A high specific activity alkaline xylanase mutant

By performing a single-point mutation of wild-type xylanase at H61L and expressing it in Pichia pastoris, the specific activity of xylanase was significantly improved, solving the problem of insufficient specific activity, reducing production costs, and promoting its application in the industrial field.

CN120624413BActive Publication Date: 2026-03-31QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-03
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing xylanases have insufficient specific activity in industrial applications, resulting in high production costs and limiting their widespread use.

Method used

A high-specific-activity basic xylanase mutant was constructed by mutating the amino acid sequence of wild-type xylanase from His to Leu, and then recombinantly expressed in Pichia pastoris to improve the enzyme's specific activity.

Benefits of technology

The specific activity of the xylanase mutant was increased by 23.97%, production costs were reduced, and its application in the industrial field was promoted.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005431233330000061
    Figure BDA0005431233330000061
  • Figure BDA0005431233330000071
    Figure BDA0005431233330000071
Patent Text Reader

Abstract

The present application relates to the field of genetic engineering and protein engineering, and particularly relates to a high specific activity alkaline xylanase mutant. The present application provides a mutant containing H61L mutation site based on wild type xylanase H1. The specific activity of the mutant is significantly higher than that of the wild type, which is beneficial to reduce the production cost and promote its wide application in the industrial field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering technology, specifically to a high specific activity basic xylanase mutant and its applications. Background Technology

[0002] Plant cell walls are primarily composed of cellulose, hemicellulose, and lignin. Xylan is the main component of hemicellulose in plant secondary cell walls. Its main component is D-xylose, a pentose sugar that can be converted into single-cell proteins and chemical fuels by microbial cells—the cheapest "chemical factories." In plant materials, xylan exists beneath lignin and cellulose, tightly bound together with them. The side-chain groups of xylan are chemically linked to lignin, and further bonded to cellulose through hydrogen bonds and with the participation of substances like pectin, forming a dense structure. This dense structure plays a crucial role in maintaining plant morphology. Xylan is widely distributed and abundant in nature.

[0003] Due to the heterogeneity and complex chemical properties of plant xylan, its complete decomposition requires the synergistic action of several classes of hydrolytic enzymes with different specificities and modes of action. The xylanase system that performs xylan hydrolysis typically consists of a series of hydrolytic enzymes: β-1,4-endoxylanase, β-xylosidase, α-L-arabinofuranylase, α-glucuronidase, acetylxylan esterase, etc. All these enzymes work synergistically to convert xylan into its constituent sugars. This multifunctional xylanase system is widely found in fungi, actinomycetes, and bacteria.

[0004] Fungi generally possess a strong ability to produce xylanases. However, fungal xylanases are typically cross-linked with cellulases. For effective bleaching in the pulp bleaching industry, selective synthesis of xylanases with low (or no) cellulase activity is necessary. Since the synthesis conditions for xylanases and cellulases differ significantly, a comprehensive and systematic understanding of the factors influencing xylanase synthesis is crucial for regulating its targeted synthesis and thus for its practical application in pulp bleaching.

[0005] Over the years, the use of xylanase in the pulp and paper industry has steadily increased. In addition, xylanase is used as a feed additive for poultry, in wheat flour to improve dough processing and the quality of baked goods, in the extraction of coffee, vegetable oils and starches, to improve the nutritional properties of agricultural silage and grain feeds, and in combination with pectinase and cellulase for clarifying juices and removing gums from plant fiber sources.

[0006] Due to the significant application value of xylanase and the development of bioengineering technology, many researchers are now dedicated to the development and research of xylanase, such as the selection of high-yielding strains, the construction of engineered bacteria, the optimization of culture conditions, and the development of xylanases that are resistant to high temperatures, acids, alkalis, and free from cellulase contamination. The success of these studies will undoubtedly promote the commercial application of xylanase in industries such as papermaking, feed, and food, allowing it to realize its enormous potential and role in various sectors. Summary of the Invention

[0007] The purpose of this invention is to provide a high specific activity alkaline xylanase mutant. The specific activity of the mutant is significantly increased compared to the wild type, which is beneficial for its widespread application in industrial fields.

