Scalable circuit for molecular detection

Abstract

In one aspect, the disclosed technology relates to systems and methods for sequencing polynucleotides. In one embodiment, the disclosed technology relates to a nanopore sensor device for identifying nucleotides, the nanopore sensor device comprising: one or more cis pores; one or more cis electrodes, the one or more cis electrodes being associated with the one or more cis pores; a plurality of trans pores, each trans pore of the plurality of trans pores being separated from the one or more cis pores by a lipid or solid state membrane having a nanopore; a plurality of field effect transistors (FETs), each FET of the plurality of FETs being associated with a trans pore of the plurality of trans pores; a power source, the power source being configured to provide an alternating current (AC) input between the one or more cis electrodes and a source terminal of the plurality of FETs; and a controller, the controller being operably coupled to the plurality of FETs, the controller being configured to measure an AC response of the plurality of FETs, wherein the AC response is dependent on an identity of a nucleotide within or near the nanopore.

Description

[0001] Cross Reference to Related Applications

[0002] This application claims priority to U.S. Provisional Application No. 63 / 169,041, filed March 31, 2021, the contents of which are incorporated herein by reference in their entirety. BACKGROUND

[0003] Some polynucleotide sequencing technologies involve performing a large number of controlled reactions on a support surface or within a predetermined reaction chamber. The controlled reactions can then be observed or detected, and subsequent analysis can help identify characteristics of the polynucleotides involved in the reactions. Examples of such sequencing technologies include next-generation or massively parallel sequencing involving sequencing-by-ligation, sequencing-by-synthesis, reversible terminator chemistry, or pyrophosphate sequencing methods.

[0004] Some polynucleotide sequencing technologies utilize a nanopore, which can provide a pathway for ionic current. For example, as a polynucleotide traverses a nanopore, the nanopore affects the current passing through the nanopore. Each passing nucleotide or series of nucleotides through the nanopore produces a characteristic current. These characteristic currents of traversing polynucleotides can be recorded to determine the sequence of the polynucleotide.

[0005] However, prior art nanopore sequencing technologies can suffer from several issues. For example, electrochemical DC current readings of a nanopore are not scalable to small trans-pore volumes. Further, small currents through the pore facilitate large amplifiers. Additionally, large double layer capacitance makes switching readings difficult. Furthermore, there are large resistor-capacitor (RC) transients when the double layer is charged or discharged. Prior methods can apply a direct current (DC) or square wave input, which requires waiting for the transient electrical response to decay before reading out the steady state signal. Thus, measuring the ionic current of prior nanopores can erroneously measure the RC transients. SUMMARY

[0006] Systems for sequencing biopolymers and methods of using these systems are provided in examples herein.

[0007] In one aspect, disclosed herein is a nanopore sensor device for identifying a nucleotide. The device can include one or more cis pores; one or more cis electrodes associated with the one or more cis pores; a plurality of trans pores, each of the plurality of trans pores separated from the one or more cis pores by a lipid or solid state membrane having a nanopore; a plurality of field effect transistors (FETs), each of the plurality of FETs associated with one of the plurality of trans pores; a power source configured to provide an alternating current (AC) input between the one or more cis electrodes and the source terminal of the plurality of FETs; and a controller operably coupled to the plurality of FETs, the controller configured to measure an AC response of the plurality of FETs, wherein the AC response is dependent on an identity of the nucleotide within or near the nanopore. In some embodiments, the controller is configured to measure a change in amplitude of the AC response. In some embodiments, the controller is configured to measure a change in waveform shape of the AC response. In some embodiments, the power source is configured to provide an AC voltage in a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform alternating between a positive potential and a negative potential. In some embodiments, the ionic flux through the nanopore is modulated by a nucleotide passing through the nanopore, a label on a nucleotide incorporated into a polynucleotide, or any combination thereof.

[0008] In one aspect, disclosed herein is a method of identifying a nucleotide. The method can include providing a nanopore within a membrane separating a cis pore and a trans pore; providing an AC input from a power source operably coupled to a cis electrode in the cis pore and to a source terminal of a FET in the trans pore; and measuring an AC response from the FET, wherein the AC response is dependent on an identity of a nucleotide within or near the nanopore. In some embodiments, measuring the AC response includes measuring a change in amplitude of the AC response. In some embodiments, measuring the AC response includes measuring a change in waveform of the AC response. In some embodiments, providing the AC input includes providing an AC voltage in a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform alternating between a positive potential and a negative potential. In some embodiments, measuring the AC response includes measuring a first response associated with a first nucleotide and a second response associated with a second nucleotide without waiting for a transient response to approach a steady state response.

[0009] In one aspect, disclosed herein is a sensor device for identifying a nucleotide. The device can include an electrode; a FET; a partially double-stranded nucleic acid polymer, one end of which is operably coupled to the electrode and the other end of which is operably coupled to a gate terminal of the FET; a power source configured to provide an AC input between the electrode and a source terminal of the FET; and a controller operably coupled to the FET, the controller configured to measure an AC response of the FET, wherein the AC response is dependent on an identity of a nucleotide that interacts with the partially double-stranded nucleic acid polymer. In some embodiments, the controller is configured to measure a change in amplitude of the AC response. In some embodiments, the controller is configured to measure a change in waveform shape of the AC response. In some embodiments, the power source is configured to provide an AC voltage in a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform alternating between a positive potential and a negative potential. In some embodiments, the electrical conduction through the partially double-stranded nucleic acid polymer is modulated by a nucleic acid label on a nucleotide incorporated into the polynucleotide, the nucleic acid label being partially complementary to the partially double-stranded nucleic acid polymer.

[0010] The systems, devices, kits, and methods disclosed herein each have several aspects, no single one of which is solely responsible for its desirable attributes. Without intending to limit the scope of the claims, some prominent features will now be discussed briefly. Numerous other features, aspects, and advantages of the systems, devices, kits, and methods will become apparent from the following discussion, the accompanying drawings, and the claims.

[0011] It should be appreciated that any of the features of the devices and / or arrays disclosed herein can be combined together in any desired manner and / or configuration. Further, it should be appreciated that any of the features of the methods of using the devices can be combined together in any desired manner. Moreover, it should be appreciated that any combination of features of the methods and / or devices and / or arrays can be used together, and / or can be combined with any of the examples disclosed herein. Additionally, it should be appreciated that any feature or combination of features of any of the devices and / or arrays and / or any method can be combined together in any desired manner, and / or can be combined with any of the examples disclosed herein.

[0012] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are enabled by the technology described herein) are contemplated as being part of the inventive subject matter disclosed herein and can be used as such. For a composite of two more specific implementations, exemplary combinations can include a combination of features of the two implementations where each individual feature is not claimed below. BRIEF DESCRIPTION OF DRAWINGS

[0013] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, of which like reference numerals are used to refer to like features throughout. For the sake of brevity, features that are described in relation to one embodiment can be incorporated into the other embodiments, whether or not they are specifically described in relation to those other embodiments.

[0014] Figure 1A , Figure 1B , Figure 1C and Figure 1D schematically illustrate embodiments including nanopores.

[0015] Figure 1E schematically illustrates an example of a solid-state nanopore.

[0016] Figure 2A , Figure 2B , Figure 2C , Figure 2D , Figure 2E and Figure 2F schematically illustrate embodiments including tethers anchored near a biological nanopore.

[0017] Figure 3A , Figure 3B and Figure 3C schematically illustrate embodiments including nanopores formed with ionophores.

[0018] Figure 4 is a schematic of an example of a sensing system including a molecular bridge sensor.

[0019] Figure 5 is a schematic of another example of a molecular bridge sensing system.

[0020] Figure 6 schematically illustrates embodiments including nanopores and AC power sources.

[0021] Figure 7 schematically illustrates embodiments including molecular bridges and AC power sources.

[0022] Figure 8 shows an equivalent circuit for an embodiment of Figure 7 .

[0023] Figure 9 shows an equivalent circuit for an embodiment of Figure 6 .

[0024] Figure 10 The response of the circuit shown in Figure 9

[0025] Figure 11A Figure 11B Figure 11C The response of the circuit shown in Figure 9

[0026] Figure 12A Figure 12B Figure 12C The signal-to-noise ratio of the response of the circuit shown in Figure 9

[0027] Figure 13 The circuit response in different scenarios related to Figure 9

[0028] Figure 14A The signal-to-noise ratio of the response of the circuit shown in Figure 14B Figure 8

[0029] Figure 15A Figure 15B Exemplary AC response waveforms are shown in DETAILED DESCRIPTION

[0030] All patents, applications, published applications and other publications referred to herein are hereby incorporated by reference in their entirety. In the event that any inconsistency or conflict is sensed by a person having ordinary skill in the art to exist between a term or phrase used herein and a definition assigned to that term or phrase in a patent, application, published application or other publication incorporated herein by reference, the definition assigned to the term or phrase in this document shall control.

[0031] Brief Description

[0032] The disclosed technology relates to systems and methods for sequencing a biopolymer (e.g., DNA, RNA, polypeptide, or protein) by identifying monomers (e.g., nucleotides or amino acids) based on an alternating current (AC) electrical response. Each specific type of monomer or, alternatively, its unique marker or barcode, can act as part of a resistor in an equivalent circuit of the disclosed system. When an AC input (e.g., a sinusoidal wave current or voltage) is applied to the system, the electrical response of the system can be a function of the resistance, which depends on the identity of the monomer and the identity of the capacitance in the system. The capacitance in the system can be associated with a membrane or a transistor in the system. The phase, amplitude, or waveform of the AC electrical response can be read out (e.g., by a transistor) to determine the sequence of the biopolymer.

[0033] ​​​​​​​​​​​In certain embodiments, the use of AC input in the disclosed technology eliminates the need for waiting due to RC transient delays, and thus can allow for faster readout and / or more accurate readout. In certain embodiments, the measurement sensitivity increases when the frequency of the AC input is tailored to the electrical characteristics of the disclosed system. Additionally, biological polymers tend to be dissolved in electrolyte or buffer solutions, and it can be beneficial to have non-faradaic processes in the disclosed system without a net electrochemical reaction. In certain embodiments, working in AC mode and without a net electrochemical reaction can enable less buffer consumption, smaller sequencing cell devices, and / or more scalable overall sequencing cell devices. In certain embodiments, the AC readout method provides scalable, electrochemistry-free, and / or high-bandwidth application of nanopore sequencing.

[0034] In non-faradaic conduction, no chemical reaction (reduction or oxidation of chemical species) occurs at the surface of the metal electrode. Changing the potential on the electrical double layer (which behaves like a capacitor) between the metal electrode and the electrolyte drives a flow of ions. For non-faradaic conduction, the metal electrode can be made of a metal that is resistant to corrosion and oxidation (e.g., titanium or a noble metal such as platinum or gold). Despite the lack of chemical interaction between the electrode and the electrolyte, in response to the applied potential, there is a transient physical displacement of ions in the electrolyte due to the growth and contraction of an ion depletion zone at the metal-liquid interface. This ion depletion zone is referred to in electrochemistry as the “electrical double layer.” Using an electrical engineering model, in the form of a parallel plate capacitor where the metal is one plate, the depletion zone is the dielectric, and the diffusive distribution of ions in the liquid is the other plate.

[0035] Operation of the Sequencing Device

[0036] The operating principles of systems and methods for identifying organic molecules based on electrical responses are described herein. In one embodiment, such a system can include a flow chamber containing a liquid, one or more electrodes, one or more structures with capacitance, and a transistor. A molecule of interest can be dissolved in the liquid. Furthermore, the molecule of interest can act as part of a resistor in the equivalent circuit of the system, where the resistance can be a function of the identity of the molecule of interest. The one or more structures with capacitance can be connected in series or in parallel with the resistor. In some cases, the transistor itself can have a capacitance that cannot be neglected in the equivalent circuit. An alternating current or voltage can be applied to the system, and the electrical response of the system can be a function of the identity of the molecule of interest. The phase, amplitude, or waveform of the electrical response can be read out by the transistor and used to determine the identity of the molecule of interest. In some cases, the molecule of interest can be a different nucleotide or amino acid. In some cases, the liquid can be an electrolyte / buffer solution. In some embodiments, multiple such systems (or multiple nanopore sequencing devices) can be arranged in an array and individually accessed by a logic circuit. For example, one selector device can be used to control each column in the array, and one amplifier can be used to read out each row in the array. In some cases, each system in the array does not need its own amplifier, and thus such an array can be more scalable. In some embodiments, the biological polymers in the respective nanopore sequencing devices can be controlled or actuated substantially simultaneously. In some embodiments, the biological polymers in the respective nanopore sequencing devices can be detected or sequenced substantially simultaneously.

[0037] In an example where multiple nanopore sequencing devices form an array on a substrate, each nanopore sequencing device in the array of multiple nanopore sequencing devices can share a common cis electrode and a common trans electrode. In another example, each nanopore sequencing device in the array of multiple nanopore sequencing devices shares a common cis electrode but has a different trans electrode. In yet another example, each nanopore sequencing device in the array of multiple nanopore sequencing devices has a different cis electrode and a different trans electrode. In yet another example, each nanopore sequencing device in the array of multiple nanopore sequencing devices has a different cis electrode and shares a common trans electrode.

