Primer probe composition and its application in detection of urogenital tract pathogens

By combining primer-probe compositions with Taqman probe technology, the problem of high detection limits for urogenital pathogens in existing technologies has been solved, achieving high sensitivity and specificity for the detection of Chlamydia trachomatis, Neisseria gonorrhoeae, and Mycoplasma genitalium, with a detection limit of 20 copies/reaction.

CN115786554BActive Publication Date: 2026-02-13ZHUHAI LIVZON DIAGNOSTICS

Patent Information

Application Number
CN202211551481.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-05
Publication Date
2026-02-13
Estimated Expiration
2042-12-05

AI Technical Summary

Technical Problem

Current technologies have relatively high detection limits for urogenital pathogens, making it difficult to achieve detections with higher sensitivity and specificity.

Method used

Using specific primer-probe compositions, including primer-probe pairs for Chlamydia trachomatis, Neisseria gonorrhoeae, and Mycoplasma genitalium, combined with Taqman probe technology, specific detection of the corresponding pathogens can be achieved through PCR detection. Furthermore, different pathogens can be distinguished by the design of luminescent and quenching markers.

Benefits of technology

It enables the combined detection of Chlamydia trachomatis, Neisseria gonorrhoeae, and Mycoplasma genitalium, with a detection limit as low as 20 copies/reaction, significantly improving the sensitivity and specificity of the detection, and providing reliable test results within 30 minutes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115786554B_ABST
    Figure CN115786554B_ABST
Patent Text Reader

Abstract

The application provides a primer probe composition and application thereof in detection of urogenital tract pathogens, and relates to the technical field of biology. The primer probe composition comprises a chlamydia trachomatis primer probe pair with sequences shown in SEQ ID NO:1-6; a gonococcus primer probe pair with sequences shown in SEQ ID NO:7-9; and a mycoplasma genitalium primer probe pair with sequences shown in SEQ ID NO:10-12. The primer probe pairs in the primer probe composition do not have significant cross interference, the lower limit of detection can be as low as 20 copies / reaction, 200 copies / mL, and the problem that the lower limit of detection of the urogenital tract pathogens in the prior art needs to be reduced is solved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and in particular to a primer probe composition and its application in detection of urogenital tract pathogens. BACKGROUND

[0002] Sexually transmitted diseases (STD) are widely prevalent in the world, which seriously endanger social stability. As the most common type of sexually transmitted diseases, the main pathogen of gonorrhea is Neisseria gonorrhoeae (NG). Neisseria gonorrhoeae, also known as Neisseria gonorrhoeae, is a gram-negative coccus, which is often located in the leukocytes of purulent secretions produced by inflammatory reactions of the reproductive system. Neisseria gonorrhoeae has strong adaptability and can continuously acquire various drug resistance through variation. Neisseria gonorrhoeae invades and infects the reproductive system, causing inflammatory reactions, and the common manifestations in men are urethritis, prostatitis, epididymitis, etc.; in women, infection can cause urethritis, cervicitis, pelvic inflammatory disease, etc., and even cause infertility.

[0003] Chlamydia trachomatis (CT) is an intracellular parasitic microorganism with up to 19 serotypes. Different genotypes are associated with diseases, such as types D-K mainly infecting the urogenital tract and causing nongonococcal urethritis (NGU). After Chlamydia trachomatis infection, the incubation period is several days to several months. For women, the most common clinical manifestations are purulent cervicitis, vaginitis, pelvic inflammatory disease, pregnancy, and tubal infertility, etc., and for men, the manifestations are epididymitis and proctitis, etc.

[0004] In addition to Chlamydia trachomatis, Mycoplasma genitalium is also a major pathogenic agent of nongonococcal urethritis. Mycoplasma genitalium is a prokaryote between bacteria and viruses, and its infection rate in the human urogenital tract is increasing year by year, and is closely related to diseases such as prostatitis, cervicitis, endometritis, pelvic inflammatory disease, and infertility.

[0005] At present, the gold standard for detection of Neisseria gonorrhoeae (NG), Chlamydia trachomatis (CT), and Mycoplasma genitalium (MG) is mainly culture method, but it has problems such as high technical requirements, difficulty in culture, complex operation, long time-consuming, etc. Immunological diagnosis is simple and fast, but has poor specificity and low sensitivity. Therefore, molecular diagnostic methods, such as real-time fluorescent quantitative PCR detection technology, can make up for the defects of the above methods, and can directly extract pathogen nucleic acids from clinical samples for detection, with the advantages of rapidness, accuracy, high specificity, high sensitivity, etc.

[0006] The domestic clinical detection of gonococcal (NG), chlamydia trachomatis (CT), mycoplasma genitalium (MG) and other pathogen DNA or RNA methods are mainly based on real-time fluorescent quantitative PCR technology and its improvement. There are many kits on the market that contain chlamydia trachomatis, gonococcal and mycoplasma genitalium and other pathogens for joint detection: such as the registered certificate number of national medical instrument approval 20203400067, the nucleic acid detection reagent kit (PCR + flow-through hybridization method) for genital tract infection pathogens, the detection lower limit is 1.0E+04 copies / mL; such as the registered certificate number of national medical instrument approval 20183401646, 20183401648, the kit uses RNA isothermal amplification technology to detect chlamydia trachomatis and neisseria gonorrhoeae, the detection lower limit of CT and NG is 1000 copies / reaction; the registered certificate number of national medical instrument approval 20173404323, the kit uses RNA isothermal amplification technology to detect mycoplasma genitalium, and the detection lower limit is 103 copies / reaction; such as the registered certificate number of national medical instrument approval 20193400148, the kit uses fluorescent quantitative PCR technology to detect chlamydia trachomatis, neisseria gonorrhoeae and ureaplasma urealyticum, and the detection lower limit is 400 copies / mL. Based on the above situation, a lower detection lower limit of chlamydia trachomatis (CT), gonococcal (NG) and mycoplasma genitalium (MG) multiplex primer probe combination is needed.

[0007] Therefore, the present application is proposed. SUMMARY

[0008] The purpose of the present application is to provide a primer probe composition to alleviate the problem of the detection lower limit of urogenital tract pathogens in the prior art. Based on the above primer probe composition, another purpose of the present application is to provide the application of the above primer probe composition and the products applying them.

[0009] To solve the above technical problems, the present application adopts the following technical solutions:

[0010] According to one aspect of the present application, the present application provides a primer probe composition, comprising a chlamydia trachomatis primer probe pair, a gonococcal primer probe pair and a mycoplasma genitalium primer probe pair;

[0011] The Chlamydia trachomatis primer probe pair comprises: a forward CT primer 1 having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse CT primer 1 having a nucleotide sequence as shown in SEQ ID NO: 2; a forward CT primer 2 having a nucleotide sequence as shown in SEQ ID NO: 3, a reverse CT primer 2 having a nucleotide sequence as shown in SEQ ID NO: 4; a CT probe 1 having a nucleotide sequence as shown in SEQ ID NO: 5, a CT probe 2 having a nucleotide sequence as shown in SEQ ID NO: 6; the Neisseria gonorrhoeae primer probe pair comprises: a forward NG primer having a nucleotide sequence as shown in SEQ ID NO: 7, a reverse NG primer having a nucleotide sequence as shown in SEQ ID NO: 8; a NG probe having a nucleotide sequence as shown in SEQ ID NO: 9; the Mycoplasma genitalium primer probe pair comprises: a forward MG primer having a nucleotide sequence as shown in SEQ ID NO: 10, a reverse MG primer having a nucleotide sequence as shown in SEQ ID NO: 11; a MG probe having a nucleotide sequence as shown in SEQ ID NO: 12; the CT probe 1, the CT probe 2, the NG probe and the MG probe are labeled with a luminescent label and a quenching label.

[0012] Preferably, the working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are independently 0.4-0.6 μM, preferably 0.4 μM;

[0013] Preferably, the working concentrations of the CT probe 1 and the CT probe 2 are independently 0.1-0.2 μM, preferably 0.13 μM;

[0014] Preferably, the working concentrations of the forward NG primer and the reverse NG primer are independently 0.4-0.8 μM, preferably 0.6 μM;

[0015] Preferably, the working concentration of the NG probe is 0.1-0.2 μM, preferably 0.14 μM;

[0016] Preferably, the working concentrations of the forward MG primer and the reverse MG primer are independently 0.4-0.8 μM, preferably 0.6 μM;

[0017] Preferably, the working concentration of the MG probe is 0.1-0.17 μM, preferably 0.13 μM.

