A dual-luciferase reporter cell line for detecting crisper-cas protein cleavage activity and applications thereof
By constructing a dual-luciferase reporter cell line in HEK293 cells, and using the activity changes of nanoluciferase and firefly luciferase to detect CRISPR-Cas protein cleavage activity, the problems of complex detection and slow response in existing technologies were solved, achieving rapid and efficient detection results, and SpCas9 inhibitors were screened.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-13
- Publication Date
- 2026-04-07
AI Technical Summary
Existing methods for detecting CRISPR-Cas protein cleavage activity are complex to operate and difficult to assess quickly, efficiently and sensitively. In particular, fluorescent protein-based reporter systems cannot respond quickly to double-strand breaks at gene loci.
A dual-luciferase reporter cell line was constructed by inserting a fusion expression gene of green fluorescent protein and secretory nanoluciferase before the stop codon of the housekeeping gene ACTG1 in HEK293 cells, and inserting the firefly luciferase gene into it using a lentiviral vector. A rapid and efficient detection method was established, and the activity changes of nanoluciferase and firefly luciferase were used to reflect the cleavage activity of CRISPR-Cas protein.
This method enables rapid, efficient, and sensitive detection of CRISPR-Cas protein cleavage activity, simplifies the operation process, rapidly responds to double-strand breaks at gene loci, and has identified several compounds that can inhibit SpCas9 activity through screening.
Smart Images

Figure CN115725623B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology. More specifically, it relates to a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity and its application. Background Technology
[0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a repetitive sequence within the genome of prokaryotes. To eliminate invading viral genes, bacteria evolved the CRISPR-Cas system to resist viral infection. The CRISPR-Cas system is present in most bacteria and all archaea, and since its discovery, it has shown great promise in clinical applications, basic research, and analytical detection.
[0003] To better utilize the CRISPR-Cas system, optimizing it and improving the activity and delivery of Cas proteins are current research hotspots. However, due to the additional activity of CRISPR-Cas proteins, editing other gene sites may occur simultaneously with editing the target site, leading to off-target effects. Therefore, developing regulators of CRISPR-Cas proteins to control their activity and improve the system's safety is also a direction that needs attention.
[0004] While deep sequencing can accurately demonstrate the editing efficiency of CRISPR-Cas proteins, the method is complex. Green fluorescent protein (GFP) reporter systems are widely used for protein localization tracking and high-throughput drug screening, offering advantages such as convenient detection and low cost. Currently, GFP-based reporter systems are also used to evaluate the activity of CRISPR systems; when the GFP gene is edited, GFP protein expression decreases, and the fluorescence signal weakens, thus allowing evaluation of CRISPR system activity. However, GFP has a long half-life in cells, requiring at least two days to detect significant GFP fluorescence quenching, making it difficult to rapidly respond to double-strand breaks at gene sites. Furthermore, because CRISPR-Cas proteins cleave target sites relatively quickly—for example, SpCas9 completes cleavage of its target site in about one day, with at least 50% of targeted cleavage occurring within six hours—GFP-based reporter cells struggle to rapidly and efficiently assess the cleavage activity of CRISPR-Cas proteins. Therefore, to evaluate the cleavage activity of CRISPR-Cas systems in cells, a sensitive, rapid, and accurate high-throughput detection method is needed. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to overcome the defects and deficiencies of the existing technologies and provide a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity and its application.
[0006] The first objective of this invention is to provide a method for preparing a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity.
[0007] A second objective of this invention is to provide a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity.
[0008] A third objective of this invention is to provide the application of the cell line in detecting CRISPR-Cas protein cleavage activity, evaluating the cleavage dynamics of CRISPR-Cas protein in cells, screening CRISPR-Cas protein mutants, or screening CRISPR-Cas protein regulators.
[0009] A fourth objective of this invention is to provide the use of the cell line in the preparation of products for detecting CRISPR-Cas protein cleavage activity, evaluating the cleavage dynamics of CRISPR-Cas protein in cells, screening CRISPR-Cas protein mutants, or screening CRISPR-Cas protein regulators.
[0010] The fifth objective of this invention is to provide a method for detecting CRISPR-Cas protein cleavage activity.
[0011] The sixth object of the present invention is to provide the use of any one or more of triptolide, dihydrotanshinone I, 10-hydroxycamptothecin, and topotecan hydrochloride in inhibiting SpCas9 activity or in preparing inhibitors of SpCas9.
