A high-strength promoter applicable to multiple typical model microorganisms

By random mutations and high-throughput screening of the P43 promoter, the high-intensity promoter sequences PM1 ~ PM7 were obtained, which solved the problem of limited number of promoters in the prior art, and achieved efficient gene expression in a variety of microorganisms, especially the high expression level of GFP was significantly improved.

CN115786335BActive Publication Date: 2025-07-25JIANGNAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210955743.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-10
Publication Date
2025-07-25
Estimated Expiration
2042-08-10

AI Technical Summary

Technical Problem

In the prior art, the number of high-expression intensity promoters suitable for a variety of microorganisms is limited, and it is difficult to meet the gene expression needs of a variety of microorganisms.

Method used

By random mutation and high-throughput screening of the P43 promoter, 7 high-intensity promoter sequences (PM1 ~ PM7) were obtained and constructed into a recombinant expression plasmid for use in host cells such as E. coli, Bacillus subtilis and Bacillus thuringiensis to achieve efficient expression of the protein of interest.

Benefits of technology

Among a variety of typical model microorganisms, the expression level of high-intensity promoter mutants is significantly improved, and the GFP expression level is up to 36.4 times, demonstrating its effectiveness and versatility in a variety of microorganisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115786335B_ABST
    Figure CN115786335B_ABST
Patent Text Reader

Abstract

The present invention discloses a high-strength promoter applicable to multiple typical model microorganisms. Based on the P43 promoter, the present invention obtained 7 high-strength promoter sequences (PM1 to PM7) through random mutation and high-throughput screening, and their free expression was carried out using plasmids in multiple typical model microorganisms, demonstrating their effectiveness and generality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a high-strength promoter applicable to a variety of typical model microorganisms, belonging to the technical field of promoter engineering. Background Art

[0002] A promoter is a DNA sequence initially recognized, bound, and where transcription begins by RNA polymerase. It is a key element in gene transcriptional regulation, containing conserved sequences required for the transcription start site and the binding site of RNA polymerase. Most are located upstream of the transcribed gene and are not transcribed.

[0003] With the rapid development of biological research, promoters will be more applied to important aspects such as metabolic engineering transformation. The enrichment and development of promoter engineering also enable people to more conveniently obtain promoters suitable for research needs. Generally speaking, however, the number of promoters with high expression intensity and applicable to a variety of microorganisms is still very limited. Therefore, it is particularly important to develop new promoters with high efficiency and universality. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides an efficient gene expression element, namely a high-strength promoter applicable to a variety of typical model microorganisms.

[0005] The first object of the present invention is to provide a high-strength promoter applicable to a variety of typical model microorganisms, and its nucleotide sequence is as shown in SEQ ID NO.1 - 7.

[0006] Furthermore, the high-strength promoter is used for Escherichia coli, Bacillus subtilis or Bacillus thuringiensis.

[0007] Furthermore, the Escherichia coli is Escherichia coli MG1655, Escherichia coli BL21 or Escherichia coli Nissle 1917.

[0008] Furthermore, the Bacillus subtilis is Bacillus subtilis 168.

[0009] Furthermore, the Bacillus thuringiensis is Bacillus thuringiensis HD - 1.

[0010] Furthermore, when the high-strength promoter is used for Escherichia coli, the expression vector is pPUC.

[0011] Furthermore, when the high-strength promoter is used for Bacillus subtilis, the expression vector is pP43NMK.

[0012] Furthermore, when the high-strength promoter is used in Bacillus thuringiensis, pP43NMK is used as the expression vector.

[0013] The second object of the present invention is to provide a method for highly expressing a target protein, which is to use the high-strength promoter to initiate the expression of the target protein.

[0014] Further, the method specifically is to add the sequence of the high-strength promoter to the front end of the nucleotide sequence of the target protein, construct it into a recombinant expression plasmid, and then transform it into a host cell for expression.