[0008] One aspect of this invention relates to a xylanase mutant, which is obtained by mutating the 61st amino acid of the xylanase with the amino acid sequence SEQ ID NO:1 from His to Leu.

[0009] The present invention also relates to DNA molecules encoding the above-mentioned mutants.

[0010] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0011] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0012] When the above plasmids were transferred into host cells, the specific activity of the recombinant xylanase mutant was significantly improved.

[0013] In some embodiments of the present invention, the host cell is Pichia pastoris.

[0014] Based on wild-type xylanase H1, this invention provides a xylanase mutant containing the H61L single-point mutation. Compared with wild-type xylanase H1, the specific activity of the xylanase mutant provided by this invention is increased by 23.97%, reaching 1469 U / mg, achieving unexpected technical effects.

[0015] In summary, the specific activity of the alkaline xylanase mutant provided by this invention is significantly improved, which is beneficial for reducing production costs and promoting its widespread application in industries such as papermaking. Detailed Implementation

[0016] This invention discloses an alkaline xylanase mutant, its preparation method and application, the DNA molecule encoding the xylanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0017] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLS IN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:

[0018] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0019] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.

[0020] Culture medium formulation:

[0021] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0022] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0023] Yeast selection medium (MD medium): 2% peptone, 2% agarose;

[0024] BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10⁻⁶ -5 % Biotin, 1% Glycerin;

[0025] BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10⁻⁶ -5 % Biotin, 0.5% Methanol;

[0026] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0027] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.

[0028] The present invention will be further illustrated below with reference to the embodiments:

[0029] Example 1 Construction of recombinant plasmid

[0030] The xylanase gene derived from *Paecilomyces sp.* was optimized according to the codon preference of *Pichia pastoris*, with the addition of six bases GAATTC (EcoR I cleavage site) before the start codon ATG and GCGGCCGC (Not I cleavage site) after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. This xylanase was named H1, with its amino acid sequence SEQ ID NO: 1 and encoding nucleotide sequence SEQ ID NO: 2.

[0031] The xylanase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, plasmid pPIC9K was digested with the same restriction endonucleases. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α *E. coli* (Invitrogen) and selected using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

[0032] The plasmid was purified from the correctly sequenced E. coli clone using the Plasmid Mini-Preparation Kit (Omega) to obtain one recombinant plasmid, which was named pPIC9K-H1.

[0033] Example 2: Screening of high specific activity mutants

[0034] To further enhance the enzymatic activity of basic xylanase H1, the applicant conducted protein structure analysis. This protein belongs to the GH11 family of xylanases and has a β-jelly roll structure. The applicant screened a large number of mutants of this enzyme using directed evolution technology.

[0035] 1.1 Design of PCR primers H1-F1 and H1-R1:

[0036] H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (The underlined part is the EcoRI restriction enzyme recognition site);

[0037] H1-R1: ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (The underlined part is the NotI restriction enzyme recognition site).

[0038] Using the H1 gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The ligation product was then transformed into Escherichia coli BL21(DE3), plated on LB-Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing xylanase.

[0039] 30 μL of lysis buffer was transferred to two new 96-well plates. 30 μL of substrate was added to one well, and the mixture was incubated at 37°C for 30 min. The reducing sugar content was determined using the DNS method. 150 μL of Coomassie Brilliant Blue solution was added to the other well, and the mixture was allowed to stand for 10 min. The protein content was determined using the Coomassie Brilliant Blue (Bradford) binding assay. The enzyme activity and protein content of different mutants were calculated. Ultimately, the applicant screened over 20,000 transformants and identified a mutation site, H61L, that significantly increased xylanase specific activity.

[0040] Based on the above-mentioned wild-type basic xylanase H1, this invention provides a mutant containing a single-point mutation of H61L.

[0041] Example 3: Expression of xylanase in Pichia pastoris

[0042] 3.1 Construction of expression plasmids

[0043] Based on the codon preference of Pichia pastoris, the gene sequences of alkaline xylanase H1 and its mutants were optimized and synthesized by Shanghai Jierui Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.