[0012] The above-mentioned objective of this invention is achieved through the following technical solution:
[0013] This invention provides a method for preparing a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity, comprising the following steps:
[0014] S1. Insert the fusion expression gene of green fluorescent protein and secretory nanoluciferase before the stop codon of the housekeeping gene of the reporter cells used, and screen for monoclonal cells with the fusion expression gene inserted at the correct site.
[0015] S2. Using a lentiviral vector with selection markers, the firefly luciferase gene is randomly inserted into the genome of the monoclonal cells obtained in step S1. Monoclonal cells containing firefly luciferase activity are screened and cultured to obtain a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity.
[0016] Specifically, the reporter cell in step S1 is a HEK293 cell.
[0017] Specifically, the housekeeping gene mentioned in step S1 is ACTG1.
[0018] Specifically, the green fluorescent protein mentioned in step S1 is an enhanced green fluorescent protein, the N-terminus of the nanoluciferase contains a secretion signal peptide, and there is a cleavable linker between the green fluorescent protein and the nanoluciferase.
[0019] As an alternative implementation, the fusion expression gene of green fluorescent protein and secretory nanoluciferase in step S1 is eGFP-P2A-Nluc, and its base sequence is shown in SEQ ID NO.1.
[0020] Specifically, in step S2, the firefly luciferase gene is randomly inserted into the genome of the monoclonal cells obtained in step S1 using a lentiviral vector carrying the puromycin N-acetyltransferase gene, and monoclonal cells containing firefly luciferase activity are screened using puromycin.
[0021] Using the above preparation method, this invention obtains a cell line capable of rapidly, efficiently, and sensitively detecting CRISPR-Cas protein cleavage activity. Specifically, HEK293 cells are used as reporter cells. The fusion expression gene of green fluorescent protein and secretory nanoluciferase (eGFP-P2A-Nluc) is knocked into the stop codon TGA at the 3' end of the housekeeping gene ACTG1. Single clones with successful site-specific insertion of the fusion expression gene are selected and named HEK293-ACTG1-KI-Nluc-#2. Simultaneously, the firefly luciferase gene is randomly inserted into the genome of the obtained single clone HEK293-ACTG1-KI-Nluc-#2 using a lentiviral vector carrying the puromycin N-acetyltransferase gene. Single clones with high firefly luciferase activity are selected using puromycin and named HEK293-ACTG1-KI-Nluc-#2-Fluc-#2. This results in a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity.
[0022] The dual-luciferase reporter cell line described in this invention for detecting CRISPR-Cas protein cleavage activity has three detectable indicators: green fluorescent protein (eGFP) fluorescence signal, nanoluciferase (Nluc) activity, and firefly luciferase (Fluc) activity. In the cell line constructed in this invention, the expression of the reporter gene Nluc is related to its upstream gene. When the upstream gene site is cleaved by CRISPR-Cas protein, the expression level of the gene Nluc decreases, indicating a reduction in Nluc activity. If CRISPR-Cas protein activity changes, the magnitude of the change in Nluc activity will also differ. This allows for the detection and evaluation of CRISPR-Cas protein cleavage activity and can also be used to screen CRISPR-Cas protein mutants or CRISPR-Cas protein regulators. Furthermore, this invention fuses Nluc with the housekeeping gene ACTG1, avoiding the influence of intracellular environmental changes on Nluc activity. In addition, Fluc, as an internal control protein, can correct for errors caused by different cell numbers.
[0023] This invention seeks to protect the dual-luciferase reporter cell line prepared by the aforementioned method for detecting CRISPR-Cas protein cleavage activity.
[0024] The present invention also claims protection for the use of the cell line in detecting CRISPR-Cas protein cleavage activity, evaluating the cleavage dynamics of CRISPR-Cas protein in cells, screening CRISPR-Cas protein mutants, or screening CRISPR-Cas protein regulators.
[0025] This invention also claims protection for the use of the cell line in the preparation of products for detecting CRISPR-Cas protein cleavage activity, evaluating the cleavage dynamics of CRISPR-Cas protein in cells, screening CRISPR-Cas protein mutants, or screening CRISPR-Cas protein regulators.
[0026] Specifically, the CRISPR-Cas protein regulator is an exogenous substance that inhibits or enhances the activity of CRISPR-Cas protein. The exogenous substance includes one or more of the following: synthetic compounds, natural products, small organic molecule compounds, lipids, carbohydrates, proteins, and nucleic acids.
