Detection probe combination for pathogenic bacteria in food and detection method and application thereof

By designing 15 pairs of probe primer combinations suitable for the food field and combining them with MLPA technology, efficient and accurate detection of 14 pathogenic bacteria in food was achieved, solving the problems of cumbersome detection steps and low sensitivity in existing technologies, and realizing rapid and easy detection of multiple pathogens.

CN115786553BActive Publication Date: 2025-10-17HUBEI PROVINCIAL INST FOR FOOD SUPERVISION & TEST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211540354.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-02
Publication Date
2025-10-17
Estimated Expiration
2042-12-02

AI Technical Summary

Technical Problem

Existing technologies for detecting foodborne pathogens in food have problems such as complicated procedures, long detection cycles, low efficiency, and poor sensitivity. There is also a lack of primer design and detection effect verification for multiplex ligation probe amplification technology applicable to the food field.

Method used

A detection probe combination containing 15 pairs of probe primers was designed for the one-time detection of 14 pathogenic bacteria in food. Through the multiplex ligation-dependent probe amplification (MLPA) technology, including DNA extraction, hybridization and ligation reaction, PCR amplification and capillary electrophoresis separation, efficient and accurate detection was achieved using a highly specific probe combination.

Benefits of technology

It realizes the rapid and easy detection of multiple pathogenic bacteria in food. The detection results are accurate, highly sensitive, and have little effect on the food matrix components. It is suitable for complex food samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115786553B_ABST
    Figure CN115786553B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of food detection, and particularly discloses a detection probe combination for pathogenic bacteria in food, a detection method and application thereof. The application designs the probe combination for detecting various foodborne pathogenic bacteria. The probe combination adopts a multiple connection-dependent probe amplification technology, can accurately detect 14 kinds of pathogenic bacteria in food through one reaction, and has different results, does not interfere with each other, the detection method is simple, time-saving and labor-saving, has the characteristics of low requirement for template DNA quality, low detection limit and high sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of food detection, and particularly relates to a detection probe combination for pathogenic bacteria in food, a detection method and application thereof. BACKGROUND

[0002] At present, common foodborne pathogenic bacteria mainly include Staphylococcus aureus, Salmonella, Shigella, Vibrio parahaemolyticus, Campylobacter jejuni, Listeria monocytogenes, Bacillus cereus and Enterobacter sakazakii. The symptoms of normal people after infection are mainly vomiting, diarrhea and abdominal pain, and the symptoms of people with low immunity and resistance such as the elderly, pregnant women and infants after infection are serious consequences such as convulsions, shock, septicemia and even death. The outbreak of foodborne diseases often shows groupness, and the number of people affected is usually several people, dozens of people or even hundreds of people. Therefore, in order to ensure food safety and minimize the occurrence of foodborne diseases, it is necessary to block the outbreak of foodborne diseases from the source, and to efficiently, accurately and sensitively detect pathogenic bacteria in food, which is a key link to achieve this goal.

[0003] The traditional detection method of foodborne pathogenic bacteria mainly includes steps such as enrichment culture, isolation and biochemical identification, which is the gold standard for testing. However, the traditional culture method and other detection technologies such as immunological detection and biosensor technology have problems such as complicated steps, long detection period, single target, low efficiency and poor sensitivity to different degrees. Therefore, it is necessary to develop a simple, sensitive and rapid detection method to detect pathogenic bacteria in complex food samples.

[0004] In recent years, nucleic acid-based molecular biology detection methods have developed rapidly, and nucleic acid technology has the characteristics of strong specificity, high throughput and comprehensive analysis angle, and has been widely used in many fields such as food detection, disease prevention and clinical diagnosis. Among them, multiplex ligation dependent probe amplification (MLPA) is a high-throughput multiple nucleic acid detection technology combining nucleic acid hybridization and PCR amplification. This technology can detect and analyze up to 40 different target genes in the same reaction tube. This method has high sensitivity and only needs 20 ng of DNA or 3,000 cells for detection. MLPA has low requirements for DNA integrity, and short fragments can be detected; and the requirements for DNA concentration and purity are low, and the influence of complex food matrix and pathogen content is small. Therefore, MLPA has great advantages in detecting pathogenic bacteria in the food field.

