Development and Application of Genome Editing Tools for Phytopathogenic Bacteria

Abstract

The present invention discloses the development and application of a genomic editing tool for phytopathogenic bacteria. The present invention provides a DNA molecule I, which has element A, element B, and element C; element A is an expression cassette for expressing the ligD gene and the Ku gene; element B is an expression cassette for expressing the Cas12a gene; the element C has an insertion site and a DNA segment for encoding the crRNA backbone; the insertion site is for inserting a DNA segment for encoding the specific binding region of the crRNA; the specific binding region of the crRNA specifically binds to the target sequence. The present invention constructs a set of genomic editing tools suitable for phytopathogenic bacteria by fusing the ligD / Ku protein with the CRISPR / FnCas12a system. This method adds a new powerful tool to the genetic analysis toolbox of phytopathogenic bacteria and has great value for studying the molecular interaction mechanism between host plants and pathogenic bacteria.

Description

Technical Field

[0001] The present invention belongs to the field of gene editing, and relates to the development and application of a genomic editing tool for plant pathogenic bacteria. Background Art

[0002] The most commonly used functional genomics method in bacteria is transposon sequencing (Tn-Seq). A transposon is a special DNA sequence that is inserted into the genomic DNA of the target strain through the catalysis of a transposase. Commonly used transposons include Tn3, Tn5, Tn10, Tn7, Mariner-like transposons, etc., and they are mainly applied to bacteria such as Bacillus, Pseudomonas, Xanthomonas, and Ralstonia. Generally, the transposon insertion contains a selection marker, and it is easy to identify the insertion site because it carries a transposon fragment. However, the insertion of the transposon is random, and it may be a single-copy insertion or a multi-copy insertion. This results in the inability to determine whether the phenotypic change is caused by gene insertion mutation under the same genetic background. For genes in a gene family, due to the redundancy of gene functions, the knockout of a single gene does not necessarily reveal the function of that gene. For certain essential genes, knockout inactivation will cause cell death, and the gene function cannot be studied using this technology either.

[0003] The emergence of genomic editing technologies based on the CRISPR technology has changed the development speed of life science research. The CRISPR / Cas technology uses artificial nucleases to cut at the target site of the biological genome, generating DNA double-strand breaks (DSBs), thereby activating the non-homologous end joining (NHEJ) repair and homology-directed repair (HDR) mechanisms of the cell to achieve the goal. Due to the advantages of high efficiency, simple operation, and low cost, the CRISPR / Cas system has been successfully applied to plants such as Arabidopsis thaliana, rice, wheat, and maize, especially for the study of the disease resistance gene functions of major crops and the genetic improvement of important agronomic traits. However, the application of the CRISPR / Cas system in microorganisms is still relatively limited, especially in pathogenic bacteria. Therefore, it is of great significance to develop a set of efficient genomic editing tools suitable for plant pathogenic bacteria. Summary of the Invention

[0004] The purpose of the present invention is to provide the development and application of a genomic editing tool for plant pathogenic bacteria.

[0005] The present invention provides a DNA molecule, named DNA molecule I, which has element A, element B, and element C;

[0006] Component A is an expression cassette for expressing the ligD gene and the Ku gene;

[0007] Component B is an expression cassette for expressing the Cas12a gene;

[0008] Component C has an insertion site and a DNA segment for encoding the crRNA backbone; the insertion site is for inserting a DNA segment for encoding the specific binding region of crRNA;

[0009] The specific binding region of crRNA specifically binds to the target sequence;

[0010] After the DNA segment for encoding the specific binding region of crRNA is inserted into the insertion site in Component C, it is ligated to the DNA segment for encoding the crRNA backbone, thereby expressing the full-length crRNA targeting the target sequence.

[0011] The ligD gene expresses the ligD protein.

[0012] The ligD protein is the ligD protein of the NHEJ pathway.

[0013] Specifically, the ligD protein is as shown in Sequence 11 of the sequence listing.

[0014] Specifically, the ligD gene is specifically as shown in nucleotides 6133 - 8412 of Sequence 2 in the sequence listing (coding strand).

[0015] The Ku gene expresses the Ku protein.

[0016] The Ku protein is the Ku protein of the NHEJ pathway.

[0017] The Ku protein is specifically the mKu protein.

[0018] Specifically, the Ku protein is as shown in Sequence 12 of the sequence listing.

[0019] Specifically, the Ku gene is specifically as shown in nucleotides 8441 - 9262 of Sequence 2 in the sequence listing (coding strand).

[0020] Specifically, the promoter in Component A is the J23119 promoter.

[0021] Specifically, the J23119 promoter is as shown in nucleotides 6072 - 6106 of Sequence 2 in the sequence listing (coding strand).

[0022] Specifically, the terminator in Component A is as shown in nucleotides 9263 - 9300 of Sequence 2 in the sequence listing (coding strand).

[0023] In Component A, the ligD gene is located upstream of the Ku gene.

[0024] In the said Component A, there is an RBS upstream of the ligD gene.

[0025] Specifically, the said RBS is shown as the nucleotides at positions 6107 - 6132 in Sequence 2 of the Sequence Listing.

[0026] In the said Component A, there is an RBS upstream of the Ku gene.

[0027] Specifically, the said RBS is shown as the nucleotides at positions 8413 - 8440 in Sequence 2 of the Sequence Listing.

[0028] Specifically, the said Component A is shown as the nucleotides at positions 6072 - 9300 in Sequence 2 of the Sequence Listing (coding strand).

[0029] The said Cas12a gene expresses Cas12a protein.

[0030] The said Cas12a protein is a Cas12a nuclease.

[0031] The said Cas12a protein can specifically be FnCas12 protein, LbCas12a protein or AsCas12a protein.

[0032] Specifically, the said FnCas12 protein is shown as Sequence 13 of the Sequence Listing.

[0033] Specifically, the promoter in the said Component B is the Ptet promoter.

[0034] Specifically, the terminator in the said Component B is the rrnB T2 terminator.

[0035] Specifically, the said Ptet promoter is shown as the nucleotides at positions 5924 - 6060 in Sequence 2 of the Sequence Listing (template strand).

