BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor and its preparation and application

Abstract

The present invention belongs to the field of fluorescence analysis and detection technology, and specifically provides a BCNO-CQDs-aptamer / CoOOHNSs fluorescence sensor and its preparation method and application, including BCNO-CQDs as a donor in fluorescence energy resonance transfer, cobalt oxyhydroxide nanosheets (CoOOHNSs) as an acceptor in fluorescence energy resonance transfer, BCNO-CQDs and CoOOH NSs are connected by an aptamer; BCNO-CQDs are prepared by compounding BCNO QDs and CQDs. The present invention is a fluorescence sensor based on fluorescence resonance energy transfer with high detection sensitivity, and the preparation method is simple, and in the practical application of detecting bisphenol A, it has the advantages of low cost, high sensitivity and strong specificity.

Description

Technical Field

[0001] The invention belongs to the technical field of fluorescence analysis and detection, and relates to a nucleic acid aptamer sensor based on fluorescence resonance energy transfer, in particular to a BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor and a preparation method and application thereof. Background Art

[0002] Bisphenol A (Bisphenol A), also known as BPA, is used in the industry to synthesize materials such as polycarbonate (PC) and epoxy resin. In recent years, it has been used to make plastic (milk) bottles, sippy cups for infants, and the inner coating of food and beverage (milk powder) cans. BPA is everywhere, from mineral water bottles, medical devices to the inside of food packaging. About 27 million tons of BPA plastics are produced worldwide. But BPA can also cause endocrine disorders and threaten the health of fetuses and children. The latest research shows that obesity caused by cancer and metabolic disorders is also believed to be related to this. Therefore, the European Union believes that baby bottles containing bisphenol A can induce precocious puberty. From March 2, 2011, the production of baby bottles containing the chemical bisphenol A (BPA) is prohibited. In this regard, the detection of bisphenol A in the environment is very important.

[0003] Fluorescence detection technology based on nucleic acid aptamers is a relatively new detection technology in recent years, with the advantages of strong selectivity, easy operation, fast response speed, etc. As the technology of artificial aptamers becomes more and more mature, nucleic acid aptamers are gradually applied to biosensors, immunoblotting and biomarker identification, and have become an indispensable part of people's establishment of biosensors. Summary of the invention

[0004] In order to determine the residual amount of bisphenol A in food or actual water samples with high sensitivity and selectivity, the present invention proposes a BCNO-CQDs-aptamer / CoOOH NSs fluorescent sensor and its preparation and application. Based on the fluorescence resonance energy transfer between BCNO-CQDs-aptamer and CoOOH NSs, and the selection of aptamers, the selectivity and sensitivity of the target detection object are greatly improved. The fluorescent nucleic acid aptamer sensor based on the present invention can realize the rapid detection of bisphenol A content, the method of use is simple, and it has high use value.

[0005] In order to achieve the above-mentioned object, the present invention provides a BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor, comprising a BCNO-CQDs (boron oxynitride and carbon quantum dot complex) fluorescent composite material as a donor in fluorescence resonance energy transfer, CoOOH NSs (cobalt oxyhydroxide nanosheets) as an acceptor in fluorescence resonance energy transfer, and a bisphenol A aptamer for connecting the donor and the acceptor.

[0006] The specific nucleotide sequence of the bisphenol A aptamer is: 5'-COOH-CCGGTGGGTGGTCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCGCATCACGGGTTCGCACCA-3'.

[0007] The present invention also provides a method for preparing the above-mentioned BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor, comprising the following steps:

[0008] A certain concentration of bisphenol A aptamer is dropped into a mixed aqueous solution of EDC and NHS to obtain an activated aptamer solution; then the BCNO-CQDs solution is added to obtain a BCNO-CQDs-aptamer solution; finally, CoOOH NSs is added and stirred thoroughly to obtain the highly sensitive and selective fluorescent sensor based on BCNO-CQDs-aptamer / CoOOH NSs.

[0009] BCNO-CQDs are prepared by mixing BCNO QDs, citric acid and ethylenediamine and then undergoing a hydrothermal reaction. Specifically, the preparation method of BCNO-CQDs includes: adding BCNO QDs (boron oxynitride quantum dots) to the process of preparing CQDs (carbon quantum dots) based on citric acid and ethylenediamine for a hydrothermal reaction to obtain a BCNO-CQDs composite material. The fluorescence intensity of BCNO QDs is about 20,000, and the fluorescence intensity of CQDs is about 30,000. After hydrothermal compounding, the fluorescence intensity is 3 times that of CQDs. Moreover, compared with the method of simply mixing BCNO QDs with CQDs (the NH bond in BCNO QDs undergoes an amidation reaction with the C=O bond in C QDs, thereby reducing the possibility of connecting to the aptamer), the surface of the quantum dots can be modified with more functional groups to facilitate the connection of the aptamer in the later stage and improve the detection sensitivity.

