A biotin synthase mutant and its application in constructing glutamate producing strain

Abstract

The present invention belongs to the field of molecular biology, and specifically relates to a mutant biotin synthase and its application in improving the yield and conversion rate of L-glutamic acid. The mutant corresponds to the biotin synthase shown in SEQ ID NO:3 or its homologous enzyme, and the leucine at position 293 is replaced by phenylalanine. The mutant can significantly improve the yield of L-glutamic acid and the sugar acid conversion rate, and has good application prospects in the production of L-glutamic acid and its derivatives, so the production cost of glutamic acid can be reduced, and a new strategy is provided for large-scale production, which has great application value.

Description

Technical Field

[0001] The invention relates to the field of microorganisms and biotechnology, and in particular to a mutant biotin synthase, and a method for constructing an L-glutamic acid producing strain using the mutant and producing L-glutamic acid. Background Art

[0002] L-glutamic acid is the world's largest amino acid product and the basic substance that constitutes the protein required for animal nutrition. It plays an important role in the protein metabolism process in organisms and participates in many important chemical reactions in animals, plants and microorganisms. It is mainly used to produce seasonings such as monosodium glutamate and chicken essence, as well as various foods, and is widely used in the fields of medicine, chemical industry, animal husbandry, etc. Due to its large demand and high production capacity, the industrial fermentation of L-glutamic acid has always been one of the important fermentation industries in my country.

[0003] Currently, L-glutamic acid is mainly produced by Corynebacterium glutamicum ( Corynebacterium glutamicum ) to produce. Corynebacterium glutamicum is a biotin auxotrophic strain that does not have a complete biotin synthesis pathway. Its genome only contains three enzymes involved in the assembly of the biotin ring structure: BioA, BioD, and BioB. Therefore, it can only use exogenous biotin or intermediate metabolites such as desulfurized biotin to maintain normal cell growth (P. Peters-Wendisch, et al., Biotinprotein ligase from Corynebacterium glutamicum : role for growth and L-lysineproduction. Appl. Microbiol. Biotechnol., 2012, 93(6), 2493-2502.). Under biotin restriction conditions, fatty acid synthesis in Corynebacterium glutamicum is blocked, the tension of the cell membrane changes, and the mechanical sensitive channel protein MscCG is activated, which can trigger the massive efflux and accumulation of L-glutamate (Nakayama, Y, Corynebacterium glutamicum Mechanosensing: From Osmoregulation to L-Glutamate Secretion forthe Avian Microbiota-Gut-Brain Axis. Microorganisms, 2021, 9, 201.). Therefore, the "suboptimal" process of biotin is a condition often used in glutamate production, in which the amount of biotin added and metabolic control are crucial. At present, no research has focused on the effects of key enzymes in biotin synthesis on glutamate synthesis. The role of biotin synthase BioB, which catalyzes the last step of the biotin synthesis pathway, and L-glutamate production in Corynebacterium glutamicum needs to be analyzed in order to further improve the production of L-glutamate. Summary of the invention

[0004] The present invention analyzes the genome sequence of the glutamate high-yield strain SL4 obtained by previous screening and finds that its biotin synthase gene encoding gene bioB There is a point mutation, and further research has found that the biotin synthase encoded by the mutation at position 293 can increase the glutamate production of the strain, thereby improving the production efficiency of glutamate and reducing production costs. On this basis, the present invention is completed.

[0005] In a first aspect, the present invention provides a biotin synthase mutant, wherein the amino acid sequence of the mutant corresponds to leucine at position 293 of the sequence shown in SEQ ID NO: 3 and is substituted by phenylalanine.

[0006] Furthermore, the amino acid sequence of the biotin synthase mutant is shown in SEQ ID NO:1.