[0036] Specifically, the said rrnB T2 terminator is shown as the nucleotides at positions 1950 - 1977 in Sequence 2 of the Sequence Listing (template strand).

[0037] Specifically, the said Cas12a gene is shown as the nucleotides at positions 2021 - 5923 in Sequence 2 of the Sequence Listing (template strand).

[0038] Specifically, the said Cas12a gene is shown as the nucleotides at positions 1366 - 5268 in Sequence 1 of the Sequence Listing (coding strand).

[0039] Specifically, the said Component B is shown as the nucleotides at positions 1950 - 6060 in Sequence 2 of the Sequence Listing (template strand).

[0040] In component C, the DNA segment encoding the crRNA backbone is as shown by nucleotides 1729 - 1747 in Sequence 2 of the Sequence Listing (coding strand).

[0041] In component C, the insertion site is located downstream of the DNA segment encoding the crRNA backbone.

[0042] The insertion site is a DNA segment with n restriction enzyme recognition sequences.

[0043] n is 1 or 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9.

[0044] Specifically, the insertion site has 2 SapI restriction enzyme recognition sequences.

[0045] Specifically, the insertion site is as shown by nucleotides 1748 - 1772 in Sequence 2 of the Sequence Listing.

[0046] Specifically, the promoter in component C is the J23119 promoter.

[0047] Specifically, the J23119 promoter is as shown by nucleotides 1693 - 1728 in Sequence 2 of the Sequence Listing (coding strand).

[0048] Specifically, the terminator in component C is the rrnBT1 terminator.

[0049] Specifically, the rrnBT1 terminator is as shown by nucleotides 1773 - 1858 in Sequence 2 of the Sequence Listing (coding strand).

[0050] Specifically, component C is as shown by nucleotides 1693 - 1858 in Sequence 2 of the Sequence Listing (coding strand).

[0051] DNA molecule I also has the TetR gene.

[0052] The TetR gene encodes the TetR protein.

[0053] The TetR protein is a tetracycline repressor protein.

[0054] Specifically, the TetR protein is as shown in Sequence 14 of the Sequence Listing.

[0055] Specifically, the TetR gene is as shown by nucleotides 9471 - 10094 in Sequence 2 of the Sequence Listing (template strand).

[0056] Specifically, the TetR gene is as shown by nucleotides 438 - 1061 in Sequence 1 of the Sequence Listing (coding strand).

[0057] Specifically, the DNA molecule I is as shown by the nucleotides at positions 1693 - 10216 of Sequence 2 in the Sequence Listing.

[0058] The present invention also provides a vector, named Vector I, which contains the DNA molecule I.

[0059] Specifically, the vector can be a circular plasmid.

[0060] Specifically, the vector can be the pHZB4 vector.

[0061] Specifically, the pHZB4 vector is as shown by Sequence 2 in the Sequence Listing.

[0062] The present invention also provides a DNA molecule, named DNA molecule II, which contains Element A, Element B, and Element D;

[0063] Element A is an expression cassette for expressing the ligD gene and the Ku gene;

[0064] Element B is an expression cassette for expressing the Cas12a gene;

[0065] Element D is an expression cassette for expressing crRNA.

[0066] The specific crRNA is designed according to the target sequence and is used to target and bind to the target sequence in the target gene.

[0067] Specifically, the crRNA is as shown by Sequence 4 in the Sequence Listing.

[0068] Specifically, the crRNA is as shown by Sequence 6 in the Sequence Listing.

[0069] Specifically, the crRNA is as shown by Sequence 8 in the Sequence Listing.

[0070] Specifically, the crRNA is as shown by Sequence 10 in the Sequence Listing.

[0071] Element A is any of the above-mentioned Element A.

[0072] Element B is any of the above-mentioned Element B.

[0073] Element D is any of the following:

[0074] (1) Replace "AgaagagcCTCGAGgctcttcATTT" in Element C with "GCAGCCTGCAGTGTCGCCGAATA", while keeping the other parts unchanged;

[0075] (2) Replace "AgaagagcCTCGAGgctcttcATTT" in Component C with "CTGGCAGCCAGGGCTCGTGCAGCAATTTCTACTGTTGTAGATCGACTTGAGCAGCCCCGCCAGGC", keeping the other parts unchanged;

[0076] (3) Replace "AgaagagcCTCGAGgctcttcATTT" in Component C with "GCATACTCGTAACATGCTCCGCAA", keeping the other parts unchanged;

[0077] (4) Replace "AgaagagcCTCGAGgctcttcATTT" in Component C with "ATCCGGGACAGCTGATAGCGCTAAATTTCTACTGTTGTAGATACAGGGTCTCATCGCAAGTGAAT", keeping the other parts unchanged.

[0078] The DNA molecule II can specifically be a DNA molecule obtained by performing any one of the following substitutions on the DNA molecule I:

[0079] (1) Replace "AgaagagcCTCGAGgctcttcATTT" in Component C with "GCAGCCTGCAGTGTCGCCGAATA", keeping the other parts unchanged;

[0080] (2) Replace "AgaagagcCTCGAGgctcttcATTT" in Component C with "CTGGCAGCCAGGGCTCGTGCAGCAATTTCTACTGTTGTAGATCGACTTGAGCAGCCCCGCCAGGC", keeping the other parts unchanged;

[0081] (3) Replace "AgaagagcCTCGAGgctcttcATTT" in Component C with "GCATACTCGTAACATGCTCCGCAA", keeping the other parts unchanged;

[0082] (4) Replace "AgaagagcCTCGAGgctcttcATTT" in Component C with "ATCCGGGACAGCTGATAGCGCTAAATTTCTACTGTTGTAGATACAGGGTCTCATCGCAAGTGAAT", keeping the other parts unchanged.

[0083] The present invention also provides a vector, named Vector II, which has the DNA molecule II.

[0084] The carrier may specifically be a circular plasmid.

[0085] The carrier may specifically be a recombinant plasmid obtained by inserting the DNA molecule II into the BamHI site of the pHM1 vector.

[0086] The carrier may specifically be a recombinant plasmid obtained by replacing a small fragment between the BamHI sites in the pHM1 vector with the DNA molecule II.

