A bovine viral diarrhea virus strain BVDV-SDJN01 and its application

Abstract

The present invention relates to a bovine viral diarrhea virus BVDV-SDJN01 and its application, and belongs to the field of bovine viral diarrhea virus vaccine reagents. The virus is the bovine diarrhea virus BVDV-SDJN01, which was sent to the China Center for Type Culture Collection on June 30, 2022 for preservation, and the preservation number is: CCTCC NO: V202255. The BVDV1c inactivated vaccine is prepared using the virus as an antigen, which has good immunogenicity and can stimulate the body to produce a high level of neutralizing antibodies. The virus strain provides an effective vaccine candidate strain for the effective prevention and treatment of bovine viral diarrhea in my country.

Description

Technical Field

[0001] The invention relates to a bovine viral diarrhea virus BVDV-SDJN01 and application thereof, and belongs to the field of bovine viral diarrhea virus vaccine reagents. Background Art

[0002] Bovine viral diarrhea is an acute, febrile, contact infectious disease caused by bovine viral diarrhea virus (BVDV), characterized by calf diarrhea, growth retardation and secondary infection of other diseases. BVDV can infect a variety of hosts and is widely present worldwide. Based on the differences in gene sequences such as BVDV 5′UTR and Npro, BVDV can be divided into two genotypes, namely BVDV1 and BVDV2. BVDV1 is further divided into 21 genotypes (1a-1u), and BVDV2 is further divided into 4 genotypes (2a-2d). Subtypes 1a and 1c are the main subtypes prevalent in my country in recent years. Subtype 1c has been detected in 17 provinces, including 5 provinces in the east. From a biological point of view, each genotype can be divided into cytopathic (CP) and non-cytopathic (NCP). After BVDV infection, the body can show typical clinical symptoms, mainly fever, diarrhea, persistent infection, immunosuppressive diseases, respiratory diseases, reproductive disorders and mucosal diseases. After BVDV persistently infects cattle, cattle can carry and excrete the virus for life, forming an important source of infection and increasing the difficulty of BVD diagnosis and prevention. At present, there are two main prevention and control measures for BVD internationally. One is to identify and kill persistently infected animals, and the other is vaccine immunization. Studies have shown that vaccination with BVDV vaccine can effectively reduce adverse effects on reproduction, such as abortion of pregnant cows and reducing the production of persistently infected cattle. Therefore, screening for suitable vaccines is the current research focus. Summary of the invention

[0003] In view of the problems existing in the treatment of bovine viral diarrhea at this stage, the present invention identifies the bovine viral diarrhea virus BVDV-SDJN01 isolated in the laboratory. The strain is the BVDV1c subtype, which is a common genetic subtype in clinical practice. The BVDV1c inactivated vaccine is prepared using the virus as an antigen. The vaccine has good immunogenicity and can stimulate the body to produce a high level of neutralizing antibodies. The virus strain provides an effective vaccine candidate strain for the effective prevention and treatment of bovine viral diarrhea in my country.

[0004] The technical solution of the present invention is as follows:

[0005] A strain of bovine viral diarrhea virus, the virus is bovine diarrhea virus BVDV-SDJN01, which was sent to the China Center for Type Culture Collection for preservation on June 30, 2022, and the preservation number is: CCTCC NO: V202255.

[0006] The application of the bovine viral diarrhea virus in the preparation of a vaccine for treating bovine viral diarrhea.

[0007] Preferably, the above application comprises the following steps:

[0008] (1) The purified virus is inoculated into bovine kidney cells to expand the virus culture, the virus fluid is collected, and the inactivated virus fluid is obtained by formaldehyde inactivation;

[0009] (2) Mix the inactivated virus solution with aluminum hydroxide adjuvant to prepare inactivated aluminum gel vaccine.

[0010] Furthermore, step (2) is replaced by: using the inactivated virus solution as the aqueous phase, and using white oil, Span 80, and aluminum stearate as the oil phase, to prepare an oil emulsion inactivated vaccine as an oil emulsion vaccine or an aluminum gel vaccine.

[0011] Another purpose of the present invention is to protect an inactivated vaccine for bovine viral diarrhea virus disease, which is prepared using the above-mentioned bovine viral diarrhea virus.

[0012] Furthermore, the virus content in the inactivated vaccine is ≥10 6 TCID50 / m.