[0010] More specifically, a solution containing 4 g of citric acid and 1.43 mL of ethylenediamine was mixed in 10 mL of water and stirred with a glass rod for 30 min until clear and transparent, 5 mL of BCNO QDs was added, and the mixed solution was transferred to a polytetrafluoroethylene autoclave and reacted for 5 h at 160 ° C. After cooling to room temperature, solid BCNO-CQDs were obtained by freeze-drying.

[0011] Furthermore, the preparation of BCNO QDs: ethylene glycol and boric acid are dissolved in water to obtain a clear and transparent precursor solution, and then the precursor solution is subjected to a hydrothermal reaction in an autoclave. After dialysis for a period of time, a BCNO QDs solution can be obtained.

[0012] Specifically, 100 μL of ethanolamine and 0.309 g of boric acid were dissolved in 10 mL of water, and the mixture was heated at 200 °C for 12 h in a polytetrafluoroethylene autoclave, and then the resulting solution was dialyzed with a dialysis bag for 12 h to remove small molecules to obtain a BCNO QDs solution.

[0013] Furthermore, the preparation method of CoOOH NSs includes adding NaOH and NaClO solutions into CoCl2 solution, ultrasonically treating for 30 minutes, centrifuging, and washing to obtain CoOOH NSs.

[0014] Specifically, 1 mL of 0.8 M NaOH and 1 mL of 0.2 M NaClO solution were added to 2 mL of 10 mM CoCl2 solution under vigorous stirring, ultrasonically treated for 30 min, centrifuged at 8000 rpm for 10 min, and then washed three times with deionized water to obtain CoOOH NSs.

[0015] The present invention also provides an application of a BCNO-CQDs-aptamer / CoOOH NSs fluorescent sensor in detecting bisphenol A, comprising the following steps:

[0016] Step 1: prepare bisphenol A solution by adding a preset amount of bisphenol A solution into a PBS buffer solution with a pH of 7.4 to obtain a series of bisphenol A standard solutions with different concentrations, ranging from 1.0×10 -12 mol / L~1.0×10 -6 mol / L, the concentration of PBS buffer solution is 0.1 mol / L;

[0017] Step 2, using the BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor as a liquid sample for fluorescence testing, scanning the emission spectrum, controlling the excitation wavelength to 325 nm, the slit width to 5 nm, the starting scanning wavelength to 335 nm, and the ending scanning wavelength to 630 nm, to obtain a series of concentration-fluorescence intensity correspondences, and then obtain a standard curve of bisphenol A, establish a linear relationship between the fluorescence intensity after adding bisphenol A and the logarithm of the bisphenol A concentration, and obtain the corresponding linear regression equation;

[0018] Step 3, sample testing, after filtering and removing impurities from the sample, adjust the pH to 7.4, test according to the above steps and obtain the fluorescence intensity, and calculate the obtained fluorescence intensity using the linear regression equation obtained in step 2 to obtain the concentration of bisphenol A in the sample.

[0019] Preferably, the incubation time of the fluorescence resonance energy transfer-based nucleic acid aptamer sensor in step 2 is 50 min, which can ensure better binding between the sensor and the detection object.

[0020] The significant advantage of the present invention is that a BCNO-CQDs-aptamer / CoOOH NSs fluorescent sensor for detecting bisphenol A and a preparation method thereof are developed, and a fluorescence resonance energy transfer mechanism is used to perform an "on-off-on" experiment on BCNO-CQDs to achieve the purpose of detection. Compared with ordinary fluorescent sensors, the present invention has the following two significant advantages:

[0021] (1) In the present invention, BCNO-CQDs are used as fluorescence donors and CoOOH NS is used as a quencher. The addition of CoOOH NS quenches the fluorescence intensity of BCNO-CQDs to a certain extent. The addition of the aptamer enables the sensor to specifically detect bisphenol A and the preparation of the donor-acceptor is more conducive to improving the sensitivity of bisphenol A detection.