[0087] The carrier may specifically be a recombinant plasmid obtained by inserting the DNA molecule II into the BamHI site of the pBBR1MCS-2 vector.

[0088] The carrier may specifically be a recombinant plasmid obtained by replacing a small fragment between the BamHI sites in the pBBR1MCS-2 vector with the DNA molecule II.

[0089] The carrier may specifically be the targeting vector pHM1-pHZB4-fgXopN in the examples, the targeting vector

[0090] pHM1-pHZB4-fgXopAY / AU, the targeting vector pBBR1MCS-2-pHZB4-fgHopAB2, or the targeting vector pBBR1MCS-2-pHZB4-fgHopD / R.

[0091] The present invention also protects the application of any one of the above-mentioned DNA molecules or any one of the above-mentioned carriers in gene editing of bacteria.

[0092] The present invention also protects the application of any one of the above-mentioned DNA molecules or any one of the above-mentioned carriers in functional genomic research of bacteria.

[0093] The present invention also protects a kit, comprising any one of the above-mentioned DNA molecules or any one of the above-mentioned carriers;

[0094] The function of the kit is as follows (a) or (b):

[0095] (a) Gene editing of bacteria;

[0096] (b) Functional genomic research of bacteria.

[0097] The present invention also provides a method for gene editing of a target gene in bacteria, comprising the following steps:

[0098] Prepare a recombinant plasmid with a specific DNA molecule; the specific DNA molecule is a DNA molecule obtained by inserting a DNA segment encoding the specific binding region of crRNA into the insertion site of the DNA molecule I; the DNA segment encoding the specific binding region of crRNA specifically binds to a target sequence; the target sequence is selected according to the target gene;

[0099] Introduce the recombinant plasmid into bacteria, then culture to obtain recombinant bacteria, and screen for bacteria in which gene editing of the target gene has occurred from the recombinant bacteria.

[0100] The target gene can specifically be the XopN gene.

[0101] The target gene can specifically be the XopAY gene, XopAV gene, and XopAU gene.

[0102] The target gene can specifically be the HopAB2 gene.

[0103] The target gene can specifically be the HopD gene and HopR gene.

[0104] Exemplarily, a partial segment of the XopN gene is as shown in Sequence 3 of the sequence listing.

[0105] Exemplarily, partial related segments of the XopAY gene, XopAV gene, and XopAU gene are as shown in Sequence 5 of the sequence listing.

[0106] Exemplarily, a partial segment of the HopAB2 gene is as shown in Sequence 7 of the sequence listing.

[0107] Exemplarily, partial related segments of the HopD gene and HopR gene are as shown in Sequence 9 of the sequence listing.

[0108] The present invention also provides a method for functional genomic research on bacteria, comprising the following steps:

[0109] Prepare a recombinant plasmid with a specific DNA molecule; the specific DNA molecule is a DNA molecule obtained by inserting a DNA segment encoding the specific binding region of crRNA into the insertion site of the DNA molecule I; the DNA segment encoding the specific binding region of crRNA specifically binds to a target sequence; the target sequence is selected according to the target gene;

[0110] Introduce the recombinant plasmid into the starting bacteria, then culture to obtain recombinant bacteria, and screen for bacteria in which gene editing of the target gene has occurred from the recombinant bacteria, which are the target bacteria;

[0111] Determine the function of the target gene by comparing the trait differences between the starting bacteria and the target bacteria.

[0112] Specifically, any of the above-mentioned bacteria may be phytopathogenic bacteria.

[0113] Specifically, the bacteria are Xanthomonas oryzae or Pseudomonas.

[0114] Specifically, the Xanthomonas oryzae may be Xanthomonas oryzae pv. oryzae PXO99A.

[0115] Specifically, the Pseudomonas may be Pseudomonas syringae pv. tomato DC3000.

[0116] In the present invention, a set of genome editing tools suitable for phytopathogenic bacteria is constructed by fusing the ligD / Ku protein with the CRISPR / FnCas12a system. This method adds a new powerful tool to the genetic analysis toolbox of phytopathogenic bacteria and has great value for studying the molecular interaction mechanism between host plants and pathogenic bacteria.

[0117] The beneficial effect of the present invention: knockout of target genes in the genome of phytopathogenic bacteria is achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0118] Figure 1 Photos of static culture for 3 - 5 days in Example 3.

[0119] Figure 2 Result diagram of Example 3.

[0120] Figure 3 Result diagram of Example 4.

[0121] Figure 4 Result diagram of Example 5.

[0122] Figure 5 Result diagram of Example 6. DETAILED DESCRIPTION OF THE INVENTION

[0123] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not limit the present invention in any way. The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified. Unless otherwise specified, the quantitative tests in the following embodiments are all set with three repeated experiments, and the results are averaged. The recombinant plasmids in the embodiments have all been verified by sequencing.

[0124] The pHM1 vector, whose full sequence is recorded in NCBI (NCBI accession number: EF059993.1; 14-JUL-2016).

[0125] pBBR1MCS-2 vector: Addgene, Plasmid: #85168.

[0126] Xanthomonas oryzae pv. oryzae PXO99A, whose whole genome sequence is recorded in NCBI (NCBI accession number: CP000967.2; 16-NOV-2015).

[0127] Pseudomonas syringae pv. tomato str. DC3000, whose whole genome sequence is recorded in NCBI (NCBI accession number: NC_004578.1; 26-OCT-2021).

[0128] Example 1. Construction of the tool vector

[0129] I. Construction of the pHZB3 vector

[0130] The pHZB3 vector is a circular plasmid formed by double-stranded DNA.

[0131] The full sequence of the pHZB3 vector is shown in Sequence 1 of the Sequence Listing.

[0132] The element order in Sequence 1 is as follows:

[0133] TetR-Ptet-FnCas12-rrnB T2 terminator-rrnB T1 terminator-crRNA backbone-J23119.