[0007] Wherein, " biotin synthase " and its abbreviation name " BioB " as described herein refer to derive from Corynebacterium glutamicum, and its coding gene is the protein of Gene ID being BBD29_00525.As used herein, BioB is not specifically limited, as long as it has corresponding activity, and it can be derived from Corynebacterium glutamicum, but is not limited thereto.For example, BioB can be the wild-type sequence of the amino acid sequence as SEQ ID NO:3 or have at least 75% with the amino acid sequence of SEQ ID NO:3, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or higher homology amino acid sequence.In addition, if amino acid sequence has homology with above-mentioned sequence and has substantially the same or corresponding biological activity with the protein of SEQ ID NO:3, then it is obvious that the amino acid sequence with disappearance, modification, displacement or addition should also belong to the scope of the present disclosure. In the present invention, any polynucleotide sequence encoding BioB belongs to the scope of the present disclosure. For example, the polynucleotide sequence can be a polynucleotide sequence having at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the polynucleotide sequence of SEQ ID NO: 4. In addition, based on codon degeneracy or considering the preferred codons for expressing proteins in organisms, the polynucleotide sequence encoding the protein can have various variants on the coding region within the range of not changing the amino acid sequence of the protein expressed from the coding region.

[0008] The "polypeptide", "peptide" and "protein" are used interchangeably herein and are amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0009] The "fragment" means a polypeptide or a catalytic or carbohydrate binding module that lacks one or more (eg, several) amino acids from the amino and / or carboxyl termini of a mature polypeptide or domain. In a specific embodiment, the fragment has citrate synthase activity.

[0010] The term "wild-type" refers to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that exists in an organism, can be isolated from a source in nature, and has not been intentionally modified by humans in a laboratory is naturally occurring. As used in this disclosure, "naturally occurring" and "wild-type" are synonymous. In some embodiments, the wild-type biotin synthase in the present invention refers to the wild-type BioB protein, that is, the polypeptide having the amino acid sequence shown in SEQ ID NO: 3.

[0011] The "mutant" refers to a polynucleotide that contains changes (i.e., substitutions, insertions and / or deletions) at one or more (e.g., several) positions relative to a "wild type" or "compared" polynucleotide or polypeptide, wherein substitution refers to replacing a nucleotide occupying a position with a different nucleotide. Deletion refers to the removal of a nucleotide occupying a position. Insertion refers to the addition of a nucleotide adjacent to and immediately following the nucleotide occupying the position. In a specific embodiment, the "mutation" is a "substitution", which is a mutation caused by the replacement of a base in one or more nucleotides by another different base, also known as a base substitution mutation (subsititution) or a point mutation (point mutation).

[0012] The "amino acid mutation" or "nucleotide mutation" includes "substitution, duplication, deletion or addition of one or more amino acids or nucleotides". In the present invention, the term "mutation" refers to a change in a nucleotide sequence or an amino acid sequence. In a specific embodiment, the term "mutation" refers to "substitution".

[0013] In some embodiments, the "mutation" comprises replacing leucine with phenylalanine at position 293 of the sequence shown in SEQ ID NO: 3. Compared with the biotin synthase of the sequence shown in SEQ ID NO: 3, the strain containing the mutant has an L-glutamic acid production increased by more than 13%.

[0014] In a second aspect, the present invention provides a polynucleotide encoding the biotin synthase.

[0015] The "polynucleotide" refers to a polymer composed of nucleotides. A polynucleotide may be in the form of a single fragment or a component of a larger nucleotide sequence structure, which is derived from a nucleotide sequence that has been isolated at least once in quantity or concentration, and can be identified, manipulated, and restored by standard molecular biology methods (e.g., using a cloning vector) and its component nucleotide sequences. When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C), in which "U" replaces "T". In other words, a "polynucleotide" refers to a nucleotide polymer removed from other nucleotides (a single fragment or an entire fragment), or may be a component or ingredient of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.