[0027] This invention also provides a method for detecting CRISPR-Cas protein cleavage activity. The method comprises: transfecting a plasmid expressing CRISPR-Cas protein and sgRNA targeting green fluorescent protein, or a CRISPR-Cas protein / sgRNA targeting green fluorescent protein complex, into a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity; simultaneously transfecting a plasmid expressing CRISPR-Cas protein and sgRNA targeting green fluorescent protein, or a protein / sgRNA targeting green fluorescent protein complex, as a control; incubating the transfected cells; detecting the activities of nanoluciferase and firefly luciferase; and calculating the CRISPR-Cas protein cleavage efficiency.
[0028] Specifically, when detecting the activities of nano-luciferase and firefly luciferase, the nano-luciferase activity is corrected using the firefly luciferase activity. The corrected enzyme activity is: relative fluorescence intensity = nano-luciferase activity / firefly luciferase activity × correction factor; the correction factor is any constant; the constant used in this application is 10 or 100.
[0029] CRISPR-Cas protein cleavage efficiency = [(relative fluorescence intensity of electroporated non-targeted sgRNA group) - (relative fluorescence intensity of electroporated targeted sgRNA group)] / (relative fluorescence intensity of electroporated non-targeted sgRNA group) × 100%.
[0030] Specifically, after incubating the transfected cells for 24-48 hours, the activities of nanoluciferase and firefly luciferase were detected, and the CRISPR-Cas protein cleavage efficiency was calculated.
[0031] Specifically, the transfection method is electrotransfer.
[0032] The methods described above for detecting CRISPR-Cas protein cleavage activity can also be used to evaluate the intracellular cleavage dynamics of CRISPR-Cas protein, screen for CRISPR-Cas protein mutants, or screen for CRISPR-Cas protein regulators.
[0033] This invention utilizes a constructed reporter cell line to screen and obtain four compounds that can inhibit SpCas9 cleavage of endogenous sites within cells. Specifically, the four compounds are triptolide, dihydrotanshinone I, 10-hydroxycamptothecin, and topotecan hydrochloride. Therefore, this invention also applies for protection of the use of any one or more of triptolide, dihydrotanshinone I, 10-hydroxycamptothecin, and topotecan hydrochloride in inhibiting SpCas9 activity or in the preparation of SpCas9 inhibitors.
[0034] The present invention has the following beneficial effects:
[0035] This invention provides a dual-luciferase reporter cell line for rapid, efficient, and sensitive detection of CRISPR-Cas protein cleavage activity. By fusing Nluc with the housekeeping gene ACTG1, the influence of intracellular environmental changes on Nluc activity is avoided, while Fluc serves as an internal control protein to correct for errors caused by varying cell numbers. This invention reflects CRISPR-Cas protein cleavage activity through changes in Nluc activity, overcoming the shortcomings of existing GFP methods, which have a long half-life in cells, requiring at least two days to detect significant GFP fluorescence quenching, and are unable to rapidly respond to double-strand breaks at gene sites.
[0036] Furthermore, the dual-luciferase reporter cell line described in this invention can be used to detect CRISPR-Cas protein cleavage activity, assess the intracellular cleavage dynamics of CRISPR-Cas protein, screen for CRISPR-Cas protein mutants, or screen for CRISPR-Cas protein regulators. The operation is simple, the detection is convenient, and the signal is stable. It has significant application prospects in comparing the activities of different CRISPR-Cas proteins or mutants and in screening CRISPR-Cas protein regulators. Simultaneously, this invention has used the constructed reporter cell line to screen several small molecule inhibitors that can inhibit SpCas9 activity. Attached Figure Description
[0037] Figure 1 The identification results of the endogenous ACTG1-eGFP-P2A-Nluc luciferase reporter cells, namely HEK293-ACTG1-KI-Nluc monoclonal cells, constructed in Example 1 of this invention are shown in Figure A, which is a schematic diagram of the principle of knocking in eGFP-P2A-Nluc based on CRISPR-Cas9 technology; Figure B is a junction PCR result of HEK293-ACTG1-KI-Nluc monoclonal cells; and Figure C is a Western blot detection result of the actin-GFP fusion protein.
[0038] Figure 2 Figure 1 shows the detection results of luciferase activity in the dual-luciferase reporter cell line constructed in Example 1 of this invention. Figure A shows the detection results of firefly luciferase (Fluc) and nano-luciferase (Nluc) activities in different HEK293-ACTG1-KI-Nluc-#2-Fluc monoclonal cells. Figure B shows the detection results of the relative activities of firefly luciferase (Fluc) and nano-luciferase (Nluc) in different HEK293-ACTG1-KI-Nluc-#2-Fluc monoclonal cells.
[0039] Figure 3This is a diagram showing the staining results of the prokaryotically purified SpCas9 protein obtained in this invention.
