A recombinant GI Japanese encephalitis virus expressing ASFV P30 protein and its construction method and application

Abstract

The present invention relates to a recombinant GI type Japanese encephalitis virus expressing ASFV P30 protein and its construction method and application. The ASFV P30 protein gene is cloned into the GI type Japanese encephalitis virus genome with a T7 promoter set upstream between the 5′UTR and the C gene by homologous recombination technology; the upstream of the P30 protein gene carries the first 102 base sequences of the Japanese encephalitis virus C gene, which ensures the stability of the recombinant virus; the downstream of the P30 protein gene contains a T2A sequence, which ensures that the ASFV P30 protein can be correctly sheared. After obtaining the full-length cDNA of the genome of the recombinant virus, in vitro transcription is performed using the T7 promoter to obtain viral RNA and transfect BHK‑21 cells. When the cells show typical cytopathic effects, the cell supernatant is collected to obtain the recombinant GI type Japanese encephalitis virus expressing the ASFV P30 protein. The recombinant virus has a genetically stable type and can stably and efficiently express the ASFV P30 protein. The present invention can quickly obtain a recombinant virus containing ASFV and GI type JEV immunogens, laying the foundation for the development of a multi-valence vaccine.

Description

Technical Field

[0001] The invention relates to a recombinant GI Japanese encephalitis virus expressing ASFV P30 protein and a construction method and application thereof, belonging to the field of biotechnology. Background Art

[0002] Japanese encephalitis (JE) is a zoonosis caused by Japanese encephalitis virus (JEV), characterized by human central nervous system disease and pig reproductive disorder. The disease is mainly transmitted through mosquito bites. Pigs are the most important amplification host and storage host of JEV. Pigs infected with JEV will produce high titer viremia. When mosquitoes suck pig blood, they can further spread the virus to humans or pigs. When JEV infects pregnant sows, it can cause miscarriage, stillbirth or mummification. When it infects boars, it causes orchitis, unilateral testicular enlargement and infertility, which poses a serious threat to the sustainable development of my country's pig industry.

[0003] At present, commercial vaccination is still the main method for preventing and controlling JEV infection, including traditional inactivated virus (P3 strain and HW1 strain) vaccine and attenuated live virus (SA14-14-2 strain) vaccine. However, the strains used to make these vaccines are all derived from genotype III (GIII), and currently my country and even the entire Asian region are mainly dominated by GI type JEV strains, but there is currently no vaccine for GI type strains. In addition, the protection effect of existing commercial vaccines on GI type strains is not ideal, which makes GI type JEV more harmful.

[0004] African swine fever (ASFV) is an acute, virulent, and highly contagious disease caused by the African swine fever virus (ASFV). African swine fever has a short course, rapid onset, and strong infectivity. It can infect domestic pigs and wild boars of any species and age, and can cause the morbidity and mortality of live pigs to reach 100%. Since the first outbreak of African swine fever in Shenyang, Liaoning Province in August 2018, the epidemic has spread rapidly to 23 provinces across the country, causing extremely serious economic losses to my country's pig farming industry. At present, there is still no vaccine against ASFV in China. Although some foreign scientists have announced the research and production results of African swine fever vaccines, its safety and effectiveness still deserve further evaluation.

[0005] The P30 protein of ASFV is a very important structural protein with strong immunogenicity, which can induce the body to produce neutralizing antibodies. In this study, the P30 gene of ASFV was generated between the 5′UTR and C gene of GI-type JEV by reverse genetics technology to obtain a recombinant GI-type Japanese encephalitis virus expressing the ASFV P30 protein. This recombinant virus has broad application value in the preparation of a vaccine that can resist both GI-type JEV and ASFV. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a recombinant GI Japanese encephalitis virus expressing ASFV P30 protein and a construction method and application thereof.

