Method for assessing distribution and migration of mongolian bream

Abstract

The present application belongs to the field of animal molecular genetics, and relates to a Mongolian bream distribution and migration evaluation method, which comprises the following steps: 1) selecting N Mongolian bream families of healthy Mongolian breams, each of which comprises M healthy Mongolian breams; 2) implanting ultrasonic markers in the selected healthy Mongolian breams; 3) releasing the Mongolian breams with healed wounds and the healthy Mongolian breams remaining except for the ultrasonic marker in flowing water; 4) tracking and monitoring the released Mongolian breams; 5) recapturing the Mongolian breams in the flowing water; 6) identifying the kinship of the recaptured Mongolian breams; 7) calculating the number of all Mongolian breams in the flowing water where the recaptured Mongolian breams are located; and 8) evaluating the distribution and migration of the Mongolian breams. The present application provides a Mongolian bream distribution and migration evaluation method which can accurately evaluate the wild Mongolian bream resources.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of animal molecular genetics, and relates to a fish distribution and migration evaluation method, in particular to a distribution and migration evaluation method for Pseudobrama simoni. BACKGROUND

[0002] Pseudobrama simoni lives in the middle and upper layers of slow-flowing river bays or lakes, moves agilely, and is relatively dispersed. Pseudobrama simoni breeds in groups from May to July, and overwinters in deep water of rivers or deep pools of lakes in winter. Juvenile Pseudobrama simoni feeds on plankton and aquatic insects, and adult Pseudobrama simoni mainly feeds on small fish. The reproductive season is from May to July, and the spawning peak is in June. Pseudobrama simoni spawns in an environment with flowing water, and the white and adhesive eggs develop and hatch on waterweeds. The ovum quantity is large, and the ovum quantity of an individual with a body length of 400-600 mm is 400-700 million.

[0003] In recent years, the wild Pseudobrama simoni resources have been seriously damaged. The sharp decrease in the number of wild Pseudobrama simoni in the Yangtze River has attracted more and more attention. Due to the large water quantity and wide river surface of the Yangtze River, the number of wild Pseudobrama simoni resources is difficult to accurately evaluate, and thus the distribution and migration law of Pseudobrama simoni in the Yangtze River cannot be accurately researched. SUMMARY

[0004] In order to solve the above technical problems in the background art, the application provides a Pseudobrama simoni distribution and migration evaluation method which can accurately evaluate wild Pseudobrama simoni resources.

[0005] In order to achieve the above purpose, the application adopts the following technical scheme:

[0006] A primer for identifying Pseudobrama simoni, characterized in that the primer for identifying Pseudobrama simoni is a Pseudobrama simoni double-PCR microsatellite primer, the Pseudobrama simoni double-PCR microsatellite primer is 5 groups, each group of Pseudobrama simoni double-PCR microsatellite primer includes two primer sequences, and the 5 groups of Pseudobrama simoni double-PCR microsatellite primers are as follows:

[0007] The first group includes a Pseudobrama 1 primer pair and a Pseudobrama 2 primer pair, wherein the forward primer F of the Pseudobrama 1 primer pair is AGCACCTTATTTCTCCCACTT, and the reverse primer R is GGCGTGCTTCACTTCTCTCT; the forward primer F of the Pseudobrama 2 primer pair is CAATGGAAGGTCAAGCCAAT, and the reverse primer R is GGAATGTCCCCACAATTCGC;

[0008] Group II includes the 3-primer pair and the 4-primer pair; the forward primer F of the 3-primer pair is TGATGCATGTAGCGCCTCAC, and the reverse primer R is AGATCATGTGGGGTCTGTGAC; the forward primer F of the 4-primer pair is AGCTGGGCTGAGAGCAGAAG, and the reverse primer R is GCAACCAGGGACGTACATAT.

[0009] Group III includes the 5-phase primer pair and the 6-phase primer pair; the forward primer F of the 5-phase primer pair is CCCGAGCCTTACTCCTTTCT, and the reverse primer R is CTCAGAGGCGAGAAAACCAG; the forward primer F of the 6-phase primer pair is ACAATCCGCCACCTAGGAAC, and the reverse primer R is AACAAGAAGCCAAGGCAAGA.