[0038] In a substrate having an array of nanopore sequencing devices, there can be one common cis-pore and one common trans-pore in communication with some or all of the nanopore sequencing devices within the array on the substrate. However, it will be appreciated that an array of nanopore devices can also include several cis-pores that are fluidically isolated from one another and fluidically connected to a respective one or more trans-pores that are fluidically isolated from one another and defined in the substrate. For example, multiple cis-pores can be needed in order to enable the measurement of multiple polynucleotides on a single substrate. In some embodiments, a substrate having an array of nanopore sequencing devices includes one common cis-electrode, one common trans-electrode, one common cis-pore, one common trans-pore, and a plurality of nanopore sequencing devices,

[0039] In other embodiments, a substrate having an array of nanopore sequencing devices includes one common cis-pore, a plurality of trans-pores, and a plurality of nanopore sequencing devices, where each nanopore sequencing device can be individually accessible with an individual trans-electrode. In other embodiments, a substrate having an array of nanopore sequencing devices includes a plurality of cis-pores, a plurality of trans-pores, and a plurality of nanopore sequencing devices, where each nanopore sequencing device can be individually accessible with an individual trans-electrode. In some examples, the cis-pore can be in contact with the nanopore array and thus capable of maintaining electrolyte in contact with each nanopore in the array.

[0040] A substrate including an array of nanopore sequencing devices can have many different layouts of nanoscale openings on the array, including regular, repeating, and irregular patterns of nanoscale openings. In one example, nanoscale openings can be disposed in a hexagonal grid for close packing and improved device density. Other array layouts can include, for example, linear (i.e., rectangular) layouts, triangular layouts, and the like. As an example, a layout or pattern can be an x-y format of nanoscale openings in rows and columns. In some other examples, a layout or pattern can be a repeating arrangement of nanoscale openings. In yet other examples, a layout or pattern can be a random arrangement of nanoscale openings. A pattern can include dots, pillars, bars, spirals, lines, triangles, rectangles, circles, arcs, checks, lattices, diagonals, arrows, squares, and / or crosshatches.

[0041] A layout of nanoscale openings can be characterized with respect to a density of nanoscale openings (i.e., a number of nanoscale openings in a defined area of a substrate including the array). For example, an array of nanoscale openings can be present at a density of about 10 nanoscale openings / mm 2 to about 1,000,000 nanoscale openings / mm 2 A density can also include, for example, at least about 10 / mm 2 , about 5,000 / mm 2about 10,000 per mm 2 about 1 million per mm 2 about 10,000 per mm 2 about 1 million per mm 2 about 10,000 per mm 2 about 5,000 per mm 2 or less. It will also be appreciated that the density of nanoscale openings in a substrate can be between one of the lower values and one of the upper values selected from the ranges described above.

[0042] The layout of nanoscale openings in an array on a substrate can also be characterized in terms of an average pitch, i.e., the spacing from the center of a nanoscale opening to the center of an adjacent nanoscale opening (center-to-center spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be irregular, in which case the coefficient of variation can be relatively large. In one example, the average pitch can be in a range from about 100 nm to about 500 nm. The average pitch can be, for example, at least about 100 nm, about 5 pm, about 10 pm, about 100 pm, or more. Alternatively or additionally, the average pitch can be, for example, at most about 500 pm, about 100 pm, about 50 pm, about 10 pm, about 5 pm, or less. The average pitch of an exemplary array of devices can be between one of the lower values and one of the upper values selected from the ranges described above. In one example, the pitch (center-to-center spacing) of an array can be about 10 pm. In one example, the pitch (center-to-center spacing) of an array can be about 5 pm. In yet another example, the pitch (center-to-center spacing) of an array can be in a range from about 1 pm to about 10 pm.

[0043] In some examples, the array lifetime is about or above 48 hours, and the typical diameter of the trans-pore is about or above 100 pm.

[0044] Embodiments

[0045] One aspect of the disclosed technology relates to nanopore sequencing of nucleic acids. In one embodiment, the disclosed system includes a nanopore. The disclosed system can include a flow chamber containing an electrolyte, and thus the application of a voltage across the system results in an ionic current through the nanopore. The molecule of interest can be a nucleotide, or equivalently, a unique tag or label of a nucleotide. For example, the tag or label of a nucleotide can be a particular sequence combination of nucleotides. When the molecule of interest is in or near the nanopore, it can result in a unique ionic current blockade at the nanopore, and thus a unique nanopore resistance, depending on the identity of the molecule of interest. In some cases, the nanopore can be a biological nanopore formed from a protein or DNA and deposited in a lipid bilayer. In other cases, the nanopore can be a solid-state nanopore that is directly formed as a nanoscale opening in a membrane (e.g., a silicon-based membrane, a graphene membrane, or a polymer membrane). The nanopore can even be a biological and solid-state hybrid. The lipid bilayer or membrane can act as a capacitor in the equivalent circuit of the system. In some embodiments, the disclosed system can be used to identify amino acids or other biological molecules.

[0046] Figure 6 One embodiment of the disclosed system is shown in FIG. 1. In Figure 6 In FIG. 6, a nanopore sensor device 6000 for identifying nucleotides is shown. The nanopore sensor device 6000 can include one or more cis pores 6002. The nanopore sensor device 6000 can further include one or more cis electrodes associated with the one or more cis pores. The nanopore sensor device 6000 can further include a plurality of trans pores 6006. Each trans pore of the plurality of trans pores can be separated from the one or more cis pores by a lipid or solid-state membrane 6004 having a nanopore 6003. The nanopore sensor device 6000 can further include a plurality of field effect transistors 6005 (FETs), each FET of the plurality of FETs being associated with a trans pore of the plurality of trans pores.

[0047] The nanopore sensor device 6000 can further include a power source 6001 configured to provide an alternating current (AC) input between the one or more cis electrodes and the source terminal of the plurality of FETs. The nanopore sensor device 6000 can further include a controller 6010 operably coupled to the plurality of FETs, the controller 6010 being configured to measure an AC response of the plurality of FETs, wherein the AC response is dependent on an identity of a nucleotide within or near the nanopore. Figure 15A and Figure 15B An illustrative AC response waveform is shown. As Figure 15B shown, changes in the nanopore resistance can result in amplitude and phase modulation of the waveform. In some cases, the controller 6010 is configured to measure changes in the amplitude of the AC response, for example, as inFigure 15B The amplitude can be obtained by comparing the maximum point 151 and the minimum point 152 in the AC response, as shown in the comparison points 153 and 154. For example, the amplitude can be obtained by comparing the maximum point 151 and the minimum point 152 in the AC response, as shown in the comparison points 153 and 154. For example, the amplitude can be obtained by comparing Figure 15B In some cases, the controller 6010 is configured to measure a change in the shape of the waveform of the AC response. In some cases, the power supply is configured to provide an AC voltage in a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform alternating between a positive potential and a negative potential. In some cases, the ionic flux through the nanopore is modulated by a nucleotide passing through the nanopore, a label on a nucleotide being incorporated into a polynucleotide, or any combination thereof. Figure 9 An equivalent circuit of the nanopore sensor device 6000 is shown.

[0048] To determine the identity of the molecule of interest, the disclosed methods can apply an AC voltage on the system and read out the voltage or current response from the transistor. By applying an AC voltage, the system will have a non-Faradaic capacitive response, depending on the identity of the molecule of interest, and the system can not have a net electrochemical reaction. Using an AC voltage can also allow for faster readout. If the AC voltage frequency is around the resonant frequency of the nanopore and the bilayer / membrane, the measurement sensitivity can be increased.

[0049] For example, with reference to Figure 6 A method of identifying a nucleotide can include providing a nanopore 6003 within a membrane 6004 separating a cis pore 6002 and a trans pore 6006. The method of identifying a nucleotide can further include providing an AC input from a power supply 6001 operably coupled to a cis electrode in the cis pore and operably coupled to a source terminal of a FET 6005 in the trans pore. The method of identifying a nucleotide can further include measuring an AC response from the FET, where the AC response depends on the identity of a nucleotide within or near the nanopore 6003.

[0050] In some cases, measuring the AC response includes measuring a change in the amplitude of the AC response. In some cases, measuring the AC response includes measuring a change in the waveform of the AC response. In some cases, providing the AC input includes providing an AC voltage in a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform alternating between a positive potential and a negative potential. In some cases, measuring the AC response includes measuring a first response associated with a first nucleotide and a second response associated with a second nucleotide without waiting for the transient response to approach a steady state response.

[0051] In certain embodiments, Figure 9 The equivalent circuit shown in g is the measured voltage on the FET gate and can be calculated by the following equation where and In Figure 9 , ω represents the frequency of the AC input, R represents the resistance of the nanopore, C BL represents the capacitance of the lipid bilayer, and C F represents the capacitance associated with the FET.

[0052] Figure 10 The response under certain parameters is plotted where and assuming = Cx, the frequency of the AC source or signal as measured by the FET is plotted on the y-axis. The location 101 with the greatest sensitivity to R changes can be found at In other words, location 101 is the resonant frequency of the nanopore and membrane / bilayer in which the signal to the FET is sensitive to changes in pore resistance or at or near the inflection point in the resistivity of the nanopore and membrane / bilayer.

[0053] Figure 11A , Figure 11B and Figure 11C The response under different parameters is plotted and shows that changes in pore resistance (R_pore) result in changes in the resonant frequency of the nanopore and membrane / bilayer. The resonant frequency of the nanopore is sensitive to changes in pore resistance (R_pore). The real part of the circuit response (Re) as measured by the voltage on the gate of the FET is plotted on the y-axis and the imaginary part (Im) is also plotted. The frequency of the AC source or signal as measured by the FET is plotted on the x-axis. In certain embodiments, the resonant frequency of the nanopore and membrane / bilayer can be determined when the real part (Re) is sensitive to changes in the AC voltage frequency or at or near the inflection point. In certain embodiments, the resonant frequency of the nanopore and membrane / bilayer circuit response can be determined from the imaginary part (Im) related to the phase shift, at or near the maximum level.

[0054] In Figure 11A the example, the gate area of the FET is about 1.0 um 2 , the membrane / bilayer area is about 1.0 um 2 , and the gate capacitance density is about 17 ff / um 2 . The resonant frequency of the nanopore and membrane / bilayer shifts higher when the pore resistance is 1.0 GOhm compared to when the pore resistance is 1.5 GOhm.

[0055] In Figure 11B the example, the gate area of the FET is about.25 um 2 , the membrane / bilayer area is about 0.25 um 2 , and the gate capacitance density is about 17 ff / um 2Compared to when the pore resistance is 1.5 GOhm, the resonant frequency shift of the nanopores and the membrane / bilayer is greater when the pore resistance is 1.0 GOhm.

[0056] exist Figure 11C In the example, the gate area of ​​the FET is approximately 3.50 μm. 2 The membrane / bilayer area is approximately 100.00 μm. 2 And the gate capacitance density is approximately 17ff / um. 2 Compared to when the pore resistance is 1.5 GOhm, the resonant frequency shift of the nanopores and the membrane / bilayer is greater when the pore resistance is 1.0 GOhm.

[0057] Figures 11A to 11C The changes in the resonant frequencies of nanopores and membranes / bilayers caused by variations in the resistance of nanopores can be used to detect sequenced bases that alter the resistance of nanopores.

[0058] Figure 12A , Figure 12B and Figure 12C The signal-to-noise ratio (SNR) of the response change relative to the changes in the size and capacitance of the FET gate and / or lipid bilayer is shown. The SNR, as illustrated, is proportional to the derivative of the FET's measured response with respect to the pore resistance (R_pore).

[0059] Figure 13 Examples are shown where the circuit response can be distinguished as having no double layer, having only a double layer, or having both nanopores and a double layer. The y-axis plots the real part (Re) of the circuit response as measured by the voltage across the FET gate, and the imaginary part (Im) is also plotted. The x-axis plots the frequency of the AC source or signal as measured by the FET. In some embodiments, the resonant frequency of the film / double layer with or without nanopores can be determined when the real part (Re) is sensitive to changes in the AC voltage frequency or is at or near an inflection point. In some embodiments, the resonant frequency of the film / double layer with or without nanopores can be determined when the imaginary part (Im) associated with the phase shift is at or near its maximum level.

[0060] In this example, when the orifice resistance (R_orifice) is 0.0GOhm, such as when the membrane / bilayer has been damaged and no longer separates the cis and trans cells, the circuit response typically follows the AC voltage.

[0061] In an example with a pore resistance (R_pore) of 100.0 GOhm, such as when the nanopores have not yet been incorporated into the film / bilayer, the circuit response is sensitive to changes in the AC voltage frequency and is in a resonant state at the AC source frequency of approximately 100 Hz.

[0062] In an example where the pore resistance (R pore) is 1.0 GOhm, such as when a nanopore has been incorporated into the membrane / bilayer, the circuit response is sensitive to changes in the AC voltage frequency, and is in resonance at an AC source frequency of about 10 kHz. In comparison to a membrane / bilayer that is in resonance without a nanopore incorporated, the nanopore and membrane / bilayer resonance is at a higher AC source frequency.

[0063] Point 131 indicates the response at the resonance frequency with both a nanopore and a bilayer. Arrow 132 shows that inserting a nanopore into the membrane / bilayer shifts the resonance frequency to a higher frequency.

[0064] In certain embodiments, the lack of a resonance frequency can be used to determine that the membrane / bilayer is damaged and that a particular trans-pore is defective. In certain embodiments, a relatively lower resonance frequency can be used to determine that a nanopore has not been incorporated into the membrane / bilayer. For example, a new nanopore can be introduced into the membrane / bilayer. In certain embodiments, a relatively higher resonance frequency can be used to determine that a nanopore has been incorporated into the membrane and that a particular trans-pore is functioning normally.