[0005] The existing patent (patent number CN 105018601 A) has studied the MLPA primer for detecting various pathogenic bacteria, but does not involve detecting common foodborne pathogenic bacteria in food, and the technical personnel in the art cannot predict the design of one or more pathogenic bacteria detection primer probes and the detection interference and detection effect between the probes, and the patent is applied in the field of clinical diseases, and cannot prove that it also has good application effect in the field of food. SUMMARY

[0006] The purpose of the present application is to provide a detection probe set for pathogenic bacteria in food, a detection method and application thereof, which can detect 14 kinds of pathogenic bacteria in food at one time through the provided probe combination, and can rapidly detect the presence or absence of various pathogenic bacteria in food at one time. A total of 15 pairs of probe primers are designed, and the stability and sensitivity of the primer probe combination in the field of food detection are verified.

[0007] In order to achieve the above purpose, the present application provides a detection probe set for pathogenic bacteria in food, which comprises first to fifteenth groups of probes, which are probes for detecting Salmonella, Campylobacter jejuni, Pseudomonas aeruginosa, Listeria monocytogenes, Diarrhea Escherichia coli (DEC) invE gene, Enterobacter sakazakii, Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Vibrio vulnificus, Escherichia coli O157:H7, Bacillus cereus, Vibrio alginolyticus, Clostridium perfringens and Diarrhea Escherichia coli (DEC) uidA gene in order, each group of probes containing a left probe LPO and a right probe RPO:

[0008] The left probe LPO of the first group of probes contains the sequence shown in SEQ ID NO. 1, and the right probe RPO contains the sequence shown in SEQ ID NO. 2;

[0009] The left probe LPO of the second group of probes contains the sequence shown in SEQ ID NO. 3, and the right probe RPO contains the sequence shown in SEQ ID NO. 4;

[0010] The left probe LPO of the third group of probes contains the sequence shown in SEQ ID NO. 5, and the right probe RPO contains the sequence shown in SEQ ID NO. 6;

[0011] The left probe LPO of the fourth group of probes contains the sequence shown in SEQ ID NO. 7, and the right probe RPO contains the sequence shown in SEQ ID NO. 8;

[0012] The left probe LPO of the fifth group of probes contains the sequence shown in SEQ ID NO. 9, and the right probe RPO contains the sequence shown in SEQ ID NO. 10;

[0013] The left probe LPO of the sixth group of probes contains the sequence shown in SEQ ID NO. 11, and the right probe RPO contains the sequence shown in SEQ ID NO. 12;

[0014] The left probe LPO of the seventh group of probes contains the sequence shown in SEQ ID NO. 13, and the right probe RPO contains the sequence shown in SEQ ID NO. 14;

[0015] The left probe LPO of the eighth group of probes contains the sequence shown in SEQ ID NO. 15, and the right probe RPO contains the sequence shown in SEQ ID NO. 16;

[0016] The left probe LPO of the ninth group of probes contains the sequence shown in SEQ ID NO. 17, and the right probe RPO contains the sequence shown in SEQ ID NO. 18;

[0017] The left probe LPO of the tenth group of probes contains the sequence shown in SEQ ID NO. 19, and the right probe RPO contains the sequence shown in SEQ ID NO. 20;

[0018] The left probe LPO of the eleventh group of probes contains the sequence shown in SEQ ID NO. 21, and the right probe RPO contains the sequence shown in SEQ ID NO. 22;

[0019] The left probe LPO of the twelfth group of probes contains the sequence shown in SEQ ID NO. 23, and the right probe RPO contains the sequence shown in SEQ ID NO. 24;

[0020] The left probe LPO of the thirteenth group of probes contains the sequence shown in SEQ ID NO. 25, and the right probe RPO contains the sequence shown in SEQ ID NO. 26;

[0021] The left probe LPO of the fourteenth group of probes contains the sequence shown in SEQ ID NO. 27, and the right probe RPO contains the sequence shown in SEQ ID NO. 28;

[0022] The left probe LPO of the fifteenth group of probes contains the sequence shown in SEQ ID NO. 29, and the right probe RPO contains the sequence shown in SEQ ID NO. 30.