[0134] In Sequence 1 of the sequence listing, nucleotides 310-315 are the recognition sequence for BamHI digestion, nucleotides 438-1061 constitute the TetR gene (coding strand), nucleotides 1229-1365 constitute the Ptet promoter (coding strand), nucleotides 1366-5268 constitute the FnCas12 gene (coding strand), nucleotides 5312-5339 constitute the rrnB T2 terminator (coding strand), nucleotides 5431-5516 constitute the rrnB T1 terminator (template strand), nucleotides 5521-5527 are the recognition sequence for SapI digestion, nucleotides 5534-5540 are the recognition sequence for SapI digestion, nucleotides 5542-5560 encode the crRNA backbone (template strand), nucleotides 5561-5596 constitute the J23119 promoter (template strand), and nucleotides 5597-5602 are the recognition sequence for BamHI digestion.

[0135] II. Construction of the pHZB4 vector

[0136] The pHZB4 vector is a circular plasmid formed by double-stranded DNA.

[0137] The complete sequence of the pHZB4 vector is shown in Sequence 2 of the sequence listing.

[0138] The order of the elements in Sequence 2 is as follows: J23119-crRNA backbone-rrnB T1 terminator-rrnB T2 terminator-FnCas12-Ptet-J23119-RBS-ligD-RBS-mKu-Terminator-TetR.

[0139] In the nucleotide positions 1687 - 1692 of Sequence 2 in the Sequence Listing, the nucleotide sequence is the recognition sequence for BamHI digestion; the nucleotide positions 1693 - 1728 form the J23119 promoter (coding strand); the nucleotide positions 1729 - 1747 encode the crRNA backbone (coding strand); the nucleotide positions 1749 - 1755 form the recognition sequence for SapI digestion; the nucleotide positions 1762 - 1768 form the recognition sequence for SapI digestion; the nucleotide positions 1773 - 1858 form the rrnBT1 terminator (coding strand); the nucleotide positions 1950 - 1977 form the rrnB T2 terminator (template strand); the nucleotide positions 2021 - 5923 form the FnCas12 gene (template strand); the nucleotide positions 5924 - 6060 form the Ptet promoter (template strand); the nucleotide positions 6072 - 6106 form the J23119 promoter (coding strand); the nucleotide positions 6107 - 6132 form the RBS (coding strand); the nucleotide positions 6133 - 8412 form the ligD gene (coding strand); the nucleotide positions 8413 - 8440 form the RBS (coding strand); the nucleotide positions 8441 - 9262 form the mKu gene (coding strand); the nucleotide positions 9263 - 9300 form the terminator (coding strand); the nucleotide positions 9471 - 10094 form the TetR gene (template strand); the nucleotide positions 10217 - 10222 are the recognition sequence for BamHI digestion.

[0140] Example 2. Construction of the targeting vector and the control vector

[0141] I. Construction of the pHM1 - pHZB3 - fgXopN vector and its control vector

[0142] The target gene is the XopN gene of Xanthomonas oryzae pv. oryzae PXO99A.

[0143] Part of the relevant region in the genomic DNA of Xanthomonas oryzae pv. oryzae PXO99A is shown in Sequence 3 of the Sequence Listing.

[0144] 1. Using TTN as PAM, select the target sequence in the target gene (the selected target sequence is located at positions 225 - 247 in Sequence 3). Design the specific binding region in crRNA according to the target sequence. Synthesize single-stranded DNA molecule fgXopN-F1 and single-stranded DNA molecule fgXopN-R1 respectively. After annealing the single-stranded DNA molecule fgXopN-F1 and the single-stranded DNA molecule fgXopN-R1, a double-stranded DNA molecule with sticky ends is formed. Insert the double-stranded DNA molecule with sticky ends between the cleavage sites of two SapI restriction enzyme recognition sequences in the pHZB3 vector (i.e., replace "AAATgaagagcCTCGAGgctcttcT" in the pHZB3 vector with "TATTCGGCGACACTGCAGGCTGC", keeping other parts unchanged) to obtain a recombinant plasmid. The recombinant plasmid expresses the crRNA shown in Sequence 4 of the sequence listing.

[0145] fgXopN-F1: gatGCAGCCTGCAGTGTCGCCGAATA;

[0146] fgXopN-R1: aaaTATTCGGCGACACTGCAGGCTGC.

[0147] 2. Take the recombinant plasmid obtained in step 1, perform digestion with the restriction enzyme BamHI, and recover a fragment of about 5.3 kb.

[0148] 3. Take the pHM1 vector, perform digestion with the restriction enzyme BamHI, then perform dephosphorylation treatment, and then recover a fragment of about 12 kb.

[0149] 4. Connect the fragment recovered in step 2 and the fragment recovered in step 3 to obtain a recombinant plasmid, which is the targeting vector pHM1-pHZB3-fgXopN for targeting the XopN gene of Xanthomonas oryzae pv. oryzae (also known as pHM1-B3-fgXopN).

[0150] 5. Take the pHZB3 vector, perform digestion with the restriction enzyme BamHI, and recover a fragment of about 5.3 kb.

[0151] 6. Connect the fragment recovered in step 5 and the fragment recovered in step 3 to obtain a recombinant plasmid, which is the control vector of the targeting vector pHM1-pHZB3-fgXopN, simply referred to as the pHM1-pHZB3 vector (also known as pHM1-B3).

[0152] II. Construction of the pHM1-pHZB4-fgXopN vector and its control vector.

[0153] 1. Using TTN as PAM, select the target sequence in the target gene (the selected target sequence is located at positions 225 - 247 in Sequence 3). Design the specific binding region in crRNA according to the target sequence. Synthesize single-stranded DNA molecule fgXopN-F1 and single-stranded DNA molecule fgXopN-R1 respectively. After annealing the single-stranded DNA molecule fgXopN-F1 and the single-stranded DNA molecule fgXopN-R1, a double-stranded DNA molecule with sticky ends is formed. Insert the double-stranded DNA molecule with sticky ends between the cleavage sites of two SapI restriction enzyme recognition sequences in the pHZB4 vector (i.e., replace "AgaagagcCTCGAGgctcttcATTT" in the pHZB4 vector with "GCAGCCTGCAGTGTCGCCGAATA", keeping other parts unchanged) to obtain a recombinant plasmid. The recombinant plasmid expresses the crRNA shown in Sequence 4 of the sequence listing.

[0154] 2. Take the recombinant plasmid obtained in step 1, digest it with the restriction enzyme BamHI, and recover a fragment of about 8.5 kb.

