display, but fluorescence-quenching method can also be used as an alternative.

[0053] Colloidal gold particles were obtained by reducing chloroauric acid solution with sodium citrate and incubating with thiol-modified oligonucleotides. Uncoupled colloidal gold particles were precipitated by adding NaCl, and the coupled colloidal gold particles were taken out for later use.

[0054] First, add 4 mL of 1% trisodium citrate to 100 mL of boiling HAuCl4 solution (0.01%). After it turns red, boil the solution for another 10 minutes. Store the resulting colloidal gold particle (AuNPs) solution at 4°C until use.

[0055] Prior to coupling between AuNPs and oligonucleotides, 40 μL of 0.5 M TCEP was added to 1 mL of 10 μM HS-oligonucleotide solution to activate the oligonucleotides, and the mixture was incubated at room temperature for 1–2 hours. Then, 52 μL of the activated oligonucleotide solution was added to 1 mL of AuNPs solution and shaken overnight at 4 °C. The mixture was then aged by slowly adding 1.5 M NaCl solution until a final concentration of 75 mM NaCl was reached, and then incubated at 4 °C for 24 hours. The particles were centrifuged (12 × 10^3 rpm, 20 min, 4 °C) and washed with wash buffer (20 mM Na3PO4, 5% BSA, 0.25% Tween-20, and 10% sucrose). The thiol-modified oligonucleotide sequence coupled to colloidal gold is complementary to the ligand enzyme prefix, i.e., the 5' end RNA adapter probe sequence.

[0056] 4. Preparation of colloidal gold test paper

[0057] The structure of the test strip is as follows Figure 4 As shown, the band consists of a sample pad (Shanghai Jiening Biotechnology Co., Ltd. SF-08), a conjugate pad (Shanghai Jiening Biotechnology Co., Ltd. G-4), an NC membrane (Sartorius CN140), and an absorbent pad (Shanghai Jiening Biotechnology Co., Ltd. H-5076) on a backing layer. The sample pad (4 mm × 12 mm) was immersed in a buffer solution (1% NaCl, 1% BSA, 0.5% Tween-20, 1% Triton X-100) and dried overnight at 50 °C, then cut to specific sizes. The conjugate pad was treated under the same conditions and cut to 4 mm × 6 mm. Then, 20 μL of AuNPs-oligomeric coupling agent solution was added to the coupling pad, and then dried at 50 °C. Biotin-oligonucleotide-T and biotin-oligonucleotide-C solutions were dispensed into the test and control areas of the NC membrane, and then dried at 37 °C for 2 h. Finally, the sample pad, conjugate pad, and absorbent pad were assembled together, as shown. Figure 4 As shown, on the backing layer, the sample pad, conjugate pad, NC membrane and absorbent pad are arranged in a partially overlapping manner from one end to the other. The sample pad is partially overlapped on the conjugate pad, the conjugate pad is partially overlapped on the NC membrane, the NC membrane is close to the backing layer and located at the bottom layer, and one end of the absorbent pad is partially overlapped on the chromatographic membrane. Preferably, they overlap by 2 mm.

[0058] For the control area, 25 μL of 10 μM biotin-oligonucleotide-C was mixed with 75 μL of 1 mg / mL streptavidin and incubated at room temperature for 2 hours. After incubating the mixture at room temperature for 2 hours, it was centrifuged at 14,000 rpm for 20 minutes using a centrifuge filter (30 kDa cutoff, nanopores) to remove excess oligonucleotides. The biotin-oligonucleotide-C and streptavidin conjugate was then washed with PBS for 3 cycles. PBS was then added to the mixture until its initial volume was reached before centrifugation.

[0059] For the test area, 10 μL of 10 μM biotin-oligonucleotide-T was mixed with 60 μL of 1 mg / mL streptavidin and incubated at room temperature for 2 hours. The mixture was then incubated at room temperature for 2 hours, followed by centrifugation at 14,000 rpm for 20 minutes using a centrifuge filter (30 kDa cutoff, nanopores) to remove excess oligonucleotides. The biotin-oligonucleotide-T and streptavidin conjugate was then washed with PBS for 3 cycles. PBS was then added to the mixture until its initial volume was reached before centrifugation.

[0060] The biotin-conjugated oligonucleotide sequence is complementary to the RNA linker probe sequence at the 3' end of the ligand enzyme suffix.