[0018] Preferably, the working concentrations of the forward MG primer and the reverse MG primer are independently 0.4-0.8 μM, preferably 0.6 μM;

[0019] Preferably, the internal reference primer probe pair comprises: a forward IC primer with a nucleotide sequence as shown in SEQ ID NO: 13, a reverse IC primer with a nucleotide sequence as shown in SEQ ID NO: 14; an IC probe with a nucleotide sequence as shown in SEQ ID NO: 15; the IC probe is labeled with a luminescent label and a quenching label.

[0020] Preferably, the working concentrations of the forward IC primer and the reverse IC primer are independently 0.4-0.6 μM, preferably 0.4 μM.

[0021] Preferably, the working concentration of the IC probe is 0.1-0.14 μM, preferably 0.12 μM.

[0022] Preferably, the working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are 0.4-0.6 μM, the working concentrations of the CT probe 1 and the CT probe 2 are 0.1-0.2 μM; the working concentrations of the forward NG primer and the reverse NG primer are 0.4-0.8 μM, the working concentration of the NG probe is 0.1-0.2 μM; the working concentrations of the forward MG primer and the reverse MG primer are 0.4-0.8 μM, the working concentration of the MG probe is 0.1-0.17 μM; the working concentrations of the forward IC primer and the reverse IC primer are 0.4-0.6 μM, the working concentration of the IC probe is 0.1-0.14 μM.

[0023] Preferably, the working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are 0.4 μM, the working concentrations of the CT probe 1 and the CT probe 2 are 0.13 μM; the working concentrations of the forward NG primer and the reverse NG primer are 0.6 μM, the working concentration of the NG probe is 0.14 μM; the working concentrations of the forward MG primer and the reverse MG primer are 0.6 μM, the working concentration of the MG probe is 0.13 μM; and, the working concentrations of the forward IC primer and the reverse IC primer are 0.4 μM, the working concentration of the IC probe is 0.12 μM.

[0024] Preferably, the luminescent labels of the probes of different primer probe pairs are different from each other.

[0025] Preferably, the luminescent label is selected from quantum dots, FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or Cy5.

[0026] Preferably, the quenching label is selected from BHQ1, BHQ2, BHQ3 or MGB.

[0027] Preferably, the CT probe 1 and the CT probe 2 are labeled with FAM and BHQ1; the NG probe is labeled with VIC and BHQ1; the MG probe is labeled with CY5 and BHQ3; and the NG probe is labeled with ROX and BHQ2.

[0028] According to another aspect of the present application, the present application also provides use of the primer probe composition described above in the preparation of a kit for detecting a urogenital tract pathogen, or in the detection of a urogenital tract pathogen for non-diagnostic and therapeutic purposes; the urogenital tract pathogen includes Chlamydia trachomatis, Neisseria gonorrhoeae and Mycoplasma genitalium.

[0029] According to another aspect of the present application, the present application also provides a kit for detecting a urogenital tract pathogen, the urogenital tract pathogen including Chlamydia trachomatis, Neisseria gonorrhoeae and Mycoplasma genitalium, the kit comprising the primer probe composition described above for detecting a urogenital tract pathogen.

[0030] Preferably, the kit further comprises one or more of an enzyme, a buffer, a metal ion, dNTPs and a positive control;

[0031] Preferably, the kit further comprises a premix, the premix comprising Taq enzyme, UNG enzyme, Tris-HCl buffer, K + and Mg 2+ ; the working concentration of each substance is as follows: Taq enzyme: 4 U / reaction; UNG enzyme: 0.2 U / reaction; Tris-HCl buffer; KCl: 50 mM; Mg 2+ : 5 mM; and, dNTPs: 0.3 mM;

[0032] Preferably, the premix further contains the primer probe composition;

[0033] Preferably, the positive control comprises a template plasmid, the template plasmid comprising a CT-o region plasmid, a CT-p region plasmid, an NG plasmid, an MG plasmid and an internal standard plasmid;

[0034] The template plasmid takes PUC57 as a backbone plasmid, the CT-o region plasmid contains a fragment with a sequence as shown in SEQ ID NO: 16, the CT-p region plasmid contains a fragment with a sequence as shown in SEQ ID NO: 17, the NG plasmid contains a fragment with a sequence as shown in SEQ ID NO: 18, the MG plasmid contains a fragment with a sequence as shown in SEQ ID NO: 19, and the internal standard plasmid contains a fragment with a sequence as shown in SEQ ID NO: 20.

[0035] According to another aspect of the present application, the present application also provides a method for detecting urogenital tract pathogens, including Chlamydia trachomatis, Neisseria gonorrhoeae and Mycoplasma genitalium, for non-diagnostic and therapeutic purposes, which comprises using the primer probe composition or the kit described above to perform PCR detection on a sample to be detected.

[0036] Compared with the prior art, the present application has the following beneficial effects:

[0037] The primer probe composition for detecting urogenital tract pathogens provided by the present application comprises Chlamydia trachomatis primer probe pairs, Neisseria gonorrhoeae primer probe pairs and Mycoplasma genitalium primer probe pairs, and can detect Chlamydia trachomatis, Mycoplasma genitalium and Neisseria gonorrhoeae in combination, can specifically and cover detection of corresponding pathogens, and do not have significant cross interference with each other. The primer probe composition provided by the present application carries the rest of the reaction components to form a rapid detection system, and more sensitive and reliable detection results can be obtained within 30 minutes. The lower limit of detection of the primer probe composition provided by the present application can be as low as 20 copies / reaction, 200 copies / mL. BRIEF DESCRIPTION OF DRAWINGS

[0038] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0039] FIG. 1A and FIG. 1B respectively, are the amplification curves of the four primer probe combinations in the CT-O region when the detection concentrations are 20000 copies / reaction and 20 copies / reaction, respectively;

[0040] FIG. 2A and FIG. 2B respectively, are the amplification curves of the six primer probe combinations in the CT-P region when the detection concentrations are 20000 copies / reaction and 20 copies / reaction, respectively;

[0041] FIG. 3A and FIG. 3B respectively, are the amplification curves of the primer probe combinations 1, 2, 5 and 6 in the NG region when the detection concentrations are 2000 copies / reaction and 20 copies / reaction, respectively;

[0042] FIG. 3C and FIG. 3D respectively, are the amplification curves of the primer probe combinations 3, 4, 7 and 8 in the NG region when the detection concentrations are 2000 copies / reaction and 20 copies / reaction, respectively.

[0043] FIG. 4A and FIG. 4B are amplification curves of the five primer probe combinations for detecting the concentration of 10000 copies / reaction and 100 copies / reaction respectively.

[0044] FIG. 5A and FIG. 5B are amplification curves of the five primer probe combinations for detecting the concentration of 10000 copies / reaction and 100 copies / reaction respectively. DETAILED DESCRIPTION

[0045] The technical solutions of the present application will be described clearly and completely below in combination with the embodiments. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0046] According to one aspect of the present application, the present application provides a primer probe combination, comprising a Chlamydia trachomatis primer probe pair, a Neisseria gonorrhoeae primer probe pair and a Mycoplasma genitalium primer probe pair.

[0047] The Chlamydia trachomatis primer probe pair comprises:

[0048] Forward CT primer 1: TGTGACGCTATCAGCATGCGTATGG (SEQ ID NO: 1);

[0049] Reverse CT primer 1: CGCCGCTCCCATCTGAAATTCTT (SEQ ID NO: 2);

[0050] Forward CT primer 2: AGCCGCTCAAGGACCAGCAA (SEQ ID NO: 3);

[0051] Reverse CT primer 2: GCAGCATTGGTTGATGGATTATTG (SEQ ID NO: 4);

[0052] CT probe 1: CCTTGCACCACTTGGTGTGACGCTATC (SEQ ID NO: 5);

[0053] CT probe 2: AATCCTTGGGACAACATCAACACCTCTC (SEQ ID NO: 6).

[0054] The preferred working concentrations of the above primers and probes are as follows: the working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are independently preferably 0.4-0.6 μM, for example, but not limited to, 0.4, 0.5 or 0.6 μM, and more independently preferably 0.4 μM, respectively. The working concentrations of the CT probe 1 and the CT probe 2 are independently preferably 0.1-0.2 μM, for example, but not limited to, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19 or 0.20 μM, and more independently preferably 0.13 μM, respectively.

[0055] The Neisseria gonorrhoeae primer-probe pair includes:

[0056] Forward NG primer: AACCCGATATAATCCGCCCTT (SEQ ID NO: 7);

[0057] Reverse NG primer: CTGGATTCATTTTCGGCTCCTTAT (SEQ ID NO: 8);

[0058] NG probe: TCGGCTCCTTATTCGGTTTGACCG (SEQ ID NO: 9).