[0010] Group IV includes the Mg7 primer pair and the Mg8 primer pair; wherein, the forward primer F of the Mg7 primer pair is GCAGAGATGGAGGAGGATGT, and the reverse primer R is CGGATGGTTCCTGGATAAAG; the forward primer F of the Mg8 primer pair is CAATGTACGCCTTGGGTTTT, and the reverse primer R is TGGCAGCTTTGCAAATACAC.

[0011] Group V includes the Mongolian 9 primer pair and the Mongolian 10 primer pair; wherein, the forward primer F of the Mongolian 9 primer pair is GCTCATGTCCGATATTGGTG, and the reverse primer R is CCATCTTTGTGGGGACATTT; the forward primer F of the Mongolian 10 primer pair is AAACAGGGCTGAATGCTTTG, and the reverse primer R is TGAGGGAGGTACCAGTTGAG.

[0012] An application of primers for identifying Culter alburnus as described above in the identification of Culter alburnus.

[0013] An application of primers for identifying Culter alburnus as described above in determining the kinship of Culter alburnus.

[0014] A method for assessing the distribution and migration of Culter alburnus based on primers for identification of Culter alburnus as described above, characterized in that the assessment method includes the following steps:

[0015] 1) Select healthy Culter alburnus from N families, with each family including M healthy Culter alburnus.

[0016] 2) Implant ultrasound markers into the healthy Culter alburnus selected in step 1), and raise the Culter alburnus until the wounds heal; the number of ultrasound markers implanted in the healthy Culter alburnus of each Culter alburnus family is S, where S ≥ 5%M;

[0017] 3) Release the wound-healed Culter alburnus and the remaining healthy Culter alburnus, except those marked with ultrasonic markers, into flowing water;

[0018] 4) Track the movement of the released Culter alburnus and monitor its location to obtain its movement data;

[0019] 5) Based on the results of step 4), recapture the Mongolian bream in flowing water;

[0020] 6) Use primers for identifying Mongolian bream to determine the kinship of recaptured Mongolian bream;

[0021] 7) Calculate the total number of all Mongolian carp in the flowing water area where they were caught;

[0022] 8) Assess the distribution and migration of the Mongolian bream based on the results of step 7).

[0023] As a preferred embodiment, the specific implementation of step 6) in this invention is as follows:

[0024] 6.1) Extract DNA from the fin rays of the recaptured Culter mongolica;

[0025] 6.2) The DNA obtained in step 6.1) was amplified by PCR using primers for the identification of Culter alburnus to obtain the amplification product;

[0026] 6.3) The amplification products were separated by electrophoresis on a 10% polyacrylamide gel;

[0027] 6.4) Use Mega5.0 software and Population software to construct a clustering development tree based on the separation results of step 6.3);

[0028] 6.5) Identify the phylogenetic relationships of the recaptured Culter alburnus based on the cluster developmental tree obtained in 6.4).

[0029] Preferably, in step 6.2) of the present invention, the PCR reaction system is 25ul: 10×PCR Buffer 3ul, 2.5mmol / L dNTP 2ul, 2mmol / L MgCl2 3ul, upstream and downstream primers 1ul each, 5U / μL Taq enzyme 0.5ul, DNA template 2ul, and ultrapure water 10.5ul.

[0030] The PCR reaction procedure is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.

[0031] As a preferred embodiment, the specific implementation of step 7) in this invention is as follows:

[0032] 7.1) Compile relevant data on the Mongolian bream recaptured in flowing water, denoted as Q. 回捕 The relevant data, indicating the flowing water area where the Mongolian bream were recaptured, includes: in Q 回捕 The number A of the Mongolian Culter alburnus with implanted ultrasound tags obtained from the recapture, and the data obtained in step Q based on the monitoring data in step 4). 回捕 The number of Mongolian bream implanted with ultrasound markers (B) in Q 回捕 The number of Mongolian bream obtained by recapture (D), and based on step 6), the number of fish in data D that have the same kinship as those in data A (C);

[0033] 7.2) Calculate the value in Q using the formula (C+A)÷(A÷B)÷((C+A)÷D). 回捕 The number of all Mongolian bream.

[0034] Preferably, the standard for selection in step 1) of the present invention is that the body length of the Mongolian bream is not less than 40 cm.

[0035] Preferably, the ultrasonic marker used in step 2) of this invention has a specification of V13-1H and a transmission frequency of 69kHz.