[0022] (2) The introduction of fluorescence resonance energy transfer system makes the sensor more sensitive and specific, and the detection limit of bisphenol A is 1.0×10 -12 mol / L~1.0×10 -6 mol / L, the minimum detection limit is 4.31×10 -13 mol / L, with the advantages of wide linear range and low detection line. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a brief flow chart of the preparation of the BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor and the detection of bisphenol A in an embodiment of the present invention.

[0024] Figure 2 This is the fluorescence emission spectrum of different concentrations of bisphenol A. The concentrations of bisphenol A are as follows from top to bottom according to the peak values ​​of the curve: 1.0×10 -6 mol / L(a), 1.0×10 -7 mol / L(b), 1.0×10 -8 mol / L(c), 1.0×10 -9 mol / L(d), 1.0×10 -10 mol / L(e), 1.0×10 -11 mol / L(f), 1.0×10-12 mol / L(g).

[0025] Figure 3 It is the standard curve of the difference in fluorescence intensity before and after the addition of bisphenol A and the logarithm of the bisphenol A concentration.

[0026] Figure 4 It is the interference performance test result.

[0027] Figure 5 This is the fluorescence intensity test of BCNO-CQDs, BCNO QDs and CQDs in the embodiment of the present invention. DETAILED DESCRIPTION

[0028] The present invention is not limited to the following specific embodiments. A person skilled in the art can implement the present invention in various other specific embodiments according to the contents disclosed in the present invention, or any simple changes or modifications made to the design structure and ideas of the present invention fall within the protection scope of the present invention. It should be noted that the embodiments and features in the embodiments of the present invention can be combined with each other without conflict.

[0029] In the embodiment of the present invention, BCNO-CQDs is used as a donor in fluorescence resonance energy transfer, and CoOOH NSs is used as an acceptor in fluorescence resonance energy transfer. The donor and the acceptor are connected by an aptamer, thereby constructing a BCNO-CQDs-aptamer / CoOOH NSs nucleic acid aptamer sensor in a solution for the detection of bisphenol A. The test results show that the nucleic acid aptamer sensor has high sensitivity, low detection line, and simple operation.

[0030] The present invention is further described in detail below in conjunction with embodiments:

[0031] Embodiment 1:

[0032] (1) Preparation of BCNO-CQDs composites:

[0033] The mixture contained 4 g of citric acid and 1.43 mL of ethylenediamine mixed in 10 mL of water, stirred with a glass rod for 30 min until clear and transparent, and 5 mL of BCNO QDs was added. The mixed solution was transferred to a polytetrafluoroethylene autoclave and reacted for 5 h at 160 ° C. After cooling to room temperature, solid BCNO-CQDs were obtained by freeze drying.

[0034] (2) Preparation of BCNO-CQDs-aptamer mixed solution:

[0035] Add 1.5 μM, 30 μL aptamer to 170 μL 4 mg / mL·EDC·2 mg / mL·NHS and shake for 30 min, then add the BCNO-CQDs solution in step (1) and shake for 2 h to obtain a BCNO-CQDs-aptamer mixed solution;

[0036] (3) Preparation of CoOOH NSs:

[0037] Under vigorous stirring, 1 mL of 0.8 M NaOH solution and 1 mL of 0.2 M NaClO solution were added to 2 mL of 10 mM CoCl2 solution, ultrasonically treated for 30 min, centrifuged at 8000 rpm for 10 min, and then washed three times with deionized water to obtain CoOOH NSs.

[0038] (4) Preparation of highly sensitive and selective fluorescence sensor of BCNO-CQDs-aptamer / CoOOH NSs:

[0039] Take the BCNO-CQDs-aptamer prepared in step (2); then, add CoOOH NSs to the BCNO-CQDs-aptamers solution to obtain the highly sensitive and selective fluorescent sensor based on BCNO-CQDs-aptamer / CoOOH NSs.

[0040] In the above sensor, the aptamer nucleotide sequence is as follows: (Ordered from Sangon Biotech (Shanghai) Co., Ltd.)

[0041] Aptamer: 5'-COOH-CCGGTGGGTGGTCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCGCATCACGGGTTTCGCACCA-3'.

[0042] (5) Drawing of standard curve

[0043] Prepare a bisphenol A standard solution, add a preset amount of bisphenol A solution into a PBS buffer solution (specifically, a 0.1 mol / L PBS buffer solution with a pH of 7.4) to obtain a series of standard solutions with different concentrations;

[0044] The BCNO-CQDs-aptamer / CoOOH NSs solution was used as a liquid sample for fluorescence testing, and the emission spectrum was scanned to detect bisphenol A. The incubation time of the BCNO-CQDs-aptamer / CoOOH NSs-based highly sensitive and selective fluorescent sensor was 50 min.