[0023] Further, the 5' end of each left probe of the first group of probes to the fifteenth group of probes is connected with a forward primer binding sequence as shown in SEQ ID NO. 31, and the 3' end of each right probe of the first group of probes to the fifteenth group of probes is connected with a reverse primer binding sequence as shown in SEQ ID NO. 32.

[0024] Further, the application provides a detection method of pathogenic bacteria in food, comprising the following steps: (1) extracting DNA of a sample to be detected and denaturing; (2) hybridizing and linking the polynucleotide pair or the probe combination with the extracted DNA; (3) performing PCR amplification and capillary electrophoresis separation on the product after the linking reaction; and (4) analyzing the result of the capillary electrophoresis separation.

[0025] Further, the application provides a detection kit comprising the probe combination.

[0026] Further, the kit provided by the application can be applied to detecting pathogenic bacteria in food by multiplex ligation-dependent probe amplification technology.

[0027] The application has the following advantages:

[0028] 1. The probe combination designed by the application can detect 14 common pathogenic bacteria in food. The designed probe pairs can be combined at will, and up to 14 pathogenic bacteria can be detected simultaneously in one detection reaction. Compared with the traditional culture method, the detection method has the advantages of short detection period and simple operation steps, and has important significance in the field of food rapid detection.

[0029] 2. The probes in the probe combination provided by the application do not affect each other, and the detection result is accurate. The probe combination designed by the application has the advantages of strong specificity for foodborne pathogenic bacteria, low detection limit, high sensitivity, and less influence of food matrix components, and has important significance in the field of foodborne pathogenic bacteria detection. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 The detection results of the probe combination designed by the application on 14 single foodborne pathogenic bacteria are as follows: (1) Salmonella, (2) Campylobacter jejuni, (3) Pseudomonas aeruginosa, (4) Listeria monocytogenes, (5) Diarrhea Escherichia coli (DEC) invE gene, (6) Enterobacter sakazakii, (7) Staphylococcus aureus, (8) Shigella, (9) Vibrio parahaemolyticus, (10) Vibrio vulnificus, (11) Escherichia coli O157:H7, (12) Bacillus cereus, (13) Vibrio alginolyticus, (14) Clostridium perfringens, and (15) Diarrhea Escherichia coli (DEC) uidA gene.

[0031] Figure 2 The detection results of the probe combination designed by the application on 14 foodborne pathogenic bacteria mixtures are as follows:

[0032] Figure 3 The detection results of the probe combination designed by the application on the mixed samples 1-5 are as follows: DETAILED DESCRIPTION

[0033] Example 1

[0034] 1. Probe design

[0035] The present application designs a total of 15 groups of probe sequences for detecting 14 foodborne pathogenic bacteria, wherein enteroinvasive Escherichia coli EIEC belongs to one of the diarrheal Escherichia coli (DEC), and the primer probe pair of two genes invE and uidA needs to be detected and confirmed at the same time. Specifically, the present application takes the genus-specific genes of foodborne pathogenic bacteria in Table 1 as the target sequences for probe design, searches 10 or so target gene sequences of each common genus-specific gene of foodborne pathogenic bacteria from NCBI, performs sequence alignment by Sequencer / Geneious software, eliminates sequences with poor consistency, and exports the aligned sequences as target sequences for probe design. When designing sequences, the length of each specific gene probe is controlled to be 75-200 bp, the GC content is 30-70%, the Tm value is 68-80℃, and the total length difference of different species probes is at least 1 bp; the software verifies the parameters, and divides them into LHS\RHS two polynucleotides. The designed probe is added with universal primer sequences at both ends for amplifying the probe in PCR reaction. Each probe can only amplify the corresponding gene fragment and the corresponding pathogenic bacteria, has good specificity, and there is no cross reaction between different probes. Since a large number of pathogenic bacteria are involved, in order to ensure similar experimental conditions, stable detection results and good repeatability, compared with the MLPA probe for a single pathogenic bacteria, the difficulty of probe design and establishment of mixed probe system conditions in the present application is greater, and more pathogenic bacteria can be detected at one time.