[0036] As a preferred embodiment, the specific implementation method of implantation in step 2) of the present invention is as follows: a 0.3 cm incision is made on the ventral midline between the pelvic fin and the anus using a scalpel sterilized with alcohol, the abdomen is opened, an ultrasonic marker sterilized with alcohol is inserted into the abdominal cavity of the Mongolian bream, and finally the wound is sutured with biodegradable sutures. After suturing, erythromycin ointment is applied to the wound, and florfenicol is injected for anti-inflammatory purposes.

[0037] Preferably, the locations for mobile tracking and fixed monitoring of the released Culter alburnus in step 4) of this invention can be, for example, sections of the Yangtze River, including the upper, middle, and lower reaches of the Yangtze River and areas in its tributaries where Culter alburnus activity is frequent. The mobile tracking system includes an ultrasonic receiver (VR100), underwater listening devices (non-directional underwater listening devices VH100 and directional underwater listening devices VH110), a GPS receiver, and a speedboat. Fixed monitoring consists of an ultrasonic receiver (VR2C), a reader, a computer, and VUE reading software; the ultrasonic receiver is commonly referred to as a fixed station. Ultrasonic data is downloaded directly to the software using the ultrasonic receiver (VR100) connected to a data cable. Initially, data is read once a week, and later, data is downloaded once a month.

[0038] Compared with the prior art, the present invention has the following advantages:

[0039] This invention provides a method for studying the distribution and migration patterns of the Mongolian Culter alburnus in the Yangtze River. This method more accurately assesses the population of wild Mongolian Culter alburnus in each section of the Yangtze River compared to traditional methods, providing a data foundation for the conservation of this species. This method can also be used to analyze the phylogenetic relationships of the Mongolian Culter alburnus, preventing inbreeding among individuals. Furthermore, this method can effectively evaluate the effectiveness of release programs, thereby proposing improvements to release methods. Attached Figure Description

[0040] Figure 1 This is an electrophoresis image of PCR products from 24 Culter mongolica fish.

[0041] Figure 2 This is a cluster analysis diagram of the kinship of 18 Culter alburnus samples;

[0042] Figure 3 This is a cluster analysis diagram of the kinship of 24 Culter alburnus samples. Detailed Implementation

[0043] The technical solution provided by the present invention will be described in detail below with reference to specific embodiments: Example 1 Extraction of DNA from Culter mongolica:

[0044] DNA was extracted from the fin rays of the Mongolian Culter alburnus using a DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The specific extraction method (i.e., the instruction manual for the DNA extraction kit) is as follows:

[0045] 1) Take 100 mg of Culter mongholicus fin rays and add 190 μL of ddH2O to a total volume of 200 μL;

[0046] 2) Add 180ul Buffer GB, 20ul Proteinase K and 10ul Rnase in sequence, mix thoroughly with a pipette, and place in a water bath at 56°C for 10 minutes.

[0047] 3) Transfer the above solution to a Spin Column and centrifuge at 12000 rpm for 2 min, then discard the filtrate;

[0048] 4) Add 500 μL of BufferWA to the Spin Column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate;

[0049] 5) Add 500 μL of Buffer WB to the Spin Column and centrifuge at 12,000 rpm for 1 min. Discard the filtrate. (Note: Please make sure that the specified volume of 100% ethanol has been added to the Buffer WB. Add the Buffer WB around the walls of the Spin Column to help completely rinse away the salts adhering to the tube walls.)

[0050] 6) Repeat step 5);

[0051] 7) Centrifuge the Spin Column at 12000 rpm for 2 min on a Collection Tube;

[0052] 8) Place the Spin Column on a new centrifuge tube, add 50 to 200 μL of sterile water or Elution Buffer to the center of the membrane, and let it stand at room temperature for 5 minutes (Note: Heating the sterile water or Elution Buffer to 65°C before use can improve elution efficiency).

[0053] 9) Centrifuge at 12000 rpm for 2 min to elute DNA.