[0065] According to some embodiments, Figures 1A to 1D A composition is schematically shown that includes a tether anchored to or proximal to a nanopore and configured to detect the action of a polymerase on a nucleotide using the tether anchored to or proximal to the nanopore in response to a change in electrical potential across the nanopore. In some cases, the nanopore can be a solid state nanopore, such as Figure 1E is shown.

[0066] Figure 1A The composition shown in FIG. 18 includes: a nanopore 1800 including a first side 1801, a second side 1802, a pore 1803 extending through the first and second sides, and a constriction 1804 disposed between the first and second sides; a permanent tether 1810 including a head region (not specifically labeled) anchored to the first side 1801 of the nanopore 1800, a tail region (not specifically labeled) movable between the first and second sides 1801, 1802 of the nanopore 1800, and an elongate body (not specifically labeled) including a reporter region 1814 and a portion 1815; and a nucleotide 1830 including an elongate tag (not specifically labeled) including a portion 1832 but lacking a reporter region. As Figure 1AAs shown, the interaction between portion 1832 of nucleotide 1830 and portion 1815 of tether 1810 can position reporting region 1814 at a predetermined location relative to portion 1832. Optionally, more than one reporting region can be provided, e.g., at least two, or three, or four, or five, or more than five reporting regions. In addition, portion 1815 can be positioned at any suitable location along the elongate tag, e.g., can be positioned between head region 1811 and reporting region 1814 and adjacent to reporting region 1814, such as shown Figure 1A as shown; or can be adjacent to head region 1811, adjacent to tail region 1812, or between tail region 1812 and reporting region 1814.

[0067] It will be appreciated that the positioning of reporting region 1814 at a predetermined location relative to portion 1832 can be detectable in any suitable manner. For example, the composition can be in operable communication with a measurement circuit. The measurement circuit can be configured to detect the position of reporting region 1814 relative to portion 1832. In one illustrative embodiment, nanopore 1800, tether 1810, polymerase 1850, and nucleotide 1830 can be immersed in a conductive fluid, e.g., a saline solution. The measurement circuit can be in communication with the first and second electrodes, and can be configured to apply a first voltage between those electrodes, so as to apply a voltage across nanopore 1800, as represented by the "+" and "-" signs shown, and to measure the magnitude of the current or flux through aperture 1803 at the first voltage using the electrodes. Reporting region 1814 can have different electrical or flux blocking properties than some or all other regions of the elongate body of the tether (not specifically labeled). For example, reporting region 1814 can include a static charge, while some or all other regions of the elongate body can include a different static charge, or can be uncharged (e.g., can be electrically neutral). Or, for example, reporting region 1814 can be uncharged, while some or all other regions of the elongate body can include a static charge. In one illustrative, non-limiting example, the elongate body of the tether includes a polynucleotide that includes one or more abasic nucleotides that define reporting region 1814. The magnitude of the current or flux through aperture 1803 can be measurably changed in response to the relative position of reporting region 1814 within aperture 1803, and such relative position can be based on the applied voltage and the position of reporting region 1814 relative to portion 1832, which in turn can be based on the action of polymerase 1850 on nucleotide 1830. Figure 1A

[0068] More particularly, the measurement circuit can be further configured to change the voltage applied across nanopore 1800 to a second voltage, e.g., by reversing the applied voltage (such as represented by the reversal of the "+" and "-" signs), such as shown​Figure 1B As shown, such a change in the applied voltage can move the interacting portions 1815, 1832 within the pore 1803 of the nanopore 1800. For example, as shown, a change in the applied voltage can move the interacting portions 1815, 1832 adjacent the constriction 1804, and can set the reporter region 1814 proximal to or within the constriction 1804. The measurement circuit can be configured to measure the magnitude of the current or flux through the pore 1803 at the second voltage using the electrodes. It can be seen that the current or flux at the first voltage is different than the current or flux at the second voltage, and such current or flux can be based on the second voltage and the location of the reporter region 1814 relative to the portion 1832, which in turn can be based on the action of the polymerase 1850 on the nucleotide 1830. Figure 1B As shown, such a change in the applied voltage can move the interacting portions 1815, 1832 adjacent the constriction 1804, and can set the reporter region 1814 proximal to or within the constriction 1804. The measurement circuit can be configured to measure the magnitude of the current or flux through the pore 1803 at the second voltage using the electrodes. It can be seen that the current or flux at the first voltage is different than the current or flux at the second voltage, and such current or flux can be based on the second voltage and the location of the reporter region 1814 relative to the portion 1832, which in turn can be based on the action of the polymerase 1850 on the nucleotide 1830.

[0069] As shown, such a change in the applied voltage can move the interacting portions 1815, 1832 adjacent the constriction 1804, and can set the reporter region 1814 proximal to or within the constriction 1804. The measurement circuit can be configured to measure the magnitude of the current or flux through the pore 1803 at the second voltage using the electrodes. It can be seen that the current or flux at the first voltage is different than the current or flux at the second voltage, and such current or flux can be based on the second voltage and the location of the reporter region 1814 relative to the portion 1832, which in turn can be based on the action of the polymerase 1850 on the nucleotide 1830.

[0070] As shown, such a change in the applied voltage can move the interacting portions 1815, 1832 adjacent the constriction 1804, and can set the reporter region 1814 proximal to or within the constriction 1804. The measurement circuit can be configured to measure the magnitude of the current or flux through the pore 1803 at the second voltage using the electrodes. It can be seen that the current or flux at the first voltage is different than the current or flux at the second voltage, and such current or flux can be based on the second voltage and the location of the reporter region 1814 relative to the portion 1832, which in turn can be based on the action of the polymerase 1850 on the nucleotide 1830. Figure 1C As shown, such a change in the applied voltage can move the interacting portions 1815, 1832 adjacent the constriction 1804, and can set the reporter region 1814 proximal to or within the constriction 1804. The measurement circuit can be configured to measure the magnitude of the current or flux through the pore 1803 at the second voltage using the electrodes. It can be seen that the current or flux at the first voltage is different than the current or flux at the second voltage, and such current or flux can be based on the second voltage and the location of the reporter region 1814 relative to the portion 1832, which in turn can be based on the action of the polymerase 1850 on the nucleotide 1830. Figure 1D As shown, such a change in the applied voltage can move the interacting portions 1815, 1832 adjacent the constriction 1804, and can set the reporter region 1814 proximal to or within the constriction 1804. The measurement circuit can be configured to measure the magnitude of the current or flux through the pore 1803 at the second voltage using the electrodes. It can be seen that the current or flux at the first voltage is different than the current or flux at the second voltage, and such current or flux can be based on the second voltage and the location of the reporter region 1814 relative to the portion 1832, which in turn can be based on the action of the polymerase 1850 on the nucleotide 1830.

[0071] It is noted that in some embodiments, the respective lengths of the tethered elongate body and the elongate tag of the nucleotide, the respective positions of the moiety 1815 and the moiety 1832, and the respective position of the reporter region 1814 are co-selected so as to inhibit the application of force to the nucleotide 1830 when the polymerase 1850 is acting on the nucleotide 1830, and thus to inhibit or exclude such force from modifying the performance of the polymerase. In one illustrative embodiment, the interaction between the moiety 1815 and the moiety 1832 forms a duplex. The length of the tethered elongate body and the position of the moiety 1815 along the elongate body can be co-selected so that the moiety 1815 can extend through the constriction 1804 in response to an appropriately applied voltage, e.g., so as to cause dissociation between the moiety 1815 and the moiety 1832. The length of the elongate tag of the nucleotide and the position of the moiety 1832 along the elongate tag can be co-selected to provide additional slack so that the elongate tag need not be taut in order to position the reporter region 1814 adjacent to the constriction 1804 under a second applied voltage. The size of the duplex 1815, 1832 can inhibit movement of the duplex through the constriction 1804, and can shield the nucleotide from forces that might otherwise be applied to the nucleotide 1830 via the elongate tag 1831. In addition, the relative positions of the reporter region 1814 and the moieties 1815 and 1832 can be co-selected to position the reporter region 1814 at a suitable position relative to the constriction 1804 under the second voltage so as to facilitate detection of the reporter region when the moieties 1815 and 1832 interact with one another. In one exemplary embodiment, the reporter region 1814 is positioned at a suitable position along the elongate body 1831 so as to cause the reporter region to be positioned within or adjacent to the constriction 1804 of the nanopore 1800 when the moieties 1815 and 1832 interact with one another in response to the action of the polymerase 1850.

[0072] According to some embodiments, Figures 2A to 2F A composition is illustratively shown that includes a tether anchored adjacent to a biological nanopore and configured for detecting the action of a polymerase on a first nucleotide using a change in voltage applied across the nanopore.

[0073] More particularly, Figure 2A A composition is shown that includes a nanopore 2200 including a first side 2201, a second side 2202, a pore 2203 extending through the first and second sides, and a constriction 2204 disposed between the first and second sides. Illustratively, the nanopore 2200 can include a biological pore, such as an MspA nanopore (e.g., an M2-NNN MspA mutant), disposed in a barrier, such as a membrane of biological origin (e.g., a lipid bilayer) or a solid state membrane. Figure 2AThe composition shown in FIG. 1A can further include a tether 2210, which includes a head region 2211, a tail region 2212, and an elongated body 2213 disposed therebetween. The head region 2211 is suitably anchored to the polymerase 2250, for example, using any suitable attachment provided herein or otherwise known in the art. The elongated body 2213 of the tether 2210 can include a portion 2214. Illustratively, the elongated body 2213 can comprise a polynucleotide, and a first subset of nucleic acids of the polynucleotide can define the portion 2214. Further, the tail region 2212 can comprise at least one charged atom, such that based on the voltage applied across the nanopore 2200 during step 1, Figure 2A the such voltage generates a first directional force Fl that causes the tail region 2212 to translocate through the pore 2203 and past the constriction 2204, such that a portion of the elongated tail 2213 becomes disposed within the pore 2203 and the tail region becomes disposed outside of the second side 2202 of the nanopore 2200 in a manner such as shown in FIG. 1B. Figure 2B Such directional force Fl also causes the polymerase 2250 to translocate toward the second side 2202 of the nanopore 2200, until the polymerase 2250 rests on or adjacent to the first side 2201 of the nanopore 2200 in a manner such as shown in FIG. 1C, thereby preventing or inhibiting further movement of the polymerase 2250 under the directional force Fl. Note that the polymerase optionally can be partially disposed within the pore 2203 of the nanopore 2200. Figure 2B Such directional force Fl also causes the polymerase 2250 to translocate toward the second side 2202 of the nanopore 2200, until the polymerase 2250 rests on or adjacent to the first side 2201 of the nanopore 2200 in a manner such as shown in FIG. 1C, thereby preventing or inhibiting further movement of the polymerase 2250 under the directional force Fl. Note that the polymerase optionally can be partially disposed within the pore 2203 of the nanopore 2200.

[0074] Figure 2A The composition shown in FIG. 1A can further include a tether 2210, which includes a head region 2211, a tail region 2212, and an elongated body 2213 disposed therebetween. The head region 2211 is suitably anchored to the polymerase 2250, for example, using any suitable attachment provided herein or otherwise known in the art. The elongated body 2213 of the tether 2210 can include a portion 2214. Illustratively, the elongated body 2213 can comprise a polynucleotide, and a first subset of nucleic acids of the polynucleotide can define the portion 2214. Further, the tail region 2212 can comprise at least one charged atom, such that based on the voltage applied across the nanopore 2200 during step 1, Figure 2A The composition shown in FIG. 1A can further include a tether 2210, which includes a head region 2211, a tail region 2212, and an elongated body 2213 disposed therebetween. The head region 2211 is suitably anchored to the polymerase 2250, for example, using any suitable attachment provided herein or otherwise known in the art. The elongated body 2213 of the tether 2210 can include a portion 2214. Illustratively, the elongated body 2213 can comprise a polynucleotide, and a first subset of nucleic acids of the polynucleotide can define the portion 2214. Further, the tail region 2212 can comprise at least one charged atom, such that based on the voltage applied across the nanopore 2200 during step 1, Figure 2B the such voltage generates a first directional force Fl that causes the tail region 2212 to translocate through the pore 2203 and past the constriction 2204, such that a portion of the elongated tail 2213 becomes disposed within the pore 2203 and the tail region becomes disposed outside of the second side 2202 of the nanopore 2200 in a manner such as shown in FIG. 1B. Figure 2A ) during step 1( Figure 2Bunder a continued directional force F1 during step 3 shown in FIG. 3B) the tail region 2212 becomes disposed outside the second side 2202 of the nanopore 2200 and becomes attached to a member 2250', e.g., hybridizes with the member, which is, e.g., a complementary fragment of a DNA ("capture-DNA") that is present adjacent to the second side 2202 (e.g., on the trans side) of the nanopore 2200. The bond between the tail region 2212 and the member 2250' (e.g., hybridization between one or more first nucleic acids of the tail region 2212 and one or more second nucleic acids of the member 2250' to form a duplex 2212, 2250', e.g., a double-stranded DNA) is strong enough such that upon application of an opposite directional force F2 (e.g., reversing the voltage during step 3 shown in FIG. 3B), the duplex inhibits the polymerase from detaching from the nanopore and thus the polymerase remains captured at the nanopore. For example, the duplex 2212, 2250' can comprise a sufficient number of hybridized nucleic acids such that the duplex does not dissociate upon application of the force F2. In addition, the duplex 2212, 2250' can be large enough to inhibit the duplex from moving through the constriction 2204. In addition, in some embodiments, the lateral dimension of the constriction 2204 of the nanopore 2200 is selected such that only a single elongated body 2213 of the single tether 2210 can be disposed through the constriction, thereby ensuring that only one polymerase 2250 becomes captured at the nanopore. Figure 2C

[0075] In particular embodiments, a quality assessment step can be utilized to assess the nanopore or the capture of the polymerase at the nanopore. A nanopore that is correctly embedded in the membrane can produce a characteristic current or flux pattern that is distinguishable from the current or flux pattern produced when the nanopore is not present in the membrane or when the nanopore is not functioning properly. In the event that the quality assessment indicates that the nanopore is not correctly embedded in the membrane, the steps for loading the nanopore can be repeated.