[0040] Figure 4 The cleavage efficiency of SpCas9 on the eGFP target site at different time points after electroporation of the PX330 plasmid (targeting the eGFP site) obtained by the dual-luciferase reporter cell line constructed in Example 1 of this invention.
[0041] Figure 5 The cleavage efficiency of SpCas9 on the eGFP target site at different time points after electroporation of the SpCas9 protein / sgRNA (targeting the eGFP site) complex in the dual-luciferase reporter cell line constructed in Example 1 of this invention.
[0042] Figure 6 The cleavage efficiency of AsCpf1 on the eGFP target site after 30 h of electroporation of the PTE4396 plasmid (targeting the eGFP site) obtained in Example 1 of this invention.
[0043] Figure 7 The cleavage efficiency of LbCpf1 on the eGFP target site after electroporation of the PTE4398 plasmid (targeting the eGFP site) for 24 hours in the dual-luciferase reporter cell line constructed in Example 1 of this invention.
[0044] Figure 8 This is a graph showing the Z' factor assay of the dual-luciferase reporter cell line used to screen SpCas9 protein regulator models in Example 1 of the present invention.
[0045] Figure 9 The results show the effects of 197 compounds on SpCas9 activity in Example 3 of this invention.
[0046] Figure 10 The results show the effects of the four compounds used in Example 4 of this invention on the activity of SpCas9 in cleaving the EMX1-1 target site in HEK293T cells; wherein, C1 is triptolide; G1 is dihydrotanshinone I; G2 is 10-hydroxycamptothecin; and R5 is topotecan hydrochloride.
[0047] Figure 11 The results show the effects of the four compounds used in Example 5 of this invention on the activity of SpCas9 in cleaving the EMX1-1 target site in U2OS cells; wherein, C1 is triptolide; G1 is dihydrotanshinone I; G2 is 10-hydroxycamptothecin; and R5 is topotecan hydrochloride.
[0048] Figure 12The results show the effects of the three compounds used in Example 5 of this invention on the activity of SpCas9 in cleaving the EMX1-2 target site in U2OS cells; wherein, G1 is dihydrotanshinone I; G2 is 10-hydroxycamptothecin; and R5 is topotecan hydrochloride.
[0049] Figure 13 The results show the effects of the three compounds used in Example 5 of this invention on the activity of SpCas9 in cleaving the RUNX1-1 target site in U2OS cells; wherein, G1 is dihydrotanshinone I; G2 is 10-hydroxycamptothecin; and R5 is topotecan hydrochloride.
[0050] Figure 14 The results show the effects of the three compounds used in Example 5 of this invention on the activity of SpCas9 in cleaving the ZSCAN2 target site in U2OS cells; wherein, G1 is dihydrotanshinone I; G2 is 10-hydroxycamptothecin; and R5 is topotecan hydrochloride.
[0051] Figure 15 The results show the effects of the three compounds used in Example 5 of this invention on the activity of SpCas9 in cleaving the VEGFA-3 target site in U2OS cells; wherein, G1 is dihydrotanshinone I; G2 is 10-hydroxycamptothecin; and R5 is topotecan hydrochloride. Detailed Implementation
[0052] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0053] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0054] Example 1: Construction of a dual-luciferase reporter cell line
[0055] In this embodiment, HEK293 cells were used as reporter cells to construct a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity.
[0056] 1. Construction of endogenous ACTG1-eGFP-P2A-Nluc luciferase reporter cells
[0057] Using CRISPR-Cas9 technology, a fusion expression gene of green fluorescent protein and secretory nanoluciferase was inserted before the stop codon (TGA) of the housekeeping gene ACTG1 in HEK293 cells. The green fluorescent protein was an enhanced green fluorescent protein, and the N-terminus of the nanoluciferase also contained a secretory signal peptide. A cleavable linker was present between the green fluorescent protein and the nanoluciferase.
[0058] Specifically, the fusion expression gene of green fluorescent protein and secretory nanoluciferase used in this embodiment is eGFP-P2A-Nluc, that is, the eGFP and Nluc genes are linked by P2A; P2A is a self-splicing linker derived from porcine teschovirus-1; the N-terminus of Nluc contains a secretory peptide signal, which can be secreted outside the cell after production, so that Nluc activity can be detected by cell lysate or cell supernatant; the base sequence of eGFP-P2A-Nluc is shown below (SEQ ID NO.1):
[0059]
[0060] Upstream and downstream of the eGFP-P2A-Nluc fusion gene are homologous arms of approximately 800 bp, with sequences identical to those upstream and downstream of the Cas9 cleavage site. After Cas9 cleaves the target site, the cell initiates a homologous recombination repair mechanism, inserting the homologous fragment into the 3' end of ACTG1. A schematic diagram illustrating the principle of CRISPR-Cas9-based knock-in of eGFP-P2A-Nluc is shown below. Figure 1 As shown in A in the figure, KI cassette represents the inserted sequence Gly linker-eGFP-P2A-Nluc.