[0015] The beneficial effects of the present invention are as follows:

[0016] In the present invention, the protein expression level is characterized by fluorescence intensity. Through high-throughput screening by a flow cytometer, 7 mutated strong promoters (PM1 - PM7) are obtained. When the fermentation time is about 10 h, the GFP expression level can be increased by up to 36.4 times at most. GFP is expressed using PM1 - PM7 on the pP3NMK plasmid and is respectively characterized in Bacillus thuringiensis HD-1, Bacillus subtilis 168. The results show that in Bacillus thuringiensis HD-1, the GFP expression level controlled by PM5 is 8.6 times higher than that controlled by the original P43 promoter and RBS; in Bacillus subtilis, the GFP expression level controlled by PM4 is 3.2 times higher than that controlled by the strong promoter P566 with the same RBS. GFP is expressed using PM1 - PM7 on the pPUC plasmid, and the strength of the mutant promoter expressed is further detected in Escherichia coli. The results show that the mutant PM4 has the highest GFP expression level in Escherichia coli MG1655, Escherichia coli BL21, and Escherichia coli Nissle1917, which are increased by 0.3, 0.3, and 0.7 times respectively compared with the GFP expression level controlled by the strong promoter Ptac with the same RBS. These results prove the effectiveness and universality of the above-mentioned high-strength promoter mutants obtained by random mutation and high-throughput screening in a variety of typical model microorganisms. Description of the Drawings

[0017] Figure 1 For Bacillus thuringiensis the expression intensities of the high-strength promoter mutants PM1 - PM7 obtained by random mutation and high-throughput screening on the HD-1 linear plasmid;

[0018] Figure 2 For the expression intensities of PM1 - PM7 in Bacillus thuringiensis HD-1 P43NMK- gfp the plasmid;

[0019] Figure 3The expression intensity of PM1 to PM7 in Bacillus subtilis 168 P43NMK- gfp the plasmid;

[0020] Figure 4 The expression intensity of PM1 to PM7 in Escherichia coli MG1655, Escherichia coli BL21 and Escherichia coli the expression intensity on the pUC- gfp plasmid in Nissle 1917. Specific implementation manners

[0021] The present invention will be further described below in conjunction with specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited are not intended to limit the present invention.

[0022] Seed culture and fermentation of recombinant strains:

[0023] Culture medium (g / L): Tryptone 10, Yeast extract 5, NaCl 10.

[0024] Culture conditions: The seeds cultured at 37 °C and 200 rpm for 10 h were transferred into the fermentation medium at an inoculation amount of 10%, and cultured at 37 °C and 200 rpm for 20 h.

[0025] Method for measuring the expression level of green fluorescent protein: Add 200 μL of the diluted fermentation broth to each well of a 96-well plate, and use a Cytation3 cell imaging microplate reader (BioTek Instruments, Inc., USA), excitation wavelength: 488 nm, emission wavelength: 523 nm, gain: 60.

[0026] Example 1: Obtaining of high-strength promoters PM1 to PM7

[0027] The high-strength promoter mutants PM1 to PM7 were obtained by random mutation on the basis of the P43 promoter and high-throughput screening with a flow cytometer.

[0028] Among the obtained mutants, there were single-point mutations (such as the G70T mutation in the -35 region of the promoter of mutant PM4), double-point mutations (there was one mutation in each of the promoter sequence and the RBS sequence of mutant PM5), and insertions of short tandem repeats (STRs) (there were 1, 2, and 3 insertions of the 'ATTTTACATTT' repeat sequence in the promoter sequences of PM1, PM2, and PM3, respectively). The specific sequences of the mutant promoters are shown in Table 1.