[0076] A polymerase that is correctly captured by the nanopore can also produce a characteristic current or flux pattern. For example, a bias voltage applied to the nanopore that has captured a polymerase via a tether can produce a current or flux pattern indicative of the interaction between the nanopore pore and a signature base in the nucleic acid tether. The bias voltage can be applied in the opposite direction to determine whether the tether has the desired mobility in the nanopore lumen such that the signature base interacts with the pore as predicted. In the event that the quality assessment indicates that the polymerase has not been correctly captured by the nanopore, the polymerase can be stripped, e.g., by applying a strong reverse bias, and the steps for capturing the polymerase at the nanopore can be repeated.

[0077] ​In another optional quality assessment routine, a relatively large reverse bias voltage can be applied to the system to determine whether the polymerase and ligands have been removed from the nanopore. Typically, the double strands formed between components 2250' and 2212 will be strong enough to prevent ligand removal. This quality assessment routine will indicate whether this is the case. Similarly, a bias voltage can be applied at this stage, and the resulting current or flux pattern can be detected to determine whether corking or uncorking has occurred as previously described. If the quality assessment indicates that the polymerase has not been captured through the nanopore with sufficient stability, the steps used to capture the polymerase at the nanopore can be repeated.

[0078] Several embodiments described herein relate to multiple devices loaded with multiple nanopores, each of which needs to be attached to a polymerase. Quality assessment steps, such as those described above, can be performed on the multiple population. If the desired number of functional nanopores has not yet formed in the multiple nanopore device, or if fractional loading is insufficient, the devices can be batch-processed to repeat nanopore (or polymerase) loading. Optionally, the nanopores (or polymerase) can be removed before the repeated loading step, for example, if defective nanopores or polymerase are present. For example, if the multiple device is loaded at less than 90%, 75%, 50%, 30%, or fewer of the expected sites, loading can be repeated (and optionally, the nanopores or polymerase can be removed).

[0079] exist Figure 2C As shown in step 3, Figure 2B The composition shown can further be subjected to an opposite orientation force F2 (e.g., voltage reversal relative to the voltages of steps 1 and 2), based on which polymerase 2250 can contact the first side 2201 of nanopore 2200 and can contact sequencing primer 2280, target single-stranded DNA 2270 (target), and multiple nucleotides 2230, 2230', each of which includes a corresponding elongated tag 2231, 2231', the elongated tag including corresponding portions 2232, 2232', which interact with portions of strand 2213 in response to polymerase 2250 acting on nucleotide 2230 or 2230'.

[0080] exist Figure 2DAt step 4, as shown, polymerase 2250 acts on the first nucleotide 2230 based on the target sequence 2270. Based on this action, the corresponding portion 2232 of the elongated tag 2231 of nucleotide 2230 interacts with a portion 2214 of the ligand 2310. For example, polymerase 2250 may preferentially bind to the first nucleotide 2230 relative to the second nucleotide 2230' based on the complementarity of the first nucleotide 2230 with the next nucleotide in the target sequence 2270. Additionally, the elongated tag 2231 may contain the first nucleotide sequence, and a portion 2214 of the elongated body 2213 may contain a second nucleotide sequence complementary to the first nucleotide sequence of the elongated tag 2231, allowing the first and second nucleotide sequences to hybridize. It should be noted that step 4 can be performed under opposite orientation forces F2 (e.g., voltage reversal relative to the voltages of steps 1 and 2), so that polymerase 2250 does not need to be positioned against the first side 2201 of the nanopore 2200.

[0081] exist Figure 2E At step 5, as shown, a directional force F1 can be applied again, which can cause the tail region 2212 to translocate in a direction away from the first side 2201 of the nanopore 2200 and the polymerase 2250 to translocate towards the second side 2202 of the nanopore 2200. For example, the voltage on the nanopore 2200 can be reversed again. However, applying force F1 at step 5 may not necessarily cause the polymerase 2250 to translocate in a direction such as Figure 2B The portion 2214 is placed on or near the first side 2201 of the nanopore 2200 as shown. Conversely, applying a force F1 (towards a reverse pull) can cause the double strand defined by the interaction (e.g., binding or hybridization) between portion 2214 and portion 2232 to be placed on or near the constriction portion 2204. Illustratively, the composition can be included in a system comprising a measuring circuitry configured to measure the current or flux through the constriction portion 2204. During step 5, the current or flux can be based on the first portion 2232, for example, based on a specific sequence of portion 2232, and the first nucleotide 2230 can be identifiable based on the current or flux. For example, portion 2232 of the first nucleotide 2230 can have a sequence different from that of portion 2232' of the second nucleotide 2230' and can bind to a different portion / moiety of the elongated body 2213 of the tie strand 2210. Illustratively, the elongated tag may contain any suitable polynucleotide sequence that facilitates the differentiation of nucleotides attached to such a tag from one another.

[0082] exist Figure 2FAt the illustrated step 6, under continued application of the directional force Fl, after a random time, the duplex between the portion 2214 of the tether 2210 and the portion 2232 of the elongate tag 2231 of the nucleotide 2230 dissociates in a manner similar to that described in Derrington et al., PNAS 2010, cited elsewhere herein. Upon such dissociation, the directional force Fl can cause the polymerase 2250 to rest on or adjacent to the first side 2201 of the nanopore 2200 in a manner such as Figure 2B illustrated.

[0083] Note that other configurations can be suitably used. For example, as an alternative to steps 5 and 6 illustrated in Figure 2E and Figure 2F respectively, the elongate tag 2231 can instead be sufficiently short that, under application of the directional force Fl, the duplex between the portion 2214 of the tether 2210 and the portion 2232 of the elongate tag 2231 of the nucleotide 2230 does not reach the constriction, but instead the polymerase 2250 rests on or adjacent to the first side 2201 of the nanopore 2200 in a manner such as illustrated in Figure 2B In such embodiments, the elongate tags 2231, 2231’ attached to different nucleotides 2230, 2230’ that can be bound by the polymerase 2250 can comprise portions 2232, 2232’ that differ from one another in sequence or length, and thus interact with (e.g. hybridize to) the portion 2214 of the tether 2210 differently from one another, resulting in different changes in length of the tether 2214. The corresponding nucleotides 2230, 2230’ can be identified based on changes in current or flux based on the length of the tether 2210 caused by the interaction between the portion 2214 and the corresponding portion 2232, 2232’. Steps 4 to 6 similar to those illustrated in Figures 2D to 2F can be repeated, whereby an AC voltage is applied to the holding electrode. In yet another embodiment, the elongate tag or elongate body can comprise a reporter region such as provided elsewhere herein, and the current or flux through the aperture 2203 can be based on the reporter region disposed within the aperture, and the nucleotide 2230 can be identifiable based on the current or flux.

[0084] Additionally, if a dysfunctional polymerase is captured, the voltage can be reversed to a very high voltage, such that the capture DNA is disengaged and a new polymerase can be captured (repeating steps 1 to 3).

[0085] The voltage, current, or optical waveform can be measured for various states of the tether passing through the nanopore. The voltage, current, or optical waveform can be used to determine the results of the analysis method performed on the nanopore system. For example, the waveform can be fit with data to increase the accuracy of a sequencing read.

[0086] In one embodiment, to begin sequencing of the template DNA, the disclosed method can apply a positive relative potential to the trans electrode to pull on the polymer tether such that the DNA polymerase moves into proximity of the nanopore. The polymer tether can be a single-stranded DNA containing an abasic segment. As the DNA polymerase incorporates a labeled nucleotide to base pair with the template DNA, the identity of the labeled nucleotide can be determined. Each labeled nucleotide incorporated by the DNA polymerase can have a unique tag. This unique tag can bind (e.g., hybridize) to a unique region of the polymer tether that has a unique distance from the abasic segment such that the location of the abasic segment relative to the nanopore can be uniquely determined. The unique location of the abasic segment relative to the nanopore can result in a unique ion current block at the nanopore and thus a unique nanopore resistance. To read out the identity of the labeled nucleotide, the disclosed method can apply an AC voltage. By applying the AC voltage, the system can have a non-faradaic capacitive response and can have no net electrochemical reaction. In some embodiments, by measuring the FET gate voltage waveform that depends on the unique nanopore resistance, the unique identity of the labeled nucleotide can be determined. Using an AC voltage can allow for faster readout compared to reading out the identity of the labeled nucleotide by applying a DC voltage, which requires waiting for the transient response to decay. The measurement sensitivity can be improved if the AC voltage frequency is around the resonance frequency of the nanopore and the membrane / double layer (this maximizes the response sensitivity to changes in the resistivity of the nanopore). After determining the identity of the labeled nucleotide, the disclosed method can apply another larger positive relative potential to the trans electrode to increase the pulling force on the polymer tether such that the tag dissociates from the polymer tether. In some embodiments, the disclosed method can be used to detect proteins or other types of biopolymers.

[0087] According to some embodiments, Figures 3A to 3CA nanopore formed with an ionophore is schematically shown. A single polymerase 3010 can be anchored into a membrane 3020. The membrane can be a lipid monolayer or a lipid bilayer. A transmembrane peptide (MSP) 3011 can be used to anchor the polymerase, and such a peptide can anchor to the underlying surface. One half (gB) 3030 of an ionophore (e.g., gramicidin) can be conjugated to the MSP via a tether— this half rests on the trans side of the membrane. The purpose of this tether is to position the gB to the polymerase and to the trans side. Other methods of positioning the gB close to the polymerase on the trans side include anchoring the gB to the surface, or using an asymmetric bilayer where the gB has properties that favor the trans side bilayer. The polymerase can interact with a template polynucleotide 3002 and a primer 3001, which can not pass through the pore. A gamma phosphate labeled nucleotide 3003 can attach to the other half of the gramicidin dimer (gA) 3031— this is on the cis side. When the nucleotide sits in the polymerase active site, a dimer 3040 can be formed from the two halves of the gramicidin, opening the nanopore or ion channel to allow current 3050 to flow. Simple modifications to the peptide sequence of the gramicidin can affect the current flow, so four different modifications can allow four different signals. The two halves of the gramicidin can be engineered to have a fast off-rate, such that after the gamma phosphate bond is cleaved, the gA will diffuse into the bulk. Note that the individual gA can not span the entire membrane to allow ion flow. To read out the identity of the labeled nucleotide, the disclosed methods can apply an AC voltage. By applying an AC voltage, the system can have a non-faradaic capacitive response, and can have no net electrochemical reaction. In some embodiments, by measuring the AC response waveform that depends on the four different modifications, the unique identity of the labeled nucleotide can be determined.

[0088] Additional details of embodiments can be found in US10364463B2; Liu, Zewen, et al. “Solid-state nanopore-based DNA sequencing technology.” Journal of Nanomaterials 2016 (2016), the entire contents of each of these disclosures are incorporated herein by reference.

[0089] Alternative Embodiments

[0090] One aspect of the disclosed technology involves using a molecule of interest as part of a molecular bridge for conducting electricity. In one embodiment, the disclosed system includes a nanogap and a molecular bridge extending across the nanogap. A dielectric plate may also extend across the nanogap to act as a capacitor. When the molecule of interest interacts with the molecular bridge (e.g., hybridizes), it can cause a pronounced change in the conductivity of the molecular bridge. The molecular bridge can be partially double-stranded DNA, DNA origami, carbon nanotubes, or other molecular wires, and may contain nanoparticles. This disclosed system can be used to identify a variety of molecules, such as different nucleotides or amino acids.

[0091] Figure 7 An implementation of the disclosed system is shown in the figure. Figure 7 The image shows a sensor device 7000 for identifying nucleotides. The sensor device 7000 may include an electrode 7012. The sensor device 7000 may further include a FET 7020 having a gate oxide 7113. The sensor device 7000 may further include a molecular bridge, such as a partially double-stranded nucleic acid polymer 7099 in a flow chamber 7017. The molecular bridge 7099 may have one end operatively coupled to the electrode 7012, for example via a top metal surface 7018; and another end operatively coupled to a gate terminal of the FET 7020, for example via a bottom metal surface 7008 and a metal interconnect 7022 buried in a thick insulator 7007. A cap dielectric 7223 and metal surfaces 7008 and 7018 may form a capacitor connected in parallel with the partially double-stranded nucleic acid polymer 7099. The thickness of the cap dielectric 7223 can be approximately a few nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm or 90 nm.

[0092] The sensor device 7000 may further include a power supply 7001 configured to provide an AC input between an electrode and the source terminal of the FET. The sensor device 7000 may further include an additional electrode 7002 for applying the AC input. A bias voltage 7004 may be applied across the source and drain terminals of the FET. The sensor device 7000 may further include a controller 7003 operatively coupled to the FET, the controller being configured to measure the AC response of the FET, wherein the AC response depends on the identity of the nucleotides interacting with the partially double-stranded nucleic acid polymer 7099.