[0061] The sgRNA sequence (sgRNA target site sequence: ACGCATCTGCTGAGTCCGTT, PAM is TAG) was cloned into the PX330 vector. The correctly sequenced plasmid and the plasmid containing the homologous recombination template were transfected into HEK293 cells. After 72 hours of transfection, GFP-positive cells were sorted by a three-round flow cytometer. Monoclonal cells were obtained by limiting dilution. After the cells were expanded to a suitable number, the cells were collected, and the knock-in of different monoclonal cells was detected by PCR and Western blotting, respectively. HEK293-ACTG1-KI-Nluc monoclonal cells were screened.
[0062] Junction PCR results of HEK293-ACTG1-KI-Nluc monoclonal cells are as follows: Figure 1 As shown in B; the Western blot results of the actin-GFP fusion protein are as follows. Figure 1 As shown in C. From Figure 1 As can be seen from B and C, this invention successfully constructed endogenous ACTG1-eGFP-P2A-Nluc luciferase reporter cells, namely HEK293-ACTG1-KI-Nluc monoclonal cells.
[0063] 2. Construction of a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity
[0064] The Fluc gene was cloned into pLenti-EF1α-N-HAFL-IRES-puro, and HEK293-ACTG1-KI-Nluc monoclonal cells (specifically HEK293-ACTG1-KI-Nluc-#2 cell line) were obtained by infecting lentiviruses packaged in 293T cells. After 48 hours, the cells were selected with 1 μg / mL puromycin for 7 days. Monoclonal cells were selected using the limiting dilution method, and the cells were expanded to an appropriate number. Cell lysates were collected, and Nluc and Fluc activities were detected.
[0065] The detection results of luciferase activity in the dual-luciferase reporter cell line constructed in this embodiment are as follows: Figure 2 As shown; Figure 2 In the figure, A represents the activity detection results of firefly luciferase (Fluc) and nanoluciferase (Nluc) in different HEK293-ACTG1-KI-Nluc-#2-Fluc monoclonal cells; Figure 2 In the figure, B represents the relative activities of firefly luciferase (Fluc) and nanoluciferase (Nluc) in different HEK293-ACTG1-KI-Nluc-#2-Fluc monoclonal cells. Figure 2 It can be seen that the present invention successfully constructed dual-luciferase reporter cell lines of Fluc and Nluc; among them, the Fluc activity of HEK293-ACTG1-KI-Nluc-#2-Fluc-#2 monoclonal cells was higher, and this cell line was selected for subsequent experiments.
[0066] Example 2: Detection of CRISPR-Cas protein cleavage activity in cells
[0067] This embodiment uses the dual-luciferase reporter cell line constructed in Example 1 to detect the cleavage activity of CRISPR-Cas protein in cells. Specifically, the dual-luciferase reporter cell line used is HEK293-ACTG1-KI-Nluc-#2-Fluc-#2.
[0068] The nano-luciferase detection kit used in this embodiment ( The Luciferase Assay System was purchased from Promega, Inc. (Catalog No. N1120); the Firefly Luciferase Reporter Gene Detection Kit was purchased from Beyotime Biotechnology Co., Ltd. (Catalog No. RG006); the T7 RNA polymerase was a product of Thermo Fisher Scientific; PTE4396 (Addgene: #74041); and PTE4398 (Addgene: #74042).
[0069] Experimental methods:
[0070] 1. Carrier Construction
[0071] Single-stranded DNA templates for gRNA were designed and ordered. After annealing, they were ligated into plasmids PX330 (digested with BBSI), PTE4396 (digested with Esp3I), and PTE4398 (digested with Esp3I), respectively, and transformed into engineered bacteria. Single colonies were picked and sequenced after transformation. Colonies showing successful construction of the recombinant vector were selected, and plasmids were extracted. Among them, PX330 is a plasmid expressing SpCas9 and empty sgRNA; PTE4396 is a plasmid expressing AsCpf1 and empty crRNA; and PTE4398 is a plasmid expressing LbCpf1 and empty crRNA.