[0013] Collection Information

[0014] Storage time: 2022-06-30

[0015] Collection Unit: China Center for Type Culture Collection

[0016] Deposit number: CCTCC NO:V202255.

[0017] Address of the depository: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province

[0018] Classification name: Bovine viral diarrhea virus-1 ( Bovine viral diarrhea virus 1 ).

[0019] Beneficial Effects of the Invention

[0020] The bovine viral diarrhea virus BVDV-SDJN01 strain has good immunogenicity. The inactivated oil emulsion vaccine prepared with it is safe and reliable. It can produce strong immunity after immunization, can effectively prevent the prevalence and spread of bovine viral diarrhea virus, and reduce the economic losses caused by the disease. It has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The cytopathic effect of MDBK cells 96 hours after inoculation of BVDV-SDJN01 strain (the left picture shows no obvious cytopathic effect of cells compared with the control 96 hours after inoculation of BVDV-SDJN01 strain, and the right picture shows the control);

[0022] Figure 2 RT-PCR identification of BVDV-SDJN01 strain; M: DL2000 DNA Maker; 1-3: BVDV-SDJN01 strain;

[0023] Figure 3 This is a phylogenetic analysis of the complete genome nucleotide sequence of BVDV-SDJN01. DETAILED DESCRIPTION

[0024] Example 1

[0025] The culture medium for cell culture is DMEM culture medium containing 10% fetal bovine serum; its preparation: take 500 ml of liquid DMEM culture medium, add fetal bovine serum according to 10% of the volume, mix thoroughly and set aside.

[0026] 1.1 Isolation, purification and propagation of BVDV

[0027] Samples with positive BVDV test results were collected from diarrhea feces of calves sent for inspection by a large cattle farm in Shandong Province, added with PBS, centrifuged at 12000r / min for 2min, and the supernatant was taken and filtered through a 0.22μm filter membrane. The filtered supernatant was concentrated at 1 ml / 10cm 2 The culture dish was inoculated with MDBK cells in a certain proportion. After 1.5 hours of induction, 10 ml of culture medium was added and the dish was placed in a 37°C, 5% CO2 incubator for about 72-120 hours. No obvious cytopathic effect was observed. Figure 1 The cell culture and supernatant containing the virus were frozen and thawed twice, and PCR identification was positive ( Figure 2 ) and then stored at -80°C. The virus was purified by limiting dilution of the positive virus culture, and after 3-5 generations, the virus was harvested, which was the BVDV-SDJN01 strain of the present invention.

[0028] 1.2 Sequence determination of BVDV-SDJN01 strain

[0029] 1.2.1 Primer design: According to the sequence of the BVDV reference strain (GenBank accession number MT079816.1), the viral genome was divided into 9 fragments for amplification. The primer sequences are as follows:

[0030] Primer Name Sequence (5'-3')

[0031] BVDV-1F GGAAAACACTCGTGTAC, as shown in SEQ ID NO. 2;

[0032] BVDV-1R TTGTACCAGTTGCACCAACC, as shown in SEQ ID NO. 3;

[0033] BVDV-2F CAAGTGAAAAGACCAACTAC, as shown in SEQ ID NO. 4;

[0034] BVDV-2R CCAAGGATACAGTCGTGG, as shown in SEQ ID NO. 5;

[0035] BVDV-3F GACACAACTGTAGTACAGA, as shown in SEQ ID NO. 6;

[0036] BVDV-3R ACCAGTTAAGCTCTACAAGTG, as shown in SEQ ID NO. 7;

[0037] BVDV-4F ATGTATTACATGCACAGG, as shown in SEQ ID NO. 8;

[0038] BVDV-4R TATTGGTAGACAGACTCTGC, as shown in SEQ ID NO.9;

[0039] BVDV-5F CAGTGATAGAGGAGATAG, as shown in SEQ ID NO. 10;

[0040] BVDV-5R TCTGTGATCATTGGGACATG, as shown in SEQ ID NO.11;

[0041] BVDV-6F ATGGGACTGTCCTCTGCTG, as shown in SEQ ID NO. 12;

[0042] BVDV-6RGCCACATGGACACCTTGTC, as shown in SEQ ID NO. 13;

[0043] BVDV-7F CAAGCAGATAAACAGAGG, as shown in SEQ ID NO. 14;

[0044] BVDV-7R ATCCTTGTTTGATCTGTAG, as shown in SEQ ID NO. 15;