[0093] Figure 15A and Figure 15B An exemplary AC response waveform is shown, such as that produced by... Figure 6 The controller in the middle, by Figure 7The controller 7003 or other suitable sensor device measures the response waveform. Changes in the electrical conduction of the molecular bridge 7099 can cause amplitude and phase modulation of the waveform, such as... Figure 15B As shown. In some cases, the controller is configured to measure changes in the magnitude of the AC response, for example, as in... Figure 15B The comparison points 153 and 154 are shown in the diagram. For example, it can be done by comparing... Figure 15B The amplitude is obtained by measuring the maximum point 151 and the minimum point 152 in the waveform. In some cases, the controller is configured to measure changes in the waveform shape of the AC response. In some cases, the power supply 7001 is configured to provide an AC voltage that alternates between positive and negative potentials in the form of a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform. In some cases, electrical conduction through the partially double-stranded nucleic acid polymer 7099 is regulated by a nucleic acid label incorporated into the nucleotides of the polynucleotide, which is partially complementary to the partially double-stranded nucleic acid polymer. Figure 8 The equivalent circuit of sensor device 7000 is shown.

[0094] Figure 14A and Figure 14B It shows Figure 8 The signal-to-noise ratio of the circuit response shown. Figure 14A In the example, the area of ​​the FET gate is approximately 1.00 μm. 2 Furthermore, the gate capacitance density of the FET 7020 is approximately 17ff / um. 2 The resonant frequency of the molecular bridge 7099 is at or near the peak of the SNR. For example... Figure 14A As shown, as the resistance (R_wire) of the molecular bridge decreases, the resonant frequency of the molecular bridge increases. Therefore, changes in the resonant frequency of the molecular bridge can be used to detect sequenced bases that alter the resistance of the molecular bridge. Figure 14B In the example, the area of ​​the FET gate is approximately 0.25 μm. 2 Furthermore, the gate capacitance density of the FET 7020 is approximately 17ff / um. 2 The resonant frequency of the molecular bridge 7099 is at or near the peak of the SNR. For example... Figure 14B As shown, as the resistance (R_wire) of the molecular bridge decreases, the resonant frequency of the molecular bridge increases. Therefore, the change in the resonant frequency of the molecular bridge can be used to detect sequenced bases that alter the resistance of the molecular bridge.

[0095] According to some implementation plans Figure 4The sensing system 40 shown in the middle includes a flow cell 41 and an electronic sensor 10 integrated into the flow cell 41. The electronic sensor 10 includes two electrodes 12, 14; a modified partially double-stranded nucleic acid polymer 16 bridging the two electrodes 12, 14, the modified partially double-stranded nucleic acid polymer 16 including two polynucleotide strands 18, 20 that are partially bound together (via hydrogen bonds), a void 22 in a first one of the polynucleotide strands 18 in which a nucleotide is missing, and a plurality of nucleotide bases 24 of a second one of the polynucleotide strands 20 that are exposed at the void 22. The flow cell 41 is a vessel that houses the sensor 10. It should be understood that other vessels, such as wells, tubes, channels, cuvettes, petri dishes, bottles, and the like, can alternatively house the sensor 10. Cyclic processes such as nucleic acid sequencing reactions are particularly well suited to the flow cell 41.

[0096] The example flow cell 41 includes a substrate / support 13 and a lid directly or indirectly bonded thereto or integrally formed therewith. The flow cell 41 can include a fluid inlet 45 and a fluid outlet 47 that enable delivery of bulk reagents to one sensor 10 or an array of sensors 10 housed within the flow cell 41.

[0097] The sensing system 40 can also include a reagent delivery system 49 to selectively introduce reagents past the sensor 10 into an input end (e.g., the fluid inlet 45) of the flow cell 41 and then out the fluid outlet 47. The reagent delivery system 49 can include tubing or other fluidics that can be permanently or removably attached to the fluid inlet 45. The reagent delivery system 49 can include a sample container 51. Reagents, including labeled nucleotides 30 to be introduced to the electronic sensor 10, can be stored in the sample container or prepared and introduced into the sample container just prior to use. The reagent delivery system 49 can also include a pump or other suitable device to retrieve reagents from the sample container 51 and deliver the reagents to the fluid inlet 45. In other examples, the sample container 51 is positioned so that reagents can flow by gravity to the fluid inlet 45, past the sensor 10, and out the fluid outlet 47. The sensor 10 in the flow cell 41 can also be operably connected to a detector 15 to detect changes in electrical conductivity of the sensor 10 when the sensing system 40 is in use.

[0098] According to some embodiments, the system 40' is in Figure 5An electronic sensor 10 is shown and includes two electrodes 12, 14; a modified partially double-stranded nucleic acid polymer 16 bridging the two electrodes 12, 14, the modified partially double-stranded nucleic acid polymer 16 comprising two polynucleotide strands 18, 20 that are partially bound together (via hydrogen bonds), a gap 22 in a first one of the polynucleotide strands 18 in which a nucleotide is missing; and a plurality of nucleotide bases 24 of a second one of the polynucleotide strands 20 that are exposed at the gap 22; and separate reagents to be introduced to the electronic sensor 10, including a labeled nucleotide 30, at least one labeled nucleotide of the labeled nucleotide 30 including a nucleotide 32, a linking molecule 34 attached to a phosphate group of the nucleotide, a switch strand 28 attached to the linking molecule 34, the switch strand 28 comprising a nucleotide strand comprising bases 36 that are complementary to at least some of the plurality of nucleotide bases 24 exposed at the gap 22. In Figure 5 In the example shown, the polynucleotide strand 18 is ACCGGGGTA-gap-ATCCG, and the polynucleotide strand 20 is TGGGCCCCATCCCCCCTAGGC (SEQ. ID No. 1). In the polynucleotide strand 20, the nucleotide bases "CCCCCC" are exposed at the gap 22 (at least until the switch strand 28 associates with the gap).

[0099] Although not shown, it is understood that the sensor 10 can be positioned within or a portion of a vessel (such as a flow cell 41 Figure 4 ), a tube, a channel, a cuvette, a petri dish, a bottle, etc. Another example of a suitable container is a flow cell.

[0100] Although Figure 5 One sensor 10 is shown in FIG. 1, but it is understood that the sensing system 40' can include an array of sensors 10 positioned on a substrate. Further, the sensors 10 of the sensing system 40' can each be electrically connected to a respective detector 15 to detect a response from the electronic sensor 10 when the switch strand 28 associates at the gap 22.

[0101] Some examples of the sensing system 40' further include a polymerase 38 anchored to the modified dsNA 16', and a template polynucleotide strand 48 to be introduced to the sensor 10.

[0102] As Figure 5As shown, sensor 10 includes polymerase 38. Any DNA polymerase capable of catalyzing the addition of one nucleotide to the nascent strand at a time can be used. The DNA polymerase can come from any of the following families: A, B, C, D, X, Y, and RT. Specific examples from family A include T7 DNA polymerase, Pol I, Polγ, PolΘ, or Pol v; or specific examples from family B include Pol II, Pol B, Polδ, Polα, Polδ, and Polε; or specific examples from family C include Pol III; or specific examples from family D include Pol D (DP1 / DP2 heterodimer); or specific examples from family X include Polβ, Polα, Polλ, Polμ, and terminal deoxynucleotidyl transferase; or specific examples from family Y include Polι, Polκ, Polε, Pol IV, and Pol V; or specific examples from family RT include telomerase.

[0103] like Figure 5 As shown, polymerase 38 is immobilized to the modified dsNA 16' using tie chain 46. In another example, polymerase 38 is immobilized to the substrate using tie chain 46. Tie chain 46 serves as an anchor for polymerase 38, and it may be desirable for tie chain 46 to be non-conductive. A non-conductive tie chain may be particularly desirable when polymerase 38 is attached to the modified dsNA 16'. Examples of suitable tie chains 46 include polyethylene glycol (PEG) having cleavable segments at some point along the PEG chain, or may include nickel NTA / His tag chemicals, streptavidin / biotin chemicals (e.g., streptavidin attached to the modified dsNA 16' and biotin attached to polymerase 38), DNA-DNA hybridization, DNA-PNA hybridization, carboxysilane 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), or any other suitable connector that may attach the polymerase to the modified dsNA 16' or the substrate surface. In some examples, the cohesive strand 46 holds polymerase 38 at least 10 nm away from the modified dsNA 16'. This may be desirable, for example, so that conformational changes of polymerase 38, the charge of polymerase 38, and / or the charge of the target / template polynucleotide strand 48 held by polymerase 38 do not interfere with the sensing operation of the modified dsNA 16'.

[0104] In one example, the modified dsNA 16' can be initially attached to the polymerase 38 via a tether 46 that includes a cleavable linkage. This combination can be introduced to the electrodes 12, 14 to attach the opposite ends of the modified dsNA 16' to the electrodes 12, 14 and the polymerase 38 to the surface of the substrate via, for example, nickel NTA / His tag chemistry. In this example, the cleavable linkage can be cleaved to detach the polymerase 38 from the modified dsNA 16'. In this example, the polymerase 38 is in proximity to the modified dsNA 16', but does not actually contact the modified dsNA. It should be understood that the cleavable tether 46 when the chemistry is provided to hold the polymerase 38 on, for example, the surface of the substrate and in the vicinity of the sensor 10.

[0105] As referred to herein, examples of the system 40, 40' can also include a template polynucleotide strand 48 to be introduced to the sensor 10.

[0106] The template polynucleotide strand 48 can be any sample to be sequenced and can be composed of DNA, RNA, or analogs thereof (e.g., peptide nucleic acids). The source of the template (or target) polynucleotide strand 48 can be genomic DNA, messenger RNA, or other nucleic acids from natural sources. In some cases, the template polynucleotide strand 48 derived from such sources can be amplified prior to use in the methods or systems 40, 40' herein. Amplification can be performed using any of a variety of known amplification techniques, including but not limited to polymerase chain reaction (PCR), rolling circle amplification (RCA), multiple displacement amplification (MDA), or random primer amplification (RPA). It should be understood that amplification of the template polynucleotide strand 48 prior to use in the methods or systems 40, 40' set forth herein is optional. As such, in some examples the template polynucleotide strand 48 will not be amplified prior to use. The template / target polynucleotide strand 48 can optionally be derived from a synthetic library. Synthetic nucleic acids can have a natural DNA or RNA composition, or can be analogs thereof.

[0107] Biological samples from which template polynucleotide strands 48 can be derived include, for example, those from a mammal, such as a rodent, mouse, rat, rabbit, guinea pig, ungulate, horse, sheep, pig, goat, cow, cat, dog, primate, human, or non-human primate; a plant, such as Arabidopsis thaliana, corn, sorghum, oat, wheat, rice, canola, or soybean; an alga, such as Chlamydomonas reinhardtii; a nematode, such as Caenorhabditis elegans; an insect, such as Drosophila melanogaster, mosquito, fruit fly, honeybee, or spider; a fish, such as zebrafish; a reptile; an amphibian, such as a frog or Xenopus laevis; Dictyostelium discoideum; a fungus, such as Pneumocystis carinii, Takifugu rubripes, yeast, Saccharomyces cerevisiae, or Schizosaccharomyces pombe; or Plasmodium falciparum. Template polynucleotide strands 48 can also be derived from a prokaryote, such as a bacterium, Escherichia coli, staphylococci, or Mycoplasma pneumoniae; an archaeon; a virus, such as hepatitis C virus, Ebola virus, or human immunodeficiency virus; or a viroid. Template polynucleotide strands 48 can be derived from a homogeneous culture or population of the above organisms, or alternatively, from a collection of several different organisms, for example, in a community or ecosystem.

[0108] In addition, template polynucleotide strands 48 can not be derived from a natural source, but can be synthesized using known techniques. For example, a gene expression probe or a genotyping probe can be synthesized and used in the examples described herein.

[0109] In some examples, the template polynucleotide strands 48 can be obtained as fragments of one or more larger nucleic acids. Fragmentation can be performed using any of a variety of techniques known in the art, including, for example, nebulization, sonication, chemical cleavage, enzymatic cleavage, or physical shearing. Fragmentation can also result from the use of particular amplification techniques that produce amplicons by copying only a portion of a larger nucleic acid strand. For example, the size of fragments produced by PCR amplification is defined by the length of the nucleotide sequence on the original template between the positions at which flanking primers hybridize during amplification. The length of the template polynucleotide strands 48 can be expressed in terms of the number of nucleotides, or in terms of a metric length (e.g., nanometers).

[0110] The population of template / target polynucleotide strands 48, or amplicons thereof, can have an average strand length that is desirable or suitable for a particular application of the methods or systems 40, 40’ described herein. For example, the average strand length can be less than about 100,000 nucleotides, about 50,000 nucleotides, about 10,000 nucleotides, about 5,000 nucleotides, about 1,000 nucleotides, about 500 nucleotides, about 100 nucleotides, or about 50 nucleotides. Alternatively or additionally, the average strand length can be greater than about 10 nucleotides, about 50 nucleotides, about 100 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 5,000 nucleotides, about 10,000 nucleotides, about 50,000 nucleotides, or about 100,000 nucleotides. The average strand length of the population of target polynucleotide strands 48, or amplicons thereof, can be within a range between the maximum and minimum values described above.