[0045] The sensor was placed in a series of bisphenol A concentrations (1.0×10 -6 mol / L(a), 1.0×10 -7 mol / L(b), 1.0×10 -8 mol / L(c), 1.0×10 -9 mol / L(d), 1.0×10 -10 mol / L(e), 1.0×10 -11 mol / L(f), 1.0×10 - 12 mol / L (g)) in a buffer solution containing 0.1 mol / L PBS with a pH of 7.4, the excitation wavelength was controlled to be 325 nm, the slit width was 5 nm, the starting scanning wavelength was 335 nm, and the ending scanning wavelength was 630 nm. A series of concentration-fluorescence intensity correspondences were obtained, and then the standard curve of bisphenol A was obtained. The linear relationship between the fluorescence intensity after adding bisphenol A and the logarithmic value of the bisphenol A concentration was established, and the corresponding linear regression equation was obtained: I = 0.30337 + 3.96614LogC (mol / L), and the correlation coefficient (R) was 0.9961. The detection range of the linear regression equation was 1.0×10 -12 ~1.0×10 -6 mol / L, the minimum detection limit is 4.31×10 -13 mol / L.

[0046] (6) Sample testing

[0047] A certain amount of filtered river water was added to a 0.1 mol / L PBS buffer solution with a pH of 7.4 for fluorescence spectrum detection. The concentration of bisphenol A in the sample to be tested was calculated according to the linear regression equation corresponding to the above step (5). The results are listed in Table 1.

[0048] (7) Interference performance test:

[0049] The concentration of bisphenol A in the test object is 1.0x10 -10 mol / L, and other interfering substances were diethylstilbestrol (DES), diclofenac (DCF), and estradiol (E2), all with a concentration of 1.0x10 -8 mol / L, mixture is a mixture of four test substances, the results are shown in Figure 4 .

[0050] Comparative Example 1

[0051] (1) Preparation of BCNO-CQDs-aptamer mixed solution:

[0052] Add 30 μL, 1.5 μΜ aptamer to 170 μL 4 mg / mL·EDC·2 mg / mL·NHS and shake for 30 min, then add the BCNO-CQDs solution in step (1) and shake for 2 h to obtain a BCNO-CQDs-aptamer mixed solution;

[0053] (2) Drawing of standard curve

[0054] The BCNO-CQDs-aptamer mixed solution was used as a liquid sample for fluorescence spectrum testing to detect a series of bisphenol A standard solutions with different concentrations. The detection method was the same as in Example 1.

[0055] The results are listed in Table 1.

[0056] Comparative Example 2:

[0057] (1) Preparation of CoOOH NSs solution

[0058] The cuvette was washed with anhydrous ethanol and deionized water in turn, and dried naturally for later use. 1 mL of 1.5 mg / mL CoOOH NSs aqueous solution (the preparation method of the CoOOH NSs aqueous solution is as in Example 1) was removed with a microinjector and added to the clean cuvette to obtain a CoOOH NSs liquid sample.

[0059] (2) Drawing of standard curve

[0060] The CoOOH NSs aqueous solution was used as the liquid sample for fluorescence spectrum test to detect a series of bisphenol A standard solutions with different concentrations. The detection method was the same as that in Example 1.

[0061] The results are listed in Table 1.

[0062] Table 1 Determination results of bisphenol A in river water

[0063]

[0064]

[0065] Note: a is the average of three measurements.

[0066] As shown in Table 1, the sample was tested three times in parallel, the relative standard deviation was less than 5%, and the spike recovery rate was 90% to 104%. The above results show that bisphenol A cannot be detected by using BCNO-CQDs-aptamer or CoOOH NSs liquid sample alone without BCNO-CQDs-aptamer / CoOOH NSs liquid sample, and the present invention is feasible for detecting bisphenol A in river water.

