A high-yield strain of b. edulis and a breeding method thereof

By optimizing the combination of enzymatic hydrolysate and stabilizer, and combining protoplast preparation with ARTP mutagenesis technology, a high-protein, fast-growing *Volvariella veitchii* strain, GXGD-EF-8-1, was screened, solving the problems of long production cycle and low protein content in *Volvariella veitchii*, and realizing efficient strain selection and large-scale production.

CN115747078BActive Publication Date: 2026-01-27NANJING HIGH TECH UNIV BIOLOGICAL TECH RES INST CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211251730.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-13
Publication Date
2026-01-27
Estimated Expiration
2042-10-13

AI Technical Summary

Technical Problem

Existing technologies for beefsteak mushrooms have long production cycles, low protein content, limited application of liquid spawn, and high costs for enzyme preparation from protoplasts, making it difficult to meet the needs of large-scale promotion.

Method used

By optimizing the combination of enzymatic hydrolysate and stabilizer, and combining protoplast preparation with ARTP mutagenesis technology, a high-protein-producing and fast-growing *Volvariella veitchii* strain, GXGD-EF-8-1, was screened. Protoplasts were prepared using inexpensive enzymes such as snail enzymes and cellulases, and gene mismatch mutagenesis was then performed.

Benefits of technology

It significantly improved the growth rate and protein yield of Beefsteak mushrooms, increased the mutation rate, and achieved efficient strain selection and large-scale production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115747078B_ABST
    Figure CN115747078B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of edible mushroom breeding, and particularly relates to a large edible fungus with high protein yield and a breeding method thereof.The large edible fungus with high protein yield is classified and named as Fistulina hepatica, and the strain number is GXGD-EF-8-1, which has been preserved in the China Center for Type Culture Collection on August 9, 2022, with a preservation number of CCTCC NO: M 20221254.The breeding method comprises the following steps: preparation of Fistulina hepatica mycelium, preparation of mycelium suspension, preparation of protoplasts by mycelium enzymolysis, ARTP mutagenesis, primary screening, and shake flask rescreening to obtain the Fistulina hepatica high-yield strain GXGD-EF-8-1.The present application optimizes the stabilizer and enzymolysis liquid in the preparation process of Fistulina hepatica protoplasts, improves the release rate and regeneration rate of Fistulina hepatica protoplasts, and uses the ARTP mutagenesis technology to breed a Fistulina hepatica strain capable of rapid growth and high protein yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of edible fungi breeding technology, specifically involving a high-yielding strain of *Volvariella veitchii* and its breeding method. Background Technology

[0002] *Fistulina hepatica*, also known as Japanese beef mushroom, Puerto Rican mushroom, brown mushroom, pig liver mushroom, pig tongue mushroom, and in Japan as liver mushroom or blood mushroom, is a tender, juicy, reddish-brown mushroom with a short or absent stem and a strong aroma. It has medicinal uses and is used in traditional Chinese medicine for its blood-tonifying properties. *Fistulina hepatica* is a rare edible mushroom found in temperate to subtropical regions. It is tender, has a unique lemon aroma, and is rich in vitamin C and various amino acids. Regular consumption can reduce cholesterol buildup, lower blood pressure, boost immunity, and prevent scurvy. Medicinally, it has anti-inflammatory, gastroenteritis-treating, and blood-tonifying effects. The fermentation mycelium of *Fistulina hepatica* contains a novel antifungal antibiotic (beefulina mycotoxin), which strongly inhibits sarcoma 5180. It also contains a rare amino acid, butyric acid. It is a valuable edible mushroom prized for its excellent appearance, flavor, and medicinal properties, earning it the nickname "beef of the mountains." Highly sought after by consumers, it has high commercial value and can be produced on a large scale. However, the mushroom is expensive, and there is a significant market gap.