[0054] Example 2: Selection and Screening of Microsatellite Primers

[0055] Microsatellite loci were predicted using MISA software based on high-throughput sequencing data of *Culter mongolica*. The predicted loci were then further screened, with the selection criterion being that each end of the SSR sequence had a length of at least 100 bp, considered as valid SSRs. Initial screening of microsatellite loci involved repeated PCR amplification. The amplified products were detected by 3% gel electrophoresis, and primers that amplified the target band were separated by 10% polyacrylamide gel electrophoresis. Primers with good amplification bands were classified according to product size, and primers of different product sizes were paired and recombined for PCR amplification on 24 *Culter mongolica* samples. Finally, five pairs of dual *Culter mongolica* PCR primers with good performance were selected, as shown in Table 1. The PCR reaction system was 25 μL: 10×PCR Buffer 3 μL, 2.5 mmol / L dNTP 2 μL, 2 mmol / L MgCl2 3 μL, forward and reverse primers 1 μL each, 5 U / μL Taq enzyme 0.5 μL, DNA template 2 μL, and ultrapure water 10.5 μL. The PCR reaction procedure was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃. Electrophoresis results are as follows. Figure 1 As shown. Figure 1 This indicates that the 24 samples of Culter mongolica showed good amplification under dual PCR conditions, using primers from groups 1 and 2. Figure 1 In the image, from left to right, the first 24 samples are amplification products of group 1, and the last 24 samples are amplification products of group 2. The amplified bands are clear with few impurities, making them perfectly suitable for phylogenetic analysis of Culter mongolica.

[0056] Table 1. Detailed information on microsatellite loci.

[0057]

[0058] Example 3

[0059] Six offspring samples were selected from each of three Mongol Culter families. Samples 1-6, 7-12, and 13-18 were from the same family, for a total of 18 samples. DNA was extracted from the fins of each fish. Using the extracted genomic DNA as a template, PCR amplification was performed on each of the 18 samples using the aforementioned primer pairs. The PCR reaction system was 25 μL: 3 μL 10×PCR Buffer, 2 μL 2.5 mmol / L dNTPs, 3 μL 2 mmol / L MgCl2, 1 μL each of forward and reverse primers, 0.5 μL 5 U / μL Taq enzyme, 2 μL DNA template, and 10.5 μL ultrapure water. The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃. The genotypes of the PCR amplification products were determined based on the isolation results; a clustering phylogenetic tree was constructed using mega5.0 software, and the results are as follows: Figure 2 As shown, the 18 samples cluster into three main branches: samples 1-6 form one branch, samples 7-12 form another branch, and samples 13-18 form yet another branch. This embodiment demonstrates that the primers described in this patent have the ability to identify whether unknown Culter alburnus samples belong to the same family.

[0060] Example 4: Method for calculating the phylogenetic relationships of Culter mongolica using microsatellite loci

[0061] Fin strips from 24 *Culter alburnus* individuals were collected. DNA was extracted from the *Culter alburnus* samples. PCR amplification was performed on the DNA of all individuals using microsatellite loci selected in this invention. The PCR reaction system was 25 μL: 3 μL 10×PCR Buffer, 2 μL 2.5 mmol / L dNTP, 3 μL MgCl2, 1 μL each of forward and reverse primers, 0.5 μL 5 U / μL Taq enzyme, 2 μL DNA template, and 10.5 μL ultrapure water. The PCR reaction program was: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃. The PCR amplification products were separated by electrophoresis on a 10% polyacrylamide gel. The genotypes of the PCR amplification products were statistically analyzed based on the separation results. Cluster phylogenetic trees were constructed using mega5.0 software, and the results are shown below. Figure 3 As shown; the kinship between individuals is identified based on the cluster analysis diagram. Figure 3 The 24 individuals of *Culter alburnus* in the figure are shown to belong to three groups: 1, 2, 4, 6, 9, 11, 13, 16, 18, and 19 form one group; 5, 7, 8, 14, 21, and 23 form another group; and 3, 12, 17, 20, 22, and 24 form yet another group. This method can be used to infer the phylogenetic relationship between *Culter alburnus* individuals and those implanted with ultrasound-guided apheresis markers.

[0062] It is not difficult to see that, based on Examples 1 to 4, the present invention provides a method for assessing the distribution and migration of Culter alburnus, which includes the following steps:

[0063] 1) Select healthy Culter alburnus from N families, with each family including M healthy Culter alburnus. The selection criteria is that the body length of the Culter alburnus is not less than 40 cm.

[0064] 2) Implant the healthy Culter alburnus selected in step 1) with an ultrasound marker and raise them until the wound heals. The number of ultrasound markers implanted in each healthy Culter alburnus family is S, where S ≥ 5%M. The ultrasound markers are V13-1H with a transmission frequency of 69kHz. The specific method for implanting the ultrasound markers is as follows: a 0.3 cm incision is made on the ventral midline between the pelvic fin and the anus using a scalpel sterilized with alcohol. The abdomen is opened, and the ultrasound marker sterilized with alcohol is inserted into the abdominal cavity of the Culter alburnus. Finally, the wound is sutured with biodegradable sutures. After suturing, erythromycin ointment is applied to the wound, and florfenicol is injected for anti-inflammatory purposes.