[0007] The object of the present invention is achieved by: a method for constructing a recombinant GI Japanese encephalitis virus expressing ASFV P30 protein, characterized in that it comprises the following steps:

[0008] (1) Construction of a full-length cDNA infectious clone of GI-type Japanese encephalitis virus carrying the ASFV P30 protein gene;

[0009] The ASFV P30 protein gene was cloned into the cDNA infectious cloning plasmid pOK-rGI of the GI type Japanese encephalitis virus with a T7 promoter set upstream, thereby constructing a recombinant viral genome cDNA carrying the ASFV P30 protein gene; specific steps:

[0010] A genome fragment F2 carrying the first 102 base sequences of the Japanese encephalitis virus C gene upstream of the ASFV P30 protein gene and the T2A sequence downstream was constructed. The genome fragment F2 was artificially synthesized and its sequence was SEQ ID NO.2;

[0011] Using plasmid pOK-rGI as a template and two pairs of primers F1-F and F1-R as well as F3-F and F3-R, genomic fragments F1 and F3 were amplified. The sequences of F1 and F3 are SEQ ID NO.1 and SEQ ID NO.3; wherein:

[0012] The primers for F1-F were: GGCGGAGCCTATGGAAAAACGGCTT;

[0013] The primer for F1-R was: CTGGTTTTTTAGTCATGGTTGTTCTTCCGTTCTAAAAAA;

[0014] The F3-F primer is: GAATCCCGGCCCTTCCGGGATGACCAAGAAGCCAGGAGGCCCG;

[0015] The primer for F3-R was: CTTTCCCGAAAAGTCCACATCCATTTCCC;

[0016] The infectious cloning vector pOK-rGI was digested with restriction endonucleases Not I and Sac II, and the digested vector was recovered. There was a 20-30 bp homologous sequence between adjacent DNA fragments. Gene fragments F1, F2, and F3 were mixed with the linearized infectious cloning vector pOK-rGI treated with Not I and Sac II in equal proportions, and homologous recombination was performed using NEB Gibson Assembly recombinase; then, Escherichia coli Top 10 was transformed, and a single clone colony was picked for amplification and plasmid extraction. The correctly identified and sequenced plasmid was named pOK-rGI-P30;

[0017] (2) Rescue of recombinant viruses;

[0018] The plasmid pOK-rGI-P30 was linearized with restriction endonuclease Sal I; the linearized plasmid pOK-rGI-P30 was used as a template for in vitro transcription using the T7 in vitro transcription kit mMESSAGE mMACHINE T7 Transcription Kit to obtain the full-length genomic RNA of the recombinant virus; the recombinant viral RNA was transfected into BHK-21 cells using the transfection reagent LipofectaminMessengerMAX, and the rescued rGI-P30 recombinant virus was obtained after typical cytopathic effects appeared.

[0019] In step (1), the cDNA infectious clone plasmid pOK-rGI of GI type Japanese encephalitis virus has a sequence as shown in SEQ ID NO.4.

[0020] In step (2), the rGI-P30 recombinant virus has a genome sequence as shown in SEQ ID NO.5.

[0021] A recombinant GI Japanese encephalitis virus expressing ASFV P30 protein was constructed using the construction method.

[0022] The application of the recombinant GI Japanese encephalitis virus expressing ASFV P30 protein constructed by the construction method in the preparation of vaccines.

[0023] The method of the present invention is advanced and scientific. Through the present invention, the purpose of the present invention is to provide a recombinant GI Japanese encephalitis virus expressing ASFV P30 protein obtained by the above-mentioned construction method. The genetic stability of the above-mentioned recombinant virus is determined, and the recombinant virus carrying the P30 protein gene can be stably propagated and express the P30 protein of ASFV. The application of the recombinant GI Japanese encephalitis virus expressing ASFV P30 protein is also provided.