[0036] Table 1 Probe target gene

[0037]

[0038] The present application finally obtains the following groups of probes, each group of probes comprising a left probe LPO and a right probe RPO (in order corresponding to SEQ ID NO: 1-30 in the sequence table):

[0039] (1) for Salmonella:

[0040] SEQ ID NO: 1: 5'-GGGTTCCCTAAGGGTTGGACTGGTCAGGCAGATAACACCAACA-3',

[0041] SEQ ID NO: 2: 5'-CTAATTTGCTGGCGGTCTCCTCTTCTAGATTGGATCTTGCTGGCAC-3';

[0042] (2) for Campylobacter jejuni:

[0043] SEQ ID NO: 3: 5'-GGGTTCCCTAAGGGTTGGACACACCTGAAGTATGAAGTGGTCTAA-3',

[0044] SEQ ID NO: 4: 5'-GTCTTGAAAAAGTGGCATTCTCCTGTCTAGATTGGATCTTGCTGGCAC-3';

[0045] (3) for Pseudomonas aeruginosa:

[0046] SEQ ID NO: 5: 5'-GGGTTCCCTAAGGGTTGGACCACGAGAAGCCTTCGAACATCAA-3',

[0047] SEQ ID NO: 6:

[0048] 5'-GGTGTTCATCCACGAACTGAACGCCGGTAATCTAGATTGGATCTTGCTGGCAC-3';

[0049] (4) for Listeria monocytogenes:

[0050] SEQ ID NO: 7: 5'-GGGTTCCCTAAGGGTTGGAGTGTGATTAACGGGAAGCTTGGCTCTATTTG-3', SEQ ID NO: 8: 5'-CGGTCAACTTTTAATCCTGACCTATGTGTCTAGATTGGATCTTGCTGGCAC-3';

[0051] SEQ ID NO: 9: 5'-GGGTTCCCTAAGGGTTGGAGTGGGATTCCAGTGGTATTCCCATTGTAAA-3', SEQ ID NO: 10:

[0052] 5'-ACATACCACGAAAGATGTGATCAGTGGAGTGTCTAGATTGGATCTTGCTGGCAC-3';

[0053] (6) for Enterobacter sakazai:

[0054] SEQ ID NO: 11:

[0055] 5'-GGGTTCCCTAAGGGTTGGAGTGTCTTCGTGCTGCGAGTTTGAGAGACTCTGA-3',

[0056] SEQ ID NO: 12:

[0057] 5'-CACACCGCGCATTCCTTATTACGGAGAAATGCTCTAGATTGGATCTTGCTGGCAC-3';

[0058] (7) against S. aureus:

[0059] SEQ ID NO: 13:

[0060] 5'-GGGTTCCCTAAGGGTTGGAGTGTCCTGCGACATTAATTAAAGCGATTGATG-3',

[0061] SEQ ID NO: 14:

[0062] 5'-GTGATACGGTTAAATTAATGTACAAAGGTCAAGTGTTCTAGATTGGATCTTGCTGGCAC-3';

[0063] (8) against Shigella:

[0064] SEQ ID NO: 15:

[0065] 5'-GGGTTCCCTAAGGGTTGGAGTGTGTGTGTCTCCACTGCCGTGAAGGAAATGCGTTT-3',

[0066] SEQ ID NO: 16:

[0067] 5'-CTATGGCGTGTCGGGAGTGACAGCAAATGTGTGTTCTAGATTGGATCTTGCTGGCAC-3';

[0068] (9) against V. parahaemolyticus:

[0069] SEQ ID NO: 17:

[0070] 5'-GGGTTCCCTAAGGGTTGGGCAGGTGCGAAGAACTTCATGTTGATGACACTGCCAACG-3',

[0071] SEQ ID NO: 18:

[0072] 5'-CGACGAAAGCGCCTCAGTTTAAGTACTCAACACAAGTCTAGATTGGATCTTGCTGGCAC-3';