[0003] In my country, the artificial cultivation of large edible fungi mainly adopts a two-stage fermentation bed-type cultivation model, using solid spawn such as layer sowing or hole sowing of wheat grain spawn, while the application of liquid spawn is relatively limited. Liquid spawn has advantages such as short production cycle, multiple germination points, uniform mycelial growth, and rapid mycelial growth, and has great potential for application in edible fungi spawn production and cultivation. He Peixin et al. optimized the culture medium and culture conditions for liquid spawn of *Schefflera arvensis* strain SB65 through single-factor experiments and uniform design. With an initial pH of 7.2, a culture temperature of 28℃, a culture time of 12 days, a shaking speed of 160 r / min, a liquid volume of 50 mL / 250 mL Erlenmeyer flask, and an inoculum size of 8% (v / v), the mycelial biomass obtained was 4.579 g / L. However, the yield is still relatively low, and the growth cycle of the strain is still relatively long. Improving the characteristics of *Schefflera arvensis* strains remains a key issue for industrial application.

[0004] Beefsteak mushrooms are large edible fungi, and their thick cell walls often make strain selection difficult. Therefore, purification, rejuvenation, and improvement of related strains are necessary, making cell wall removal the primary issue – protoplast preparation. Successful protoplast preparation is essential for protoplast mutagenesis and fusion breeding techniques. However, several enzymes currently used in protoplast preparation kits, such as yatalase, lysing enzymes, β-gluturonidase, and cell wall-dissolving enzymes, are expensive and have unsatisfactory effects, limiting their large-scale application. This case study will utilize one or more of the relatively inexpensive and readily available snail enzymes, cellulase, chitosanase, chitinase, and pectinase as the main cell wall-dissolving agents. By adjusting enzyme activity, dosage, and other parameters, the protoplast regeneration rate can be controlled, providing sufficient candidate germplasm resources for further strain selection.

[0005] Currently, methods for breeding large edible fungi strains are insufficient to meet practical needs simply through protoplast preparation and regeneration. Combining protoplast preparation and regeneration with mutagenesis breeding techniques can effectively improve the breeding level. This method not only detoxifies and rejuvenates strains but also increases the mutation rate of superior genes through gene mismatch, providing ample germplasm resources for further strain selection.

[0006] In existing technologies, it has been found that the overall crude protein level of edible fungi is relatively low. Specifically, the protein content of oyster mushrooms is 19-24%; king oyster mushrooms 14-23%; tea tree mushrooms 24-30%; shiitake mushrooms 8-20%; and enoki mushrooms 11-18%, etc. The starting strain selected for this case is *Schefflera arvense*, which has a crude protein content of 25%-33%, placing it among the superior starting protein strains in edible fungi. Currently, there are no reports on the selection and breeding of this strain. This case will utilize protoplast preparation and ARTP (room temperature plasma) mutagenesis techniques to screen for strains that improve growth rate and protein yield. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to provide a high-yield strain of Steak Mushroom in response to the shortcomings of the prior art.

[0008] Another technical problem to be solved by the present invention is to provide a method for breeding the above-mentioned high-yielding strains of *Volvariella veitchii*.

[0009] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0010] A high-yielding strain of *Fistulina hepatica*, classified and named *Fistulina hepatica*, strain number GXGD-EF-8-1, was deposited at the China Center for Type Culture Collection on August 9, 2022, with accession number CCTCC NO: M20221254.

[0011] Among them, the high-yielding strain of *Volvariella veitchii* has a growth rate of up to 17.05 mm / d, an organic matter content (dry weight) of up to 20.28 g / L, and a protein content of up to 42.50%.

[0012] The breeding method for the above-mentioned high-yielding *Volvariella veitchii* strains includes the following steps:

[0013] (1) Preparation of Beefsteak mushroom mycelium: The fruiting body segments of the starting strain of Beefsteak mushroom were disinfected with 75% v / v alcohol, repeatedly rinsed with sterile water, the outer layer of the fruiting body was removed, and a grain-sized tissue was cut from the core of the fruiting body and inoculated onto a modified PDA plate. After being cultured at 26℃ in the dark for 3-5 days, the white mycelium that grew was transferred and purified to obtain pure Beefsteak mushroom mycelium.