[0065] 3) Release the wound-healed Culter alburnus and the remaining healthy Culter alburnus, except those marked with ultrasonic markers, into flowing water;

[0066] 4) Conduct mobile tracking and fixed monitoring of the released Culter alburnus to obtain their movement data. Locations for mobile tracking and fixed monitoring of the released Culter alburnus can be, for example, sections of the Yangtze River, including the upper, middle, and lower reaches, as well as areas in the tributaries where Culter alburnus are frequently active. The mobile tracking system includes an ultrasonic receiver (VR100), underwater listening devices (non-directional underwater listening devices VH100 and directional underwater listening devices VH110), a GPS receiver, and a speedboat. Fixed monitoring consists of an ultrasonic receiver (VR2C), a reader, a computer, and VUE reading software. The ultrasonic receiver is commonly referred to as a fixed station. Ultrasonic data is downloaded directly to the software using the ultrasonic receiver (VR100) connected to a data cable. Initially, data is read weekly, and later monthly.

[0067] 5) Based on the results of step 4), recapture the Mongolian bream in flowing water;

[0068] 6) Use primers for identifying Mongolian bream to determine the kinship of the recaptured Mongolian bream (as described in all of Examples 1 to 4);

[0069] 7) Calculate the total number of all Mongolian carp in the flowing water area where they were caught. The specific calculation method is as follows:

[0070] 7.1) Compile relevant data on the Mongolian bream recaptured in flowing water, denoted as Q. 回捕 The data indicating the location of the recapture of Mongolian bream includes: in Q 回捕 The number A of the Mongolian Culter alburnus with implanted ultrasound tags obtained from the recapture, and the data obtained in step Q based on the monitoring data in step 4). 回捕 The number of Mongolian bream implanted with ultrasound markers (B) in Q 回捕 The number of Mongolian bream obtained by recapture (D), and based on step 6), the number of fish in data D that have the same kinship as those in data A (C);

[0071] 7.2) Calculate the value in Q using the formula (C+A)÷(A÷B)÷((C+A)÷D). 回捕 The number of all Mongolian bream.

[0072] 8) Assess the distribution and migration of the Mongolian bream based on the results of step 7).

[0073] Example 5: Study on the distribution of Culter alburnus in the Wuhu section of the Yangtze River.

[0074] Ten families of healthy Culter alburnus, totaling 10,000 individuals, were selected. Approximately 80 individuals from each family (over 40 cm in length) were implanted with ultrasonic tags and raised until their sutured wounds healed. These 10,000 individuals were released into the Wuhan section of the Yangtze River. The released individuals were tracked and monitored, and data was collected and analyzed. The released individuals were recaptured in the Wuhu section of the Yangtze River, resulting in the capture of 470 individuals, including 5 with ultrasonic tags. Based on tracking and monitoring, 33 individuals in that area had been tagged with ultrasonic tags. Using the microsatellite tagging method provided by this invention, 85 individuals were identified as related to the tagged individuals. Therefore, of the 470 individuals captured, 90 (85+5) individuals were identified. Therefore, according to the method provided in this article, the total number of wild Culter alburnus in this area is calculated as follows: (85+5)÷(5÷33)÷(90÷470), which means the total number of wild Culter alburnus in this area is 3102, of which the number of released Culter alburnus is (85+5)÷(5÷33), or 594. The same method can be used to calculate the number of Culter alburnus in the Wuhan section, Jiujiang section, Jiangyin section, or other sections of the Yangtze River, as well as the movement patterns of the released Culter alburnus.

Claims

1. A primer for identifying Pterycombus brashimi, characterized by: The identification primer for the Mongolian catfish is a double-PCR microsatellite primer for the Mongolian catfish, which comprises a primer pair of Mong1 and a primer pair of Mong2; wherein the forward primer F of the primer pair of Mong1 is AGCACCTTATTTCTCCCACTT, and the reverse primer R is GGCGTGCTTCACTTCTCTCT; the forward primer F of the primer pair of Mong2 is CAATGGAAGGTCAAGCCAAT, and the reverse primer R is GGAATGTCCCCACAATTCGC.