[0073] (10) Against Vibrio vulnificus:

[0074] SEQ ID NO: 19:

[0075] 5'-GGGTTCCCTAAGGGTTGGGAGTGTGTACTCCTGACCGCCAAAATTGTCCGTTTCACCGTCGA-3', SEQ ID NO: 20:

[0076] 5'-TGCCGACAAGCCTGGCACGGGTATTCATTTGGTTGTTCTAGATTGGATTCTTGCTGGCAC-3';

[0077] (11) Against Escherichia coli O157:H7:

[0078] SEQ ID NO: 21:

[0079] 5'-GGGGTTCCCTAAGGGTTGGGTGTGTGTGTGCAGATAAACTCATCGAAACAAGGCCAGTT-3',

[0080] SEQ ID NO: 22:

[0081] 5'-TTTTACCCTGTCCACACGATGCCAATGTACTCGGTGTGTTCTAGATTGGATTCTTGCTGGCAC-3';

[0082] (12) Against Bacillus cereus:

[0083] SEQ ID NO: 23:

[0084] 5'-GGGTTCCCTAAGGGTTGGAGTGTGTGTCCTTCACGAATCATAGCTTGTGCTAATACAGTTGC-3',

[0085] SEQ ID NO: 24:

[0086] 5'-AGTTGTTGTCCGTCACCAGCTACGTCATTTGGTGTGTGTCTAGATTGGATCTTGCTGGCAC-3';

[0087] (13) Targeting Vibrio alginolyticus:

[0088] SEQ ID NO: 25:

[0089] 5'-GGGTTCCCTAAGGGTTGGACAGTTGAAGTGGCGATGCAATGGAACGATGGTTTCCA-3',

[0090] SEQ ID NO: 26:

[0091] 5'-GGGTTCCCTAAGGGTTGGACAGTTGAAGTGGCGATGCAATGGAACGATGGTTTCCA-3',

[0092] (14) For Clostridium perfringens:

[0093] SEQ ID NO: 27:

[0094] 5'-GGGTTCCCTAAGGGTTGGACAGTTGAAGTGGCGATGCAATGGAACGATGGTTTCCA-3',

[0095] SEQ ID NO: 28:

[0096] 5'-GGGTTCCCTAAGGGTTGGACAGTTGAAGTGGCGATGCAATGGAACGATGGTTTCCA-3',

[0097] (15) For Escherichia coli uidA gene:

[0098] SEQ ID NO: 29:

[0099] 5'-GGGTTCCCTAAGGGTTGGACAGTTGAAGTGGCGATGCAATGGAACGATGGTTTCCA-3',

[0100] SEQ ID NO: 30:

[0101] 5'-GGGTTCCCTAAGGGTTGGACAGTTGAAGTGGCGATGCAATGGAACGATGGTTTCCA-3',

[0102] The target sequence specific binding sequence and the primer binding sequence of each group of probes in the present application can be composed of the above-mentioned sequences, the left probe includes the forward primer binding sequence GGGTTCCCTAAGGGTTGGA at the 5' end and the target sequence specific binding sequence at the 3' end, and the right probe includes the target sequence specific binding sequence at the 5' end and the reverse primer binding sequence TCTAGATTGGATCTTGCTGGCAC at the 3' end. The target sequence specific binding sequence at the 5' end of the right probe is modified with a phosphate group at the 5' end of the RHS, thereby forming a probe.

[0103] 2. Extraction of pathogenic bacteria DNA

[0104] The target nucleic acid is extracted by using a kit, and the concentration is detected and adjusted to 50±10 ng / μL.

[0105] 3. Hybridization and ligation reaction of probes and target nucleic acid

[0106] 5 μL of the target nucleic acid is denatured at 95°C for 5 min, 1.5 μL of hybridization buffer and 1.5 μL of probe mixture are added, the probe concentration is 1.3-5 nM (the probe concentration of Salmonella and Staphylococcus aureus in the probe mixture is 0.75 times the probe concentration of the other 12 pathogenic bacteria, and the probe diluent is TE buffer), and hybridization is performed at 60-68°C for 6-16 hours; after the hybridization reaction is completed, 3 μL of ligase buffer A, 3 μL of ligase buffer B, 25 μL of H2O and 1 μL of ligase are added, incubation is performed at 54°C for 15 min for ligation, and the ligase is inactivated at 98°C for 5 min.