[0014] (2) Preparation of mycelial suspension: The purebred vegan mushroom mycelium obtained in step (1) was inoculated into the seed liquid at a rate of 5-6 pieces / bottle and cultured at 26℃ and 150rpm for 2-3 days. Then, the mycelial suspension was collected by shaking and filtration. After centrifugation at 10000rpm and 4℃ for 10min, the mycelium was collected, rinsed with stabilizer 1-2 times, and then resuspended with enzymatic hydrolysate to prepare mycelial suspension.

[0015] (3) Preparation of protoplasts by enzymatic hydrolysis of mycelium: The mycelium suspension obtained in step (2) was placed at 30℃ and 200rpm for 3h to prepare protoplast suspension.

[0016] (4) Protoplast regeneration: Adjust the concentration of the protoplast suspension from step (3) to 10. 6 The protoplasts were counted at 1 / mL. 0.1 mL of protoplast suspension was spread on the regeneration medium. The regeneration rate of protoplasts was observed and calculated. The regenerated protoplast strains were purified and rejuvenated, and regenerated strains with rapid growth and large colonies were screened.

[0017] (5) ARTP mutagenesis: The regenerated strains screened in step (4) were used to prepare protoplast suspensions, and the number of protoplasts was adjusted to 10. 5 -10 6 CFU / mL; Take 10 μL of the adjusted suspension and spread it evenly on the surface of the sterile slide, with a liquid layer thickness of 0.2-0.4 cm; Set the irradiation time to 0-180 s under the conditions of working power 100W, working airflow 10 SLM, and irradiation distance 2 mm.

[0018] (6) Initial screening: After the ARTP mutagenesis treatment in step (5) is completed, place the bacterial slide in an EP tube containing physiological saline and mix thoroughly. Dilute the mycelial content to 50-100 CFU / mL (for hemocytometer counting). Spread the mycelial slide on regeneration medium and incubate at 26℃ for 2-3 days. After single colonies grow on the regeneration medium, perform initial screening based on colony diameter and growth rate to select mutant strains with rapid growth and large colonies.

[0019] (7) Shake-flask re-screening: The mutant strains initially screened in step (6) were inoculated into Erlenmeyer flasks containing 200 mL of seed liquid and cultured at 26℃ and 150 rpm for 2-3 days. They were then inoculated into secondary seed liquid at a rate of 10% v / v and cultured. After static fermentation at 26℃ and 150 rpm for 3 days, the wet weight, ash content, dry weight, organic matter content, and protein content of the solid residue were used as indicators for re-screening to select strains that promote the rapid growth of Beefsteak mushroom and high protein production.

[0020] In step (1), the starting strain of Steak Mushroom is D-15, which was purchased from Shandong Mushroom Garden Edible Fungus Technology Co., Ltd., and the mushroom age is 28 days.

[0021] In step (2), the oscillation filtration to collect the mycelial suspension involves oscillation with 10-20 glass beads and filtration with Mircloth filter cloth.

[0022] In step (2), the stabilizer is reagent A and / or reagent B; wherein reagent A is 10mM NaH2PO4, 0.8M NaCl, pH 6.0, and the solvent is water; reagent B is 0.6-0.8mol / L mannitol, pH 6.0, and the solvent is water; the enzymatic hydrolysate includes any one or a combination of several of the following: 4000-10000U / mL cellulase, 200-500U / mL snailase, 100-400U / mL chitosanase, 100-400U / mL chitinase, and 100-400U / mL pectinase, and the remainder is a stabilizer.

[0023] The preferred stabilizer is a stabilizer prepared by mixing reagent A and reagent B in a 1:1 ratio. The preferred enzymatic hydrolysate is 8000 U / mL cellulase, 400 U / mL snailase, and the remainder is stabilizer.