[0059] The preferred working concentrations of the above primers and probes are as follows: the working concentrations of the forward NG primer and the reverse NG primer are independently preferably 0.4-0.8 μM, for example, but not limited to, 0.4, 0.5, 0.6, 0.7 or 0.8 μM, and more independently preferably 0.6 μM, respectively. The working concentration of the NG probe is preferably 0.1-0.2 μM, for example, but not limited to, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19 or 0.20 μM, and more preferably 0.14 μM.

[0060] The Mycoplasma genitalium primer-probe pair includes:

[0061] Forward MG primer: GAGATGGCCACAGTGACGAA (SEQ ID NO: 10);

[0062] Reverse MG primer: AGTATTGCTGCTAAGTATAGTGTTCT (SEQ ID NO: 11);

[0063] MG probe: CGAAGTGGACCATACCACCAGTG (SEQ ID NO: 12).

[0064] The preferred working concentrations of the above primers and probes are as follows: the working concentrations of the forward MG primer and the reverse MG primer are independently preferred to be 0.4-0.8 μM, for example, can be but not limited to 0.4, 0.5, 0.6, 0.7 or 0.8 μM, and more independently preferred to be 0.6 μM. The working concentration of the MG probe is preferred to be 0.1-0.17 μM, for example, can be but not limited to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16 or 0.17 μM, and more preferred to be 0.13 μM.

[0065] In some alternative embodiments, the primer probe composition further comprises an internal reference primer pair. The internal reference primer probe pair preferably comprises:

[0066] Forward IC primer: AGGTGAACGTGGATGAAGTTGGTG (SEQ ID NO: 13);

[0067] Reverse IC primer: GCAGAGAGAGTCAGTGCCTATCAGA (SEQ ID NO: 14);

[0068] IC probe: TGAGGCCCTGGGCAGGTTGGTATC (SEQ ID NO: 15).

[0069] The preferred working concentrations of the above primers and probes are as follows: the working concentrations of the forward IC primer and the reverse IC primer are independently preferred to be 0.4-0.6 μM, for example, can be but not limited to 0.4, 0.5 or 0.6 μM, and more independently preferred to be 0.4 μM. The working concentration of the IC probe is preferred to be 0.1-0.14 μM, for example, can be but not limited to 0.1, 0.11, 0.12, 0.13 or 0.14 μM, and more preferred to be 0.12 μM.

[0070] In some alternative embodiments, the primer probe composition comprises a Chlamydia trachomatis primer probe pair, a Neisseria gonorrhoeae primer probe pair, a Mycoplasma genitalium primer probe pair and an internal reference primer probe pair, and the preferred working concentrations of the primers and probes in the primer probe composition are as follows:

[0071] The working concentration of forward CT primer 1, reverse CT primer 1, forward CT primer 2 and reverse CT primer 2 is 0.4-0.6 μM, and the working concentration of CT probe 1 and CT probe 2 is 0.1-0.2 μM; the working concentration of forward NG primer and reverse NG primer is 0.4-0.8 μM, and the working concentration of NG probe is 0.1-0.2 μM; the working concentration of forward MG primer and reverse MG primer is 0.4-0.8 μM, and the working concentration of MG probe is 0.1-0.17 μM; the working concentration of forward IC primer and reverse IC primer is 0.4-0.6 μM, and the working concentration of IC probe is 0.1-0.14 μM.

[0072] In some preferred embodiments, the preferred working concentrations of the primers and probes in the above primer probe composition are as follows:

[0073] The working concentration of forward CT primer 1, reverse CT primer 1, forward CT primer 2 and reverse CT primer 2 is 0.4 μM, and the working concentration of CT probe 1 and CT probe 2 is 0.13 μM; the working concentration of forward NG primer and reverse NG primer is 0.6 μM, and the working concentration of NG probe is 0.14 μM; the working concentration of forward MG primer and reverse MG primer is 0.6 μM, and the working concentration of MG probe is 0.13 μM; and the working concentration of forward IC primer and reverse IC primer is 0.4 μM, and the working concentration of IC probe is 0.12 μM.

[0074] The working concentration herein refers to the concentration of each component in the PCR reaction system.

[0075] The primer probe composition provided by the present application is based on the Taqman probe technology. The Taqman probe is an oligonucleotide sequence complementary to the target gene sequence and highly specific. The probe is modified with a luminescent label and a quencher label. When the probe is intact, no fluorescence signal is emitted. When the primer is extended, the probe bound to the template is cut by the 5' exonuclease activity of Taq enzyme, and the luminescent label and the quencher label are separated, thereby generating a fluorescence signal. Based on the above principle, the probe in each primer probe pair in the primer probe composition of the present application is modified with a luminescent label and a quencher label. The luminescent label is preferably labeled at the 5' end, and the quencher label is preferably labeled at the 3' end. The luminescent labels of the probes belonging to different primer probe pairs can be the same or different, and are preferably different, in order to distinguish different target genes and corresponding pathogens. The luminescent labels of the CT probe 1 and the CT probe 2 can be the same or different. The luminescent label and the quencher label can be selected from mature and well-known labels in the art, and the present application does not limit this. The luminescent label can be, but is not limited to, quantum dots, FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or Cy5; and the quencher label can be, but is not limited to, BHQ1, BHQ2, BHQ3 or MGB. In an alternative embodiment, the CT probe 1 and the CT probe 2 are modified with FAM and BHQ1; the NG probe is modified with VIC and BHQ1; the MG probe is modified with CY5 and BHQ3; and the NG probe is modified with ROX and BHQ2.

[0076] According to another aspect of the present application, the present application also provides the use of the primer probe composition described above in the preparation of a urogenital tract pathogen detection kit, or in the detection of urogenital tract pathogens for non-diagnostic and therapeutic purposes; the urogenital tract pathogens include Chlamydia trachomatis, Neisseria gonorrhoeae and Mycoplasma genitalium.

[0077] Based on the inventive concept of the above use, the present application also provides a urogenital tract pathogen detection kit, which comprises the primer probe composition described above for the detection of urogenital tract pathogens. The urogenital tract pathogens detected by the kit include Chlamydia trachomatis, Neisseria gonorrhoeae and Mycoplasma genitalium.

[0078] It can be understood that, in addition to the above-mentioned probe composition, the kit can also optionally comprise substances or reagents acceptable in the art for PCR reaction, including but not limited to one or more of enzymes, buffers, metal ions, dNTPs and positive controls. The above-mentioned substances for PCR reaction can be optionally packaged separately or premixed in the same reagent, for example, premixed as a reaction buffer reagent. Each substance or reagent in the kit can be optionally present in the form of a working reagent or a stock reagent. When it is a stock reagent, it is diluted to a working concentration for use.

[0079] In some alternative embodiments, the enzymes include Taq enzyme and UNG enzyme;

[0080] In some alternative embodiments, the buffer is Tris-HCl;

[0081] In some alternative embodiments, the metal ions include K + and Mg 2+ .

[0082] In some alternative embodiments, the kit further includes a premix solution, which includes Taq enzyme, UNG enzyme, Tris-HCl buffer, K + and Mg 2+ ; the working concentrations of each substance are as follows: Taq enzyme: 4 U / reaction; UNG enzyme: 0.2 U / reaction; Tris-HCl buffer; KCl: 50 mM; Mg 2+ : 5 mM; and, dNTPs: 0.3 mM.

[0083] In some alternative embodiments, the premix solution further contains the primer probe composition.

[0084] In some alternative embodiments, the positive control includes template plasmids containing the target fragments amplified by the primer probe composition described above, which include CT-o region plasmid, CT-p region plasmid, NG plasmid, MG plasmid and internal standard plasmid. The template plasmids use PUC57 as the backbone plasmid, the CT-o region plasmid contains a fragment with the sequence shown in SEQ ID NO: 16, the CT-p region plasmid contains a fragment with the sequence shown in SEQ ID NO: 17, the NG plasmid contains a fragment with the sequence shown in SEQ ID NO: 18, the MG plasmid contains a fragment with the sequence shown in SEQ ID NO: 19, and the internal standard plasmid contains a fragment with the sequence shown in SEQ ID NO: 20.