[0029] Table 1 Sequences of mutant high-strength promoters PM1 to PM7

[0030]

[0031] Example 2: Construction of recombinant plasmid P43NMK- gfp Construction

[0032] The composition of the recombinant plasmid is to replace the P43 promoter sequence of the P43NMK plasmid with the mutant high-strength promoter PM1 - PM7 sequences, and then insert the green fluorescent protein (GFP) gene. To replace the P43 promoter sequence with the high-strength promoter PM1 - PM7 sequences, primers rh_PM_F: 5’-actggatcctgataggtggtatgttttcgcttg-3’ and rh_PM_R: 5’-gtgtacattcctctcttacCTATAATGGTACCGCGTGTACATTCCTCTCTTACCTATAATGGTACCG-3’ were designed. Using Bacillus subtilis containing the green fluorescent protein (GFP, GenBank: AF324408.1) gene as a template, primers fx_ GFP_F: 5’-GCGGTACCATTATAGgtaagagaggaatgtacacatgaaaaaaatcaaaaacaaccaacaaaaaaatgaactg-3’ and fx_ GFP_R: 5’-ccatgattacgccaagctttcatcaTTATTTGTATAGTTCATCCATGCCATGTGTAATCC-3’ were designed. Through colony PCR, the green fluorescent protein fragment was obtained. Using plasmid pP43NMK as a template, primers fx_p43NMK_F: 5’-TAAtgatgaaagcttggcgtaatcatggtc-3’ and fx_p43NMK_R: 5’-caagcgaaaacataccacctatcaggatccagt-3’ were used to reverse amplify the plasmid fragment by PCR; finally, the recombinant plasmid was constructed using the Gibson Assembly Clonging Kit (New England Biolabs), and verified by sequencing to confirm that the recombinant pP43NMK- gfp The plasmid construction was successful.

[0033] Example 3: Construction of recombinant plasmid pUC- gfp Construction

[0034] For the pUC-gfp plasmid, first use the primers rh-pP43NMK-F: ctggatcctgataggtggtatgttttcgc and rh-pP43NMK-R: GGGACAACTCCAGTGAAAAGTTCTTCTCC to amplify the strong promoter, then use fx-pP43NMK-F: gcgaaaacataccacctatcaggatccag and fx-pP43NMK-R: GGAGAAGAACTTTTCACTGGAGTTGTCCC to amplify the pUC vector with the GFP gene, and finally construct the plasmid by Gibson assembly. The composition of the recombinant plasmid is to replace the Ptac promoter sequence of the pUC plasmid with the mutant high-intensity promoter PM1 - PM7 sequences, and then insert the green fluorescent protein (GFP) gene.

[0035] Example 4: Construction of recombinant P43NMK- gfp Plasmid Bacillus thuringiensis

[0036] Take 3 - 5 μL of the constructed P43NMK- gfp plasmid and add it to 50 μL of Bacillus thuringiensis HD-1 electrocompetent cells, gently mix by shaking, take out after ice bath for 10 - 30 min, add all to a pre-cooled 1 mm electroporation cuvette, quickly add 1 mL of LB medium preheated at 37 °C after electroporation at 1.25 kV; recover and culture at 37 °C, 220 r / min for 3 h, then spread on a resistant plate and culture overnight in a 37 °C incubator. Select transformants for colony PCR and sequence verification to confirm the successful construction of recombinant Bacillus thuringiensis.

[0037] Transfer the seeds cultured at 37 °C, 200 rpm for 10 h to the fermentation medium at an inoculum size of 10%, and culture at 37 °C, 200 rpm for 20 h, then measure the fluorescence intensity.

[0038] Example 5: Construction of recombinant P43NMK- gfp Plasmid Bacillus subtilis

[0039] Take 3 - 5 μL of the constructed P43NMK- gfp plasmid and add it to 50 μL of Bacillus subtilis 168 electrocompetent cells, gently mix by shaking, take out after ice bath for 10 - 30 min, add all to a pre-cooled 1 mm electroporation cuvette, quickly add 1 mL of LB medium preheated at 37 °C after electroporation at 1.25 kV; recover and culture at 37 °C, 220 r / min for 3 h, then spread on a resistant plate and culture overnight in a 37 °C incubator. Select transformants for colony PCR to verify the successful construction of recombinant Bacillus subtilis.

[0040] The seeds cultured at 37 °C and 200 rpm for 10 h were transferred into the fermentation medium at an inoculum size of 10%, and cultured at 37 °C and 200 rpm for 20 h, and the fluorescence intensity was measured.