[0024] In steps (2) and (7), the seed liquid consists of: 9 g / L glucose, 0.9 g / L yeast extract, 6 g / L soluble starch, 0.1 g / L potassium dihydrogen phosphate, 0.1 g / L anhydrous magnesium sulfate, 0.02 g / L vitamin B1, and 24 g / L wheat bran, with water as the solvent, packaged in 150-200 mL / bottle.

[0025] In step (3), the protoplast suspension releases 1.0 × 10⁻⁶ protoplasts. 6 -6.2×10 6 The CFU / mL concentration resulted in a protoplast regeneration rate of 0.33-3.37%.

[0026] The preferred protoplast release amount is 5.8 × 10⁻⁶. 6 The CFU / mL concentration resulted in a protoplast regeneration rate of 3.37%.

[0027] In steps (4) and (6), the regeneration culture medium consists of: 0.6 mol / L sucrose, 50 mg / L antibiotic, 200 g / L potato juice, 20 g / L glucose, 3 g / L potassium dihydrogen phosphate, 1.5 g / L magnesium sulfate, 0.1 g / L vitamin B1, and water as the solvent.

[0028] In step (4), the regenerated strains are EF-1, EF-2, EF-3, EF-4, EF-5, EF-6, EF-7, and EF-8, with EF-8 being the preferred regenerated strain.

[0029] In step (5), after ARTP mutagenesis treatment and regeneration culture, the number of colonies at 0S was observed, and the lethality of the mutant strain under irradiation times of 30S, 60S, 90S, 120S, and 180S was calculated. The lethality rates were 18.18%, 30.43%, 64.06%, 93.75%, and 95.31%, respectively, and the positive mutation rates were 9.20%, 11.12%, 34.69%, 46.25%, and 35.94%, respectively.

[0030] Furthermore, since the mutation effect is best when the lethality rate is above 90%, based on the positive mutation rate data and taking all factors into consideration, the mutant strain with a lethality rate of 93.75% and a positive mutation rate of 46.25% under 120s irradiation time is preferred for the initial regeneration screening.

[0031] In step (6), the initial screening selected a total of 6 mutant strains, which were named EF-8-1, EF-8-2, EF-8-3, EF-8-4, EF-8-5 and EF-8-6 respectively.

[0032] In step (7), the preferred mutant strain for the shake-flask screening is EF-8-1.

[0033] In step (7), the fermentation culture medium is: 50 mL / L corn flour saccharification solution, 20 g / L corn steep liquor, 5 g / L ammonium sulfate, 0.5 g / L magnesium sulfate, 0.08 g / L ferrous sulfate heptahydrate, 0.5 g / L potassium dihydrogen phosphate, 0.02 g / L vitamin B1, and pH 5.0.

[0034] The application of the above-mentioned high-yield strains of *Gnaphalium affine* in the preparation of edible fungi is also within the scope of protection of this invention.

[0035] Beneficial effects:

[0036] This invention improves the release and regeneration rate of *Volvariella veitchii* protoplasts by optimizing the stabilizer and enzymatic hydrolysate during the preparation process, and uses ARTP mutagenesis technology to breed a *Volvariella veitchii* strain GXGD-EF-8-1 that can grow rapidly and produce high protein. Attached Figure Description

[0037] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0038] Figure 1 Morphology and size of Steakhouse mushroom mycelium

[0039] Figure 2 Release status of Steak mushroom protoplasts

[0040] Figure 3 Regeneration status of Steak mushroom protoplasts

[0041] Figure 4 The growth of ARTP mutant strains of *Volvariella esculenta* protoplasts, with the top three from left to right being 0S, 30S, and 60S, and the bottom three from left to right being 90S, 120S, and 180S.

[0042] Figure 5 Growth diagram of protoplast strain (EF-8) and target strain (EF-8-1) Detailed Implementation

[0043] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are commercially available.

[0044] In the following embodiments, the beefsteak mushroom is D-15, purchased from Shandong Guyuan Edible Fungus Technology Co., Ltd., the snail enzyme is purchased from Shanghai Yuanye Biotechnology Co., Ltd., and the cellulase is purchased from Shandong Weilan Biotechnology Co., Ltd.