[0085] Based on the application concept described above, the present application further provides a method for detecting urogenital tract pathogens, which are non-diagnostic and therapeutic purposes, wherein the urogenital tract pathogens include Chlamydia trachomatis, Neisseria gonorrhoeae and Mycoplasma genitalium. The method includes using the primer probe composition described above, or the kit described above to perform PCR detection on the sample to be tested. The determination of the detection result can be based on the mature and well-known methods in the art, such as judging whether the corresponding pathogenic microorganism exists in the sample to be tested according to whether the amplification curve appears, and further constructing a standard curve for quantitative detection, which is not limited by the present application.

[0086] In some alternative embodiments, the PCR reaction system for PCR detection comprises the primer probe combination for detection of the urogenital tract pathogens described above; and, Taq enzyme, UNG enzyme, Tris-HCl buffer, K + and Mg 2+ The preferred concentrations of the substances in the PCR reaction system are as follows:

[0087] The concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are 0.4-0.6 μM; the concentrations of the CT probe 1 and the CT probe 2 are 0.1-0.2 μM; the concentrations of the forward NG primer and the reverse NG primer are 0.4-0.8 μM; the concentration of the NG probe is 0.1-0.2 μM; the concentrations of the forward MG primer and the reverse MG primer are 0.4-0.8 μM; the concentration of the MG probe is 0.1-0.17 μM; the concentrations of the forward IC primer and the reverse IC primer are 0.4-0.6 μM; and the concentration of the IC probe is 0.1-0.14 μM;

[0088] UNG enzyme: 0.2 U / reaction; Tris-HCl buffer; KCl: 50 mM; Mg 2+ : 5 mM; and, dNTPs: 0.3 mM;

[0089] In some preferred embodiments, in the PCR reaction system described above, the working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are 0.4 μM, the working concentrations of the CT probe 1 and the CT probe 2 are 0.13 μM; the working concentrations of the forward NG primer and the reverse NG primer are 0.6 μM, the working concentration of the NG probe is 0.14 μM; the working concentrations of the forward MG primer and the reverse MG primer are 0.6 μM, the working concentration of the MG probe is 0.13 μM; and the working concentrations of the forward IC primer and the reverse IC primer are 0.4 μM, the working concentration of the IC probe is 0.12 μM.

[0090] In some alternative embodiments, the amplification is performed by using a C7 real-time fluorescent quantitative PCR system, and the reaction procedure is as follows: (a) 50 °C, 2 min, 1 cycle; (b) 95 °C, 20 s, 1 cycle; (c) 95 °C, 5 s, 61 °C, 10 s for collecting fluorescence, 45 cycles. The amplification procedure can be completed in only 25 min.

[0091] The technical solutions and beneficial effects of the present application will be further illustrated in combination with preferred embodiments.

[0092] The Taq enzyme, UNG enzyme, primer probe pair (CT, NG, MG and internal standard), template plasmid (CT-o region, CT-p region, NG, MG and internal standard) used in the following examples are commercially available raw materials.

[0093] The chlamydia trachomatis, mycoplasma genitalium and gonococcus detection system comprises an enzyme system, CT primer probe pair, NG primer probe pair, MG primer probe pair, internal reference primer probe pair, PCR buffer system and template plasmid. The enzyme system mainly comprises Taq enzyme and UNG enzyme, and the concentrations are 4U and 0.2U respectively. The PCR buffer system contains 10mM Tris-HCl (pH8.5), 50mM KCl, 5mM Mg 2+ , 0.3mM dNTPs, etc. The working concentration of the primer is 0.2-0.8mM, and the working concentration of the probe is 0.05-0.2mM.

[0094] The sequence information of the template plasmid (CT-o region, CT-p region, NG, MG and internal standard) in the following examples is shown in the following table, and the template plasmid is taken as a PUC57 vector.

[0095] Table A. Template plasmid sequence information

[0096]

[0097] Example 1

[0098] (I) Single target gene primer probe combination screening:

[0099] 1. CT-O region primer probe combination screening:

[0100] (1) Prepare the detection system of different primer probe combinations of CT-O region according to Table 1-1, wherein the primer concentration is fixed at 0.4μM and the probe concentration is 0.1μM, 25μL (nucleic acid ratio is 40%) per hole of each group is dispensed into PCR eight-tube tube, and placed into real-time fluorescence quantitative PCR instrument for amplification detection.

[0101] Table 1-1: CT-O region primer probe combination summary table

[0102]

[0103] Table 1-2: CT-O region primer probe sequence

[0104]

[0105] (2) The amplification conditions are as follows: (amplification time is 58min).

[0106] Table 1-3: Amplification conditions

[0107]

[0108] (3) The detection results are shown in Table 1-4. FIG. 1A , 1B and Table 1-4.

[0109] Table 1-4: Detection results

[0110]

[0111] (4) Conclusion: The results show that in the system, without adding nucleic acid, the four primer combinations have no non-specific amplification, and the primer probe design of CT-O region is reasonable. Under the template plasmid (CT-O region) concentration of 20000 copies / reaction, 20 copies / reaction, compared with the four primer combinations, the target gene amplification line of combination 4 is more linear, the Ct value is smaller, and the fluorescence signal is higher, which shows that the use of combination 4 in the system can obviously improve the amplification effect of Chlamydia trachomatis.

[0112] 2. CT-P region primer probe combination screening:

[0113] (1) Prepare the detection system of different primer probe combinations of CT-P region according to Table 2-1, wherein the primer concentration is fixed at 0.4 μM, the probe concentration is 0.1 μM, and each group is 25 μL (nucleic acid ratio is 40%) per hole. The PCR eight-tube is divided into real-time fluorescence quantitative PCR instrument for amplification detection.

[0114] Table 2-1: CT-P region primer probe combination summary table

[0115]

[0116] Table 2-2: CT-P region primer probe sequence

[0117]

[0118] (2) The amplification conditions are as follows: (amplification time is 58 min).

[0119] Table 2-3: Amplification conditions

[0120]

[0121] (3) The detection results are shown in Table 2-4. FIG. 2A , 2B and Table 2-4.

[0122] Table 2-4: Detection results

[0123]

[0124] (4) Conclusion: The results show that in the system, without the addition of nucleic acid, the six primer combinations have no non-specific amplification, and the primer probe design of CT-P region is reasonable; compared with the primer probe combination with Pb2 as the probe (combination 4, 5, 6), the target gene amplification line of the primer probe combination with Pb1 as the probe (combination 1, 2, 3) is more linear, the Ct value is significantly advanced, and the fluorescence signal is significantly improved, indicating that the use of Pb1 as the detection probe in the system can significantly improve the amplification effect of Chlamydia trachomatis. Among them, combination 3 is better, combination 1 and 2 are second, which can be used as alternative primer probe combinations.

[0125] 3. Screening of NG primer probe combinations

[0126] (1) The detection system of different NG primer probe combinations was prepared according to Table 3-1, in which the primer concentration was fixed at 0.4 μM, the probe concentration was 0.1 μM, and each group was 25 μL (nucleic acid ratio was 40%) per well, which was divided into PCR eight-tube and placed in real-time fluorescent quantitative PCR instrument for amplification detection.

[0127] Table 3-1: Summary of NG primer probe combinations

[0128]

[0129] Table 3-2: NG primer probe sequence

[0130]

[0131] (2) The amplification conditions are as follows: (the amplification time is 58 min).

[0132] Table 3-3: Amplification conditions

[0133]

[0134] (3) The detection results are shown in FIG. 3A to FIG. 3D and Table 3-4.

[0135] Table 3-4: Detection results

[0136]

[0137] (4) Conclusion: The results showed that, without the addition of nucleic acid, none of the eight primer combinations exhibited non-specific amplification, indicating that the NG primer-probe design was reasonable. At template plasmid (NG) concentrations of 2000 copies / reaction and 20 copies / reaction, compared with primer-probe combinations using P1 (combinations 1, 2, 3, 4), primer-probe combinations using P2 (combinations 5, 6, 7, 8) showed superior linear amplification of the target gene, significantly earlier Ct values, and significantly enhanced fluorescence signals. This indicates that using P2 as the detection probe significantly improves the amplification effect of Chlamydia trachomatis. Among the primer-probe combinations using P2 as the probe, combination 6 had the lowest Ct value, followed by combination 5, which can be considered as alternative primer-probe combinations.

[0138] 4. Screening of MG primer-probe combinations:

[0139] (1) Prepare detection systems for different primer-probe combinations of MG according to Table 4-1, wherein the primer concentration is fixed at 0.4 μM and the probe concentration is 0.1 μM. 25 μL (40% nucleic acid) per well of each group is dispensed into PCR eight-tubes and placed into a real-time fluorescence quantitative PCR instrument for amplification and detection.