[0107] 4. PCR amplification and capillary electrophoresis separation

[0108] The universal sequence at both ends is preset when designing the probe, and a single primer is used for PCR amplification. The reaction system is 40 μL of ligation solution + 10 μL of PCR premix (7.5 μL of H2O + 2 μL of PCR primer mixture + 0.5 μL of polymerase), and the reaction conditions are 95°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 20 min; 4°C for ∞. After the PCR product is diluted by 10-50 times, 1 μL of the mixture is mixed with formamide Hidi 9 μL and LIZ-500 molecular weight internal standard 0.5 μL, 95°C reaction is performed for 5 min, and the reaction is placed on ice for ≥2 min. After the reaction, the product is transferred to a 96-well plate, POP7 gel and a 50 cm capillary are used on an ABI 3500 gene analyzer in a fragment analysis mode.

[0109] The hybridization buffer, ligase buffer, ligase, PCR primer mixture, and polymerase used in the above steps were all from the MLPA kit: Salsa MLPA EK1 Reagent kit 100 reactions - FAM, which was purchased from MRC Holland.

[0110] The detection results were directly analyzed on the 3500 Series Date Collection software. First, a single MLPA experiment was performed using each pathogenic bacteria standard strain DNA to obtain a positive result of a single pathogenic bacteria specific gene, and the fragment size and position of each pathogenic bacteria specific gene were obtained on the software (as shown in Table 1), and the PCR amplified product was sent to a gene sequencing company (Beijing Qikong Biotechnology Co., Ltd.) for detection of the amplified sequence, and the detection sequence was compared with the target gene target sequence using Genemapper software to confirm that the measured result was the target sequence. Table 2 shows the actual size of the capillary electrophoresis of the pathogenic bacteria standard strain DNA. The MLPA results of the mixed bacteria sample were compared with the relative size and position of the single pathogenic bacteria standard strain to obtain the detection results. Figure 1

[0111] Table 2 Relative total probe size of each pathogenic bacteria

[0112]

[0113] 5. Result analysis

[0114] Figure 1 The detection results obtained by the single foodborne pathogenic bacteria experiment are shown in Figure 1. As can be seen from Figure 1, the horizontal axis represents the fragment size, the vertical axis represents the signal value, the light color peak is the GeneScan 500LIZE dye Size Standard (LIZ-500 molecular weight internal standard), also known as the molecular weight internal control, which is a molecular weight standard composed of 16 double-stranded DNA fragments labeled with LIZ fluorescent (orange), used as a reference fragment for determining the size of the target fragment, Figure 1 Figure 1 The molecular weight of the molecular weight standard shown in Figure 1 is 100 bp and 139 bp, respectively. The size of the positive result of each pathogenic bacteria in the MLPA detection is shown by the dark target peak, no impurity peak is detected, and the positive results of the 15 genes are different in size and do not interfere with each other.