[0072] The sequence of the gRNA template single-stranded DNA is shown below:
[0073] PX330-sgGFP-FP:CACCGGGCACGGGCAGCTTGCCGG
[0074] PX330-sgGFP-RP:AAACCCGGCAAGCTGCCCGTGCCC
[0075] PTE4396 / PTE4398-sgGFP-FP: AGATCGTCGCCGTCCAGCTCGACCAGG
[0076] PTE4396 / PTE4398-sgGFP-RP:AAAACCTGGTCGAGCTGGACGGCGACG
[0077] 2. Prokaryotic purification of SpCas9 protein
[0078] The recombinant plasmid pET28a-N-6×His-TEV-NLS-SpCas9 was transformed into BL21-star(DE3) competent cells and evenly spread on LB solid medium containing 50 μg / mL kanamycin, and cultured overnight at 37°C. Single clones were picked and seeded into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C for 16 h. Cells were then seeded into the same liquid medium at a volume ratio of 1:100 and cultured at 37°C until OD600. 600The culture medium was kept between 0.6 and 0.8, and then IPTG was added to a final concentration of 0.5 mM. Induction was performed at 18°C for 24 h. After induction, the cells were collected by centrifugation at 4°C and 4000 rpm for 10 min. 5 mL of lysis buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 20 mM imidazole, 5% glycerol) was added to every 100 mL of culture medium. The cells were resuspended and lysed using an ultrasonic homogenizer until the suspension was clear. The supernatant was collected by centrifugation at 4°C and 10000 rpm for 30 min. The supernatant was filtered through a 0.45 μm microporous membrane. The filtrate was passed through a His affinity chromatography column, eluted with 5 column volumes of lysis buffer, and then eluted with elution buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 250 mM imidazole, 5% glycerol). The elution buffer was collected and processed using Superdex chromatography. The protein was further purified by a 200 glucono-filtration chromatography column, and after concentration, a high-purity target protein was obtained. The protein concentration was tested using a BCA kit, and the protein was aliquoted and stored at -80°C.
[0079] The staining results of the purified prokaryotic SpCas9 protein are shown in the figure below. Figure 3 As shown, by Figure 3 It can be seen that the SpCas9 protein was successfully purified in this invention.
[0080] 3. In vitro transcription of sgRNA
[0081] The transcription template was generated by annealing primers (sgRNA-FP: TGTAATACGACTCACTATAGGG, sgRNA-RP: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCCGGCAAGCTGCCCGTGCCCTATAGTGAGTCGTATTACA). T7 polymerase and buffer were obtained from an in vitro transcription kit. A 20 μL transcription system containing 5 μM of transcription template was incubated at 37°C for 4–5 hours. Then, 1 μL of DNase was added, and the reaction was continued at 37°C for 15 minutes to digest the transcription template. sgRNA was recovered using an RNA recovery kit, purified, and aliquoted before storage at -80°C.
[0082] 4. Preparation of SpCas9 / sgRNA complex
[0083] The purified SpCas9 protein was mixed with in vitro transcribed sgRNA at a molar ratio of 1:1.2 and then incubated at room temperature for 30 min.
[0084] 5. Electric transfer
[0085] Seed HEK293-ACTG1-KI-Nluc-#2-Fluc-#2 cells in 10cm dishes. Once cells reached approximately 80% confluence, remove the supernatant and wash twice with PBS. Add 1mL of 0.25% trypsin digestion solution, and after 30 seconds, add 1mL of serum-containing cell culture medium. Transfer 800μL of the cell resuspended cells to two 1.5mL EP tubes and centrifuge at 500rpm for 20min. Aspirate the supernatant and add 100μL of electroporation buffer to the cell pellet. Add 440ng of the plasmid to be transfected or 20pmol of SpCas9 / sgRNA complex to 20μL of the cell resuspended cells. Then add the mixture to electroporation strips and use the Lonza 4D X module and the instrument's recommended electroporation program. After electroporation, add 100µL of preheated culture medium, resuspend the cells, and transfer to an appropriate amount of culture medium. Seed the cells in 96-well plates and place them in a cell culture incubator.
[0086] 6. Detection of luciferase activity
[0087] After culturing the cells for a period of time, the cell culture medium was removed, the cells were washed once with PBS, and 50 μL of reporter gene cell lysis buffer was added. After lysing at room temperature for 5 min, 20 μL of each cell was taken into two white 96-well plates, and the activities of nanoluciferase and firefly luciferase were detected according to the kit method.
[0088] 7. Data Processing
[0089] The Nluc activity of each well is corrected using the Fluc activity. The corrected enzyme activity is: RLU (Relative Fluorescence Intensity) = Nluc activity / Fluc activity × correction factor; where the correction factor is any constant.
[0090] The constant used in this embodiment is 100.