[0140] Table 4-1: Summary of MG Primer-Probe Combinations

[0141]

[0142] Table 4-2: MG primer and probe sequences

[0143]

[0144] (2) The amplification conditions are as follows: (the amplification time is 58 min).

[0145] Table 4-3: Amplification Conditions

[0146]

[0147] (3) Test results are as follows FIG. 4A , 4B And as shown in Table 4-4:

[0148] Table 4-4: Test Results

[0149]

[0150] (4) Conclusion: The results showed that, in the system, without the addition of nucleic acid, the six primer combinations had no non-specific amplification, and the primer probe of MG was designed reasonably. Compared with the primer probe combination (combination 4, 5, 6) with P2 as the probe, the primer probe combination (combination 1, 2, 3) with P1 as the probe had better linear amplification of the target gene, the Ct value was significantly advanced, and the fluorescence signal was significantly improved, and there was no significant difference between the combinations, which indicated that the use of P1 as the detection probe in the system could improve the amplification effect of Mycoplasma genitalium. Among them, combination 1 was slightly better, and combinations 2 and 3 could be used as alternative primer probe combinations.

[0151] 5. Screening of internal standard primer probe combination:

[0152] (1) The detection system of different internal standard primer probe combinations was prepared according to Table 5-1, in which the primer concentration was fixed at 0.4 μM, the probe concentration was 0.1 μM, and each group was 25 μL (nucleic acid ratio was 40%) per well, which was divided into PCR eight-tube and placed in a real-time fluorescent quantitative PCR instrument for amplification detection.

[0153] Table 5-1: Internal standard primer probe combination summary table

[0154]

[0155] Table 5-2: Internal reference primer probe sequence

[0156]

[0157] (2) The amplification conditions were as follows: (amplification time was 58 min).

[0158] Table 5-3: Amplification conditions

[0159]

[0160] (3) The detection results are shown in FIG. 5A FIG. 6A FIG. 6B FIG. 7A FIG. 7B FIG. 8A FIG. 8B FIG. , 5B and Table 5-4.

[0161] Table 5-4: Detection results

[0162]

[0163] (4) Conclusion: The results show that, in the system, without the addition of nucleic acid, the five primer combinations have no non-specific amplification, and the design of the internal standard primer probe is reasonable; under the template plasmid (internal standard) concentration of 10000, 100 copies / reaction, the comparison of each group shows that the detection effect of combination 1 is significantly worse, the Ct value is significantly delayed, the Rn value is lower, and there is no detection at low concentration, indicating that the primer probe combination has poor detection effect on the internal standard. After replacing the probe with P2, the detection effect of each group is significantly improved, the Ct value is smaller, the Rn value is higher, and the detection concentration is lower, which significantly improves the amplification effect of the internal standard. Among them, combination 2 is the best, combination 3 is the second, which can be used as an alternative primer probe combination.

[0164] Example 2

[0165] 1. Screening of primer probe combinations for multiple target genes:

[0166] (1) According to the results of single target gene primer probe combination screening, different multiple primer probe combination detection systems were prepared according to Table 6-1, wherein the primer concentration of each target gene was fixed at 0.4 μM, the probe concentration was 0.1 μM, and each group was 25 μL (the ratio of template plasmid (CT+NG+MG+internal standard) was 40%) per well. The PCR eight-tube was divided into real-time fluorescence quantitative PCR instrument for amplification detection.

[0167] Table 6-1: Summary of multiple primer probe combinations

[0168]

[0169] (2) The amplification conditions are as follows: (amplification time is 58 min).

[0170] Table 6-2: Amplification conditions

[0171]

[0172] (3) The detection results are shown in Tables 6-3, 6-4, 6-5, and 6-6:

[0173] Table 6-3: Detection results-CT

[0174]

[0175] Table 6-4: Detection results-NG

[0176]

[0177] Table 6-5: Detection results-MG

[0178]

[0179] Table 6-6: Detection results-IC

[0180]

[0181] (4) Conclusion: The results show that for CT, compared with the other five primer probe combinations, only combination 2 has a significantly delayed Ct value and a decreased Rn value, and is seriously interfered by the primer probe sequences of NG, MG and IC. The other combinations have no significant difference in the double-section primer probe combination of CT, and the detection effect is basically not affected by the primer probe sequences of the other target genes compared with the single system of CT-O and CT-P. Therefore, the optimal primer probe combination of the double-section of CT in the multiplex system is F4cR3P1+Fb2Rb2Pb1.

[0182] For NG, compared with the single system of NG, the Ct values of combinations 3 and 2 in the multiplex system are significantly delayed, the Rn values decrease, and the detection effect is poor, indicating that NG is easily interfered by the primer probe sequences of CT, MG and IC. Since the detection effects of combinations 1, 4, 5 and 6 are basically the same, the optimal primer probe combination of NG in the multiplex system is F1R2P2.

[0183] For MG, compared with the single system of MG, only combination 5 in the multiplex system has little difference in detection effect, and is basically not affected by the primer probe sequences of CT, NG and IC. Combination 4 is the second, and the Ct values of combinations 1, 2, 3 and 6 are all delayed, the Rn values decrease, and the detection effect is poor, indicating that the optimal primer probe for single detection of MG is not necessarily optimal in the multiplex system. Therefore, the optimal primer probe combination of MG in the multiplex system is F3R2P1.

[0184] For IC, compared with the single system of IC, only combination 6 in the multiplex system has a significantly delayed Ct value and fails to detect 20 copies / reaction, and is greatly affected by the primer probe sequences of CT, NG and MG. The detection effects of the other combinations have little difference, and therefore the optimal primer probe combination of IC in the multiplex system is F2R2P2.

[0185] Preferably, the primer probe combination for simultaneously detecting Chlamydia trachomatis, Mycoplasma genitalium, Neisseria gonorrhoeae and the internal reference gene is: CT (F4cR3P1+Fb2Rb2Pb1) + NG (F1R2P2) + MG (F3R2P1) + IC (F2R2P2).

[0186] 2. Verification of cross-reaction of multiplex primer probe combination:

[0187] (1) According to the screening results of the multiple target gene primer probe combination, the detection system is prepared, wherein the primer concentration of each target gene is fixed at 0.4 μM, the probe concentration is 0.1 μM, 25 μL per well (the proportion of nucleic acid of the cross strain is 40%) is divided into PCR eight joint tubes, and the real-time fluorescent quantitative PCR instrument is placed for amplification detection; wherein the type and concentration of the cross strain are shown in Table 7-1.

[0188] Table 7-1: Cross strain name and concentration

[0189]

[0190] (2) Amplification conditions: (amplification time is 58 min)

[0191] Table 7-2: Amplification conditions

[0192]

[0193] (3) The detection results are shown in Table 7-3:

[0194] Table 7-3: Detection results

[0195]

[0196] (4) Conclusion: The results show that in the system, the multiple primer probe combination does not appear cross reaction for the above 10 kinds of cross strains (clinical medical level), and the detection of individual strain internal standard is because the strain is expanded in human-derived cells, the sample is not pure, and contains human-derived cells.

[0197] Example 3

[0198] Concentration optimization of multiple primer probe combination:

[0199] 1. CT double-section primer concentration optimization:

[0200] (1) According to Table 8-1, the detection system of CT double-section different primer concentration of “CT (F4cR3P1+Fb2Rb2Pb1) + NG (F1R2P2) + MG (F3R2P1) + IC (F2R2P2)” is prepared, and the primer concentration of the rest NG, MG and internal standard is 0.4 μM, and the probe concentration is 0.1 μM, 25 μL per well (the proportion of template plasmid (CT+NG+MG+internal standard) is 40%) is divided into C7 reaction cups, and the C7 real-time fluorescent quantitative PCR system is placed for amplification detection.

[0201] Table 8-1: Summary table of CT double-section different primer concentrations

[0202]

[0203] (2) The amplification conditions are as follows: (the amplification time is 25 min).

[0204] Table 8-2: Amplification conditions

[0205]

[0206] (3) The detection results are shown in Table 8-3:

[0207] Table 8-3: Detection results

[0208]

[0209] Data analysis: Ct difference = Ct mean (0.2 μM, 0.6 μM, 0.8 μM) - Ct mean (0.4 μM)

[0210] Table 8-4: Data analysis

[0211]

[0212] (4) Conclusion: The results show that under the rapid program, at the concentration of 2000 copies / reaction, there is no significant difference in the Ct value of each target gene of each group compared with the preferred 0.4 μM group (Ct difference ≤ 1). At the concentration of 20 copies / reaction, compared with the preferred 0.4 μM group, the CT-Ct value of the 0.2 μM group is significantly delayed, and the CT-Ct value of the remaining groups has no significant difference (Ct difference ≤ 1); among them, the IC of the 0.8 μM group is seriously delayed, which is suspected to be related to the primer concentration interfering with the amplification of the internal standard. Therefore, when the concentration of the CT double-section primer is 0.4 μM~0.8 μM, the Ct value of CT is small, and 20 copies / reaction can be stably detected. Considering the sensitivity and detection cost, preferably, the concentration of the CT double-section primer is preferably 0.4 μM.