[0155] 3. Take the pHM1 vector, digest it with the restriction enzyme BamHI, then perform dephosphorylation treatment, and then recover a fragment of about 12 kb.

[0156] 4. Connect the fragment recovered in step 2 and the fragment recovered in step 3 to obtain a recombinant plasmid, which is the targeting vector pHM1-pHZB4-fgXopN (also known as pHM1-B4-fgXopN) for targeting the XopN gene of Xanthomonas oryzae pv. oryzae.

[0157] 5. Take the pHZB4 vector, digest it with the restriction enzyme BamHI, and recover the fragment.

[0158] 6. Connect the fragment recovered in step 5 and the fragment recovered in step 3 to obtain a recombinant plasmid, which is the control vector of the targeting vector pHM1-pHZB4-fgXopN, simply referred to as the pHM1-pHZB4 vector (also known as pHM1-B4).

[0159] III. Construction of the pHM1-pHZB4-fgXopAY / AU vector

[0160] The target genes are the XopAY gene, XopAV gene, and XopAU gene of Xanthomonas oryzae pv. oryzae PXO99A.

[0161] Part of the relevant region in the genomic DNA of Xanthomonas oryzae pv. oryzae PXO99A is shown in Sequence 5 of the sequence listing.

[0162] 1. Using TTN as PAM, select double target sequences in the target gene (the selected target sequences are located at positions 251 - 273 and 3724 - 3746 in sequence 5 respectively). Design the specific binding region in crRNA according to the double target sequences. Synthesize single-stranded DNA molecule fgXopAY / AU-F1 and single-stranded DNA molecule fgXopAY / AU-R1 respectively. After annealing the single-stranded DNA molecule fgXopAY / AU-F1 and the single-stranded DNA molecule fgXopAY / AU-R1, a double-stranded DNA molecule with sticky ends is formed. Insert the double-stranded DNA molecule with sticky ends between the cleavage sites of two SapI restriction enzyme recognition sequences in the pHZB4 vector (i.e., replace "AgaagagcCTCGAGgctcttcATTT" in the pHZB4 vector with "CTGGCAGCCAGGGCTCGTGCAGCAATTTCTACTGTTGTAGATCGACTTGAGCAGCCCCGCCAGGC", and keep the other parts unchanged) to obtain a recombinant plasmid. The recombinant plasmid expresses the crRNA shown in sequence 6 of the sequence listing.

[0163] fgXopAY / AU-F1: gatCTGGCAGCCAGGGCTCGTGCAGCAATTTCTACTGTTGTAGATCGACTTGAGCAGCCCCGCCAGGC;

[0164] fgXopAY / AU-R1: aaaGCCTGGCGGGGCTGCTCAAGTCGATCTACAACAGTAGAAATTGCTGCACGAGCCCTGGCTGCCAG.

[0165] 2. Take the recombinant plasmid obtained in step 1, digest it with the restriction enzyme BamHI, and recover a fragment of about 8.5 kb.

[0166] 3. Take the pHM1 vector, digest it with the restriction enzyme BamHI, then perform dephosphorylation treatment, and then recover a fragment of about 12 kb.

[0167] 4. Connect the fragment recovered in step 2 and the fragment recovered in step 3 to obtain a recombinant plasmid, which is the targeting vector pHM1-pHZB4-fgXopAY / AU for targeting the XopAY gene, XopAV gene, and XopAU gene of Xanthomonas oryzae pv. oryzae.

[0168] IV. Construction of pBBR1MCS-2-pHZB4-fgHopAB2 vector

[0169] The target gene is the HopAB2 gene of Pseudomonas syringae pv. tomato DC3000.

[0170] A partial relevant segment in the genomic DNA of Pseudomonas syringae pv. tomato DC3000 is as shown in Sequence 7 of the Sequence Listing.

[0171] 1. Using TTN as the PAM, select the target sequence in the target gene (the selected target sequence is located at positions 598 - 621 in Sequence 7). Design the specific binding region in the crRNA according to the target sequence. Synthesize the single-stranded DNA molecule fgHopAB2-F1 and the single-stranded DNA molecule fgHopAB2-R1 respectively. After annealing the single-stranded DNA molecule fgHopAB2-F1 and the single-stranded DNA molecule fgHopAB2-R1, a double-stranded DNA molecule with sticky ends is formed. Insert the double-stranded DNA molecule with sticky ends between the cleavage sites of two SapI restriction enzyme recognition sequences of the pHZB4 vector (i.e., replace "AgaagagcCTCGAGgctcttcATTT" in the pHZB4 vector with "GCATACTCGTAACATGCTCCGCAA", keeping other parts unchanged) to obtain a recombinant plasmid. The recombinant plasmid expresses the crRNA shown in Sequence 8 of the Sequence Listing.

[0172] fgHopAB2-F1: gatGCATACTCGTAACATGCTCCGCAA;

[0173] fgHopAB2-R1: aaaTTGCGGAGCATGTTACGAGTATGC.

[0174] 2. Take the recombinant plasmid obtained in step 1, perform digestion with the restriction enzyme BamHI, and recover a fragment of about 8.5 kb.

[0175] 3. Take the pBBR1MCS-2 vector, perform digestion with the restriction enzyme BamHI, and recover a fragment of about 5.1 kb

[0176] 4. Connect the fragment recovered in step 2 and the fragment recovered in step 3 to obtain a recombinant plasmid, which is the targeting vector pBBR1MCS-2-pHZB4-fgHopAB2 for targeting the HopAB2 gene of Pseudomonas syringae pv. tomato DC3000.

[0177] V. Construction of the pBBR1MCS-2-pHZB4-fgHopD / R vector

[0178] The target genes are the HopD gene and the HopR gene of Pseudomonas syringae pv. tomato DC3000.

[0179] A partial relevant segment in the genomic DNA of Pseudomonas syringae pv. tomato DC3000 is as shown in Sequence 9 of the Sequence Listing.