[0091] Cutting efficiency = [(relative fluorescence intensity of electroporated non-targeted sgRNA group) - (relative fluorescence intensity of electroporated targeted sgRNA group)] / (relative fluorescence intensity of electroporated non-targeted sgRNA group) × 100%.
[0092] Experimental results:
[0093] The cleavage efficiency of SpCas9 on the eGFP target site at different time points after electroporation of PX330 plasmid using the dual-luciferase reporter cell line obtained in this invention is shown in the following figures. Figure 4 As shown, by Figure 4 It can be seen that the dual-luciferase reporter cell line constructed in this invention can reflect the cleavage efficiency of SpCas9 on the target site at different time points.
[0094] The cleavage efficiency of SpCas9 on the eGFP target site at different time points after electroporation of the SpCas9 protein / sgRNA complex in the dual-luciferase reporter cell line obtained in this invention is as follows: Figure 5 As shown, by Figure 5 It is known that the dual-luciferase reporter cell line constructed in this invention can detect the cleavage efficiency of the SpCas9 protein / sgRNA complex at the target site.
[0095] The cleavage efficiency of AsCpf1 on the eGFP target site after 30 hours of electroporation of the PTE4396 plasmid in the dual-luciferase reporter cell line obtained in this invention is as follows: Figure 6 As shown; the cleavage efficiency of LbCpf1 on the eGFP target site after 24 hours of electroporation of the PTE4398 plasmid obtained in this invention is as follows. Figure 7 As shown. By Figure 6 and Figure 7 It is known that the dual-luciferase reporter cell line constructed in this invention can be used to detect the cleavage efficiency of AsCpf1 and LbCpf1 on target sites.
[0096] Example 3 Screening of CRISPR-Cas protein regulators
[0097] In this invention, cells obtained by electroporation in Example 2.5 were plated in 96-well plates containing different compounds (a total of 197 compounds, sourced from Dow Chemical or the inventor's laboratory compound library; these compounds had previously undergone in vitro screening, showing they could affect the binding of the SpCas9 / sgRNA complex to DNA). The final concentration of the compounds was 10 μM. A plate containing only DMSO served as a control group. Each experiment had 2-3 replicates; the DMSO control group had more than 10 replicates. The relative inhibition rate of the compound was calculated as (DMSO control group cleavage efficiency - experimental group cleavage efficiency) / DMSO control group cleavage efficiency × 100%. A negative inhibition rate indicated that the compound was an activator; a positive inhibition rate indicated that the compound was an inhibitor.
[0098] This invention calculates the Z-factor of the screening method by testing the cleavage efficiency of the DMSO control group in the PX330-sgGFP electroporation group in four 96-well plates. The Z' factor determination graph for screening SpCas9 protein regulator models is shown in the figure. Figure 8 As shown, by Figure 8 It can be seen that the Z factor is 0.640, which meets the requirements for high-throughput screening.
[0099] The test results of the effects of the 197 compounds used in this embodiment on SpCas9 activity are as follows: Figure 9 As shown, by Figure 9It was found that, after screening with reporter cell lines, 31 of the 197 compounds showed an inhibition rate of 20%–100% against SpCas9, indicating that these compounds have potential for further application. Furthermore, this invention selected four compounds (C1, G1, G2, and R5; C1 is triptolide; G1 is dihydrotanshinone I; G2 is 10-hydroxycamptothecin; and R5 is topotecan hydrochloride) to verify their functional targeting of SpCas9 at endogenous cleavage sites.
[0100] Example 4: Functional verification of four screened small molecule compounds inhibiting SpCas9 cleavage of endogenous sites.
[0101] PX330 plasmids targeting endogenous gene sites (EMX1-1, EMX1-2, RUNX1-1, ZSCAN2, VEGFA-3) were electroporated in 293T or U2OS cells and plated in 12-well plates containing the compounds. The DMSO group served as a control. After 24 hours, cells were collected and genomic DNA was extracted. The target sites were amplified using primers with sequencing adapters and a KOD PCR kit (Toyobo) to generate deep sequencing libraries. Single-end sequencing of the samples was performed using a 150HiSeq 2000 (Illumina) platform. The sequencing files were split using MATLAB, and the proportion of indels was analyzed using CRISPResso2.