[0045] In the following embodiments, GXGD-EF-8-1 and EF-8-1 have the same meaning, both referring to high-yielding *Schefflera valieri* strains obtained through ARTP mutagenesis and final selection.

[0046] Example 1: Preparation of *Stachys edulis* protoplasts (optimal enzymatic hydrolysate and optimal permeation stabilizer)

[0047] (1) Preparation of *Volvariella venetum* mycelium: Under a clean bench, *Volvariella venetum* D-15 fruiting body segments were disinfected with 75% v / v alcohol, repeatedly rinsed with sterile water, and the outer layer of the fruiting body was removed. A rice-grain-sized tissue sample was taken from the core of the fruiting body and inoculated onto a modified PDA plate. The sample was then cultured at 26℃ in the dark for 3-5 days. The resulting white mycelium was transferred and purified to obtain a pure culture. The fruiting behavior was then verified, and the culture was identified as *Volvariella venetum*. Its mycelial morphology is as follows: Figure 1 As shown, the mycelium diameter is 2-4 μm.

[0048] Sequencing analysis was performed on the mycelium using primers ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' and ITS4: 5'-TCCTCCGCTTATTGATATGC-3'. The sequencing results are shown in SEQ ID No.:1, yielding a 656bp fragment (PCR amplified and sequenced by Wuhan Qingke Biotechnology Co., Ltd.), the specific sequence of which is as follows. AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTCAGTCGATCTTCTTCATGGAGATCGACCAAACATCAACCTTTATCTTTTAACTCTTTG TCTGAAAAATATTATGAATAAACAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCC GAAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAAAGCTTTTGGATTTTTTTAATCGAAAAGCTTTGGACTTGAGCAATCCCAACACCAATCTTTTGAGATCGGTGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTCCTGAGCTAAAAGCATA TTCATTTAGTCCCGTCAAACGGATTATTACTTTTGCTGCAGCTAACATAAAGGGAGTTTGACCGTATTGGCTGACTGATGCAGGATTTCACAAGGGTCGGCAACGATTCTTGTTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGAACTTAAGCATATCA

[0049] The PDA tablet formulation is as follows: 200g / L potato juice, 20g / L glucose, 3g / L potassium dihydrogen phosphate, 1.5g / L magnesium sulfate, and 0.1g / L vitamin B1.

[0050] (2) Preparation of mycelial suspension: 5-6 pieces of *Volvariella veitchii* mycelium were inoculated into the seed culture and cultured at 26℃ and 150 rpm for 2-3 days. Then, 10-20 sterilized glass beads were placed into the seed culture and shaken for 5-10 minutes. The mycelial clumps were then filtered through a 22-25 μm mircloth filter cloth (Calbiochem) to collect the mycelial suspension. After centrifugation at 10,000 rpm and 4℃ for 10 minutes, the mycelium was collected, rinsed 1-2 times with a stabilizer, and then resuspended in an enzymatic hydrolysate to prepare the mycelial suspension.

[0051] The seed culture formula is as follows: glucose 9g / L, yeast extract 0.9g / L, soluble starch 6g / L, potassium dihydrogen phosphate 0.1g / L, anhydrous magnesium sulfate 0.1g / L, vitamin B1 0.02g / L, wheat bran 24g / L, dispensed into 150-200mL bottles.

[0052] The penetrant formulation is as follows: Reagent A: 10mM NaH2PO4, 0.8M NaCl, pH 6.0; Reagent B: 0.6-0.8mol / L mannitol, pH 6.0; Reagent A and Reagent B are mixed in a 1:1 ratio to obtain the stabilizer.

[0053] The preparation of the enzymatic hydrolysate is as follows: snail enzyme and cellulase are prepared in the permeabilizing agent at a ratio of 400 U / mL and 8000 U / mL, respectively. After centrifugation at 8000 rpm for 15-20 min, the supernatant is filtered through a 0.22 μm microporous membrane. The resulting filtrate is the mixed enzymatic hydrolysate.