[0016] Specifically, the biotin synthase encoding polynucleotides of the present invention include the polynucleotides shown in SEQ ID NO: 2, and polynucleotides mutated at position 877. In addition, the polynucleotides of the present invention also include any polynucleotides having 75% or more, specifically 80% or more, more specifically 85% or more, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% or more homology with the polynucleotide shown in SEQ ID NO: 2.

[0017] The term "homology" of the present invention refers to the percentage of identity between two polynucleotides or polypeptide parts. The homology between the sequence of one part and another part can be measured by techniques known in the art. For example, homology can be measured by directly arranging the sequence information of two polynucleotide molecules or two polypeptide molecules using an easily available computer program. Examples of computer programs can include BLAST (NCBI), CLC Main Workbench (CLCbio), MegAlignTM (DNASTAR Inc.), etc. In addition, the homology between polynucleotides can be measured by the following steps: hybridizing polynucleotides under conditions of forming stable double chains between homologous regions, decomposing using single-stranded specific nucleases, and then measuring the size of the decomposed fragments.

[0018] In a third aspect, the present invention provides a recombinant host cell containing the biotin synthase of the first aspect or the coding gene of the second aspect. In particular, the host cell is a strain producing L-glutamic acid.

[0019] The construction of the L-glutamic acid production strain of the present invention is achieved by transforming biotin synthase or its encoding gene into the host cell. Here, "transformation" has the meaning generally understood by those skilled in the art, that is, the process of introducing exogenous DNA into the host. The method of transformation includes any method for introducing nucleic acid into the cell, and these methods include but are not limited to electroporation, calcium phosphate (CaPO4) precipitation method, calcium chloride (CaCl2) precipitation method, microinjection method, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method and lithium acetate-DMSO method.

[0020] "Host cell" of the present invention is the meaning that those of ordinary skill in the art usually understand, that is, the cell that can import the nucleic acid with promoter activity of the present invention, is called recombinant host cell after importing. In other words, the present invention can utilize any host cell, as long as its cell contains the nucleic acid with promoter activity of the present invention, and is operably connected with a certain gene to mediate the transcription of this gene.Host cell of the present invention can be a prokaryotic cell or a eukaryotic cell, preferably enterobacterium or corynebacterium, more preferably Corynebacterium glutamicum, including but not limited to Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and the mutant or the bacterial strain of the L-amino acid produced by the above-mentioned bacterial strain preparation.

[0021] In some embodiments, the glutamate producing strain may be a strain obtained by transformation based on Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum ATCC13869, wherein the transformation includes but is not limited to one or more genes selected from the following being enhanced or overexpressed:

[0022] a. Encoding mechanosensitive channel proteins ygB Gene (CN108250278A);

[0023] b. Encoding phosphoketolase fxpk Gene (WO2006016705A1);

[0024] c. Encoding pyruvate carboxylase pyc Gene (WO2004069996A2);

[0025] d. Encoding glutamate dehydrogenase gd gene (CN103205390A);

[0026] e. Gene encoding carbonic anhydrase (WO2011024583A1).

[0027] In some embodiments, the glutamate producing strain may also have one or more genes selected from the group consisting of, but not limited to, the following attenuated or reduced in expression:

[0028] a. Encoding α-ketoglutarate dehydrogenase odhA Gene (WO2006028298A2);

[0029] b. Encoding transcriptional regulatory genes ikB Gene (EP2276845A1);

[0030] c. Encoding transcriptional repressors acn Gene (CN111334535A).

[0031] In one embodiment of the present invention, the host cell is Corynebacterium glutamicum, which is further modified, specifically in the bacteria NCgl1221 Homologous gene (BBD29_06760 or ygB ) was introduced into the strain A111V to obtain the glutamate-producing strain SCgGC5.

[0032] In the present invention, the host cells can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0033] In a fourth aspect, the present invention provides the use of the biotin synthase mutant or its encoding gene or recombinant host cell in improving the production and conversion rate of L-glutamic acid.