[0111] In some cases, the population of template / target polynucleotide strands 48 can be produced under conditions, or otherwise configured to have a maximum length of its constituents. For example, the maximum length of the constituents can be less than about 100,000 nucleotides, about 50,000 nucleotides, about 10,000 nucleotides, about 5,000 nucleotides, about 1,000 nucleotides, about 500 nucleotides, about 100 nucleotides, or about 50 nucleotides. Alternatively or additionally, the population of template polynucleotide strands 48, or amplicons thereof, can be produced under conditions, or otherwise configured to have a minimum length of its constituents. For example, the minimum length of the constituents can be greater than about 10 nucleotides, about 50 nucleotides, about 100 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 5,000 nucleotides, about 10,000 nucleotides, about 50,000 nucleotides, or about 100,000 nucleotides. The maximum and minimum lengths of the template polynucleotide strands 48 in the population can be within a range between the maximum and minimum values described above.

[0112] As Figure 5As shown, a template polynucleotide strand 48 (e.g., a single-stranded DNA strand) to be sequenced is bound to the polymerase 38 after being introduced in solution with reagents, such as labeled nucleotides 30.

[0113] In some examples, several different labeled nucleotides 30 (e.g., labeled with dA, dC, dG, and dT as nucleotides 32, respectively) can be used together in a system 40, 40’ including an array of sensors 10. In one example, four different labeled nucleotides 30 are used, each including a different nucleotide 32 and a different nucleotide-specific switch strand 28. As an example, the labeled nucleotides 30 include a first labeled nucleotide including deoxyadenosine polyphosphate as the nucleotide and a first nucleotide-specific switch strand; a second labeled nucleotide including deoxyguanosine polyphosphate as the nucleotide and a second nucleotide-specific switch strand having a different sequence than the first switch strand; a third labeled nucleotide including deoxycytidine polyphosphate as the nucleotide and a third nucleotide-specific switch strand having a different sequence than each of the first and second switch strands; and a fourth labeled nucleotide including deoxythymidine polyphosphate as the nucleotide and a fourth nucleotide-specific switch strand having a different sequence than each of the first, second, and third switch strands. Thus, in this example, the first, second, third, and fourth nucleotide-specific switch strands are different from one another. The different switch strands will produce different changes in electrical conductivity (when associated at the complementary gap 22), which can be used to identify the particular nucleotide to which the different switch strand is attached.

[0114] To determine the identity of the molecule of interest, the disclosed methods can apply an AC voltage on the system and read out the voltage or current response from the transistor. The electrical conductivity of the molecular bridge, and thus the electrical response of the system, depends on the identity of the molecule of interest. The measurement sensitivity can be improved if the AC voltage frequency is around the optimal frequency, which maximizes the response sensitivity.

[0115] Further details of embodiments can be found in US2020 / 0002758, the entire contents of each of these publications are incorporated herein by reference.

[0116] Further Embodiments

[0117] Example 1: A system for identifying components in a macromolecule, the system comprising:

[0118] a first element having a first resistance, wherein the first resistance is dependent on the identity of the component;

[0119] a second element having a first capacitance, wherein the second element is operably connected to the first element; and

[0120] a power source configured to supply a first periodic waveform having a substantially first frequency, whereby a sensitivity of the system to an electrical response of the first resistance is maximized.

[0121] Embodiment 2: The system of embodiment 1, wherein the first frequency is dependent on the first resistance and the first capacitance.

[0122] Embodiment 3: The system of embodiment 1, wherein the first periodic waveform is sinusoidal.

[0123] Embodiment 4: The system of embodiment 1, wherein the first element and the second element are connected in parallel.

[0124] Embodiment 5: The system of embodiment 1, further comprising a plurality of electrodes and a plurality of transistors.

[0125] Embodiment 6: The system of embodiment 5, wherein one transistor of the plurality of transistors is a field effect transistor (FET).

[0126] Embodiment 7: The system of embodiment 1, further comprising an electrode and a FET, wherein the electrode is operably connected to one side of the first element, wherein a gate terminal of the FET is operably connected to an opposite side of the first element, and wherein the first element and the second element are connected in parallel.

[0127] Embodiment 8: The system of embodiment 7, wherein the first periodic waveform is supplied as a voltage across the electrode and the source terminal of the FET.

[0128] Embodiment 9: The system of embodiment 7, wherein the first frequency is further dependent on a second capacitance associated with the FET.

[0129] Embodiment 10: The system of embodiment 9, wherein the second capacitance is a gate capacitance of the FET.

[0130] Embodiment 11: The system of embodiment 1, wherein the power source is further configured to supply a second waveform.

[0131] Embodiment 12: The system of embodiment 11, wherein the power source is configured to supply the second waveform and the first periodic waveform simultaneously.

[0132] Example 13: The system of Example 11, wherein the second waveform is periodic.

[0133] Example 14: The system of Example 11, wherein the second waveform is a direct current (DC) waveform.

[0134] Example 15: The system of Example 1, wherein the macromolecule comprises a plurality of types of polymers, and wherein the component is a monomer of one type of polymer of the plurality of types of polymers.

[0135] Example 16: The system of Example 1, wherein the macromolecule comprises one or more polypeptides, and wherein the component is an amino acid.

[0136] Example 17: The system of Example 1, wherein the macromolecule comprises one or more polynucleotides, and wherein the component is a nucleotide.

[0137] Example 18: The system of Example 17, wherein the nucleotides of the one or more polynucleotides are modified and / or labeled such that the values of the first resistances of any two types of nucleotides are distinguishable.

[0138] Example 19: The system of Example 17, further comprising a reverse transcriptase, wherein the reverse transcriptase is configured to reverse transcribe a portion of the macromolecule.

[0139] Example 20: The system of Example 17, further comprising a DNA polymerase, wherein the DNA polymerase is configured to replicate a portion of the macromolecule.

[0140] Example 21: The system of Example 20, further comprising a chamber, an electrolyte in the chamber, and nucleic acid precursors, wherein the precursors are dissolved in the electrolyte.

[0141] Example 22: The system of Example 21, further comprising a polymer tether permanently attached to the DNA polymerase, wherein the polymer tether is configured to fit in the electrolyte.

[0142] Example 23: The system of Example 22, wherein portions of the precursors are configured to hybridize to predetermined regions of the polymer tether, wherein the predetermined regions depend on the types of the precursors.

[0143] Example 24: The system of Example 22, wherein the power source is further configured to actuate the polymer tether.

[0144] Example 25: The system of Example 21, further comprising a fluidic subsystem configured to supply the electrolyte and the precursor to the chamber.

[0145] Example 26: The system of Example 21, wherein the precursor is modified and / or labeled such that the values of the first electrical resistance of any two types of precursors are distinguishable.

[0146] Example 27: The system of Example 26, wherein the precursor is coupled to an ionophore or a portion of an ionophore.

[0147] Example 28: The system of Example 1, wherein the second element comprises at least one dielectric layer and at least one electrically conductive layer.

[0148] Example 29: The system of Example 28, wherein the first element comprises a modified partially double-stranded nucleic acid polymer.

[0149] Example 30: The system of Example 29, wherein the modified partially double-stranded nucleic acid polymer comprises:

[0150] two polynucleotide strands that are partially bound together;

[0151] a gap in one of the polynucleotide strands in which nucleotides are missing; and

[0152] a plurality of nucleotide bases of the other polynucleotide strand that are exposed at the gap.

[0153] Example 31: The system of Example 1, wherein the second element comprises a membrane.

[0154] Example 32: The system of Example 31, wherein the membrane is formed from a lipid, silicon, graphene, a solid state material, a synthetic material, a biomimetic equivalent of a lipid, or any combination thereof.

[0155] Example 33: The system of Example 31, further comprising an ionophore or a portion of an ionophore deposited in the membrane.

[0156] Example 34: The system of Example 33, wherein the first element comprises an ion channel formed in the membrane based in part on the ionophore or the portion of the ionophore.

[0157] Example 35: The system of Example 31, wherein the first element comprises a nanopore.

[0158] Example 36: The system of Example 35, wherein the nanopore is a hole in the membrane.

[0159] Example 37: The system of Example 35, wherein the nanopore comprises a structure deposited in the membrane, wherein the structure is formed from one or more polynucleotides, one or more polypeptides, one or more types of biopolymer, one or more carbon nanotubes, one or more types of solid state material, or any combination thereof.

[0160] Example 38: An array of multiple sequencers, wherein at least one sequencer is defined by the system of any of the preceding examples.

[0161] Example 39: A method of using a system as defined in any of Examples 7-10, the method comprising measuring a response of the FET according to the identity of the component to identify the component in the macromolecule.

[0162] Example 40: The method of Example 39, wherein measuring the response comprises measuring a FET gate-source voltage, a FET source-drain current, a FET drain-to-source resistance, or any combination thereof.

[0163] Example 41: The method of Example 39, wherein measuring the response comprises measuring a phase of the response, an amplitude of the response, a waveform of the response, or any combination thereof.

[0164] Example 42: The method of Example 39, further comprising setting the first frequency to a value such that a partial derivative of the response of the FET with respect to the first resistance is maximum or minimum.

[0165] Example 43: The method of Example 39, further comprising setting the first frequency to a value such that a change in the response of the FET measured with respect to changing the first resistance is greater than a threshold value.

[0166] Example 44: The method of Example 42, further comprising configuring the power supply to supply the first periodic waveform at a frequency within 10% of the first frequency.

[0167] Example 45: The method of Example 42, further comprising configuring the power supply to supply the first periodic waveform at a frequency of the same order of magnitude as the first frequency.

[0168] Definitions

[0169] Unless specifically stated otherwise, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0170] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a sequence” can include multiple such sequences, and so forth.

[0171] The terms comprising, including, containing, and various forms of these terms are synonymous with one another and are intended to be equally broad. Additionally, unless explicitly stated to the contrary - examples comprising, including or having one or more elements are intended to encompass a single instance of the element as well as a plurality of instances of the element, whether the additional instances are of the same or different attribute.

[0172] As used herein, “cis” refers to a side of a nanopore opening through which an analyte or modified analyte enters the opening, or across which an analyte or modified analyte moves.

[0173] As used herein, “trans” refers to a side of a nanopore opening through which an analyte or modified analyte (or fragment thereof) exits the opening, or across which an analyte or modified analyte does not move.

[0174] As used herein, the terms “fluidically connected,” “fluidically in communication,” “fluidically coupled,” and the like refer to two spatial regions connected together such that a liquid or gas can flow between the two spatial regions. For example, one or more cis pores can be fluidically connected to one or more trans pores through an intervening pore, fluidic tunnel, narrower region, or aperture (e.g., nanopore) such that at least a portion of an electrolyte can flow between the connected pores. The two spatial regions can be in fluidic communication through a first nanoscale opening and a second nanoscale opening, or through one or more valves, flow restrictors, or other fluidic components for controlling or regulating the flow of fluid through the system.

[0175] As used herein, the term “operably connected” refers to a configuration of elements in which the action or reaction of one element affects another element, but in a manner that preserves the functionality of each element.

[0176] As used herein, the term "membrane" refers to a barrier or other sheet of material that is impermeable or semi-permeable to two liquid / gel chambers (e.g., a cis-pore and a fluid cavity) that can contain the same composition or different compositions therein. The permeability of a membrane to any given substance depends on the properties of that membrane. In some examples, a membrane can be ion-, current-, and / or fluid-impermeable. For example, a lipid membrane can be ion-impermeable (i.e., does not allow the transport of any ions therethrough), but can be at least partially water-permeable (e.g., a water diffusivity in the range of about 40 pm / s to about 100 pm / s). For another example, a synthetic / solid-state membrane (one example of which is silicon nitride) can be ion-, charge-, and fluid-impermeable (i.e., diffusion of all of these substances is zero). Any membrane can be used in accordance with the present disclosure so long as the membrane can include nanoscale openings across the membrane and can maintain a potential difference across the membrane. The membrane can be a single layer or a multi-layer membrane. A multi-layer membrane includes two or more layers, each of which is an impermeable or semi-permeable material.

[0177] A membrane made from a biologically-derived material refers to a material derived from or isolated from a biological environment, such as an organism or a cell, or a synthetic manufactured version of a biologically usable structure (e.g., a biomimetic material).

[0178] An example membrane made from a biologically-derived material includes a monolayer formed from a bolalipid. Another example membrane made from a biologically-derived material includes a lipid bilayer. Suitable lipid bilayers include, for example, the membranes of cells, the membranes of organelles, liposomes, planar lipid bilayers, and supported lipid bilayers. A lipid bilayer may, for example, be formed from two opposing layers of phospholipids arranged such that their hydrophobic tail groups face each other to form a hydrophobic interior, while the hydrophilic head groups of the lipids face outward toward the aqueous environment on each side of the bilayer. A lipid bilayer may, for example, also be formed by a method in which a lipid monolayer is supported on an aqueous solution / air interface, on either side of a pore that is substantially normal to the interface. The lipid is typically added to the surface of an aqueous electrolyte solution by first dissolving the lipid in an organic solvent, and then allowing a drop of the solvent to evaporate on the surface of the aqueous solution on either side of the pore. Once the organic solvent has been at least partially evaporated, the solution / air interface on either side of the pore is physically moved up and down through the pore until a bilayer is formed. Other suitable methods of forming bilayers include tip-dipping, painting on bilayers, and patch-clamp of liposome bilayers. Any other method for obtaining or generating a lipid bilayer can also be used.