[0180] 1. Using TTN as PAM, select double target sequences in the target gene (the selected target sequences are located at positions 237 - 259 and 14028 - 14050 in Sequence 9 respectively). Design the specific binding region in the crRNA according to the double target sequences. Synthesize single-stranded DNA molecule fgHopD / R-F1 and single-stranded DNA molecule fgHopD / R-R1 respectively. After annealing the single-stranded DNA molecule fgHopD / R-F1 and the single-stranded DNA molecule fgHopD / R-R1, a double-stranded DNA molecule with sticky ends is formed. Insert the double-stranded DNA molecule with sticky ends between the cleavage sites of two SapI restriction enzyme recognition sequences of the pHZB4 vector (i.e., replace "AgaagagcCTCGAGgctcttcATTT" in the pHZB4 vector with "ATCCGGGACAGCTGATAGCGCTAAATTTCTACTGTTGTAGATACAGGGTCTCATCGCAAGTGAAT", and keep the other parts unchanged) to obtain a recombinant plasmid. The recombinant plasmid expresses the crRNA shown in Sequence 10 of the sequence listing.

[0181] fgHopD / R-F1: gatATCCGGGACAGCTGATAGCGCTAAATTTCTACTGTTGTAGATACAGGGTCTCATCGCAAGTGAAT;

[0182] fgHopD / R-R1: aaaATTCACTTGCGATGAGACCCTGTATCTACAACAGTAGAAATTTAGCGCTATCAGCTGTCCCGGAT.

[0183] 2. Take the recombinant plasmid obtained in Step 1, perform digestion with the restriction enzyme BamHI, and recover a fragment of about 8.5 kb.

[0184] 3. Take the pBBR1MCS-2 vector, perform digestion with the restriction enzyme BamHI, and recover a fragment of about 5.1 kb

[0185] 4. Connect the fragment recovered in Step 2 and the fragment recovered in Step 3 to obtain a recombinant plasmid, which is the targeting vector pBBR1MCS-2-pHZB4-fgHopD / R for targeting the HopD gene and HopR gene of Pseudomonas syringae pv. tomato DC3000.

[0186] Example 3. Detection of the editing efficiency of the targeting vector for the XopN gene of Xanthomonas oryzae pv. oryzae PXO99A

[0187] Test vectors: pHM1-pHZB3 vector, targeting vector pHM1-pHZB3-fgXopN, pHM1-pHZB4 vector, targeting vector pHM1-pHZB4-fgXopN.

[0188] The schematic diagram of the target sequence targeted by the targeting vector is shown in Figure 2 A of

[0189] Electroporate the test vectors into Xanthomonas oryzae pv. oryzae PXO99A, and the specific steps are as follows:

[0190] 1. Take 0.7 - 1 μg of the test vector and place it in 100 μl of melted competent cells of Xanthomonas oryzae pv. oryzae PXO99A. After gently mixing, place it in a pre-cooled 0.1 cm electroporation cuvette, and electroporate at 2.5 KV for 4 - 6 ms. Then add 700 μl of liquid NB medium (Nutrient broth 8 g / L, pH 7.0 - 7.2), and incubate with shaking at 28 °C and 200 rpm for 2 - 3 h.

[0191] 2. After completing step 1, add tetracycline to make its concentration in the system 200 ng / L, incubate with shaking at 28 °C and 200 rpm for 1 h, then centrifuge to collect the cell pellet, and spread it on a solid NB medium (Nutrient broth 8 g / L, Agar 15 g / L, pH 7.0 - 7.2) plate containing 100 ng / μl spectinomycin, and incubate statically at room temperature for 3 - 5 days.

[0192] The photos of static incubation for 3 - 5 days are shown in Figure 1 Compared with the treatment group transformed with the pHM1-pHZB3 vector, the number of colonies in the treatment group transformed with the targeting vector pHM1-pHZB3-fgXopN was significantly reduced, indicating that the FnCas12a nuclease can effectively cleave the bacterial chromosome under the guidance of crRNA with a specific binding region. Compared with the treatment group transformed with the targeting vector pHM1-pHZB3-fgXopN, the number of colonies in the treatment group transformed with the targeting vector pHM1-pHZB4-fgXopN was significantly increased, and the number of colonies increased approximately 5-fold.

[0193] 3. After completing step 2, randomly pick monoclonal colonies. After expanding and multiplying the monoclonal colonies, extract genomic DNA respectively. Using the genomic DNA as a template, perform PCR amplification with the primer pair composed of XopN-F3 and XopN-R3, and then perform agarose gel electrophoresis. For the electrophoresis showing amplified products, recover and sequence the amplified products. For the electrophoresis not showing amplified products, perform whole-genome sequencing.

[0194] XopN-F3: GTTTTCGCTCAATCCCTGCG;

[0195] XopN-R3: CCACTGCATCAAGCACCAGG.

[0196] For the treatment group transformed with the targeting vector pHM1-pHZB3-fgXopN, 22 randomly selected monoclonal colonies were detected. Electrophoresis of the 22 monoclonal colonies after PCR amplification showed amplification products, and the sequencing results indicated that these amplification products were all wild-type. The results showed that the FnCas12a nuclease could effectively exert its cleavage activity under the guidance of crRNA with a specific binding region, but bacteria did not have the function of repairing DSB.

[0197] For the treatment group transformed with the targeting vector pHM1-pHZB4-fgXopN, 44 randomly selected monoclonal colonies were detected. The sequencing results showed that only 3 monoclonal colonies were wild-type, and the remaining 41 monoclonal colonies had mutations (the mutation forms were all deletions, and the deletion sizes ranged from 23 bp to 8808 bp), and the mutation efficiency was 93.18%. Exemplary electrophoresis diagrams of some monoclonal colonies after PCR amplification are shown in Figure 2 B of, some showed amplification products and some did not. The sequencing results of the amplification products of an exemplary monoclonal colony are shown in Figure 2 C of. The sequencing results of the whole-genome sequencing of some exemplary monoclonal colonies are shown in Figure 2 D of. The 44 monoclonal colonies were statistically analyzed according to the size of the deleted fragments, and the results are shown in Figure 2 E of. The results showed that the DSBs introduced into Xanthomonas oryzae by crRNA with a specific binding region and the FnCas12a nuclease were efficiently repaired by the mtNHEJ proteins (ligD / Ku).