[0115] Figure 2 The detection results obtained by the foodborne pathogenic bacteria mixture experiment are shown in Figure 2. As can be seen from Figure 2, the horizontal axis represents the fragment size, the vertical axis represents the signal value, the light color peak is the GeneScan 500LIZE dye Size Standard (LIZ-500 molecular weight internal standard), also known as the molecular weight internal control, which is a molecular weight standard composed of 16 double-stranded DNA fragments labeled with LIZ fluorescent (orange), used as a reference fragment for determining the size of the target fragment, Figure 2 ​​(1) is the detection result of a mixture of 14 foodborne pathogens (Salmonella, Campylobacter jejuni, Pseudomonas aeruginosa, Listeria monocytogenes, enteroinvasive Escherichia coli (EIEC), Enterobacter sakazakii, Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Vibrio vulnificus, Escherichia coli O157:H7, Bacillus cereus, Vibrio alginolyticus, Clostridium perfringens) ; Figure 2 (2) is the detection result of a mixture of 12 foodborne pathogens (Salmonella, Campylobacter jejuni, Pseudomonas aeruginosa, Listeria monocytogenes, enteroinvasive Escherichia coli (EIEC), Enterobacter sakazakii, Staphylococcus aureus, Vibrio parahaemolyticus, Vibrio vulnificus, Escherichia coli O157:H7, Bacillus cereus, Clostridium perfringens) ; Figure 2 (3) is the detection result of a mixture of 8 foodborne pathogens (Salmonella, Pseudomonas aeruginosa, Listeria monocytogenes, enteroinvasive Escherichia coli (EIEC), Enterobacter sakazakii, Staphylococcus aureus, Vibrio parahaemolyticus, Vibrio vulnificus) ; Figure 2 (4) is the detection result of a mixture of 5 foodborne pathogens (Listeria monocytogenes, enteroinvasive Escherichia coli (EIEC), Shigella, Vibrio alginolyticus, Clostridium perfringens).

[0116] Example 2:

[0117] The specificity and sensitivity of the probe designed in Example 1 are verified in this test example, and the specific steps are as follows:

[0118] Prepare a simulated food sample, which contains meat (pork, beef), vegetables (Chinese cabbage, potatoes, cucumbers), aquatic products (crucian carp, kelp), wheat, eggs, milk powder. The simulated sample is sterilized by 121℃, 15min high pressure sterilization, so that it does not contain the foodborne pathogens. Randomly mix multiple pathogens into the sterilized simulated sample, and add each pathogen to the 10g simulated sample at a final concentration of 10 4 CFU / mL (equivalent to containing 10pg-1ng genomic DNA per microliter), to obtain mixed samples one to five. Mix 10g of mixed sample with 90mL of phosphate buffer to obtain a simulated sample suspension, and take 1mL of sample suspension for subsequent DNA extraction and MLPA detection.

[0119] Specifically, Vibrio parahaemolyticus, Pseudomonas aeruginosa, Clostridium perfringens are added to mixed sample one;

[0120] Salmonella, enteroinvasive Escherichia coli (EIEC), Shigella are added to mixed sample two;

[0121] Staphylococcus aureus, Salmonella, Enterobacter sakazakii, Listeria monocytogenes were added in the mixed sample three;

[0122] Staphylococcus aureus, Salmonella, Enterobacter sakazakii, Listeria monocytogenes, Escherichia coli O157:H7, Bacillus cereus were added in the mixed sample four;

[0123] Staphylococcus aureus, Salmonella, Enterobacter sakazakii, Vibrio vulnificus, Vibrio parahaemolyticus, Campylobacter jejuni, Escherichia coli O157:H7, Bacillus cereus were added in the mixed sample five;

[0124] The test was carried out by steps 2-4 in Example 1, and the result was analyzed.

[0125] Figure 3 (1) the detection result corresponding to the mixed sample one; Figure 3 (2) the detection result corresponding to the mixed sample two; Figure 3 (3) the detection result corresponding to the mixed sample three; Figure 3 (4) the detection result corresponding to the mixed sample four; Figure 3 (5) the detection result corresponding to the mixed sample five. The results show that Figure 3 The results in (1) to (5) are consistent with the pathogenic bacteria in the mixed sample in advance, which indicates that the probe combination provided by the application can specifically and accurately detect the foodborne pathogenic bacteria in food.