[0034] In a fifth aspect, the present invention provides a method for producing L-glutamic acid, the method comprising culturing the host cell of the third aspect to produce L-glutamic acid, and further comprising the steps of separating, extracting or recovering L-glutamic acid from the culture medium.

[0035] Beneficial effects of the present invention: The biotin synthase mutant provided by the present invention can improve the yield and conversion rate of L-glutamic acid in the strain, reduce the production cost of glutamic acid, and provide a new strategy for large-scale production. DETAILED DESCRIPTION

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used to implement or test the present invention, the methods and materials provided herein are preferred.

[0037] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental techniques and experimental methods used in the examples are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out according to conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples, unless otherwise specified, can all be obtained through regular commercial channels.

[0038] The culture medium used in the examples is as follows:

[0039] The components of TSB plate culture medium are (g / L): glucose, 5 g / L; yeast powder, 5 g / L; soy peptone, 9 g / L; urea, 3 g / L; succinic acid, 0.5 g / L; K2HPO4·3H2O, 1 g / L; MgSO4·7H2O, 0.1 g / L; biotin, 0.01 mg / L; vitamin B1, 0.1 mg / L; MOPS, 20 g / L; agar powder, 15 g / L.

[0040] The components of TSB liquid culture medium are (g / L): glucose, 5 g / L; yeast powder, 5 g / L; soy peptone, 9 g / L; urea, 3 g / L; succinic acid, 0.5 g / L; K2HPO4·3H2O, 1 g / L; MgSO4·7H2O, 0.1 g / L; biotin, 0.01 mg / L; vitamin B1, 0.1 mg / L; MOPS, 20 g / L.

[0041] The components of the seed culture medium used in the glutamate fermentation experiment were: glucose, 25 g / L; KH2PO4·3H2O, 2.2 g / L; urea, 3 g / L; corn steep liquor, 33 mL; MgSO4·7H2O, 0.9 g / L; soybean cake hydrolyzate, 22 mL; MOPS, 20 g / L; initial pH 7.2.

[0042] The components of the fermentation medium used in the glutamate fermentation experiment were: glucose, 80 g / L; KH2PO4, 1 g / L; urea, 10 g / L; corn steep liquor powder, 5 g / L; MgSO4·7H2O, 0.4 g / L; FeSO4·7H2O, 10 mg / L; MnSO4·4H2O, 10 mg / L; VB1, 200 μg / L; MOPS, 40 g / L; initial pH 7.5.

[0043] Example 1 Construction of mutant BioB editing plasmid

[0044] The inventors obtained a mutant strain capable of high glutamate production through mutagenesis screening and named it SL4 (Liu Jiao, et al., Mutations in Peptidoglycan Synthesis Gene ponA Improve Electrotransformation Efficiency of Corynebacterium glutamicum ATCC 13869.Appl. Environ. Microbiol., 2018, 84, e02225-02218.). By sequencing the genome of the SL4 strain, three genes involved in biotin synthesis were found. bioD , bioA and bioB ,only bioB The 877th position of the gene mutated from C to T, and the corresponding amino acid changed from leucine to phenylalanine. Given the key role of biotin in glutamate synthesis, we predict that this mutation may be a new target for increasing glutamate production.

[0045] Based on the published genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1) and the sequence of wild-type BioB (its amino acid sequence is shown in SEQ ID NO: 3, and its nucleotide sequence is shown in SEQ ID NO: 4), amplification primers BioB-F1 / R1 and BioB-F2 / R2 were designed, and the ATCC 13869 genome was used as a template to amplify the BioB L293F The upstream and downstream recombinant fragments of the mutant. sacB The primers pK-F / R were designed based on the sequence information of plasmid pK18mob sacB The linearized vector fragment was obtained by reverse PCR amplification using PCR as a template. The primers used in this example are shown in Table 1. The three fragments were recovered and recombined to obtain a fragment with BioB L293F The editing plasmid pK18-BioB of the mutant L293F .

