High specific activity amylase mutant and its application

Abstract

The present invention relates to the field of genetic engineering and protein modification technology, and specifically provides a medium-temperature amylase mutant with high specific activity and its application. The present invention is based on the wild-type medium-temperature amylase ZD7, and provides a mutant comprising single mutation sites of K76L, Q224S, and D325Y. Compared with the wild type, the specific activity of the amylase mutant is generally increased by 161.5%-293.6%, which is conducive to reducing the production cost of the enzyme and promoting its wide application in the industrial field.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering and protein modification, and in particular to a high specific activity amylase mutant and application thereof. Background Art

[0002] Amylase is a general term for enzymes that hydrolyze starch and glycogen. It has the specificity of enzyme preparations. Its main mechanism of action is to hydrolyze starch into maltose, glucose, dextrin, etc. Starch is a storage polysaccharide stored in cells in the form of starch granules during plant growth. It exists in seeds and tubers, such as 70% starch in wheat and 80% in rice. Starch is not a single molecule, but a mixture, consisting of two different types of starch, divided into two categories: straight-chain starch and amylopectin; amylase can be divided into α-amylase, β-amylase, γ-amylase, and isoamylase according to the different positions of starch hydrolysis; it can be divided into bacterial amylase, fungal amylase, and mold amylase according to the microbial source; it can be divided into medium-temperature amylase and high-temperature amylase according to the reaction temperature, medium-temperature amylase at 70°C, and high-temperature amylase at 90-105°C.

[0003] α-amylase is a widely used product in enzyme preparations. It has a long history of application and a large output, accounting for about 25% of the enzyme preparation market. It is mainly used in textile desizing, beer and alcohol production, starch processing, food processing, fermentation industry, pharmaceutical industry, and oil extraction industry. α-amylase uses glycogen or starch as a substrate, cuts the α-1,4 glucosidic bond from the inside of the molecule, and hydrolyzes the substrate into dextrin and a small amount of glucose and maltose. At present, most of the α-amylase strains used in domestic industrial production are mutant strains obtained by mutagenesis of wild strains. Usually, the wild-type α-amylase strains directly isolated from nature have low enzyme production capacity and cannot meet the needs of industrial production. Therefore, how to obtain strains with higher enzyme production capacity has become the key to solving the current amylase preparation industry.

[0004] With the continuous application and development of genetic engineering technology, exogenous expression of various enzymes has received attention. The main recombinant protein expression systems include: Escherichia coli, yeast, insect cells, mammalian cells, transgenic plants or animals expression systems and in vitro translation systems. However, because eukaryotic organisms grow fast, are easy to culture, and have simple genetic manipulations, and have the characteristics of processing, modifying and folding expressed proteins, yeast expression systems are increasingly valued and used. Among them, the Pichia pastoris expression system is one of the more complete and widely used expression systems.

[0005] The invention uses directed evolution technology to screen a large number of mutations of medium-temperature starch genes, and obtains a series of amylase mutants with greatly improved specific activity. Summary of the invention

[0006] The purpose of the present invention is to provide a high specific activity amylase mutant. The specific activity of the mutant is significantly improved compared with the wild type, which is conducive to its wide application in the industrial field.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] In one aspect, the present invention provides an amylase, whose amino acid sequence is SEQ ID NO:2.

[0009] In one aspect, the present invention provides an amylase mutant, wherein the 76th amino acid of the amylase having the amino acid sequence of SEQ ID NO: 2 is changed from Lys to Leu.

[0010] The present invention also provides an amylase mutant, wherein the 224th amino acid of the amylase having the amino acid sequence of SEQ ID NO: 2 is changed from Gln to Ser.

[0011] The present invention also provides an amylase mutant, wherein the amino acid at position 325 of the amylase having the amino acid sequence of SEQ ID NO: 2 is changed from Asp to Tyr.

[0012] The present invention also relates to a DNA molecule encoding the above amylase mutant.

[0013] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0014] The present invention also relates to a host cell, comprising the above recombinant expression vector.

[0015] The host cell is Pichia pastoris ( Pichia pastoris ).

[0016] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed amylase mutant is significantly improved.