[0024] The present invention has the following advantages and effects:

[0025] (1) The present invention provides a method for constructing an infectious clone of a recombinant GI-type Japanese encephalitis virus expressing ASFV P30 protein. The construction method adopts the technical means of homologous recombination, and the method is efficient and fast. From the perspective of research and development purposes, with this recombinant virus platform, the viral genome can be artificially and accurately modified, and a JEV recombinant plasmid that can insert a foreign gene at a specific site can be quickly obtained. This platform can be used to develop vaccines against GI-type JEV and other infectious swine diseases.

[0026] (2) The present invention obtains a recombinant GI-type Japanese encephalitis virus expressing ASFV P30 protein, which can be used as a candidate strain for developing a vaccine that can simultaneously resist GI-type JEV and ASFV infection, filling a gap in domestic and international research.

[0027] (3) The recombinant virus constructed by the present invention has genetic stability, the recombinant virus carrying exogenous genes can be continuously propagated, and the ASFV P30 protein is efficiently expressed.

[0028] The present invention discloses a recombinant GI type Japanese encephalitis virus expressing ASFV P30 protein and a construction method and application thereof. The present invention uses homologous recombination technology to clone the ASFV P30 protein gene into the GI type Japanese encephalitis virus genome with a T7 promoter set upstream between the 5′UTR and the C gene; the upstream of the P30 protein gene carries the first 102 base sequences of the Japanese encephalitis virus C gene, which ensures the stability of the recombinant virus; the downstream of the P30 protein gene contains a T2A sequence, which ensures that the ASFVP30 protein can be correctly sheared. After obtaining the full-length cDNA of the genome of the recombinant virus, in vitro transcription is performed using the T7 promoter to obtain viral RNA and transfect BHK-21 cells. When typical cytopathic effects appear in the cells, the cell supernatant is collected to obtain the recombinant GI type Japanese encephalitis virus expressing the ASFV P30 protein. The recombinant virus has a genetically stable type and can stably and efficiently express the ASFV P30 protein. The construction method provided by the present invention can quickly obtain a recombinant virus containing ASFV and GI type JEV immunogens, thereby laying a foundation for the development of a multi-valence vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the strategy for constructing a recombinant viral cDNA infectious clone carrying the ASFV P30 gene.

[0030] Figure 2A The figure shows the cytopathic effect after RNA transfection.

[0031] Figure 2B This is the indirect immunofluorescence identification of the parental virus YZ-1 and the recombinant virus rGI-P30.

[0032] Figure 2C This is a Western Blot verification diagram of cells infected with the parental virus YZ-1 and the recombinant virus rGI-P30.

[0033] Figure 3 This is a multi-step growth curve diagram of the recombinant virus rGI-P30 and the parental virus YZ-1.

[0034] Figure 4A The graphs show the RT-PCR detection of P30 gene in recombinant viruses of different generations (P1, P5, P10).

[0035] Figure 4B This is an indirect immunofluorescence verification of the P30 protein after BHK-21 cells were infected with recombinant viruses of different generations (P1, P5, P10). DETAILED DESCRIPTION

[0036] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, the embodiments are merely exemplary and do not constitute any limitation to the scope of protection of the present invention.

[0037] The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in commonly used reference books in the field such as Molecular Cloning Experimental Guide (3rd edition, Science Press, 2005), or according to the conditions recommended by the reagent manufacturers.

[0038] In the embodiments of the present invention, the cDNA infectious clone plasmid pOK-rGI carrying the full-length genome of the GI type JEV strain YZ-1 (GenBank accession number: MZ540901), the BHK-21 cell line, and the positive serum of pigs infected with African swine fever virus were all constructed and preserved in advance by this experimental laboratory.