[0046] Table 1 Primers for constructing mutant editing plasmids

[0047] Primers Nucleotide sequence pK-F AAGCTTGGCACTGGCCGTCG pK-R GAATTCGTAATCATGTCATAGCTGT BioB-F1 tgacatgattacgaattcAGTCATGGGTTAAGGTTGTC BioB-R1 cctcccaggaaggcttgctcggaacc BioB-F2 agcaagccttcctgggaggcatcaat BioB-R2 cgacggccagtgccaagcttCTTCGATGAAGTGTTGTTGG

[0048] Example 2 Construction of glutamate-producing strain of mutant BioB

[0049] In this example, a strain capable of producing L-glutamic acid was first constructed, and the construction process was as follows:

[0050] It has been reported in the literature that the genome of Corynebacterium glutamicum ATCC 13869 NCgl1221 Homologous gene (BBD29_06760 or ygB ) can make the strain have the ability to constitutively synthesize and secrete L-glutamate. According to the published genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1), primers A111V-UH-F / R and A111V-DH-F / R were designed. Using the ATCC13869 genome as a template, the above primers were used to amplify the YggB A111V Mutated DNA fragment; based on plasmid pK18mob sacB The primers pK-F / R were designed based on the sequence information of plasmid pK18mob sacB The linearized vector fragment was obtained by reverse PCR amplification as a template; the three fragments were recovered and recombined, and the clones obtained after transformation were collected and plasmids were extracted to obtain YggB A111V Mutated editing vector pK18-YggB A111V .

[0051] Prepared by the method reported in the literature C. glutamicum ATCC 13869 competent cells (Biotechnology Letters, 2015, 37: 2445-52.), 1 μg of pK18-YggB was electroporated into the 13869 competent cells prepared above. A111V Plasmid, add 1 mL of TSB medium preheated at 46°C, incubate at 46°C for 6 min, incubate at 30°C for 3 h, apply TSB solid medium containing 25 μg / mL kanamycin, and culture at 30°C for 1 day to obtain the first recombinant transformant. The correct transformant was transferred to TSB medium containing 5 g / L glucose for overnight culture, and then transferred to TSB medium containing 100 g / L sucrose. After culturing at 30°C for 6 h, it was applied to TSB medium supplemented with 100 g / L sucrose for screening to obtain L-glutamic acid producing strain SCgGC5. The primers used in this example are shown in Table 2.

[0052] Table 2 Primers used in this example

[0053] Primers Nucleotide sequence A111V-UH-F tgacatgattacgaattcATCCACTGGAGTTTTGCCAATTCTC A111V-UH-R gtcttggtGTGcagtcgattgttgcg A111V-DH-F atcgactgCACaccaagaccaatggc A111V-DH-R cgacggccagtgccaagcttTGGAGGAATAGAGCGGGTCATACAC

[0054] The L-glutamic acid production strain SCgGC5 competent cells were prepared by the method reported in the literature, and 1 μg of pK18-BioB was electroporated into the prepared SCgGC5 competent cells. L293FPlasmid, add 1 mL of TSB medium preheated at 46℃, incubate at 46℃ for 6 min, incubate at 30℃ for 3 h, apply TSB solid medium containing 25 μg / mL kanamycin, and culture at 30℃ for 24 h to obtain the first recombinant transformant. The correct transformant was transferred to TSB medium containing 5 g / L glucose for overnight culture, and then transferred to TSB medium containing 100 g / L sucrose. After culturing at 30℃ for 4 h, it was applied to TSB medium supplemented with 100 g / L sucrose for screening, and the L-glutamic acid production strain SCgGC5-BioB with mutant BioB was obtained. L293F That is, the strain contains the mutated BioB (the amino acid sequence of which is shown in SEQ ID NO: 1, and the nucleotide sequence of which is shown in SEQ ID NO: 2).