[0102] The results of the assay for the effects of four compounds (C1, G1, G2, and R5, where C1 is triptolide; G1 is dihydrotanshinone I; G2 is 10-hydroxycamptothecin; and R5 is topotecan hydrochloride) on the activity of SpCas9 in cleaving the EMX1-1 target site in HEK293T cells are as follows: Figure 10 As shown, by Figure 10 The results showed that the proportion of indels in the control group was 29.1%, the proportion of indels in the C1 treatment group was 24%, the proportion of indels in the G2 treatment group was 12.6%, and the proportion of indels in the R5 treatment group was 14.5%, indicating that C1, G2, and R5 can inhibit the cleavage of the EMX1-1 target site by SpCas9 in HEK293T cells.
[0103] The results of the test on the effect of four compounds (C1, G1, G2, and R5) on the activity of SpCas9 in cleaving the EMX1-1 target site in U2OS cells are as follows: Figure 11 As shown, by Figure 11 The results showed that the proportion of indels in the control group was 33.7%, the proportion of indels in the G1 treatment group was 16.2%, the proportion of indels in the G2 treatment group was 21%, and the proportion of indels in the R5 treatment group was 25.8%, indicating that G1, G2, and R5 can inhibit the cleavage of the EMX1-1 target site by SpCas9 in U2OS cells.
[0104] The results of the tests on the effects of three compounds (G1, G2, and R5) on the activity of SpCas9 in U2OS cells at cleaving EMX1-2, RUNX1-1, ZSCAN2, and VEGFA-3 target sites are as follows: Figures 12-15 As shown, by Figures 12-15 The results show that G1, G2, and R5 can also inhibit the cleavage activity of SpCas9 on EMX1-2, RUNX1-1, ZSCAN2, and VEGFA-3 targets in U2OS cells, but the inhibitory effects differ at different sites.
[0105] The above results indicate that the dual-luciferase reporter gene based on nanoluciferase and firefly luciferase constructed in this invention can rapidly and sensitively detect the cleavage activity of CRISPR-Cas proteins, and has great application potential in comparing the activities of different CRISPR-Cas proteins or variants and in screening CRISPR-Cas protein regulators.
[0106] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A method for preparing a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity, characterized in that, Includes the following steps: S1. A fusion expression gene of green fluorescent protein and secretory nanoluciferase was inserted before the stop codon of the housekeeping gene in the reporter cells used, and monoclonal cells with successfully inserted fusion expression genes were screened; the reporter cells were HEK293 cells, and the housekeeping gene was... ACTG1 The fusion expression gene is eGFP-P2A-Nluc, and its base sequence is shown in SEQ ID NO.1; S2. Using a lentiviral vector carrying the puromycin N-acetyltransferase gene, the firefly luciferase gene was randomly inserted into the genome of the monoclonal cells obtained in step S1. Monoclonal cells containing firefly luciferase activity were screened with puromycin and cultured to obtain a dual-luciferase reporter cell line for detecting CRISPR-Cas protein cleavage activity.
2. The dual-luciferase reporter cell line prepared by the method of claim 1 for detecting CRISPR-Cas protein cleavage activity.
3. The use of the cell line of claim 2 in detecting CRISPR-Cas protein cleavage activity, evaluating the cleavage dynamics of CRISPR-Cas protein in cells, screening CRISPR-Cas protein mutants, or screening CRISPR-Cas protein regulators.
4. The use of the cell line of claim 2 in the preparation of products for detecting CRISPR-Cas protein cleavage activity, evaluating the cleavage dynamics of CRISPR-Cas protein in cells, screening CRISPR-Cas protein mutants, or screening CRISPR-Cas protein regulators.
5. A method for detecting CRISPR-Cas protein cleavage activity, characterized in that, The method is as follows: a plasmid expressing CRISPR-Cas protein and sgRNA targeting green fluorescent protein, or a CRISPR-Cas protein / sgRNA targeting green fluorescent protein complex, is transfected into the cell line described in claim 2. Simultaneously, a plasmid expressing CRISPR-Cas protein and sgRNA targeting green fluorescent protein, or a protein / sgRNA targeting green fluorescent protein complex, is transfected as a control. After incubating the transfected cells, the activities of nanoluciferase and firefly luciferase are detected, and the CRISPR-Cas protein cleavage efficiency is calculated.
6. The method according to claim 5, characterized in that, When detecting the activities of nano-luciferase and firefly luciferase, the nano-luciferase activity is corrected using the firefly luciferase activity. The corrected enzyme activity is: relative fluorescence intensity = nano-luciferase activity / firefly luciferase activity × correction factor; where the correction factor is any constant. CRISPR-Cas protein cleavage efficiency = [(relative fluorescence intensity of electroporated non-targeted sgRNA group) - (relative fluorescence intensity of electroporated targeted sgRNA group)] / (relative fluorescence intensity of electroporated non-targeted sgRNA group) × 100%.