2. Application of the identification primer for the Mongolian catfish as claimed in claim 1 in the identification of the Mongolian catfish.

3. Application of the identification primer for the Mongolian catfish as claimed in claim 1 in the identification of the kinship of the Mongolian catfish.

4. A method for evaluating the distribution and migration of P. mongolicus based on the primer for identifying P. mongolicus according to claim 1, characterized by: The evaluation method comprises the following steps: 1) selecting N healthy Mongolian catfishes of Mongolian catfish families, and each Mongolian catfish family comprises M healthy Mongolian catfishes; 2) implanting an ultrasonic marker in each of the healthy Mongolian catfishes selected in step 1), and culturing the Mongolian catfishes until the wounds are healed; the number of the ultrasonic markers implanted in each healthy Mongolian catfish of each Mongolian catfish family is S, and S≥5%M; 3) releasing the Mongolian catfishes with healed wounds and the healthy Mongolian catfishes remaining after being marked by the ultrasonic markers into a flowing water area; 4) tracking the released Mongolian catfishes and obtaining movement data of the Mongolian catfishes; 5) recapturing the Mongolian catfishes in the flowing water area according to the results of step 4); 6) identifying the kinship of the recaptured Mongolian catfishes by using the identification primer for the Mongolian catfish as claimed in claim 1; 7) calculating the number of all the Mongolian catfishes in the flowing water area when the Mongolian catfishes are recaptured; 8) evaluating the distribution and migration of the Mongolian catfishes according to the results of step 7).

5. The evaluation method according to claim 4, characterized in that: The specific implementation mode of step 6) is: 6.1) extracting DNA from the fin strips of the recaptured Mongolian catfishes; 6.2) performing PCR amplification on the DNA obtained in step 6.1) by using the identification primer for the Mongolian catfish as claimed in claim 1 to obtain an amplification product; 6.3) performing electrophoretic separation of the amplification product on a 10% polyacrylamide gel; 6.4) using mega5.0 software and population software to make a cluster development tree for the separation results of step 6.3); 6.5) identifying the kinship of the recaptured Mongolian catfishes according to the cluster development tree obtained in 6.4).

6. The evaluation method according to claim 5, wherein in step 6.2), the reaction system during PCR amplification is 25ul: 10×PCR Buffer 3ul, 2.5mmol / L dNTP 2ul, 2mmol / L MgCl2 3ul, 1ul of each of the upstream and downstream primers, 5 U / μL Taq enzyme 0.5ul, DNA template 2ul, and ultrapure water 10.5ul. The reaction program during the PCR amplification is: 94℃ pre-denaturation for 3min; 94℃ denaturation for 30s, annealing temperature recombination for 30s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 10min; 4℃ storage.

7. The evaluation method according to claim 6, characterized in that: The specific implementation of the step 7) is: 7.1) Compile relevant data on the Mongolian bream recaptured in flowing water, denoted as Q. 回捕 The relevant data, indicating the flowing water area where the Mongolian bream were recaptured, includes: in Q 回捕 The number A of the Mongolian Culter alburnus with implanted ultrasound tags obtained from the recapture, and the data obtained in step 4) in Q. 回捕 The number of Mongolian bream implanted with ultrasound markers (B) in Q 回捕 The number of Mongolian bream obtained by recapture (D), and based on step 6), the number of fish (C) in data D that have the same kinship as data A; 7.2) Calculate the number of all Mongolian loaches in Q 回捕 according to the formula (C+A) ÷ (A ÷ B) ÷ ((C+A) ÷ D).

8. The evaluation method according to claim 4 or 5 or 6 or 7, characterized in that: The standard selected in the step 1) is that the body length of the Cottus hangiongensis is not less than 40 cm.

9. The evaluation method according to claim 8, characterized in that: The specification of the ultrasonic marker in the step 2) is V13-1H.

10. The evaluation method according to claim 9, characterized in that: The specific implementation of the step 2) is that a 0.3 cm incision is made on the ventral midline between the ventral fin and the anus by using an alcohol-disinfected scalpel, the abdomen is cut open, the alcohol-disinfected ultrasonic marker is inserted into the abdominal cavity of the Cottus hangiongensis, finally, the wound is sutured with degradable suture thread, after the suture is completed, the wound is smeared with erythromycin ointment, and flunixin is injected for anti-inflammatory.

Images