[0041] Example 6: Construction of recombinant pUC- gfp Plasmid Escherichia coli

[0042] The constructed pUC- gfp Plasmids were separately transformed into Escherichia coli MG1655, Escherichia coli BL21, and Escherichia coli Nissle1917. Transformants were selected for colony PCR to verify the successful construction of recombinant Escherichia coli.

[0043] The seeds cultured at 37 °C and 200 rpm for 10 h were transferred into the fermentation medium at an inoculum size of 10%, and cultured at 37 °C and 200 rpm for 20 h, and the fluorescence intensity was measured.

[0044] Comparative Example 1: Construction of a control group of Bacillus thuringiensis expressing GFP under the control of the P43 promoter

[0045] The recombinant control plasmid was composed of directly using the P43 promoter to express the green fluorescent protein (GFP) gene in the Pp43NMK plasmid. After sequencing verification and confirmation of the successful construction of the recombinant pP43NMK- gfp Plasmid, it was transformed Bacillus thuringiensis HD-1. Colony PCR verified the successful transformation of the plasmid.

[0046] The seeds cultured at 37 °C and 200 rpm for 10 h were transferred into the fermentation medium at an inoculum size of 10%, and cultured at 37 °C and 200 rpm for 20 h, and the fluorescence intensity was measured.

[0047] Comparative Example 2: Construction of a control group of Bacillus subtilis expressing GFP under the control of the P43 promoter

[0048] The recombinant control plasmid was composed of directly using the P43 promoter to express the green fluorescent protein (GFP) gene in the Pp43NMK plasmid. After sequencing verification and confirmation of the successful construction of the recombinant pP43NMK- gfp Plasmid, it was transformed Bacillus subtilis 168. Colony PCR verified the successful transformation of the plasmid.

[0049] The seeds cultured at 37 °C and 200 rpm for 10 h were transferred into the fermentation medium at an inoculum size of 10%, and cultured at 37 °C and 200 rpm for 20 h, and the fluorescence intensity was measured.

[0050] Comparative Example 3: Construction of an Escherichia coli control group with GFP expression controlled by the Ptac promoter

[0051] The recombinant control plasmid was composed of directly using the Ptac promoter in the pUC plasmid to express the green fluorescent protein (GFP) gene. Sequencing verification confirmed that the recombinant pUC- gfp After successful plasmid construction, it was transformed into Escherichia coli MG1655, Escherichia coli BL21, and Escherichia coli Nissle1917, respectively. Colony PCR verified successful plasmid transformation.

[0052] The seeds cultured at 37 °C and 200 rpm for 10 h were transferred into the fermentation medium at an inoculation amount of 10%, and cultured at 37 °C and 200 rpm for 20 h, and the fluorescence intensity was measured.

[0053] Example 7 Homologous recombination modification of linear plasmid

[0054] First, an auxiliary plasmid pBMB-ESC (SEQ ID NO.8) was constructed to achieve efficient recombination of Bacillus thuringiensis HD-1. Specifically, on this plasmid, Exo (double-stranded DNA 5'-3' exonuclease), EcoSSB (single-stranded DNA-binding protein from Escherichia coli), and CspRecT (DNA annealing protein) were induced to express using xylose to enable the formation of single-stranded DNA of DNA fragments in the cell and efficient annealing. The construction of the linear plasmid integration cassette was carried out by fusion PCR. First, a recombination cassette with a homologous arm length of 500-1000 bp was designed. Taking the linear plasmid (SEQ ID NO.9) containing the PM1 promoter as an example. The specific operation was as follows: The left arm was amplified using primers HD-Re-1F: acggacagttgtgcaacaactacg and HD-Rgfp-1R: aggatccagttgctccgtcacacgtgtgtcattttggac; the GFP expression cassette under the control of a high-strength promoter was amplified using primers HD-Rgfp-2F: acgtgtgacggagcaactggatcctgataggtggtatg and HD-Rgfp-2R: gaaattgttatccgctcccaagctttcatcaCTATTTGTATAGTTCATCC; the antibiotic resistance gene was amplified using primers HD-Rgfp-3F: Gtgatgaaagcttgggagcggataacaatttcacacaggaaacagc and HD-Rgfp-3R: gcgtgataacgccagggttttcccagtcacg; the right arm was amplified using primers HD-Re-4F: tgggaaaaccctggcgttatcacgctgggcataactactttgtg and HD-Re-4R: caattacggcttgtgcttcctctcg. The corresponding linear plasmid / genome integration operation was as follows:

[0055] First, the competent state of the strain containing the pBMB-ESC plasmid was prepared. When the OD600 of the bacterial solution was about 0.5, xylose with a final concentration of 3% was added, and the culture was continued until OD600 was approximately equal to 1.0-1.3. The remaining operations were the same as those for electrotransforming the plasmid. During electrotransformation, the DNA fragment needed to be relatively single. 5 μL of DNA fragment with a concentration of more than 200 ng / μL was added, and then cultured for 3 h. The remaining operations were the same as those for electrotransforming the plasmid. Finally, the DNA integration cassette achieved recombinant editing of the prophage GIL16 genome, and a recombinant Bacillus thuringiensis containing a linear plasmid expressing GFP was constructed. Under the same conditions, the high-strength promoter mutant Bacillus thuringiensis increased the GFP expression level on the HD-1 linear plasmid to a maximum of 36.4 times the expression intensity controlled by the original P43 ( Figure 1 ).

[0056] Example 8: Effects of High-Strength Promoters PM1 - PM7 on the Expression of Green Fluorescent Protein in Engineered Bacteria

[0057] In Bacillus thuringiensis the P43NMK-gfp plasmid of HD-1, the GFP expression level under the control of PM5 was 8.6 times higher than that under the control of the original P43 promoter and RBS ( Figure 2 ); in the P43NMK- gfp plasmid of Bacillus subtilis, the GFP expression level under the control of PM4 was 3.2 times higher than that under the control of the strong promoter P566 with the same RBS ( Figure 3 ). The mutant PM4 located on the pUC- gfp plasmid had the highest GFP expression level in Escherichia coli MG1655, Escherichia coli BL21, and Escherichia coli Nissle 1917, which were 0.3, 0.3, and 0.7 times higher than the GFP expression level under the control of the strong promoter Ptac with the same RBS ( Figure 4 ), respectively, demonstrating the effectiveness and universality of the high-strength promoter mutants PM1 - PM7 in a variety of typical model microorganisms.

[0058] The above-described embodiments are merely preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A high-strength promoter, characterized in that, Their nucleotide sequences are shown in SEQ ID NO.1 to 7 respectively.

2. The high-strength promoter according to claim 1, wherein The high-strength promoter is used for Bacillus subtilis or Bacillus thuringiensis.

3. The high-strength promoter according to claim 2, wherein The Bacillus subtilis is Bacillus subtilis 168.

4. The high-strength promoter according to claim 2, characterized in that, The Bacillus thuringiensis is Bacillus thuringiensis HD-1.

5. The high-strength promoter according to claim 2, wherein When the high-strength promoter is used for Bacillus subtilis, pP43NMK is used as the expression vector.

6. The high-strength promoter according to claim 2, characterized in that, When the high-strength promoter is used for Bacillus thuringiensis, pP43NMK is used as the expression vector.

7. A method for efficiently expressing a target protein, characterized in that, It is to use the high-strength promoter described in claim 1 to initiate the expression of the target protein in the host cell, and the host cell is Bacillus subtilis or Bacillus thuringiensis.

8. The method according to claim 7, wherein The specific method is to add the sequence of the high-strength promoter to the front end of the nucleotide sequence of the target protein, construct it into a recombinant expression plasmid, and then transform it into the host cell for expression.

Citation Information

Patent Citations

  • Efficient expression system based on heterologous quorum sensing

    CN112553236A