[0039] In the present embodiment, other reagents used: transfection reagent Lipofectamin MessengerMAX, mMESSAGE mMACHINE TMT7 in vitro transcription kits were purchased from Thermo Fisher Scientific; homologous recombination enzyme NEBuilder HiFi DNA Assembly Master Mix, PCR enzyme Q5 High-Fidelity DNA Polymerase, DNA restriction endonucleases (Not I, Sal I and Sac II), HRP-labeled goat anti-rabbit secondary antibody, and HRP-labeled goat anti-pig secondary antibody were purchased from New England Biolabs; JEV NS3 antibody (rabbit source) was purchased from Genetex; Alexa Fluor 647-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) and Alexa Fluor 488-conjugated AffiniPure Goat Anti-pig IgG (H+L) were purchased from Jackson Immune Research Inc; DAPI dye was purchased from Solebao Biotechnology Co., Ltd.; primers and genes were synthesized at Nanjing GenScript Biotechnology Co., Ltd.

[0040] Example 1: Construction of cDNA infectious clone of recombinant GI Japanese encephalitis virus expressing ASFV P30 protein Construction strategy Figure 1 shown.

[0041] The cDNA infectious clone plasmid pOK-rGI carrying the full-length genome of GI-type JEV YZ-1 strain (GenBank accession number: MZ540901) was double-digested with restriction endonucleases Not I and Sac II. The reaction system was: plasmid pOK-rGI, 2μg; 10×Reaction Buffer, 2μL; restriction endonuclease Not I, 1μL; restriction endonuclease Sac II, 1μL; Nuclease-Free Water, supplemented to 20μL. The reaction conditions were: 37℃, 2h. After the digestion, the fragments were separated by nucleic acid electrophoresis, and the large fragments after digestion were recovered by gel.

[0042] According to the genome sequence of the GI type parental virus YZ-1 strain (GenBank accession number: MZ540901), two pairs of primers (F1-F and F1-R and F3-F and F3-R) were designed (Table 1), and the gene fragments F1 and F3 were amplified using plasmid pOK-rGI as a template. The PCR reaction system was: 5×Reaction Buffer, 10μL; 10mM dNTPs, 1μL; 10μMForward Primer, 2.5μL; 10μMReverse Primer, 2.5μL; Template DNA, 0.5μl; Q5 High-Fidelity DNA Polymerases, 0.5μL; Nuclease-Free Water, 33μL. The amplification conditions were: 98℃30s, 98℃15s, 58℃15s, 72℃30s, 72℃10min, 4℃10min, 30 cycles.

[0043] The 5′ end of the F1 fragment and the 3′ end of the F3 fragment have homology arm sequences with the vector pOK-rGI after restriction digestion. Fragment F2 (SEQ ID NO.2) is artificially synthesized and has homology arm sequences with fragments F1 and F2. The vector plasmid pOK12-rGI after restriction digestion is homologously recombined with the F1, F2, and F3 fragments. The reaction system is: 100 ng each of the F1, F2, and F3 fragments; 100 ng of the linearized vector pOK12-rGI; Gibson Assembly Master Mix (2×), 5 μL; Deionized H2O is supplemented to 10 μL. The reaction conditions are: 50℃50min, 4℃10min. Take 2 μL of the recombinant product and transform it into the competent Escherichia coli TOP 10, and spread the transformed Escherichia coli on Kanamycin (K + )-resistant LB plates were placed in a 26°C incubator for 48 h, and single colonies were picked for PCR identification. The positive clones were extracted and sequenced, and the clones with correct sequencing were named pOK-rGI-P30.

[0044] Table 1. Primer list

[0045]

[0046] Example 2: Rescue and biological characteristics analysis of recombinant GI Japanese encephalitis virus expressing ASFV P30 protein

[0047] 2.1 Rescue of recombinant viruses

[0048] The full-length recombinant viral genomic RNA was obtained by in vitro transcription technology, and the virus was rescued by transfecting BHK-21 cells with viral RNA. The recombinant viral plasmid pOK-rGI-P30 obtained in Example 1 was linearized using restriction endonuclease Sal I, and the product was recovered. Using the linearized plasmid pOK-rGI-P30 as a template, the mMESSAGE mMACHINE TM The full-length genome of the recombinant virus was obtained using the T7 in vitro transcription kit. The reaction system was: linearized vector, 1000ng; 2×NTP / CAP, 10μL; 10×Reaction Buffer, 2μL; Enzyme Mix, 2μL; Nuclease-free Water supplemented to 20μL. Amplification conditions were: 37℃, 2h; add 2μL TURBO DNase, and react at 37℃ for 15min.