[0213] 2. CT double-section probe concentration optimization:

[0214] (1) Prepare the detection system of CT double-section different probe concentrations according to Table 9-1, and the primer concentrations of the remaining NG, MG and internal standard are all 0.4 μM, and the probe concentrations are all 0.1 μM. 25 μL (nucleic acid ratio is 40%) per hole per group is dispensed into a PCR tube, and placed into a C7 real-time fluorescent quantitative PCR system for amplification detection.

[0215] Table 9-1: Summary table of CT double-section different probe concentrations

[0216]

[0217] (2) The amplification conditions are the same as those of "CT double-section primer concentration optimization".

[0218] (3) The detection results are shown in Table 9-2:

[0219] Table 9-2: Detection results

[0220]

[0221] Data analysis: Ct difference = Ct mean (groups 1, 2, 4, 5) - Ct mean (group 3); Rn difference = Rn mean (groups 1, 2, 4, 5) - Rn mean (group 3).

[0222] Table 9-3: Data analysis

[0223]

[0224] (4) Conclusion: The results show that under the rapid program, at a concentration of 2000, 20 copies / reaction, compared with the preferred group 3, the CT-Ct value of group 1 is significantly delayed, and the CT-Ct values of the other groups have no significant difference (Ct difference ≤1); at the same time, the Ct values of the other target genes (NG, MG, IC) have no significant difference (Ct difference ≤1). At the same time, the CT double-section probe basically increases the Rn value with the increase of the concentration, and considering that it basically has no significant effect on the Rn value of the other target genes, therefore, the optimal concentration of the CT double-section probe is 0.13 μM.

[0225] 3. NG primer concentration optimization:

[0226] (1) Prepare the detection system with different NG primer concentrations according to Table 10-1, wherein the primer concentration of the CT double-section is 0.4 μM and the probe concentration is 0.13 μM; the primer concentration of MG and the internal standard is 0.4 μM and the probe concentration is 0.1 μM; 25 μL (nucleic acid ratio is 40%) per hole per group is dispensed into a PCR tube and placed into a C7 real-time fluorescent quantitative PCR system for amplification detection.

[0227] Table 10-1: Summary of different NG primer concentrations

[0228]

[0229] (2) The amplification conditions are the same as those of "CT double-section primer concentration optimization".

[0230] (3) The detection results are shown in Table 10-2:

[0231] Table 10-2: Detection results

[0232]

[0233] Data analysis: Ct difference = Ct mean (0.4 μΜ, 0.5 μΜ, 0.8 μΜ) - Ct mean (0.6 μΜ); Rn difference = Rn mean (0.4 μΜ, 0.5 μΜ, 0.8 μΜ) - Rn mean (0.6 μΜ).

[0234] Table 10-3: Data analysis

[0235]

[0236] (4) Conclusion: The results show that under the rapid program, at 2000 copies / reaction, 20 copies / reaction concentration, compared with the preferred 0.6 μΜ group, the NG-Ct values of the other groups are not significantly different (Ct difference ≤ 1); at the same time, the Ct values of the other target genes (CT\MG) are not significantly different (Ct difference ≤ 1). But for Rn value, the Rn values of each target gene (CT\NG\MG\IC) of the other groups are reduced. Therefore, when the concentration of NG primer is 0.4 μΜ~0.8 μΜ, the Ct value of NG is not significantly different, and 20 copies / reaction can be stably detected, but the Rn value of the 0.6 μΜ group is higher. Considering sensitivity and detection cost, preferably, the concentration of NG primer is 0.6 μΜ.

[0237] 4. NG probe concentration optimization:

[0238] (1) Prepare the detection system of different NG probe concentrations according to Table 11-1, wherein the primer concentration of CT double segment is 0.4 μΜ, and the probe concentration is 0.13 μΜ; the primer concentration of MG and internal standard is 0.4 μΜ, and the probe concentration is 0.1 μΜ; 25 μL (nucleic acid ratio is 40%) per hole per group is dispensed into a PCR tube, and placed into a C7 real-time fluorescent quantitative PCR system for amplification detection.

[0239] Table 11-1: Summary of different NG probe concentrations

[0240]

[0241] (2) The amplification conditions are the same as those of "CT double segment primer concentration optimization".

[0242] (3) The detection results are shown in Table 11-2:

[0243] Table 11-2: Detection results

[0244]

[0245] Data analysis: Ct difference = Ct mean (0.10 μΜ, 0.12 μΜ, 0.16 μΜ, 0.2 μΜ) - Ct mean (0.14 μΜ); Rn difference = Rn mean (0.10 μΜ, 0.12 μΜ, 0.16 μΜ, 0.2 μΜ) - Rn mean (0.14 μΜ).

[0246] Table 11-3: Data analysis

[0247]

[0248] (4) Conclusion: The results show that under the rapid program, at 2000 copies / reaction, 20 copies / reaction concentration, compared with the preferred 0.14 μΜ group, the NG-Ct values of the other groups are not significantly different (Ct difference ≤ 1); at the same time, the Ct values of the other target genes (CT\MG) are not significantly different (Ct difference ≤ 1). But for Rn value, the Rn values of each target gene (CT\NG\MG\IC) of the other groups are lower, therefore, when the concentration of NG probe is 0.1 μΜ~0.2 μΜ, the Ct value of NG is not significantly different, and 20 copies / reaction can be stably detected, but the Rn value of the 0.14 μΜ group is higher. Considering sensitivity and detection cost, the preferred NG probe concentration is 0.14 μΜ.

[0249] 5, MG primer concentration optimization:

[0250] (1) Prepare the detection system of different MG primer concentrations according to Table 12-1, wherein the primer concentration of CT double section is 0.4 μΜ, and the probe concentration is 0.13 μΜ; the primer concentration of NG is 0.6 μΜ, and the probe concentration is 0.14 μΜ; the primer concentration of internal standard is 0.4 μΜ, and the probe concentration is 0.1 μΜ; 25 μL (nucleic acid ratio is 40%) per hole per group is dispensed into PCR tubes, and placed into C7 real-time fluorescence quantitative PCR system for amplification detection.

[0251] Table 12-1: Summary of different MG primer concentrations

[0252]

[0253] (2) The amplification conditions are the same as those of "CT double section primer concentration optimization".

[0254] (3) The detection results are shown in Table 12-2:

[0255] Table 12-2: Detection results

[0256]

[0257] Data analysis: Ct difference = Ct mean (0.2 μΜ, 0.4 μΜ, 0.8 μΜ) - Ct mean (0.6 μΜ); Rn difference = Rn mean (0.2 μΜ, 0.4 μΜ, 0.8 μΜ) - Rn mean (0.6 μΜ).

[0258] Table 12-3: Data analysis

[0259]

[0260] (4) Conclusion: The results show that under the rapid program, at the concentration of 2000 copies / reaction, 20 copies / reaction, compared with the preferred 0.6 μΜ group, the MG-Ct value of the 0.2 μΜ group is significantly delayed, and the MG-Ct values of the other groups have no significant difference (Ct difference <1); At the same time, the Ct values of the other target genes (CT\NG\IC) have no significant difference (Ct difference <1). However, for Rn value, it basically increases with the increase of primer concentration MG-Rn value. Therefore, when the concentration of MG primer is 0.4 μΜ~0.8 μΜ, the Ct value of MG has no significant difference, and 20 copies / reaction can be stably detected, but the Rn value of the 0.6 μΜ group is higher. Considering sensitivity and detection cost, the preferred concentration of MG primer is 0.6 μΜ.

[0261] 6, MG probe concentration optimization:

[0262] (1) Prepare the detection system of different probe concentrations of MG according to Table 13-1, in which the primer concentration of CT double segment is 0.4 μΜ, and the probe concentration is 0.13 μΜ; The primer concentration of NG is 0.6 μΜ, and the probe is 0.14 μΜ; The primer concentration of the internal standard is 0.4 μΜ, and the probe concentration is 0.1 μΜ; 25 μL (nucleic acid ratio is 40%) per hole per group is dispensed into PCR tubes, and placed into C7 real-time fluorescence quantitative PCR system for amplification detection.