[0017] The present invention also provides application of the above amylase mutant in the field of feed.

[0018] The present invention is based on the wild-type mesophilic amylase ZD7, and provides mutants containing single mutation sites of K76L, Q224S or D325Y. At the shaking flask level, the specific activity of the fermentation supernatant in the transformant expressing the wild-type mesophilic amylase ZD7 is as high as 156U / mg; while the specific activity of the fermentation supernatant in the transformant expressing the amylase single-point mutants ZD7-1, ZD7-2, and ZD7-3 is as high as 408U / mg, 480U / mg, and 614U / mg, respectively, which is 161.5%-293.6% higher than the wild type; among them, the mutant ZD7-3 containing the D325Y single-point mutation has the highest specific activity, achieving unexpected technical effects.

[0019] In summary, the specific activity of the mesophilic amylase mutant provided by the present invention is significantly improved, which is beneficial to reduce the production cost of the enzyme and promote its wide application in the industrial field. DETAILED DESCRIPTION

[0020] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example MOLECΜLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECΜLAR BIOLOGY (Ausubel, 2003) in the method of recording. These general references provide definitions and methods known to those skilled in the art. But those skilled in the art can, on the basis of the technical scheme recorded in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, and are not limited to the limitation of specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents:

[0021] Strains and vectors: Escherichia coli DH5α was preserved by our company, Pichia pastoris GS115, vectors pPIC9k, pPICZA, Amp, G418, and Zeocin were purchased from Invitrogen.

[0022] Experimental reagents: DNA polymerase was purchased from Takara, T4 ligase and restriction endonuclease were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0023] Culture medium:

[0024] LB medium (E. coli medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0025] LB+Amp medium: LB medium plus 100 μg / ml ampicillin;

[0026] YPD medium (yeast medium): 1% yeast extract, 2% peptone, 2% glucose;

[0027] YPD+Zeocin medium: YPD medium plus 100 μg / ml Zeocin;

[0028] MD medium (yeast screening medium): 1.34% YNB, 4×10 -5 biotin, 1% glycerol, 2% agarose;

[0029] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0030] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol,

[0031] The method for detecting the enzymatic activity of amylase described in the examples of the present invention refers to GB / T24401-2009.

[0032] The present invention is further described below in conjunction with specific implementation methods.

[0033] Example 1 Gene synthesis of mesophilic amylase ZD7

[0034] Based on the amino acid sequence of the mesophilic amylase gene (GenBank No. WP_017474613.1), the amino acid sequence of the mesophilic amylase was analyzed, its own signal peptide was removed, and then codons were optimized according to the codon preference of Pichia pastoris, and the whole gene was synthesized by BGI. The applicant named the synthesized mesophilic amylase gene ZD7, with a total length of 1452 bp, a nucleotide sequence of SEQ ID NO: 1, encoding 483 amino acids, and the amino acid sequence encoded by it is SEQ ID NO: 2.

[0035] Example 2 Screening of high specific activity mesophilic amylase mutants

[0036] In order to improve the specific activity of mesophilic amylase ZD7, the applicant screened a large number of mutations using directed evolution technology.

[0037] Design PCR Primer 1(F) and Primer 1(R):

[0038] Primer 1 (F): GCGC GAATTC GCTAATTTGAATGGTACATTGATGC (underlined is restriction enzyme Eco RI recognition site);

[0039] Primer 1 (R): TAAA GCGGCCGC TTATCTTTGAACATAAATAGAAACA (underlined are restriction enzymes Not I recognition site).

[0040] The gene fragment of mesophilic amylase ZD7 was used as template, and PCR amplification was performed using the above primers and GeneMorph II random mutation PCR kit (Biomax). The PCR product was recovered by gel. Eco RI, Not After enzyme digestion, the transformants were connected with the pET21a vector after the same enzyme digestion, transformed into Escherichia coli BL21 (DE3), spread on LB+Amp plates, and inverted at 37°C. After the transformants appeared, they were picked one by one with a toothpick to a 96-well plate, and 150 ul of LB+Amp medium containing 0.1 mM IPTG was added to each well, and cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended with buffer, and the cells were repeatedly frozen and thawed to break the cell wall to obtain Escherichia coli cell lysate containing medium-temperature amylase. The cell lysate was then centrifuged, and the supernatant was taken for amylase activity determination and protein content determination, respectively, to calculate the specific activity levels of different mutants.