[0061] In this embodiment, the two RNA linker probes of the ligand enzyme are located at the prefix and suffix of the ligand enzyme, respectively. These two probes are complementary to the thiol-modified oligonucleotide coupled to the colloidal gold particles and the biotin-modified oligonucleotide coupled online, respectively. As shown in this embodiment, streptavidin is implanted into the control region and the test region in a certain ratio. The 5' end of the ligand enzyme is complementary to the thiol-modified oligonucleotide sequence coupled to the colloidal gold, and the 3' end is complementary to the biotin-coupled oligonucleotide sequence, as shown below. Figure 5 As shown, in the positive case, the sandwich-like structure can "capture" AuNPs (gold nanoparticles) to the T-line region, and the collected AuNPs show a clear red line here; in the negative case, the ligand enzyme that does not bind to the target will catalyze the autolysis process, and the 5' end will dissociate and be washed away by the transverse flow buffer. Therefore, the AuNPs will no longer collect on the T-line and will not show any color.

[0062] 5. Sensitivity Characterization

[0063] To validate the sensitivity of the test strip, Gard-337 was used again with the addition of probe sequences. First, different concentrations of small target molecules were added to the transcription system to try to find the limit of detection (LOD) of the detection system, and the system was fine-tuned to improve sensitivity and reduce false positives. Figure 6As shown, the test strip of this invention exhibits good differentiation at different concentrations. Within a certain concentration range, the color depth of the T line shows a good linear relationship with the concentration of the target molecule. Using a colloidal gold test reader, semi-quantitative analysis of the target molecule within a certain concentration range can be achieved. Analysis demonstrates that this test strip has a low detection limit (10 μM).

[0064] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A sideflow chromatography detection composition based on computer-aided design, characterized in that, The test strip includes a test strip, a ligand enzyme, and an RNA adapter probe. The test strip includes a backing layer. On the backing layer, a sample pad, a conjugate pad, a chromatographic membrane, and an absorbent pad are arranged in partial overlap from one end to the other. The sample pad is partially overlapped on the conjugate pad, and the conjugate pad is partially overlapped on the chromatographic membrane. The chromatographic membrane is located at the bottom layer, closely attached to the backing layer. One end of the absorbent pad is partially overlapped on the chromatographic membrane. When the test strip is used, the pre-transcribed ligand enzyme is co-incubated with the sample. The ligand enzyme recognizes the target molecules in the sample and is then dropped onto the sample pad. The test strip is a colloidal gold side-flow chromatography test strip, the chromatographic membrane is an NC membrane, the binding pad is added with an oligomeric conjugate solution of colloidal gold particles and then dried, the colloidal gold is coupled with thiol-modified oligonucleotides, the test area and control area of ​​the NC membrane are respectively dispensed with biotin-oligonucleotide-T and biotin-oligonucleotide-C solutions and then dried. The ligand enzyme is Gard-337, and its DNA template sequence is as follows: GCUGUCACCGGAAUAGUCGAUGGGUGCCACAUAGCGCCAGAAUCCAGUCUGAUGAGUCUCUCGGCAGGACGAAACAGC; The ligand enzyme Gard-337 has RNA adapter probes attached to both ends, with the following sequences: The 5' end sequence is GGGUGUAAAACCUCCUCGUGU The 3' end sequence is CAGCUCUGACCCUUUUG; The ligand enzyme has RNA adapter probes attached to its 5' prefix and 3' suffix, respectively. The probe at the 5' prefix is ​​complementary to the thiol-modified oligonucleotide sequence coupled to colloidal gold, and the probe at the 3' suffix is ​​complementary to the biotin-coupled oligonucleotide sequence.

2. The sideflow chromatography detection composition based on computer-aided design as described in claim 1, characterized in that, The preparation process of the colloidal gold particles in the bonding pad is as follows: Colloidal gold particles were obtained by reducing chloroauric acid solution with sodium citrate and incubating with thiol-modified oligonucleotides. Uncoupled colloidal gold particles were precipitated by adding NaCl, and the coupled colloidal gold particles were taken out for use in test strips.

3. The sideflow chromatography detection composition based on computer-aided design as described in claim 1, characterized in that, Before adding biotin-oligonucleotide-T and biotin-oligonucleotide-C, streptavidin was added to biotin-oligonucleotide-T and biotin-oligonucleotide-C in a certain proportion.

4. The sideflow chromatography detection composition based on computer-aided design as described in claim 1, characterized in that, The design process of the RNA adapter probe involves using a specific computer algorithm to explore the sequence space of the RNA adapter probe of the selected ligand enzyme, predicting the secondary structure of all selected ligand enzymes and selected ligand enzymes with RNA adapter probes attached to the 5' prefix and 3' suffix, and using the structure prediction information to evaluate and screen the RNA adapter probes, selecting the probe that has the least impact on the spatial structure of the selected ligand enzyme.

5. The sideflow chromatography detection composition based on computer-aided design as described in claim 4, characterized in that, The specific computer algorithm is a random sampling or full sampling algorithm.

Images