[0263] Table 13-1: Summary of different primer concentrations of MG

[0264]

[0265] (2) The amplification conditions are the same as those of "CT double segment primer concentration optimization".

[0266] (3) The detection results are shown in Table 13-2:

[0267] Table 13-2: Detection results

[0268]

[0269] Data analysis: Ct difference = Ct mean (0.2 μM, 0.17 μM, 0.15 μM, 0.10 μM) - Ct mean (0.13 μM); Rn difference = Rn mean (0.2 μM, 0.17 μM, 0.15 μM, 0.10 μM) - Rn mean (0.13 μM).

[0270] Table 13-3: Data analysis

[0271]

[0272] (4) Conclusion: The results show that under the rapid program, at 200 copies / reaction, 20 copies / reaction concentration, compared with the preferred 0.13 μM group, the MG-Ct value of the other groups has little difference (Ct difference ≤ 1), and there is no significant difference between groups; at the same time, except that the IC-Ct value of the 0.2 μM group is significantly delayed (which may be due to the inhibition of the internal standard amplification when the MG probe concentration is 0.2 μM), the Ct values of the other target genes (CT\NG\IC) have no significant difference (Ct difference ≤ 1). As for the Rn value, the Rn value of each target gene in the 0.13 μM group is higher overall.

[0273] Therefore, when the concentration of the MG probe is 0.1 μM-0.17 μM, the Ct value of the MG has no significant difference, and 20 copies / reaction can be stably detected, but the Rn value of each target gene in the 0.13 μM group is higher overall. Considering sensitivity and detection cost comprehensively, the preferred concentration of the MG probe is 0.13 μM.

[0274] 7. Internal standard primer concentration optimization:

[0275] (1) Prepare the detection system with different concentrations of internal standard primers according to Table 14-1, wherein the primer concentration of CT double section is 0.4 μM, and the probe concentration is 0.13 μM; the primer concentration of NG is 0.6 μM, and the probe concentration is 0.14 μM; the primer concentration of MG is 0.6 μM, and the probe concentration is 0.13 μM; 25 μL (nucleic acid ratio 40%) per hole per group is dispensed into a PCR tube, and placed into a C7 real-time fluorescence quantitative PCR system for amplification detection.

[0276] Table 14-1: Summary of IC different primer concentrations

[0277]

[0278] (2) The amplification conditions are the same as those of "CT double section primer concentration optimization".

[0279] (3) The detection results are shown in Table 14-2:

[0280] Table 14-2: Detection results

[0281]

[0282] Data analysis: Ct difference = Ct mean (0.2 μΜ, 0.6 μΜ, 0.8 μΜ) - Ct mean (0.4 μΜ); Rn difference = Rn mean (0.2 μΜ, 0.6 μΜ, 0.8 μΜ) - Rn mean (0.4 μΜ).

[0283] Table 14-3: Data analysis

[0284]

[0285] (4) Conclusion: The results show that under the rapid program, at the concentration of 200 copies / reaction, there is no significant difference in IC-Ct value (Ct difference ≤ 1) between the preferred 0.4 μΜ group and the other groups, and there is no significant difference in Ct value (Ct difference ≤ 1) among the other target genes (CT\NG\MG). At the concentration of 20 copies / reaction, compared with the 0.4 μΜ group, the IC-Ct value of the 0.6 μΜ group has no significant difference, except that the IC-Ct value of the 0.2 μΜ group and the 0.8 μΜ group is significantly delayed. For Rn value, the Rn value of CT is reduced, which is suspected to be related to the increase of the concentration of the internal standard primer. Preferably, the IC primer concentration is 0.4 μΜ.

[0286] 8. Internal standard probe concentration optimization

[0287] (1) Prepare the detection system with different IC probe concentrations according to Table 15-1, wherein the primer concentration of CT double segment is 0.4 μΜ, the probe concentration is 0.13 μΜ; the primer concentration of NG is 0.6 μΜ, the probe concentration is 0.14 μΜ; the primer concentration of MG is 0.6 μΜ, the probe concentration is 0.13 μΜ, 25 μL (nucleic acid ratio is 40%) per hole per group is dispensed into PCR tubes, and placed into C7 real-time fluorescent quantitative PCR system for amplification detection.

[0288] Table 15-1: Summary of IC different probe concentrations

[0289]

[0290] (2) The amplification conditions are the same as those of "CT double segment primer concentration optimization".

[0291] (3) The detection results are shown in Table 15-2:

[0292] Table 15-2: Detection results

[0293]

[0294] Data analysis: Ct difference = Ct mean (0.10 μΜ, 0.14 μΜ, 0.16 μΜ, 0.2 μΜ) - Ct mean (0.12 μΜ); Rn difference = Rn mean (0.10 μΜ, 0.14 μΜ, 0.16 μΜ, 0.2 μΜ) - Rn mean (0.12 μΜ).

[0295] Table 15-3: Data analysis

[0296]

[0297] (4) Conclusion: The results show that under the rapid program, at the concentration of 2000 copies / reaction, there is no significant difference in IC-Ct value (Ct difference ≤ 1) between each group and the preferred 0.12 μΜ group; at the concentration of 20 copies / reaction, the IC-Ct value of each group is pushed back; and the Rn value is not much different from the rest of the group, and all can stably detect 20 copies / reaction. Considering the preparation stability and detection cost, the preferred IC probe concentration is 0.12 μΜ.

[0298] 9. Multiplex combination primer probe concentration verification:

[0299] (1) According to the optimized primer probe concentration of each target gene, the detection system in Table 16-1 is prepared, 25 μL (nucleic acid ratio of 40%) per group per well is dispensed into PCR tubes, and C7 real-time fluorescence quantitative PCR system is used for amplification detection.

[0300] Table 16-1: Primer probe concentration combination table of each target gene

[0301]

[0302] (2) The amplification conditions are the same as those of "CT double section primer concentration optimization".

[0303] (3) The detection results are shown in Table 16-2:

[0304] Table 16-2: Detection results

[0305]

[0306] Data analysis: Ct difference = Ct mean (0.10 μΜ, 0.14 μΜ, 0.16 μΜ, 0.2 μΜ) - Ct mean (0.12 μΜ); Rn difference = Rn mean (0.10 μΜ, 0.14 μΜ, 0.16 μΜ, 0.2 μΜ) - Rn mean (0.12 μΜ).

[0307] Table 16-3: Data analysis

[0308]

[0309] (4) Conclusion:

[0310] The results show that under the rapid program, at the concentration of 2000 copies per reaction, the Ct values of each target gene of each group have no significant difference (Ct difference ≤1) compared with the preferred group 5, and Ct difference > 0; at the concentration of 20 copies per reaction, the Ct values of each group have no significant difference (Ct difference ≤1) for CT and NG, but for MG and IC, the Ct values of each group have no significant difference (Ct difference ≤1) except that the MG-Ct value and IC-Ct value of group 1 are slightly pushed back. The detection results are consistent with the previous single concentration trend, preferably, the primer probe concentrations of each target gene are CT double section (0.4 μM+0.13 μM), NG (0.6 μM+0.14 μM), MG (0.6 μM+0.13 μM) and IC (0.4 μM+0.12 μM) respectively.

[0311] The nucleic acid detection kit (PCR+flow hybridization method) for pathogen of reproductive tract infection registered with the certificate number of Guojishengzhun 20203400067 has the defects of low sensitivity, high cost and complicated operation due to a large number of detection numbers, and the detection lower limit is 1.0E+04 copies / mL. For example, the kit registered with the certificate numbers of Guojishengzhun 20183401646 and 20183401648 uses RNA isothermal amplification technology to detect Chlamydia trachomatis and Neisseria gonorrhoeae, and the detection lower limit of CT and NG is 1000 copies per reaction, and the kit registered with the certificate number of Guojishengzhun 20173404323 uses RNA isothermal amplification technology to detect Mycoplasma genitalium, and the detection lower limit is 10 3 copies per reaction. For example, the kit registered with the certificate number of Guojishengzhun 20193400148 uses fluorescence quantitative PCR technology to jointly detect Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum, and the detection lower limit is 400 copies / mL. In this embodiment, the detection lower limit of the reagent for MG, CT and NG is 20 copies per reaction and 200 copies / mL, which is much lower than the above several reagents.