[0041] The experimental results showed that some mutations had no effect on the specific activity of mesophilic amylase ZD7, and some mutations even made its specific activity lower. Finally, the applicant screened out single point mutations that could significantly improve the specific activity of mesophilic amylase ZD7: K76L, Q224S, D325Y.

[0042] The mesophilic amylase mutant containing the K76L single-point mutation was named ZD7-1;

[0043] The mesophilic amylase mutant containing the Q224S single-point mutation was named ZD7-2;

[0044] The mesophilic amylase mutant containing the D325Y single point mutation was named ZD7-3.

[0045] The amino acid sequences of mutants ZD7-1, ZD7-2 and ZD7-3 are SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0046] With reference to the above amino acid sequences, the encoding nucleotide sequences of the mutants were synthesized respectively.

[0047] Example 3 Expression of mesophilic amylase in Pichia pastoris

[0048] 1. Construction of recombinant plasmid

[0049] The mesophilic amylase gene ZD7 and its mutant genes (ZD7-1, ZD7-2, and ZD7-3) were respectively cleaved with restriction endonucleases Eco RI and NotI was used for double digestion, and the expression vector pPIC9K was double digested with the same restriction endonuclease. The 100 μl digestion system was as follows: gene fragment / vector 40 μl, 10×H buffer 10 μl, 10×BSA 10 μl, Eco RI5 μl, Not I 5 μl, ddHO 2 After digestion at 37℃ for 4 h, the fragments were recovered by agarose gel electrophoresis.

[0050] The mesophilic amylase gene fragments after double digestion were connected to the expression vector pPIC9K respectively. The connection system was as follows: 5 μl of the expression vector pPIC9K double digestion product, 3 μl of the mesophilic amylase gene double digestion product, 10×T 4 ligase buffer 1 μl, T 4 ligase 1 μl. Ligate overnight at 22°C, transform into E. coli DH5α, and select transformants for sequencing verification. Transformants verified to be correct by sequencing are transferred to LB+Amp liquid culture medium, cultured overnight at 37°C, and plasmids are extracted to obtain the recombinant yeast expression plasmid.

[0051] 2. Conversion and screening

[0052] The recombinant yeast expression plasmids constructed above were used Sal I was linearized, and the linearized product was purified by a column purification kit, and then transformed into Pichia pastoris GS115 by electroporation, and coated on MD plates. The colonies grown on the MD plates were Pichia pastoris engineering strains that recombinantly expressed mesophilic amylase ZD7 or its mutants, and then coated on YPD plates containing different concentrations of Geneticin G418 to screen for multi-copy transformants.

[0053] 3. Shake flask fermentation verification

[0054] Single multi-copy transformants were selected and inoculated into BMGY medium, shaken and cultured at 30°C and 220 rpm for 24 hours, and then transferred to BMMY medium, shaken and cultured at 30°C and 220 rpm, and 0.5% methanol was added every 24 hours. After induced expression for 4 days, the bacteria were removed by centrifugation, and the supernatant was subjected to medium-temperature amylase activity and protein content determination, and the specific activity was calculated.

[0055] The results showed that at the shake flask level, the specific activity of the fermentation supernatant of the transformants expressing the wild-type mesophilic amylase ZD7 reached a maximum of 156 U / mg; while the specific activity of the fermentation supernatant of the transformants expressing the amylase single-point mutants ZD7-1, ZD7-2, and ZD7-3 reached a maximum of 408 U / mg, 480 U / mg, and 614 U / mg, respectively, which were 161.5%-293.6% higher than that of the wild type; among them, the mutant ZD7-3 containing the D325Y single-point mutation had the highest specific activity, achieving unexpected technical effects.

[0056] 1. Amylase activity detection method

[0057] Refer to GB / T24401-2009 method.