[0198] Example 4: Detection of the editing efficiency of the multi-gene XopAY-AU targeting vector in Xanthomonas oryzae

[0199] The schematic diagram of the target sequence targeted by the targeting vector is shown in Figure 3 A of.

[0200] 1. Take 0.7 - 1 μg of the targeting vector pHM1-pHZB4-fgXopAY / AU and place it in 100 μl of melted Xanthomonas oryzae PXO99A competent cells. After gently mixing, place it in a pre-cooled 0.1 cm electroporation cuvette, and perform electroporation at 2.5 KV for 4 - 6 ms. Then add 700 μl of liquid NB medium and incubate at 28 °C and 200 rpm for 2 - 3 h.

[0201] 2. After completing step 1, add tetracycline to make its concentration in the system 200 ng / L, incubate at 28 °C and 200 rpm for 1 h, then centrifuge to collect the cell pellet and spread it on a solid NB medium plate containing 100 ng / μl spectinomycin, and incubate at room temperature for 3 - 5 days.

[0202] 3. After completing Step 2, randomly pick 22 monoclonal clones. After expanding the monoclonal clones, extract genomic DNA separately. Using the genomic DNA as a template, perform PCR amplification with the primer pair consisting of XopAY / AU-F1 and XopAY / AU-R2, and then perform agarose gel electrophoresis. For those with electrophoresis showing amplified products, recover and sequence the amplified products. For those without electrophoresis showing amplified products, perform whole-genome sequencing.

[0203] XopAY / AU-F1: AGCAGCGAACACGAATTCCA;

[0204] XopAY / AU-R2: TTTCGGTGAAAAAGGGGGCG.

[0205] The sequencing results show that only 3 monoclonal clones are wild-type, and the remaining 19 monoclonal clones have all mutated (the mutation form is deletion, and the mutation efficiency is 86.36%). Among the 19 mutated monoclonal clones, 1 monoclonal clone has a deletion of 3482 bp (the deletion region corresponds to positions 259 to 3740 of Sequence 5), 1 monoclonal clone has a deletion of 3491 bp (the deletion region corresponds to positions 254 to 3744 of Sequence 5), and the remaining 17 monoclonal clones have large fragment deletions (the deletion regions completely cover Sequence 5). An exemplary electrophoresis pattern after PCR amplification of some monoclonal clones is shown in Figure 3 B of, some show amplified products and some do not. The sequencing result of the amplified product of an exemplary monoclonal clone is shown in Figure 3 C of. The results show that multiple genes can be deleted in large fragments by designing a pair of target sites, that is, the FnCas12-ligD / Ku-mediated genome editing system can be applied not only to single-gene knockout but also to multi-gene knockout.

[0206] Example 5. Construction of Pseudomonas syringae HopAB2 targeting vector and detection of editing efficiency

[0207] 1. Take 0.7 - 1 μg of the targeting vector pBBR1MCS-2-pHZB4-fgHopAB2 and place it in 100 μl of melted competent cells of Pseudomonas syringae pv. tomato strain DC3000. After gently mixing, place it in a pre-cooled 0.1 cm electroporation cuvette, and perform electroporation at 2.5 KV for 4 - 6 ms. Then add 700 μl of liquid KB medium (protease peptone NO.3 20 g / L, K 2 HPO 4 1.5 g / L, Glycerol 15 g / L, pH 7.0, after sterilization, add 3.2 ml of 1 M MgSO 4 ), and incubate at 28 °C and 200 rpm for 2 - 3 h.

[0208] 2. After completing step 1, add tetracycline to make its concentration in the system 200 ng / L, shake culture at 28 °C and 200 rpm for 1 h, then centrifuge to collect the cell precipitate, and spread it on a solid KB medium plate containing 50 ng / μl kanamycin (protease peptone NO.3 20 g / L, K 2 HPO 4 1.5 g / L, Glycerol 15 g / L, Agar 15 g / L, pH 7.0. After sterilization, add 3.2 ml of 1M MgSO 4 ), and let it stand at room temperature for 2 - 3 days.

[0209] 3. After completing step 2, randomly pick 22 monoclonal colonies. Expand the monoclonal colonies and then extract genomic DNA respectively. Using the genomic DNA as a template, perform PCR amplification with the primer pair composed of HopAB2-F1 and HopAB2-R1, and then perform agarose gel electrophoresis. For the electrophoresis showing amplified products, recover the amplified products and sequence them. For the electrophoresis not showing amplified products, perform whole-genome sequencing.

[0210] HopAB2-F1: ATGCGATTCAACGCTACATT;

[0211] HopAB2-R1: ATCGGAGAGGATCAGCATAT.

[0212] The sequencing results showed that 18 monoclonal colonies were wild-type, and the remaining 4 monoclonal colonies had mutations (the mutation forms were all deletions, and the mutation efficiency was 18.18%. Among the 4 monoclonal colonies with mutations, the deletion sizes ranged from 438 bp to 714 bp. One monoclonal colony had a 438-bp deletion (the deleted region corresponded to positions 342 to 779 of sequence 7), one monoclonal colony had a 506-bp deletion (the deleted region corresponded to positions 174 to 679 of sequence 7), one monoclonal colony had a 649-bp deletion (the deleted region corresponded to positions 94 to 742 of sequence 7), and one monoclonal colony had a 714-bp deletion (the deleted region corresponded to positions 83 to 796 of sequence 7). The sequencing results are shown in Figure 4 . The results showed that the FnCas12-ligD / Ku-mediated genome editing system could be applied to Pseudomonas.

[0213] Example 6. Construction of Pseudomonas HopD / R targeting vector and detection of editing efficiency

[0214] 1. Take the targeting vector pBBR1MCS-2-pHZB4-fgHopD / R and place it into 100 μl of melted competent cells of Pseudomonas syringae pv. tomato strain DC3000. Gently mix and then place it into a pre-cooled 0.1 cm electroporation cuvette. Electroporate at 2.5 KV for 4 - 6 ms, and then add 700 μl of liquid KB medium. Incubate with shaking at 28 °C and 200 rpm for 2 - 3 h.