[0312] After repeated screening, the primer probe combination for detecting Chlamydia trachomatis, Mycoplasma genitalium, Neisseria gonorrhoeae and the internal reference gene preferred by the application can specifically detect the corresponding target gene, and there is basically no obvious cross interference between the target genes. After optimizing the primer probe concentration, the whole amplification time can be shortened from 58 min to 25 min by using the rapid equipment and the rapid reaction system, and the detection sensitivity is higher, and the detection lower limit is 20 copies per reaction and 200 copies / mL.

[0313] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer probe composition characterized in that, The chlamydia trachomatis primer probe pair, the gonococcus primer probe pair and the mycoplasma genitalium primer probe pair are included. The chlamydia trachomatis primer probe pair includes: a forward CT primer 1 with a nucleotide sequence as shown in SEQ ID NO: 1, and a reverse CT primer 1 with a nucleotide sequence as shown in SEQ ID NO: 2; a forward CT primer 2 with a nucleotide sequence as shown in SEQ ID NO: 3, and a reverse CT primer 2 with a nucleotide sequence as shown in SEQ ID NO: 4; a CT probe 1 with a nucleotide sequence as shown in SEQ ID NO: 5, and a CT probe 2 with a nucleotide sequence as shown in SEQ ID NO: 6; The gonococcus primer probe pair includes: a forward NG primer with a nucleotide sequence as shown in SEQ ID NO: 7, and a reverse NG primer with a nucleotide sequence as shown in SEQ ID NO: 8; a NG probe with a nucleotide sequence as shown in SEQ ID NO: 9; The mycoplasma genitalium primer probe pair includes: a forward MG primer with a nucleotide sequence as shown in SEQ ID NO: 10, and a reverse MG primer with a nucleotide sequence as shown in SEQ ID NO: 11; a MG probe with a nucleotide sequence as shown in SEQ ID NO: 12; The CT probe 1, the CT probe 2, the NG probe and the MG probe are labeled with a luminescent label and a quenching label.

2. The primer probe composition of claim 1, wherein The working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are independently 0.4-0.6 μM respectively; The working concentrations of the CT probe 1 and the CT probe 2 are independently 0.1-0.2 μM respectively; The working concentrations of the forward NG primer and the reverse NG primer are independently 0.4-0.8 μM respectively; The working concentration of the NG probe is 0.1-0.2 μM; The working concentrations of the forward MG primer and the reverse MG primer are independently 0.4-0.8 μM respectively; The working concentration of the MG probe is 0.1-0.17 μM.

3. The primer probe composition of claim 2, wherein The working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are independently 0.4 μM respectively; The working concentrations of the CT probe 1 and the CT probe 2 are independently 0.13 μM respectively; The working concentrations of the forward NG primer and the reverse NG primer are independently 0.6 μM respectively; The working concentration of the NG probe is 0.14 μM; The working concentrations of the forward MG primer and the reverse MG primer are independently 0.6 μM respectively; The working concentration of the MG probe is 0.13 μM.

4. The primer probe composition of claim 1, wherein, The internal reference primer probe pair is also included.

5. The primer probe composition according to claim 4, characterized in that, The internal reference primer probe pair includes: a forward IC primer with a nucleotide sequence as shown in SEQ ID NO: 13, a reverse IC primer with a nucleotide sequence as shown in SEQ ID NO: 14; and an IC probe with a nucleotide sequence as shown in SEQ ID NO: 15; the IC probe is labeled with a luminescent label and a quenching label.

6. The primer probe composition of claim 5, wherein, The working concentrations of the forward IC primer and the reverse IC primer are independently 0.4-0.6 μM respectively; The working concentration of the IC probe is 0.1-0.14 μM.

7. The primer probe composition of claim 6, wherein, The working concentrations of the forward IC primer and the reverse IC primer are independently 0.4 μM; The working concentration of the IC probe is 0.12 μM.

8. The primer probe composition of claim 6, wherein, The working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are 0.4-0.6 μM, and the working concentrations of the CT probe 1 and the CT probe 2 are 0.1-0.2 μM; the working concentrations of the forward NG primer and the reverse NG primer are 0.4-0.8 μM, and the working concentration of the NG probe is 0.1-0.2 μM; the working concentrations of the forward MG primer and the reverse MG primer are 0.4-0.8 μM, and the working concentration of the MG probe is 0.1-0.17 μM; the working concentrations of the forward IC primer and the reverse IC primer are 0.4-0.6 μM, and the working concentration of the IC probe is 0.1-0.14 μM.

9. The primer probe composition of claim 8, wherein, The working concentrations of the forward CT primer 1, the reverse CT primer 1, the forward CT primer 2 and the reverse CT primer 2 are 0.4 μM, and the working concentrations of the CT probe 1 and the CT probe 2 are 0.13 μM; the working concentrations of the forward NG primer and the reverse NG primer are 0.6 μM, and the working concentration of the NG probe is 0.14 μM; the working concentrations of the forward MG primer and the reverse MG primer are 0.6 μM, and the working concentration of the MG probe is 0.13 μM; The working concentrations of the forward IC primer and the reverse IC primer are 0.4 μM, and the working concentration of the IC probe is 0.12 μM.

10. The primer probe composition according to any one of claims 1 to 9, characterized in that, The luminescent markers of the probe markers of different primer probe pairs are different from each other.

11. The primer probe composition according to claim 10, characterized in that, The luminescent markers are selected from quantum dots, FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or Cy5; The quenching markers are selected from BHQ1, BHQ2, BHQ3 or MGB.

12. The primer probe composition of claim 10, wherein The CT probe 1 and the CT probe 2 are labeled with FAM and BHQ1; The NG probe is labeled with VIC and BHQ1; the MG probe is labeled with CY5 and BHQ3; the NG probe is labeled with ROX and BHQ2.

13. The primer probe composition of any one of claims 1-12 is used for the preparation of a urogenital tract pathogen detection kit, or the detection of urogenital tract pathogens for non-diagnostic and therapeutic purposes; the urogenital tract pathogens include Chlamydia trachomatis, Neisseria gonorrhoeae and Mycoplasma genitalium.

14. A urogenital tract pathogen detection kit characterized in that, The urogenital tract pathogens include Chlamydia trachomatis, Neisseria gonorrhoeae and Mycoplasma genitalium, and the kit comprises the primer probe composition for the detection of urogenital tract pathogens according to any one of claims 1-12.

15. The kit of claim 14, wherein It further comprises one or more of enzymes, buffers, metal ions, dNTPs and positive controls.

16. The kit of claim 15, wherein The enzymes include Taq enzyme and UNG enzyme; The buffer is Tris-HCl; The metal ions include K + and Mg 2+ .

17. The kit of claim 16, wherein The kit further comprises a premix solution comprising Taq enzyme, UNG enzyme, Tris-HCl buffer, K + and Mg 2+ ; the working concentration of each substance is respectively: Taq enzyme: 4 U / reaction; UNG enzyme: 0.2 U / reaction; Tris-HCl buffer; KCl: 50 mM; Mg 2+ : 5 mM; and, dNTPs: 0.3 mM.

18. The kit of claim 17, wherein The premix solution further contains the primer probe composition.

19. The kit of claim 15, wherein The positive controls include template plasmids, and the template plasmids include CT-o region plasmid, CT-p region plasmid, NG plasmid, MG plasmid and internal standard plasmid; The positive controls include template plasmids, and the template plasmids include CT-o region plasmid, CT-p region plasmid, NG plasmid, MG plasmid and internal standard plasmid; The template plasmid takes PUC57 as a backbone plasmid, the CT-o region plasmid contains a fragment with a sequence as shown in SEQ ID NO: 16, the CT-p region plasmid contains a fragment with a sequence as shown in SEQ ID NO: 17, the NG plasmid contains a fragment with a sequence as shown in SEQ ID NO: 18, the MG plasmid contains a fragment with a sequence as shown in SEQ ID NO: 19, and the internal standard plasmid contains a fragment with a sequence as shown in SEQ ID NO:

20.

20. A method for detecting a pathogen of the urogenital tract for non-diagnostic and therapeutic purposes, characterized in that, The urogenital tract pathogens include chlamydia trachomatis, gonococcus and mycoplasma genitalium; PCR detection is performed on a sample to be tested using the primer probe composition according to any one of claims 1-12, or the kit according to any one of claims 14-19.

Citation Information

Patent Citations

  • Gonococcus, treponema pallidum, chlamydia trachomatis and ureaplasma urealyticum hybrid membrane strip and detection kit

    CN106701983A

  • Kit and method for synchronously detecting multiple genital tract pathogens

    CN113444821A

Cited By

  • A primer probe combination for simultaneously detecting multiple genital tract pathogens, a kit and application thereof

    CN122588260A