[0045] BVDV-8F GAAAGACAAGTATCACTTGG, as shown in SEQ ID NO. 16;

[0046] BVDV-8R CTGGATTTCTCCGATAAGC, as shown in SEQ ID NO. 17;

[0047] BVDV-9F GGACTTATTCAATGAACC, as shown in SEQ ID NO. 18;

[0048] BVDV-9R GGGGCTGTTAGAGGTTTC, as shown in SEQ ID NO. 19;

[0049] 1.2.2 Extraction of viral RNA and RT-PCR amplification

[0050] a) Take 0.2 ml of the frozen-thawed virus culture medium, add 0.5 ml of lysis buffer, vortex for 10 sec, and centrifuge at 12000 rpm for 2 min;

[0051] b) Add 0.6 ml of washing solution, centrifuge at 12000 r / min for 1 min, and discard the filtrate;

[0052] c) Repeat step b once;

[0053] d) centrifugation at 12000 r / min for 2 min;

[0054] e) Add an appropriate amount of eluent, let stand at room temperature for 1 min, and centrifuge at 12000 rpm for 1 min. The eluent is the extracted RNA sample;

[0055] f) Use the primers in the primer list to amplify according to the instructions of the one-step RT-PCR kit; the sequence of the amplified product is shown in SEQ ID NO.1.

[0056] g) Phylogenetic analysis of the complete genome sequence of BVDV-SDJN01 strain. The complete genome sequences of 26 BVDV isolates were obtained from GenBank and compared with the complete genome sequence of BVDV-SDJN01 strain for phylogenetic analysis. The results are shown in Figure 3 , BVDV-SDJN01 strain has the highest homology with GXNN1, GSTZ, Bega-like and other isolates, clustering into a cluster, which is genotype 1c.

[0057] Example 2

[0058] Application of BVDV-SDJN01 strain in the preparation of inactivated bovine viral diarrhea virus vaccine: Take BVDV-SDJN01 strain with virus seed collection number CCTCC NO: V202255, inoculate it into MDBK cells to amplify the virus, collect the virus liquid, inactivate it with formaldehyde, and mix it with aluminum hydroxide adjuvant to prepare inactivated aluminum gel vaccine. The operation steps are as follows:

[0059] 2.1 Selection of virus strains

[0060] The vaccine strain is BVDV-SDJN01, whose collection number is CCTCC NO: V202255. It has good immunogenicity and the minimum immunization dose should be ≥2.0×10 6 TCID 50 .

[0061] 2.2 Preparation of virus seed for production

[0062] 2.2.1 Primary production seed propagation

[0063] The BVDV-SDJN01 strain with the virus seed deposit number of CCTCC NO: V202255 was inoculated into MDBK cells at a ratio of 1 mL / 75 cm2. After 1.5 h of virus infection, the virus culture medium was replaced and placed in a 37°C 5% CO2 incubator for culture. After 96 h, the culture medium was collected and the virus content in the culture medium was adjusted to 10 6 TCID 50 / mL. After passing the purity test, it will be used as first-class production seeds.

[0064] 2.2.2 Propagation of secondary production seeds

[0065] Take the first-level production seeds and inoculate them into MDBK cells at a 5% inoculation rate, culture them in a 37℃ 5% CO2 incubator, and collect the culture fluid after 96 hours. After passing the purity inspection, they are used as second-level seeds.

[0066] 2.3 Preparation of virus solution for vaccine production

[0067] The secondary seeds were inoculated into MDBK cells at a 5% inoculation rate and cultured in a 37°C 5% CO2 incubator. After 96 hours, the culture medium was collected and tested for purity and virus titer. The purity test and virus titer were carried out in accordance with the appendix of the Veterinary Pharmacopoeia of the People's Republic of China. Each batch of virus solution for seedling production was pure, without other virus growth, and the virus titer was adjusted to 2×10 6 TCID 50 / mL.

[0068] 2.4 Inactivation of virus fluid

[0069] Use formaldehyde to inactivate the virus solution: add formaldehyde solution to the virus solution to a final concentration (v / v) of 0.3%, place it at 37℃ for inactivation for 24 hours, and shake it every 4 to 6 hours. The inactivated virus solution is qualified after testing for sterile growth, and the inactivated virus solution is used as the antigen for vaccine preparation.