[0215] 2. After completing step 1, add tetracycline to make its concentration in the system 200 ng / L. Incubate with shaking at 28 °C and 200 rpm for 1 h, then centrifuge to collect the cell pellet and spread it on a solid KB medium plate containing 50 ng / μl kanamycin. Incubate at room temperature for 2 - 3 days.

[0216] 3. After completing step 2, randomly pick 22 monoclonal colonies. Amplify the monoclonal colonies and then extract genomic DNA separately. Using the genomic DNA as a template, perform PCR amplification with three primer pairs respectively, and then perform agarose gel electrophoresis. For those where electrophoresis shows amplified products, recover the amplified products and sequence them. For those where electrophoresis does not show amplified products, perform whole-genome sequencing. The three primer pairs: HopD-F1 and HopD-R1 are used to amplify the HopD gene, HopR-F1 and HopR-R1 are used to amplify the HopR gene, and HopQ-F1 and HopQ-R1 are used to amplify the HopQ gene. The HopQ gene is located between the HopD gene and the HopR gene.

[0217] HopD-F1: CACATTAGTTGCGAGCGAGC;

[0218] HopD-R1: CCTGAACCGTCAGCTCGTTAT.

[0219] HopQ-F1: GATGTGCACAAAGCCCTCAG;

[0220] HopQ-R1: CCAGCATTTTGTCACGCAGT.

[0221] HopR-F1: GGTTAAAGTCCAGCGCATGAATAC;

[0222] HopR-R1: CGGTAGCCTCCATCGCCTG.

[0223] Sequencing results showed that 2 monoclonal clones were wild-type, and the remaining 20 monoclonal clones had mutations (all mutations were deletions, and the mutation efficiency was 90.91%). Amplification products were obtained for the 2 wild-type monoclonal clones using three primer pairs, and the sequencing results of the amplification products were all wild-type. No amplification products were obtained for the 20 monoclonal clones using three primer pairs, and whole-genome sequencing results showed that they all had large fragment deletions. Exemplary sequencing results of 3 monoclonal clones with large fragment deletions are shown in Figure 5 , and the deletion size was 72 kb for all.

[0224] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements of the present invention, including those that depart from the scope disclosed in this application but are made using conventional techniques known in the art. Some basic features can be applied according to the scope of the appended claims below.

Claims

1. A DNA molecule, named DNA molecule I, which has element A, element B, and element C; Element A is an expression cassette for expressing the ligD gene and the Ku gene, in which the promoter is the J23119 promoter; Element B is an expression cassette for expressing the Cas12a gene; Element C has an insertion site and a DNA segment for encoding the crRNA backbone; the insertion site is for inserting a DNA segment for encoding the specific binding region of crRNA; The specific binding region of crRNA specifically binds to the target sequence; After the DNA segment for encoding the specific binding region of crRNA is inserted into the insertion site in element C, it is ligated to the DNA segment for encoding the crRNA backbone, thereby expressing crRNA targeting the target sequence; The ligD gene expresses the ligD protein, and the amino acid sequence of the ligD protein is as shown in SEQ ID No:11 in the sequence listing; The Ku gene expresses the Ku protein, and the amino acid sequence of the Ku protein is as shown in sequence 12 in the sequence listing; The Cas12a gene expresses the Cas12a protein, and the amino acid sequence of the Cas12a protein is as shown in sequence 13 in the sequence listing.

2. A vector, named vector I, which has the DNA molecule I as claimed in claim 1.

3. A DNA molecule, named DNA molecule II, which has element A, element B, and element D; Element A is an expression cassette for expressing the ligD gene and the Ku gene, in which the promoter is the J23119 promoter; Element B is an expression cassette for expressing the Cas12a gene; Element D is an expression cassette for expressing crRNA; The ligD gene expresses the ligD protein, and the amino acid sequence of the ligD protein is as shown in SEQ ID No:11 in the sequence listing; The Ku gene expresses the Ku protein, and the amino acid sequence of the Ku protein is as shown in sequence 12 in the sequence listing; The Cas12a gene expresses the Cas12a protein, and the amino acid sequence of the Cas12a protein is as shown in sequence 13 in the sequence listing.

4. A vector, named vector II, which has the DNA molecule II as claimed in claim 3.

5. Use of the vector as claimed in claim 2 or 4 in gene editing of bacteria, wherein the bacteria are Xanthomonas oryzae pv. oryzae or Pseudomonas.

6. Use of the vector as claimed in claim 2 or 4 in functional genomics research of bacteria, wherein the bacteria are Xanthomonas oryzae pv. oryzae or Pseudomonas.

7. A kit, comprising the DNA molecule as claimed in claim 1 or 3 or the vector as claimed in claim 2 or 4; The function of the kit is as follows (a) or (b): (a) Gene editing of bacteria; (b) Functional genomics research of bacteria.

8. A method for gene editing of a target gene in bacteria, comprising the following steps: Prepare a recombinant plasmid with a specific DNA molecule; the specific DNA molecule is a DNA molecule obtained by inserting a DNA segment encoding the specific binding region of crRNA into the insertion site of the DNA molecule I described in claim 1; the DNA segment encoding the specific binding region of crRNA specifically binds to a target sequence; the target sequence is selected according to the target gene; Introduce the recombinant plasmid into bacteria, then culture to obtain recombinant bacteria, and screen for bacteria in which gene editing of the target gene has occurred from the recombinant bacteria; The bacteria are Xanthomonas oryzae or Pseudomonas.

9. A method for functional genomic research on bacteria, comprising the following steps: Prepare a recombinant plasmid with a specific DNA molecule; the specific DNA molecule is a DNA molecule obtained by inserting a DNA segment encoding the specific binding region of crRNA into the insertion site of the DNA molecule I described in claim 1; the DNA segment encoding the specific binding region of crRNA specifically binds to a target sequence; the target sequence is selected according to the target gene; Introduce the recombinant plasmid into the starting bacteria, then culture to obtain recombinant bacteria, and screen for bacteria in which gene editing of the target gene has occurred from the recombinant bacteria, which are the target bacteria; Determine the function of the target gene by comparing the trait differences between the starting bacteria and the target bacteria; The bacteria are Xanthomonas oryzae or Pseudomonas.

Images