[0067] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and concepts of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor for the detection of bisphenol A, characterized in that: The invention comprises a composite of boron oxynitride and carbon quantum dots BCNO-CQDs as a donor in fluorescence resonance energy transfer, cobalt oxyhydroxide nanosheets CoOOH NSs as an acceptor in fluorescence resonance energy transfer, and a bisphenol A aptamer for connecting the donor and the acceptor; The nucleotide sequence of the bisphenol A aptamer: 5'-COOH- CCGGTGGGTGGTCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCGCATCACGGGTTCGCACCA -3'; The preparation method of BCNO-CQDs comprises the following steps: adding BCNO QDs to the process of preparing CQDs based on hydrothermal reaction of citric acid and ethylenediamine and carrying out the hydrothermal reaction together to obtain a BCNO-CQDs composite material; The preparation of the highly sensitive and selective fluorescent sensor of BCNO-CQDs-aptamer / CoOOH NSs includes the following steps: dropping a certain concentration of bisphenol A aptamer into a mixed aqueous solution of EDC and NHS to obtain an activated aptamer solution; then adding a BCNO-CQDs solution to obtain a BCNO-CQDs-aptamer solution; and finally adding CoOOH NSs and stirring thoroughly.

2. The method for preparing the BCNO-CQDs-aptamer / CoOOH NS fluorescence sensor according to claim 1, characterized in that: The method comprises the following steps: dropping a bisphenol A aptamer solution into a mixed aqueous solution of EDC and NHS to obtain a carboxyl (-COOH) activated aptamer solution; subsequently adding a BCNO-CQDs solution to obtain a BCNO-CQDs-aptamer solution; and finally adding CoOOH NSs and shaking evenly to obtain a BCNO-CQDs-aptamer / CoOOH NSs fluorescent sensor.

3. The method for preparing the BCNO-CQDs-aptamer / CoOOH NS fluorescence sensor according to claim 2, characterized in that: The preparation method of BCNO-CQDs includes the following steps: preparing a mixture containing 4 g of citric acid and 1.43 mL of ethylenediamine in 10 mL of water, stirring with a glass rod for 30 min until clear and transparent, adding 5 mL of BCNO QDs, transferring the mixed solution to a polytetrafluoroethylene autoclave and reacting for 5 h at 160°C, cooling to room temperature, and freeze-drying to obtain solid BCNO-CQDs.

4. The method for preparing the BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor according to claim 2, characterized in that: The preparation method of CoOOH NSs includes: introducing 1 mL of 0.8 M NaOH solution and 1 mL of 0.2 M NaClO solution into 2 mL of 10 mM CoCl solution under vigorous stirring, ultrasonically treating for 30 min, and centrifuging at 8000 rpm for 10 min; then washing with deionized water for 3 times, and vacuum drying to obtain CoOOH nanosheets.

5. The use of the BCNO-CQDs-aptamer / CoOOH NSs fluorescence sensor as claimed in claim 1 in detecting bisphenol A, characterized in that: The steps include: (1) Prepare 0.1 mol / L PBS buffer solution with a pH of 7.4; (2) Preparation of different concentrations of bisphenol A and PBS buffer solution with pH = 7.4; Prepare bisphenol A solution with deionized water, then add a certain amount of bisphenol A solution into the PBS buffer solution in step (1) to obtain a series of bisphenol A standard solutions with different concentrations, ranging from 1.0×10 -12 mol / L~1.0×10 -6 mol / L; (3) Drawing of standard curve A series of bisphenol A standard solutions of different concentrations in step (2) were added dropwise to the BCNO-CQDs-aptamer / CoOOH NSs solution, and incubated at room temperature. The obtained solution was recorded as BCNO-CQDs-aptamer / CoOOH NSs+bisphenol A; The BCNO-CQDs-aptamer / CoOOH NSs+bisphenol A solution was used as the liquid sample for fluorescence test, and the emission spectrum was scanned. The excitation wavelength was controlled to be 325 nm, the slit width was 5 nm, the starting scanning wavelength was 335 nm, and the ending scanning wavelength was 630 nm. A series of concentration-fluorescence intensity correspondences were obtained, and then the standard curve of bisphenol A was obtained. The linear relationship between the fluorescence intensity after adding bisphenol A and the logarithm of the bisphenol A concentration was established, and the corresponding linear regression equation was obtained. (4) Actual sample testing After filtering and removing impurities from the sample, the pH value was adjusted to 7.

4. The above steps were followed to test and obtain the fluorescence intensity. The obtained fluorescence intensity was calculated using the linear regression equation obtained in step (3) to obtain the concentration of bisphenol A in the sample.

6. The use according to claim 5, characterized in that: The incubation time of the tested BCNO-CQDs-aptamer / CoOOH NSs and bisphenol A solution was 50 min.

Images