[0055] Example 3 Effect of BioB mutants on L-glutamate synthesis

[0056] To verify the effect of the BioB mutant on glutamate production, the SCgGC5-BioB constructed above was L293F The strains were subjected to fermentation tests, and strains ATCC 13869 and SCgGC5 were used as controls.

[0057] First, the strain was inoculated into seed culture medium and cultured for 8 h. The culture was inoculated as seeds into 24-well plates containing 800 μL of fermentation medium per well. The initial OD 600 The control was about 0.5, the speed of the well plate shaker was 800 rpm, and each strain was cultured in 3 parallels at 30°C. 5 g / L urea was added at 17 h, 20 h, and 23 h. The fermentation ended at 25 h, and the L-glutamic acid production and glucose consumption were detected, and the sugar-acid conversion rate from glucose to L-glutamic acid was calculated. The results are shown in Table 3.

[0058] Table 3 L-glutamic acid production

[0059] strain L-Glutamic acid (g / L) Sugar-acid conversion rate (g / g, %) ATCC 13869 0.20±0.00 0.27±0.00 SCgGC5 4.26±0.19 5.27±0.28 <![CDATA[SCgGC5-BioB L293F ]]> 4.82±0.05 5.97±0.08

[0060] From the table, we can see that the mutant BioB L293F It can significantly increase the yield of L-glutamic acid and the sugar-acid conversion rate, and has good application prospects in the production of L-glutamic acid and its derivatives.

Claims

1. A biotin synthase mutant, characterized in that: The mutant corresponds to the biotin synthase shown in SEQ ID NO: 3, but the leucine at position 293 is replaced by phenylalanine.

2. The gene encoding the biotin synthase mutant according to claim 1.

3. A recombinant vector containing the coding gene as claimed in claim 2.

4. A recombinant host cell containing the encoding gene as claimed in claim 2.

5. The recombinant host cell according to claim 4, characterized in that The recombinant host cell is Corynebacterium glutamicum.

6. A Corynebacterium glutamicum producing L-glutamic acid, characterized in that The strain comprises the biotin synthase mutant according to claim 1 or the encoding gene according to claim 2.

7. The Corynebacterium glutamicum according to claim 6, characterized in that The starting strain of the Corynebacterium glutamicum is selected from Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, or a strain producing L-glutamic acid prepared from the above strains.

8. The Corynebacterium glutamicum according to any one of claims 6 or 7, characterized in that The Corynebacterium glutamicum is based on Corynebacterium glutamicum ATCC 13869, and one or more genes selected from the following are weakened or the expression is reduced: Encoding α-ketoglutarate dehydrogenase odhA Gene; Encoding succinate dehydrogenase sucA Gene.

9. The Corynebacterium glutamicum according to claim 8, characterized in that It also includes one or more genes selected from the following being enhanced or overexpressed: a. Encoding pyruvate carboxylase pyc Gene; b. Encoding glutamate dehydrogenase gd Gene; c. Encoding citrate synthase gltA Gene; d. Encoding phosphoketolase fxpk Gene; e. Encoding phosphoenolpyruvate carboxylase ppc Gene; f. Encoding phosphate transporter pitA Gene; g. Encoding mechanosensitive channel proteins ygB Gene.

10. The Corynebacterium glutamicum according to any one of claims 6 to 9, characterized in that The Corynebacterium glutamicum NCgl1221 Alanine at position 111 of the gene or its homologous gene is substituted by valine.

11. The Corynebacterium glutamicum according to claim 10, characterized in that The homologous gene is selected from BBD29_06760 or ygB .

12. Use of the biotin synthase mutant or its encoding gene or its recombinant host cell as claimed in claim 1 in producing L-glutamic acid.

13. A method for producing L-glutamic acid, characterized in that: The method comprises the steps of culturing the Corynebacterium glutamicum as claimed in any one of claims 6 to 11 to produce L-glutamic acid, and separating, extracting or recovering the L-glutamic acid.