[0049] BHK-21 cells were seeded in 6-well plates in advance. When the cell density was 60% to 80%, the transcribed recombinant viral RNA was transfected into BHK-21 cells using the transfection reagent Lipofectamin MessengerMAX. After 36 hours of transfection, the BHK-21 cells transfected with the recombinant viral genome began to become round and shrunken, and typical cytopathic effects ( Figure 2A ), the supernatant of the diseased cells was collected as the rescued virus and named rGI-P30, which is the P0 generation virus.

[0050] 2.2 Validation of recombinant viruses

[0051] The rescued P0 recombinant virus rGI-P30 was identified by indirect immunofluorescence assay (IFA) and Western Blot. The rescued P0 virus rGI-P30 and its parental virus rGI were used to infect BHK-21 cells. After 24 hours of infection, the cell supernatant was discarded and the cells were fixed with 4% paraformaldehyde. After the cells were fixed at room temperature for 30 minutes, the fixative was discarded and the cells were washed three times with PBS. Cell blocking solution (PBS solution containing 1% BSA) was added to block the cells at room temperature for 1 hour. Rabbit antibody against JEV NS3 (Genetex, 1:500 dilution) and ASFV positive serum (1:500 dilution) were added. After acting at room temperature for 1 hour, the cells were washed three times with PBS, and Alexa Fluor 647-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) and Alexa Fluor 488-conjugated AffiniPure Goat Anti-pig IgG (H+L) with a dilution of 1:500 were added. The cells were protected from light for 1 hour at room temperature. After washing the cells three times with PBS, the cell nuclei were stained with DAP for 10 minutes, and the cells were observed and photographed under an inverted fluorescence microscope. The results showed that BHK-21 cells infected with the recombinant virus (rGI-P30) and the parent virus (rGI) showed obvious red fluorescence, indicating that the virus was successfully rescued, and the group infected with the recombinant virus (rGI-P30) showed obvious green fluorescence, indicating that the recombinant virus can successfully express ASFV P30 cells after infecting the cells ( Figure 2B ).

[0052] We further verified it by Western Blot. After infecting BHK-21 cells with virus rGI-P30 and YZ-1 for 24 hours, we collected cell samples and subjected the cell samples to SDS-PAGE electrophoresis and protein electrotransfer (transfer). The protein membrane was blocked in PBS buffer containing 5% w / v skim milk powder at 37°C for 2 hours, and then incubated with rabbit anti-NS3 antibody (1:1000) and ASFV positive serum (1:2000) at 4°C overnight; after incubation, the membrane was washed 3 times with PBST buffer and incubated with HRP-labeled goat anti-swine IgG and goat anti-rabbit IgG.

[0053] The cells were incubated at room temperature for 1 hour, washed three times with PBST, and then detected using a chemiluminescence detection kit. The results showed that obvious NS3 protein bands were observed in BHK-21 cells infected with the recombinant virus (rGI-P30) and the parent virus (YZ-1). Figure 2C ), and obvious ASFV P30 protein bands were observed in BHK-21 cells infected with the recombinant virus rGI-P30 ( Figure 2C ).