[0179] Materials that are not of biological origin can also be used as the membrane. Some of these materials are solid materials and can form a solid-state membrane, and others of these materials can form a thin liquid film / membrane. The solid-state membrane can be a monolayer, such as a coating or film on a support substrate (i.e., a solid support), or a freestanding element. The solid-state membrane can also be a composite of multiple layers of material in a sandwich configuration. Any material that is not of biological origin can be used, so long as the resulting membrane can include nanoscale openings across the membrane and can maintain a potential difference across the membrane. The membrane can comprise organic materials, inorganic materials, or both. Examples of suitable solid-state materials include, for example, microelectronic materials, insulating materials (e.g., silicon nitride (Si3N4), aluminum oxide (Al2O3), hafnium oxide (HfO2), tantalum pentoxide (Ta2O5), silicon oxide (SiO2), etc.), some organic and inorganic polymers (e.g., polyamides, plastics such as polytetrafluoroethylene (PTFE), or elastomers such as two-component addition-cured silicone rubber), and glasses. Additionally, the solid-state membrane can be made of a single layer of graphene, which is an atomic sheet of carbon atoms densely packed into a two-dimensional honeycomb lattice, multiple layers of graphene, or one or more layers of graphene mixed with one or more layers of other solid-state materials. The graphene-containing solid-state membrane can include at least one layer of graphene that is a graphene nanoribbon or a graphene nanogap, which can be used as an electrical sensor to characterize a target polynucleotide. It should be understood that the solid-state membrane can be prepared by any suitable method, for example, chemical vapor deposition (CVD). In one example, the graphene membrane can be prepared by CVD or exfoliation from graphite. Examples of suitable thin liquid film materials that can be used include diblock or triblock copolymers, such as amphiphilic PMOXA-PDMS-PMOXA ABA triblock copolymers.

[0180] As used herein, the term "nanopore" is intended to mean a hollow structure that is discrete from or defined in a membrane and extends across the membrane, which allows ions, electrical current, and / or fluid to pass from one side of the membrane to the other side of the membrane. For example, a membrane that inhibits the passage of ions or water-soluble molecules can include a nanopore structure that extends across the membrane to allow ions or water-soluble molecules to pass from one side of the membrane to the other side of the membrane (through a nanoscale opening that extends through the nanopore structure). The nanoscale opening that extends through the nanopore structure can vary in diameter along its length (i.e., from one side of the membrane to the other side of the membrane), but is nanoscale (i.e., about 1 nm to about 100 nm, or to less than 1000 nm) at any point. Examples of nanopores include, for example, biological nanopores, solid-state nanopores, and solid-state biological hybrid nanopores.

[0181] As used herein, the term "diameter" is intended to mean the longest straight line that can be drawn through the centroid of a cross-section of a nanoscale opening that inscribes the cross-section of the nanoscale opening. It is to be understood that the nanoscale opening can or can not have a circular or substantially circular cross-section (the cross-section of the nanoscale opening is substantially parallel to the cis / trans electrode). Further, the cross-section can be regular or irregular in shape.

[0182] As used herein, the term "biological nanopore" is intended to mean a nanopore whose structural components are made of materials of biological origin. Biological origin refers to materials derived or isolated from a biological environment, such as an organism or a cell, or a synthetically manufactured version of a biological usable structure. Biological nanopores include, for example, polypeptide nanopores and polynucleotide nanopores.

[0183] As used herein, the term "polypeptide nanopore" is intended to mean a protein / polypeptide that extends across a membrane and allows ions, electric current, polymers (such as DNA or peptides), or other molecules of appropriate size and charge, and / or fluids to flow through the protein / polypeptide from one side of the membrane to the other side of the membrane. Polypeptide nanopores can be monomeric, homopolymers, or heteropolymers. Structures of polypeptide nanopores include, for example, a-helical bundle nanopores and β-barrel nanopores. Exemplary polypeptide nanopores include a-hemolysin, Mycobacterium smegmatis porin A (MspA), gramicidin A, maltoporin, OmpF, OmpC, PhoE, Tsx, F pilus, and the like. The protein a-hemolysin naturally occurs in cell membranes, where the protein acts as a pore for transporting ions or molecules into and out of the cell. Mycobacterium smegmatis porin A (MspA) is a membrane pore protein produced by mycobacteria that allows hydrophilic molecules to enter the bacteria. MspA forms a tightly interconnected octamer and a transmembrane β-barrel that resembles a goblet and contains a central pore.

[0184] Polypeptide nanopores can be synthetic. Synthetic polypeptide nanopores comprise protein-like amino acid sequences that do not exist in nature. The protein-like amino acid sequences can include some of the amino acids that are known to exist but do not form the basis of proteins (i.e., non-proteinogenic amino acids). The protein-like amino acid sequences can be artificially synthesized, rather than expressed in a biological organism, and then purified / isolated.

[0185] As used herein, the term "polynucleotide nanopore" is intended to include a polynucleotide that extends across a membrane and allows ions, electric current, and / or fluids to flow from one side of the membrane to the other side of the membrane. Polynucleotide pores can include, for example, polynucleotide origami (e.g., nanoscale folding of DNA to create a nanopore).

[0186] As used herein, the term“solid-state nanopore” is intended to mean a nanopore whose structural portion is defined by a solid-state membrane and comprises material that is not of biological origin (i.e., is not of biological origin). Solid-state nanopores can be formed from inorganic or organic materials. Solid-state nanopores include, for example, silicon nitride nanopores, silicon dioxide nanopores, and graphene nanopores.

[0187] The nanopores disclosed herein can be hybrid nanopores. A“hybrid nanopore” refers to a nanopore that comprises both material of biological origin and material of non-biological origin. Examples of hybrid nanopores include polypeptide solid-state hybrid nanopores and polynucleotide solid-state nanopores.

[0188] As used herein, the term“nanopore sequencer” refers to any of the devices disclosed herein that can be used for nanopore sequencing. In examples disclosed herein, a nanopore is immersed in an example of an electrolyte disclosed herein during nanopore sequencing, and a potential difference is applied across the membrane. In examples, the potential difference is an electrical potential difference or an electrochemical potential difference. The electrical potential difference can be applied across the membrane via a voltage source that injects or applies an electrical current into at least one of the ions of the electrolyte contained in one or more of the cis- or trans-pores. The electrochemical potential difference can be established by a difference in the combination of ion composition and electrical potential of the cis- and trans-pores. The different ion composition can be, for example, different ions in each pore or different concentrations of the same ion in each pore.

[0189] Applying a potential difference across a nanopore can force a nucleic acid to translocate through the nanopore. Corresponding to the translocation of a nucleotide through the nanopore, one or more signals are generated. Thus, as a target polynucleotide or as a single nucleotide or a probe derived from a target polynucleotide or a single nucleotide is transported through a nanopore, the electrical current across the membrane changes due to, for example, base-dependent (or probe-dependent) blockage of the constriction. The signals from the changes in electrical current can be measured using any of a variety of methods. Each signal is unique to the species of nucleotide (or probe) in the nanopore, such that the resulting signals can be used to determine the identity of the polynucleotide. For example, the identity of the species of nucleotide (or probe) that produced a characteristic signal can be determined.

[0190] As used herein, a "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. A nucleotide is a monomeric unit of a nucleic acid sequence. Examples of nucleotides include, for example, ribonucleotides or deoxyribonucleotides. In ribonucleotides (RNA), the sugar is ribose, and in deoxyribonucleotides (DNA), the sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group present at the 2' position in ribose. The nitrogenous heterocyclic base can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 of a pyrimidine or the N-9 of a purine. The phosphate group can be in a monophosphate form, a diphosphate form, or a triphosphate form. These nucleotides are natural nucleotides, but it is further understood that non-natural nucleotides, modified nucleotides, or analogs of the foregoing nucleotides can also be used.

[0191] As used herein, the term "signal" is intended to mean an indicator representative of information. Signals include, for example, electrical signals and optical signals. The term "electrical signal" refers to an indicator of electrical quality representative of information. The indicator can be, for example, an electrical current, a voltage, a tunneling, a resistance, a potential, a voltage, a conductance, or a transverse electrical effect. "Electrical current" or "current" refers to a flow of electrical charge. In one example, the electrical signal can be a current through a nanopore, and the current can flow upon application of a potential difference across the nanopore.

[0192] The term "substrate" refers to a rigid solid support that is not soluble in aqueous liquids and that is not capable of transferring liquids in the absence of pores, ports, or other as liquid conduits. In examples disclosed herein, a substrate can have a well or chamber defined in the substrate. Examples of suitable substrates include glass and modified or functionalized glass, plastics (including acrylic resins, polystyrene, and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (PTFE) (such as TEFLON® from Chemours), cyclic olefin / cyclic olefin polymer (COP) (such as ZEONOR® from Zeon), polyimide, and the like), nylon, ceramic, silica or silica-based materials, silicon and modified silicon, carbon, metal, inorganic glass, and optical fiber bundles.

[0193] ​​The terms top, bottom, lower, upper, superior, and the like are used herein to describe the device / nanopore sequencer and / or various components of the device. It should be understood that these directional terms are not meant to imply a particular orientation, but are used to designate relative orientation between components. The use of directional terms should not be interpreted to limit the examples disclosed herein to any particular orientation. As used herein, the terms “upper,” “lower,” “vertical,” “horizontal,” and the like mean to indicate relative orientations.

[0194] As used herein, the terms “pore,” “cavity,” and “chamber” are used synonymously and refer to discrete features defined in a device that can contain a fluid (e.g., liquid, gel, gas). A cis-pore is a chamber that contains or is partially defined by a cis-electrode and is also fluidically connected to a fluidic system of a FET, which in turn is fluidically connected to a trans-pore / chamber. Examples of arrays of the present devices can have one cis-pore or multiple cis-pores. A trans-pore is a single chamber that contains or is partially defined by its own trans-electrode and is also fluidically connected to a cis-pore. In examples that include multiple trans-pores, each trans-pore is electrically isolated from each other trans-pore. Further, it should be understood that a cross-section of the pore taken parallel to a surface of a substrate that at least partially defines the pore can be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0195] As used herein, a “field effect transistor” or “FET” generally includes doped source / drain regions formed of a semiconductor material (e.g., silicon, germanium, gallium arsenide, silicon carbide, etc.) and separated by a channel region. An n-FET is a FET with an n-channel in which the current carriers are electrons. A p-FET is a FET with a p-channel in which the current carriers are holes. The source / drain regions of an n-FET device can comprise different materials than the source / drain regions of a p-FET device. In some examples, the source / drain regions or channels can not be doped. A doped region can be formed by adding dopant atoms to an intrinsic semiconductor. This changes the electron and hole carrier concentrations of the intrinsic semiconductor at thermal equilibrium. A doped region can be p-type or n-type. As used herein, “p-type” refers to the addition of an impurity to an intrinsic semiconductor that results in a deficiency of valence electrons. For silicon, exemplary p-type dopants, i.e., impurities, include, but are not limited to, boron, aluminum, gallium, and indium. As used herein, “n-type” refers to the addition of an impurity that contributes free electrons to an intrinsic semiconductor. For silicon, exemplary n-type dopants, i.e., impurities, include, but are not limited to, antimony, arsenic, and phosphorus. Dopants can be introduced by ion implantation or plasma doping.

[0196] For example, in an integrated circuit having multiple metal oxide semiconductor field effect transistors (MOSFETs), each MOSFET has a source and a drain that are formed in an active region of a semiconductor layer by implanting n-type or p-type impurities in the semiconductor material layer. A channel (or body) region is disposed between the source and the drain. A gate electrode is disposed over the body region. The gate electrode and the body are separated by a gate dielectric (gate oxide) layer. The channel region connects the source and the drain, and current flows through the channel region from the source to the drain. Current flow is induced in the channel region by a voltage applied at the gate electrode.

[0197] Non-planar transistor device architectures, such as nanosheet (or nanowire) transistors, can provide increased device density and increased performance relative to planar transistors. A "gate-all-around" transistor is one in which the gate is configured to wrap around the channel. A "nanotransistor" refers to a type of FET that can include a plurality of stacked nanosheets extending between a pair of source / drain regions, forming a channel. In contrast to conventional planar FETs, a nanosheet transistor can include a gate stack wrapped around the entire periphery of the plurality of nanosheet channel regions. The nanosheet transistor configuration enables more complete depletion in the nanosheet channel regions and reduces short channel effects. A "nanowire transistor" can be similar to a nanosheet transistor, except that the channel can include nanowires instead of nanosheets. The gate-all-around structure in a nanosheet transistor or a nanowire transistor can provide very small devices with better switching control, lower leakage current, faster operation, and lower output resistance.

[0198] One way to increase channel conductivity and reduce FET size is to form the channel as a nanostructure. For example, gate-all-around (GAA) nanosheet FETs are architectures that provide a relatively small FET footprint by forming the channel region as a series of nanosheets. In a GAA configuration, a nanosheet-based FET includes a source region, a drain region, and a stacked nanosheet channel between the source and drain regions. A gate surrounds the stacked nanosheet channel and modulates the flow of electrons through the nanosheet channel between the source and drain regions. GAA nanosheet FETs can be fabricated by forming alternating layers of channel nanosheets and sacrificial nanosheets. The sacrificial nanosheets are released from the channel nanosheets before the FET device is completed. For n-type FETs, the channel nanosheets are typically silicon (Si) and the sacrificial nanosheets are typically silicon germanium (SiGe). For p-type FETs, the channel nanosheets are typically SiGe and the sacrificial nanosheets are typically Si. In some embodiments, the channel nanosheets of a p-FET can be SiGe or Si and the sacrificial nanosheets can be Si or SiGe. Forming GAA nanosheets from alternating layers of channel nanosheets formed from a first type of semiconductor material (e.g., Si for n-type FETs and SiGe for p-type FETs) and sacrificial nanosheets formed from a second type of semiconductor material (e.g., SiGe for n-type FETs and Si for p-type FETs) provides excellent channel electrostatic control, which is beneficial for continued scaling of gate length to seven-nanometer CMOS technology and below. Using multiple layers of SiGe / Si sacrificial / channel nanosheets (or Si / SiGe sacrificial / channel nanosheets) to form the channel region in a GAA FET semiconductor device provides desirable device characteristics, including the introduction of strain at the interface between SiGe and Si.