[0054] Enzyme activity is defined as follows: Under certain reaction conditions (pH 4.8, 50℃, constant temperature for 1 hour), the amount of glucose produced by 1 mL of cellulase solution from cellulose in 1 minute during the hydrolysis reaction is defined as 1 unit of filter paper enzyme activity, expressed as U.

[0055] (3) Preparation of protoplasts by enzymatic hydrolysis of mycelium: The prepared mycelium suspension was placed in the enzymatic hydrolysis solution and enzymatically hydrolyzed at 30℃ and 200 rpm for 3 hours to prepare a protoplast suspension. The protoplasts produced by enzymatic hydrolysis were observed and counted using a hemocytometer (Watson 25*16). Figure 2 As shown, the amount of protoplasts released was measured to be 5.8 × 10⁻⁶. 6 CFU / mL, with protoplast diameters ranging from 4 to 6 μm.

[0056] The formula for calculating protoplast release is:

[0057] (5) Protoplast regeneration: Adjust the protoplast concentration to 10 6 Protoplasts per mL were counted, and 0.1 mL of protoplast suspension was spread onto regeneration medium. The regeneration rate of protoplasts was observed and calculated. The calculated regeneration rate was 3.37%. Figure 3 As shown.

[0058] Regeneration rate calculation formula:

[0059] (6) Characterization of the growth characteristics of regenerated strains: from Figure 3 Eight rapidly growing and large-colony regenerated strains (EF-1, EF-2, EF-3, EF-4, EF-5, EF-6, EF-7, and EF-8) were selected from the protoplast colonies shown for regeneration and purified. After single colonies grew on the regeneration medium, the rapidly growing and large-colony regenerated strains were selected and compared with the original strains. The mycelial content and colony diameter were observed, and the growth rate was recorded and calculated. The results are shown in Table 1.

[0060] The regeneration culture medium formula is as follows: 0.6 mol / L sucrose, 50 mg / L antibiotic, 200 g / L potato juice, 20 g / L glucose, 3 g / L potassium dihydrogen phosphate, 1.5 g / L magnesium sulfate, and 0.1 g / L vitamin B1.

[0061] Table 1. Growth rate and yield of regenerated strains

[0062]

[0063] According to the results in Table 1, after protoplast detoxification and rejuvenation, the growth rate of EF-8 was 13.65 mm / d, and the protein yield was 35.52%, which was not significantly different from the protein content of the starting strain (D-15). Therefore, EF-8 was selected as the starting strain for the next mutagenesis.

[0064] Comparative Example 1: Preparation of *Stachys cuspidatum* protoplasts (screening of enzymatic hydrolysate)

[0065] The enzyme activity ratio and amount of snail enzyme and cellulase in the enzymatic hydrolysate were adjusted by adding a permeation stabilizer. The other conditions were the same as in Example 1. The release amount and regeneration rate of the 'beef steak mushroom' protoplasts were investigated, and the results are shown in Table 2.

[0066] Table 2. Release and regeneration rate of *Agropyron cristatum* protoplasts under different enzyme combinations.

[0067]

[0068] By adjusting the enzyme activities of different groups, it was found that in the enzymatic hydrolysate, the snail enzyme activity was 400 U / mL, the cellulase activity was 8000 U / mL, and the cellulase:snail enzyme activity ratio was 20:1. Under these conditions, the release of protoplasts of Mushroom veggie was the highest, the regeneration rate was also the highest, and the activity of its protoplasts was the greatest.

[0069] Comparative Example 2: Preparation of Steakhouse Mushroom Protoplasts (Screening of Penetrants)

[0070] With only the formulation of the penetrant adjusted, and all other conditions remaining the same as in Example 1, the release amount and regeneration rate of the Beefsteak mushroom protoplasts were investigated, and the results are shown in Table 3.

[0071] Table 3. Release and regeneration rate of *Agrocybe valieri* protoplasts under different enzyme combinations.