Claims

1. A probe for detecting pathogenic bacteria in food, characterized in that: The first to fifteenth probe groups are probes for detecting Salmonella, Campylobacter jejuni, Pseudomonas aeruginosa, Listeria monocytogenes, invE gene of enteroinvasive Escherichia coli (EIEC), Enterobacter sakazakii, Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Vibrio vulnificus, Escherichia coli O157:H7 / NM, Bacillus cereus, Vibrio alginolyticus, Clostridium perfringens, and uidA gene of enteroinvasive Escherichia coli (EIEC), respectively. Each probe group contains the left probe LPO and the right probe RPO: The first group of probes includes a left probe LPO as shown in SEQ ID NO.1 and a right probe RPO as shown in SEQ ID NO.2; The second group of probes includes the left probe LPO shown in SEQ ID NO.3 and the right probe RPO shown in SEQ ID NO.4; The third group of probes includes the left probe LPO shown in SEQ ID NO.5 and the right probe RPO shown in SEQ ID NO.6; The fourth group of probes includes the left probe LPO shown in SEQ ID NO. 7 and the right probe RPO shown in SEQ ID NO. 8; The fifth group of probes includes the left probe LPO shown in SEQ ID NO.9 and the right probe RPO shown in SEQ ID NO.10; The sixth group of probes includes the left probe LPO shown in SEQ ID NO.11 and the right probe RPO shown in SEQ ID NO.12; The seventh group of probes includes the left probe LPO shown in SEQ ID NO. 13 and the right probe RPO shown in SEQ ID NO. 14; The eighth group of probes includes the left probe LPO shown in SEQ ID NO.15 and the right probe RPO shown in SEQ ID NO.16; The ninth group of probes includes a left probe LPO as shown in SEQ ID NO. 17 and a right probe RPO as shown in SEQ ID NO. 18; The tenth probe group includes the left probe LPO shown in SEQ ID NO. 19 and the right probe RPO shown in SEQ ID NO. 20; The eleventh group of probes includes the left probe LPO shown in SEQ ID NO. 21 and the right probe RPO shown in SEQ ID NO. 22; The twelfth probe group includes the left probe LPO shown in SEQ ID NO. 23 and the right probe RPO shown in SEQ ID NO. 24; The thirteenth probe group includes the left probe LPO shown in SEQ ID NO. 25 and the right probe RPO shown in SEQ ID NO. 26; The fourteenth probe group includes the left probe LPO shown in SEQ ID NO. 27 and the right probe RPO shown in SEQ ID NO. 28; The fifteenth probe group includes the left probe LPO shown in SEQ ID NO. 29 and the right probe RPO shown in SEQ ID NO.

30.

2. The detection probe for pathogenic bacteria in food according to claim 1, characterized in that The 5' end of each left probe of the first to fifteenth groups of probes is connected to the forward primer binding sequence shown in SEQ ID NO.31, and the 3' end of each right probe of the first to fifteenth groups of probes is connected to the reverse primer binding sequence shown in SEQ ID NO.

32.

3. A method for detecting pathogenic bacteria in food, characterized in that: The steps include: (1) Extract the DNA of the sample to be tested and denature it; (2) performing hybridization and ligation reaction on the fifteen probe groups described in claim 1 and DNA; (3) Using a pair of universal primers, the hybridized left probe LPO and the right probe RPO are connected and then PCR amplified and separated by capillary electrophoresis; (4) Analyze the results of capillary electrophoresis separation to detect whether at least one of Salmonella, Campylobacter jejuni, Pseudomonas aeruginosa, Listeria monocytogenes, Enterobacter sakazakii, Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Vibrio vulnificus, Escherichia coli O157:H7 / NM, Bacillus cereus, Vibrio alginolyticus, Clostridium perfringens, and enteroinvasive Escherichia coli is present in the sample.

4. A detection kit, characterized in that The kit comprises the probe set according to claim 1.

5. The detection kit according to claim 4, wherein A pair of universal primers is also included.

6. Use of the kit according to any one of claims 4 to 5 for detecting pathogenic bacteria in food by multiplex ligation-dependent probe amplification technology, wherein the pathogenic bacteria in food is at least one of Salmonella, Campylobacter jejuni, Pseudomonas aeruginosa, Listeria monocytogenes, Enterobacter sakazakii, Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Vibrio vulnificus, Escherichia coli O157:H7 / NM, Bacillus cereus, Vibrio alginolyticus, Clostridium perfringens, and enteroinvasive Escherichia coli.

Citation Information

Patent Citations

  • Post-neurosurgical intracranial bacterial infection common pathogenic bacterium MLPA detection probe and application thereof

    CN105018601A