[0054] 2.3 Growth kinetics analysis of recombinant rGI-P30

[0055] The growth kinetics of the recombinant virus rGI-P30 and the parental virus YZ-1 were analyzed and compared. BHK-21 cells were cultured in 24-well plates in advance. When the cells were full of monolayer cells, the rescued rGI-P30 and the parental virus YZ-1 in Example 1 were inoculated into BHK-21 cells at a dose of 0.01 MOI, respectively. After incubation in a 37°C incubator for 2 hours, the cell supernatant was discarded, and fresh culture medium containing 2% FBS was added to continue culturing. The cell supernatant was collected 24h, 36h, 48h, 60h, and 72h after virus infection, and the cell supernatant was centrifuged at 4°C and 12000rpm for 10min to remove cell impurities. Subsequently, the cell supernatant was diluted 10 times in a gradient, and the diluted virus solution was added to a 96-well plate full of BHK-21 unilateral cells, 100 μL was added to each well, and 8 replicates of each dilution of the virus were set, and the cells continued to be cultured in a 37°C incubator. Observe the degree of cell lesions every day after infection. Record the number of cell lesions 5-6 days after infection and calculate the TCID of the virus according to the Reed-Muench method. 50 , and draw a multi-step growth curve of the virus. The results showed that rGI-P30 had a lower replication ability in BHK-21 cells than the parent virus YZ-1 ( Figure 3 ).

[0056] Example 3: Genetic stability analysis of recombinant rGI-P30

[0057] The recombinant virus rGI-P30 P0 virus in implementation case 1 was continuously passaged in BHK-21 cells to analyze the genetic stability of the P30 gene in the recombinant virus genome and its expression in BHK-21 cells. BHK-21 cells were cultured in 6-well plates in advance, and the rescued P0 recombinant virus was infected with BHK-21 cells at a dose of 0.1MOI. Cell samples and virus supernatants were collected 36 hours after infection and defined as P1, after which 100 μL of P1 virus solution was added to BHK-21 cells and cultured again (defined as P2). After 10 rounds of similar passages, cell supernatants and cell samples of P1, P5, and P10 generations were collected. RNA was extracted from the viruses of P1, P5, and P10 generations, and the viral genome region containing the P30 gene was amplified using primers (F: CCCCGCGTATTCCCACTAGTGG; R: GCGTCAATGAGTGTTCCAAGTTC) after reverse transcription. The results showed that the size of RT-PCR products was consistent between different generations. Sequencing confirmed that the virus had been stably carrying the P30 gene without deletion or mutation of the exogenous gene ( Figure 4AAt the same time, cells infected with different generations of viruses were verified by indirect immunofluorescence. The results showed that after cells were infected with different generations of viruses (P1, P5, P10), ASFV P30 protein could be successfully expressed ( Figure 4B ), indicating that the exogenous gene P30 remained genetically stable and could be stably expressed during the virus proliferation and passage process.

[0058] SEQ ID NO.1:

[0059] GGCGGAGCCTATGGAAAAACGGCTTTGGCGGCCGCTAATACGACTCACTATAGGAGAAGTTTATCTGTGTGAACTTCTTGGCTTAGTATCGTTGAGAAGAATCGAGAGATTAGTGCAGTTTAAACAGTTTTTTAGAACGGAAGAACAACCATGACTAAAAAACCAG

[0060] SEQ ID NO.2:

[0061] ATGACTAAAAAACCAGGAGGGCCCGGAAAAAACCGGGCCATCAATATGCTGAAACGCGGATTACCCCGCGTATTCCCACTAGTGGGAGTGAAGAGGGTAGTTTCCGGGATGGACTTCATCCTGAACATCAGCATGAAAATGGAAGTGATTTTCAAGACAGATCTGAGAAGCTCTTCTCAGGTGGTGTTCCACGCCGGATCTCTGTACAACTGGTTCAGCGTGGAAATCATCAACAGCGGCAGAATCGTGACCACCGCCATCAAGACACTGCTGAGCACCGTGAAGTACGACATCGTGAAAAGCGCTAGAATCTACGCCGGCCAGGGCTACACCGAGCACCAGGCCCAGGAGGAATGGAATATGATCCTGCACGTGCTGTTCGAGGAAGAGACAGAGAGCTCCGCCAGCTCCGAGAACATCCACGAGAAGAACGACAATGAAACCAACGAGTGCACCAGCTCCTTCGAAACCCTGTTTGAGCAGGAGCCAAGCTCTGAGGTCCCCAAGGACAGCAAGCTGTACATGCTGGCTCAAAAGACAGTGCAGCATATCGAGCAGTACGGCAAGGCCCCTGATTTTAACAAGGTGATCCGGGCCCACAACTTCATCCAGACCATCTATGGCACCCCTCTGAAGGAAGAAGAGAAAGAGGTTGTGCGGCTGATGGTGATTAAGCTGCTCAAGAAAAAGGGGTCCGAGGGCAGAGGAAGCCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTTCCGGG

[0062] SEQ ID NO.3:

[0063]

[0064] SEQ ID NO.4:

[0065]

[0066] SEQ ID NO.5:

[0067]

Claims

1. A method for constructing a recombinant GI Japanese encephalitis virus expressing ASFV P30 protein, characterized by: The steps include: (1) Construction of a full-length cDNA infectious clone of GI-type Japanese encephalitis virus carrying the ASFV P30 protein gene; The ASFV P30 protein gene was cloned into the cDNA infectious cloning plasmid pOK-rGI of the GI type Japanese encephalitis virus with a T7 promoter set upstream, thereby constructing a recombinant viral genome cDNA carrying the ASFV P30 protein gene; specific steps: A genome fragment F2 carrying the first 102 base sequences of the Japanese encephalitis virus C gene upstream of the ASFV P30 protein gene and the T2A sequence downstream was constructed. The genome fragment F2 was artificially synthesized and its sequence was SEQ ID NO.2; Using plasmid pOK-rGI as a template and two pairs of primers F1-F and F1-R as well as F3-F and F3-R, genomic fragments F1 and F3 were amplified. The sequences of F1 and F3 are SEQ ID NO.1 and SEQ ID NO.3; wherein: The primers for F1-F were: GGCGGAGCCTATGGAAAAACGGCTT; The primer for F1-R was: CTGGTTTTTTAGTCATGGTTGTTCTTCCGTTCTAAAAAA; The F3-F primer is: GAATCCCGGCCCTTCCGGGATGACCAAGAAGCCAGGAGGCCCG; The primer for F3-R was: CTTTCCCGAAAAGTCCACATCCATTTCCC; The infectious cloning vector pOK-rGI was digested with restriction endonucleases Not I and Sac II, and the digested vector was recovered; there was a homologous sequence of 20 to 30 bp between adjacent DNA fragments, and the gene fragments F1, F2, and F3 were mixed in equal proportions with the linearized infectious cloning vector pOK-rGI treated with Not I and SacII enzymes, and homologous recombination was performed using NEB Gibson Assembly recombinase; then, Escherichia coli Top 10 was transformed, and a single clone colony was picked for amplification and plasmid extraction, and the correctly identified and sequenced plasmid was named pOK-rGI-P30; (2) Rescue of recombinant viruses; The plasmid pOK-rGI-P30 was linearized with restriction endonuclease Sal I; the linearized plasmid pOK-rGI-P30 was used as a template for in vitro transcription using the T7 in vitro transcription kit mMESSAGE mMACHINE T7 Transcription Kit to obtain the full-length genomic RNA of the recombinant virus; the recombinant viral RNA was transfected into BHK-21 cells using the transfection reagent Lipofectamin MessengerMAX, and the rescued rGI-P30 recombinant virus was obtained after typical cytopathic effects appeared.

2. The method for constructing a recombinant GI Japanese encephalitis virus expressing ASFV P30 protein according to claim 1, characterized in that: In step (1), the cDNA infectious clone plasmid pOK-rGI of GI type Japanese encephalitis virus has a sequence as shown in SEQ ID NO.

4.

3. The method for constructing a recombinant GI Japanese encephalitis virus expressing ASFV P30 protein according to claim 1, characterized in that: In step (2), the rGI-P30 recombinant virus has a genome sequence as shown in SEQ ID NO.

5.

4. A recombinant GI Japanese encephalitis virus expressing ASFV P30 protein constructed using the construction method described in any one of claims 1-2.

Images