[0072] stabilizer formulation Protoplast release (CFU / mL) Regeneration rate (%) Reagent A <![CDATA[2.78×10 6 ]]> 1.11% Reagent B <![CDATA[1.74×10 6 ]]> 1.26% Reagent A : Reagent B = 1:1 <![CDATA[5.8×10 6 ]]> 3.37%

[0073] By adjusting the formulation of the permeation stabilizer, the results showed that the release of protoplasts was increased by the composite permeation stabilizer compared with that of a single inorganic salt or polar permeation stabilizer. Compared with reagent A, the composite permeation stabilizer increased the number of protoplasts by 2.09 times and the regeneration rate by 3.04 times; compared with reagent B, the composite permeation stabilizer increased the number of protoplasts by 3.33 times and the regeneration rate by 2.67 times.

[0074] Example 2: Screening of *Schefflera valgum* strains (protoplasts induced by ARTP mutagenesis)

[0075] (1) ARTP mutagenesis: Using EF-8 selected in Example 1 as the starting strain, protoplast suspension was prepared according to steps (2) and (3) of Example 1. The number of protoplasts was adjusted to 10. 5 -10 6 Take 10 μL of the adjusted suspension (CFU / mL) and spread it evenly on the surface of a sterile slide, with a liquid layer thickness of 0.2-0.4 cm. Set the irradiation time to 0-180 s under the conditions of 100 W working power, 10 SLM working airflow, and 2 mm irradiation distance.

[0076] The regeneration culture medium formula is as follows: 0.6 mol / L sucrose, 50 mg / L antibiotic, 200 g / L potato juice, 20 g / L glucose, 3 g / L potassium dihydrogen phosphate, 1.5 g / L magnesium sulfate, and 0.1 g / L vitamin B1.

[0077] (2) Initial screening: After ARTP mutagenesis treatment, the bacterial slides were placed in EP tubes containing physiological saline and thoroughly mixed. The mycelial content was diluted to 50-100 CFU / mL, then spread on regeneration medium and incubated at 26℃ for 2-3 days. The mutagenesis lethality was observed: with 0S treatment as a control, the lethality rates at 30S, 60S, 90S, 120S, and 180S were 18.18%, 30.43%, 64.06%, 93.75%, and 95.31%, respectively, and the positive mutation rates were 9.20%, 11.12%, 34.69%, 46.25%, and 35.94%, respectively. Figure 4 Since the mutant strain exhibits the best mutation effect when the lethality rate is above 90%, based on the positive mutation rate data and comprehensive consideration, the mutant strain with a lethality rate of 93.75% and a positive mutation rate of 46.25% under 120s irradiation time is selected for the initial regeneration screening.

[0078] After single colonies grow on the regeneration medium, initial screening is conducted based on colony diameter and growth rate. Mutant strains with rapid growth and large colonies are selected and compared with the original strain EF-8. The mycelial content and colony diameter are observed, and the growth rate is recorded and calculated.

[0079] The lethality rate is calculated as follows: (unmutated colonies - mutated colonies) / number of unmutated colonies × 100%.

[0080] Among them, the positive mutation rate is defined as an increase of more than 10% in mycelial protein content.

[0081] Six mutant strains were selected during the initial screening and named EF-8-1, EF-8-2, EF-8-3, EF-8-4, EF-8-5, and EF-8-6, respectively. Their growth over 4 consecutive days is shown in Table 4. Their growth rates were 24.97%, 15.75%, 19.41%, 12.82%, 7.33%, and 12.82% higher than that of the original strain EF-8, respectively.

[0082] Table 4. Plate diameter, growth rate, and yield of the mutant strain.

[0083]

[0084] (2) Shake-flask re-screening: The six fast-growing mutant strains EF-8-1, EF-8-2, EF-8-3, EF-8-4, EF-8-5, and EF-8-6 selected in step (2) were inoculated into Erlenmeyer flasks containing 200 mL of seed liquid and cultured at 26℃ and 150 rpm for 2 to 3 days. They were then inoculated into secondary seed liquid at a rate of 10% v / v (200 mL / 1 L Erlenmeyer flask) and fermented at 26℃ and 150 rpm for 3 days. The re-screening was carried out based on the wet weight, ash content, dry weight, organic matter content, and protein content of the solid residue. The specific re-screening results are shown in Table 5.