[0058] 2. Coomassie Brilliant Blue Method for Protein Content Detection

[0059] 1. Reagents

[0060] (1) Coomassie Brilliant Blue G-250 staining solution: Dissolve 100 mg of Coomassie Brilliant Blue G-250 in 50 ml of 95% ethanol, add 100 ml of 85% phosphoric acid, and dilute to 1 liter with water. It can be used at room temperature for 1 month.

[0061] (2) Standard protein solution: Use bovine serum albumin, determine the protein content in advance by the micro-Kjeldahl method, and prepare a 1 mg / ml protein standard solution based on its purity;

[0062] (3) Preparation of standard stock solution: Accurately weigh 0.05g of crystallized bovine serum albumin on an analytical balance, dissolve it in a small beaker, add a small amount of distilled water, and transfer it to a 50ml volumetric flask. Rinse the residual liquid in the beaker several times with a small amount of distilled water, pour the rinse liquid into the volumetric flask, and finally dilute to the mark with distilled water. Prepare a standard stock solution with a bovine serum albumin concentration of 1000μg / ml.

[0063] 2. Drawing of standard curve.

[0064] (1) Take 6 test tubes, number them, add reagents according to the table below, and mix well.

[0065] Tube No. 1 2 3 4 5 6 Sample (ml) 0 0.1 0.2 0.3 0.4 0.5 Water (ml) 2.0 1.9 1.8 1.7 1.6 1.5 Protein content (mg / ml) 0 0.05 0.1 0.15 0.2 0.25

[0066] Accurately pipette 2.5 ml of Coomassie Brilliant Blue solution into 6 clean test tubes. Accurately pipette 0.1 ml of the solution from each tube into the corresponding test tubes. Vortex to mix evenly. After leaving at room temperature for 5 min, adjust the value of zero with test tube No. 1, measure the colorimetric value at 595 nm, and record the absorbance.

[0067] (2) Draw a standard curve: record the absorbance values ​​of tubes 1-6, and draw a standard curve with protein content (μg) as the horizontal axis and absorbance as the vertical axis. Note that due to the strong staining ability of Coomassie Brilliant Blue, the colorimetric cup must be cleaned. Do not use a quartz cup for measurement.

[0068] 3. Sample determination

[0069] Sample preparation:

[0070] (1) Liquid samples: dilute the sample to be tested to a protein content of 0.1-0.3 mg / ml, and control the absorbance value after removing the blank (after subtracting the blank) to be between 0.2-0.4;

[0071] (2) Solid samples: Accurately weigh 1.0000 g of sample into a 100 ml Erlenmeyer flask, add 20 ml of deionized water using a pipette, stir magnetically for 10 min, centrifuge at 4000 rpm for 10 min, take the supernatant and further dilute to determine the protein content. The dilution method is the same as that for liquid samples.

[0072] Sample testing:

[0073] Take a clean test tube, add it to 2.5ml Coomassie Brilliant Blue solution, then add the sample to be tested, vortex and shake well, leave it at room temperature for 5 minutes, use the standard curve blank as a control, measure the absorbance at 595nm with a micro-colorimetric cup with a light path of 1cm, and calculate the protein content based on the standard curve.

[0074] 4. Calculation of protein content

[0075] Protein content = X × dilution factor × standard sample conversion factor.

[0076] X: protein content calculated from the standard curve (mg / ml);

[0077] Standard sample conversion value: The standard sample is 47 mg / ml, and a coefficient is calculated based on the actual measured value.

[0078] (III) Calculation of specific activity

[0079] "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.

[0080] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0081] In summary, the three mutation sites K76L, Q224S and D325Y provided by the present invention can significantly improve the specific activity of mesophilic amylase ZD7, thereby helping to reduce the production cost of the enzyme and promote its wide application in the industrial field.

Claims

1. An amylase mutant, characterized in that The amino acid sequence of the amylase mutant is SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:

5.

2. Use of the amylase mutant according to claim 1 in the field of feed.

3. A DNA molecule encoding the amylase mutant according to claim 2.

4. A recombinant plasmid comprising the DNA molecule of claim 3.

5. A host cell comprising the recombinant plasmid according to claim 4, characterized in that: The host cell is Pichia pastoris ( Pichia pastoris ).

6. Use of the host cell according to claim 5 in the production of amylase.