[0070] 2.5 Screening of immune adjuvants

[0071] 2.5.1 Preparation of oil seedlings

[0072] Take 96 parts of virus liquid (parts are by weight, the same below) and add 4 parts of Tween to mix as the water phase. Take 93 parts of white oil and add 6 parts of Span 80 and 1 part of aluminum stearate to mix, and sterilize at 121℃ for 30 minutes as the oil phase. Emulsify the water phase and the oil phase in a volume ratio of 1:2 to prepare the oil emulsion inactivated vaccine. The virus content in the finished vaccine is 10 6 TCID 50 / mL. The vaccine was sampled for sterility testing according to the current method of the Veterinary Pharmacopoeia of the People's Republic of China, and no bacteria or mold grew.

[0073] 2.5.2 Preparation of aluminum gel vaccine

[0074] Take 20 g of aluminum gel and add it to 100 mL of sterile distilled water, stir until completely dissolved, sterilize at 121℃ for 1 h to prepare 20% aluminum gel, add it to the inactivated virus solution at a volume ratio of 1:2, mix well, let it stand at 2-8℃ for 2-3 days, discard the supernatant and concentrate it to about two-thirds of the total amount, and store it in aliquots. The virus content in the finished vaccine is 10 6 TCID 50 / mL. The vaccine was sampled for sterility testing according to the current method of the Veterinary Pharmacopoeia of the People's Republic of China, and no bacteria or mold grew.

[0075] 2.5.3 Safety Inspection

[0076] One-month-old calves were injected with oil vaccine, aluminum gel vaccine and PBS 2mL, with 3 calves in each group. The second immunization was performed 3 weeks later and the calves were observed for 2 weeks after the injection. The results showed that the spirit, body temperature and appetite of most calves were normal after the immunization. However, the injection site of the oil vaccine group was still slightly swollen at the end of the experiment, and the vaccine was poorly absorbed. There was no swelling and necrosis in the aluminum gel vaccine group, and there were no other adverse reactions.

[0077] 2.5.4 Effectiveness test

[0078] One month after immunization, 4 TCID 50 The mice were challenged with a dose of 1 mL / mL and observed for 1 week. The temperature changes and clinical manifestations were recorded, and pathological changes were observed after autopsy.

[0079] Oil vaccine group: One calf developed anorexia, depression, and elevated body temperature (39.5℃) after challenge with the virus, and developed diarrhea symptoms on the second day after challenge. The other two calves had little change in body temperature, and their spirits and appetites were normal. The protection rate of this group of vaccines was 80%.

[0080] Aluminum gel vaccine group: The body temperature, mental state and appetite of the three calves were normal. The protection rate of this group of vaccines was 100%.

[0081] Control group: The body temperatures of the three calves were all elevated (>40.5℃), their appetites were significantly reduced, they were depressed, their fur was rough and messy, and they had diarrhea symptoms.

[0082] In summary, both oil seedlings and aluminum gel seedlings can provide protection for calves, but the protective effect of aluminum gel seedlings is stronger than that of oil seedlings.

Claims

1. A bovine viral diarrhea virus, characterized in that The virus is bovine viral diarrhea virus 1 BVDV-SDJN01, which was sent to the China Center for Type Culture Collection on June 30, 2022, with the collection number: CCTCC NO: V202255.

2. Use of the bovine viral diarrhea virus according to claim 1 in the preparation of a vaccine for treating bovine viral diarrhea.

3. The use according to claim 2, characterized in that: The following steps are involved: (1) The purified virus is inoculated into bovine kidney cells to expand the virus culture, the virus fluid is collected, and the inactivated virus fluid is obtained by formaldehyde inactivation; (2) Mix the inactivated virus solution with aluminum hydroxide adjuvant to prepare inactivated aluminum gel vaccine.

4. The use according to claim 2, characterized in that: The following steps are involved: (1) The purified virus is inoculated into bovine kidney cells to expand the virus culture, the virus fluid is collected, and the inactivated virus fluid is obtained by formaldehyde inactivation; (2) An oil emulsion inactivated vaccine was prepared using the inactivated virus solution as the aqueous phase and white oil, Span 80 and aluminum stearate as the oil phase.

5. An inactivated vaccine for bovine viral diarrhea virus disease, characterized in that: The bovine viral diarrhea virus is prepared by using the bovine viral diarrhea virus described in claim 1.

Images