[0085] Organic matter content = dry weight - ash content.

[0086] Table 5. Results of secondary screening of 6 fast-growing mutant strains

[0087]

[0088]

[0089] As shown in Table 5, the organic matter content of mutant strains EF-8-1, EF-8-2, EF-8-3, EF-8-4, EF-8-5, and EF-8-6 increased by 31.69%, 27.28%, 18.77%, 12.01%, 23.77%, and 27.79% respectively compared to EF-8, while their protein content increased by 23.55%, 12.85%, 19.04%, 6.42%, 8.17%, and 6.89% respectively compared to EF-8.

[0090] In summary, through comprehensive comparative analysis, a mutant strain EF-8-1 was selected, exhibiting the fastest growth rate, highest organic matter content, and highest protein yield. The mutant strain EF-8-1 was deposited at the China Center for Type Culture Collection (CCTCC) on August 9, 2022, with strain number GXGD-EF-8-1 and accession number CCTCC M 20221254.

[0091] The seed culture formula is as follows: glucose 9g / L, yeast extract 0.9g / L, soluble starch 6g / L, potassium dihydrogen phosphate 0.1g / L, anhydrous magnesium sulfate 0.1g / L, vitamin B1 0.02g / L, wheat bran 24g / L, dispensed into 150-200mL bottles.

[0092] The wet weight of the solid residue was determined by centrifuging at 4000 rpm for 10 min, discarding the supernatant and retaining the solid residue, weighing the wet weight, and drying at 105℃ for 24 h to obtain the dry weight. The specific detection steps and methods for moisture, ash, and crude protein were in accordance with the national standards GB 5009.3-2016, GB5009.4-2016, and GB 5009.5-2016, respectively.

[0093] Comparative Example 3: Screening of *Schefflera valgum* strains (protoplasts not subjected to ARTP mutagenesis)

[0094] The *Agaricus bladderwrack* protoplasts were not subjected to ARTP mutagenesis. The protoplast suspension prepared in Example 2 was directly diluted and spread onto regeneration medium, and cultured at 26°C for 2–3 days. Their growth was then observed. The growth rate and protein content of the selected *Agaricus bladderwrack* strains were investigated under conditions where the protoplasts were not subjected to ARTP mutagenesis.

[0095] The results are shown in Table 6. After protoplast preparation, the growth rate of the strains was improved to some extent, but the protein content did not change significantly. After mutagenesis, both the growth rate and protein content of the strains showed significant improvement and breakthroughs. This indicates that the combined use of protoplast preparation and ARTP mutagenesis technology can induce strains with fast growth rate and high protein content. Figure 5 ).

[0096] Table 6 Comparison of growth rate and protein content of strains under different treatments

[0097]

[0098]

[0099] Results analysis: Compared with the starting strain D-15, the target strain EF-8-1 showed the following yield increases: average growth rate increased by 56.14% within 4 days, protein content increased by 24.09%, and organic matter content increased by 100%. Based on these results, it can be seen that the obtained target products were significantly improved. Therefore, combining protoplast and ARTP mutagenesis for multi-step selection and screening of large edible fungi will become an effective approach for the breeding of large edible fungi.

[0100] This invention provides a high-yielding strain of *Volvariella veitchii* and its breeding method. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

Claims

1. A high-yielding strain of *Volvariella veitchii* has been classified and named *Volvariella veitchii* (…). Hepatic fistula The strain, GXGD-EF-8-1, was deposited at the China Center for Type Culture Collection on August 9, 2022, with accession number CCTCC NO: M20221254.

Citation Information

Patent Citations

  • Polysaccharide-rich edible and medical fungus mycelium culture method and application

    CN107624513A

  • Medium composition for cultivating mushrooms according to species using food compost

    KR1020140101127A