[0199] In some examples, a "nanowire" is characterized by a critical dimension of less than about 30 nm, while a "nanosheet" is characterized by a critical dimension of about 30 nm or greater. In illustrative devices, the critical dimension is measured along the gate. In this direction, if the width of the channel is small, the channel cross-section resembles a "wire," while if the width of the channel is large, the channel cross-section resembles a "sheet."

[0200] In some examples, the smallest dimension of the nanosheet or nanowire is between about 1 nm-10 nm, about 1 nm-50 nm, about 1 nm-100 nm, about 1 nm-500 nm, or about 1 nm-1000 nm. In some examples, the smallest dimension of the nanosheet or nanowire is between about 1 nm-5 nm, about 3 nm-10 nm, about 5 nm-15 nm, about 10 nm-20 nm, about 15 nm-30 nm, about 20 nm-40 nm, about 30 nm-50 nm, about 40 nm-75 nm, about 50 nm-100 nm, about 75 nm-150 nm, about 100 nm-200 nm, about 150 nm-300 nm, about 200 nm-400 nm, about 300 nm-500 nm, about 400 nm-750 nm, or 500 nm-1000 nm. In some examples, the smallest dimension of the nanosheet is at least about 3 times, about 5 times, about 7 times, about 10 times, about 15 times, about 20 times, about 50 times, about 100 times, about 150 times, about 200 times, about 250 times, about 300 times, about 350 times, about 400 times, about 450 times, about 500 times, about 600 times, about 700 times, about 800 times, about 900 times, about 1000 times, about 2000 times, about 2500 times, about 3000 times, about 4000 times, or about 5000 times smaller than the other two dimensions of the nanosheet. In some examples, the smallest dimension of the nanosheet is between about 2 times-5 times, about 3 times-7 times, about 5 times-10 times, about 7 times-15 times, about 10 times-20 times, about 15 times-50 times, about 20 times-100 times, about 50 times-150 times, about 100 times-200 times, about 150 times-250 times, about 200 times-300 times, about 250 times-350 times, about 300 times-400 times, about 350 times-450 times, about 400 times-500 times, about 450 times-600 times, about 500 times-700 times, about 600 times-800 times, about 700 times-900 times, about 800 times-1000 times, about 900 times-2000 times, about 1000 times-2500 times, about 2000 times-3000 times, about 2500 times-4000 times, or about 3000 times-5000 times smaller than the other two dimensions of the nanosheet. In some examples, the smallest dimension of the nanosheet is at most about 3 times, about 5 times, about 7 times, about 10 times, about 15 times, about 20 times, about 50 times, about 100 times, about 150 times, about 200 times, about 250 times, about 300 times, about 350 times, about 400 times, about 450 times, about 500 times, about 600 times, about 700 times, about 800 times, about 900 times, about 1000 times, about 2000 times, about 2500 times, about 3000 times, about 4000 times, or about 5000 times smaller than the other two dimensions of the nanosheet.In some examples, the largest dimension of the nanowire is at least about 3, about 5, about 7, about 10, about 15, about 20, about 50, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 2000, about 2500, about 3000, about 4000, or about 5000 times larger than the other two dimensions of the nanowire. In some examples, the largest dimension of the nanowire is between about 2-5, about 3-7, about 5-10, about 7-15, about 10-20, about 15-50, about 20-100, about 50-150, about 100-200, about 150-250, about 200-300, about 250-350, about 300-400, about 350-450, about 400-500, about 450-600, about 500-700, about 600-800, about 700-900, about 800-1000, about 900-2000, about 1000-2500, about 2000-3000, about 2500-4000, or about 3000-5000 times larger than the other two dimensions of the nanowire. In some examples, the largest dimension of the nanowire is at most about 3, about 5, about 7, about 10, about 15, about 20, about 50, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 2000, about 2500, about 3000, about 4000, or about 5000 times larger than the other two dimensions of the nanowire.

[0201] In view of the foregoing definitions, it will be appreciated that aspects and examples described herein and recited in claims are understood.

[0202] Additional Description

[0203] It should be appreciated that all combinations of the foregoing concepts and additional concepts (if any) not specifically explained herein are contemplated as being part of the subject matter disclosed herein. In particular, the subject matter disclosed herein can be combined with any of the examples described in the following numbered clauses:

[0204] References throughout this specification to “one example”, “an example”, “one implementation” or “an implementation” mean that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and can or can not be present in other examples. In addition, it should be understood that the described elements for any example can be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0205] It is to be understood that the ranges provided herein include the specified ranges and any values or sub-ranges within the specified ranges, as if such values or sub-ranges were explicitly listed. For example, a range from about 2 nm to about 20 nm should be interpreted to include not only the explicitly listed limits of about 2 nm to about 20 nm, but also the individual values (such as about 3.5 nm, about 8 nm, about 18.2 nm, etc.) and sub-ranges (such as about 5 nm to about 10 nm, etc.) within the specified ranges. Further, when values are expressed as approximations by use of the antecedent “about”, it will be understood that the value provides one of ordinary skill with an expectation that there are tiny variations (up to + / - 10%) from the nominal values.

[0206] While several examples have been described in detail, it will be appreciated that modifications can be made to the disclosed examples. Accordingly, the description is to be considered as non-limiting.

[0207] While certain examples have been described, these examples have been presented by way of example only, and are not intended to limit the scope of the disclosure. Indeed, the novel methods and systems described herein can be embodied in a variety of other forms. Furthermore, various omissions, substitutions and changes in the systems and methods described herein can be made without departing from the spirit of the disclosure. The enclosed claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of the disclosure.

[0208] Features, materials, characteristics or groups described in conjunction with a particular aspect or example are to be understood to be applicable to any other aspect or example described in this section or elsewhere in this specification unless incompatible with that other aspect or example. All features disclosed in the specification (including any accompanying claims, abstract and drawings) and / or all the steps of any method or process described herein can be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. Protection is not sought for any of the examples in the details of the examples. Protection is sought only for one new feature, or any novel combination of features, disclosed in the specification (including any accompanying claims, abstract and drawings) as a feature, or a step of any method or process as disclosed. Protection is sought only for one new feature, or any novel combination of features, disclosed in the specification (including any accompanying claims, abstract and drawings) as a feature, or a step of any method or process as disclosed.

[0209] Furthermore, certain features described in the context of separate embodiments in the disclosure can also be implemented in combination in a single embodiment. Conversely, various features described in the context of a single embodiment can also be implemented separately or in any suitable subcombination. Moreover, although features can be described above as acting in particular combinations and / or input / output and or processing arrangements, such features can be implemented in other combinations and / or arrangements than those specifically described. Thus, as will be apparent from this disclosure, features can be implemented in a wide variety of different ways. Additionally, although some aspects and features of the disclosure can be described as being stored in memory, this applies equally to processor-readable non-transitory storage media, which includes all tangible storage media. However, those skilled in the art will readily recognize that the disclosure need not be embodied only in the software. For example, various features can be implemented in hardware, or a combination of hardware and software, or entirely in software. Accordingly, the disclosure can be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The disclosed aspects, therefore, are not to be taken as limiting but are merely intended to illustrate general subsystems arranged to perform the steps of the disclosure.

[0210] Furthermore, although operations can be depicted in the drawings or described herein in a particular order, this should not be understood as requiring or implying that such operations be performed in the particular order shown or in sequential order, or that all operations be performed, to achieve desirable results. Other operations that are not depicted or described can be incorporated into exemplary methods and processes. For example, one or more additional operations can be performed before, after, simultaneously, or between any of the operations described herein. Further, the operations can be rearranged or reordered in other implementations. Those skilled in the art will appreciate that the actual steps taken in the processes can differ from those shown in the figures. Depending on the example, certain of the steps described above can be removed, others can be added, and some steps can be modified.

[0211] For purposes of the present disclosure, certain aspects, advantages, and novel features are described herein. It is to be understood that not necessarily all such advantages can be achieved in accordance with any particular embodiment. Thus, for example, those skilled in the art will recognize that the disclosure can be embodied or carried out in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other advantages as can be taught or suggested herein.

[0212] Conditional language, such as the phrases“can,”“could,”“might,” or“may,” unless specifically stated otherwise, generally are intended to convey that certain examples include, while other examples do not include, certain features, elements, and / or steps. Thus, such conditional language is not generally intended to imply that certain features, elements, and / or steps are in any way required for one or more examples or that one or more examples necessarily include logic for deciding, with or without user input or prompting, whether these features, elements, and / or steps are included or are to be performed in any specific example.

[0213] Connectivity language, such as the phrase“at least one of’ X, Y, and Z,” unless specifically stated otherwise, is generally intended to convey the same meaning as “X, Y, and Z can be any one of X, Y, and Z.” Thus, such connectivity language is generally not intended to imply that certain examples require at least one of X, at least one of Y, and at least one of Z.

[0214] Degree language, such as the terms“substantially,”“about,” and“approximately,” as used herein mean to be near the indicated value, amount, or characteristic and / or to be reasonably close to the indicated value, amount, or characteristic as would be understood by those of ordinary skill in the art. When used in the context of a range or a parameter, these terms generally mean that the value, amount, or characteristic is within 10%, within 5%, within 1%, or within 0.5% of the stated value, amount, or characteristic.

[0215] The scope of the disclosure is not intended to be limited to the specific examples described in this subsection or elsewhere in this specification and can be defined by the claims as presented at the time of filing of this application. The language of the claims should be interpreted based on the language adopted by the USPTO in the prosecution of the case and in light of the examples set forth in this specification and / or the prosecution history of the case.

Claims

1. A nanopore sensor device for identifying nucleotides, the nanopore sensor device comprising: one or more cis pores; one or more cis electrodes associated with the one or more cis pores; a plurality of trans pores, each of the plurality of trans pores separated from the one or more cis pores by a lipid or solid state membrane having a nanopore; a plurality of field effect transistors (FETs), each of the plurality of FETs associated with one of the plurality of trans pores and each of the plurality of FETs comprising a source terminal; a power source configured to provide an alternating current (AC) input between the one or more cis electrodes and the source terminals of the plurality of FETs; and a controller operably coupled to the plurality of FETs, the controller configured to measure an AC response of the plurality of FETs, wherein the AC response is dependent on an identity of the nucleotide within or near the nanopore.

2. The nanopore sensor device of claim 1, wherein the controller is configured to measure a change in an amplitude of the AC response.

3. The nanopore sensor device of claim 1, wherein the controller is configured to measure a change in a waveform shape of the AC response.

4. The nanopore sensor device of any one of claims 1-3, wherein the power source is configured to provide an AC voltage in a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform alternating between a positive potential and a negative potential.

5. The nanopore sensor device of any one of claims 1-3, wherein an ion flux through the nanopore is modulated by a nucleotide passing through the nanopore, a label on a nucleotide incorporated into a polynucleotide, or any combination thereof.

6. A non-diagnostic method of identifying nucleotides, the method comprising: providing a nanopore within a membrane separating a cis pore from a trans pore; providing an AC input from a power source, the power source operably coupled to a cis electrode in the cis pore and operably coupled to a source terminal of a FET in the trans pore; and measuring an AC response from the FET, wherein the AC response is dependent on an identity of a nucleotide within or near the nanopore.

7. The method of claim 6, wherein measuring the AC response comprises measuring a change in an amplitude of the AC response.

8. The method of claim 6, wherein measuring the AC response comprises measuring a change in a waveform of the AC response.

9. The method of any one of claims 6-8, wherein providing the AC input comprises providing an AC voltage in a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform alternating between a positive potential and a negative potential. ​ ​ 10. The method of any one of claims 6-8, wherein measuring the AC response comprises measuring a first response associated with a first nucleotide and a second response associated with a second nucleotide without waiting for the transient response to approach the steady state response.

11. A sensor device for identifying a nucleotide, the sensor device comprising: an electrode; a FET comprising a gate terminal and a source terminal; a partially double-stranded nucleic acid polymer, one end of which is operably coupled to the electrode and the other end of which is operably coupled to the gate terminal of the FET; a power source configured to provide an AC input between the electrode and the source terminal of the FET; and a controller operably coupled to the FET, the controller configured to measure an AC response of the FET, wherein the AC response is dependent on the identity of a nucleotide interacting with the partially double-stranded nucleic acid polymer.

12. The sensor device of claim 11, wherein the controller is configured to measure a change in amplitude of the AC response.

13. The sensor device of claim 11, wherein the controller is configured to measure a change in waveform shape of the AC response.

14. The sensor device of any one of claims 11-13, wherein the power source is configured to provide an AC voltage in a sinusoidal waveform, a rectangular waveform, a triangular waveform, a sawtooth waveform, or another suitable waveform, alternating between a positive potential and a negative potential.

15. The sensor device of any one of claims 11-13, wherein electrical conduction through the partially double-stranded nucleic acid polymer is modulated by a nucleic acid label incorporated onto a nucleotide in a polynucleotide, the nucleic acid label being partially complementary to the partially double-stranded nucleic acid polymer. ​

Images