[0044] Following the method described in Example 1, the gene sequences of the synthesized xylanase H1 and its mutants were double-digested with EcoRI and NotI, respectively. Then, they were ligated into the pPIC-9K vector, which had undergone similar digestion, overnight at 16°C, and transformed into *E. coli* DH5α. The transformed samples were plated on LB-Amp plates and incubated upside down at 37°C. After transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM) 0.5 μL, 3' AOX primer 0.5 μL, ddH2O 14.5 μL; reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). Positive clones were verified, and the correct recombinant expression plasmid was obtained after sequencing.

[0045] 3.2 Construction of Pichia pastoris engineered strains

[0046] 3.2.1 Preparation of competent yeast cells

[0047] Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30°C for 48 h. Then, a single activated GS115 colony was inoculated into 6 mL of YPD liquid medium and cultured at 30°C and 220 rpm for approximately 12 h. The culture was then transferred to 30 mL of YPD liquid medium. In Erlenmeyer flasks containing YPD liquid culture medium, the cells were incubated at 30°C and 220 rpm for approximately 5 hours. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 4°C and 9000 rpm for 2 minutes into sterile EP tubes. The supernatant was gently discarded, and any remaining supernatant was blotted dry with sterile filter paper. The cells were then resuspended in 1 mL of pre-cooled sterile water. After centrifugation at 4°C and 9000 rpm for 2 minutes, the supernatant was gently discarded. The cells were washed once more with 1 mL of sterile water, then centrifuged at 4°C and 9000 rpm for 2 minutes, and the supernatant was gently discarded. The cells were then resuspended in 1 mL of pre-cooled sorbitol (1 mol / L). Finally, after centrifugation at 4°C and 9000 rpm for 2 minutes, the supernatant was gently discarded, and the cells were gently resuspended in 100–150 μL of pre-cooled sorbitol (1 mol / L).

[0048] 3.2.2 Conversion and Screening

[0049] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.

[0050] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm with shaking for 1 day; then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking; 0.5% methanol was added daily for 4 days to induce expression; the cells were removed by centrifugation at 9000 rpm for 10 min, yielding fermentation supernatants containing wild-type xylanase H1 and its mutant, respectively. The xylanase activity and protein content of the fermentation supernatants were measured, and the specific activity was calculated.

[0051] 1. Method for determining xylanase activity

[0052] (1) Definition of xylanase activity unit

[0053] Under conditions of 50℃ and pH 8.0, the amount of enzyme required to degrade and release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / mL is defined as one unit of enzyme activity, denoted by U.

[0054] (2) Method for determining xylanase activity

[0055] Take 10.0 mL of xylan solution and equilibrate at 50 °C for 20 min.

[0056] Take 10.0 mL of appropriately diluted enzyme solution and equilibrate at 50°C for 5 min.

[0057] Blank sample determination: Pipette 2.00 mL of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, add 5 mL of DNS reagent, and vibrate electromagnetically for 3 s. Then add 2.0 mL of xylan solution, equilibrate at 50℃ for 30 min, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, add water to a final volume of 25 mL, and vibrate electromagnetically for 3–5 s. Using the standard blank sample as a blank control, measure the absorbance A at 540 nm. B .

[0058] Sample determination: Pipette 2.00 mL of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, then add 2.0 mL of xylan solution (equilibrated at 50℃), vibrate electromagnetically for 3 s, and precisely incubate at 50℃ for 30 min. Add 5.0 mL of DNS reagent, vibrate electromagnetically for 3 s to terminate the enzymatic reaction. Heat in a boiling water bath for 5 min, cool to room temperature with tap water, and dilute to 25 mL with water, vibrating electromagnetically for 3 s. Using a standard blank sample as a blank control, measure the absorbance A at 540 nm. E .

[0059] Formula (1): XD=[(A E -A B )×K+C0]×1000 / (M×t).

[0060] In the formula:

[0061] X D — Xylanase activity in the sample dilution, U / mL;

[0062] A E —Absorbance of the enzyme reaction solution;

[0063] A B —Absorbance of the enzyme blank sample;

[0064] K—the slope of the standard curve;

[0065] C0—The intercept of the standard curve;

[0066] M—Molar mass of xylose M(C5XYN) 110 O5) = 150.2 g / mol;

[0067] t—Enzymatic hydrolysis reaction time, min;

[0068] 1000 — conversion factor, 1 mmol = 1000 μmol;

[0069] X D The value should be between 0.04 and 0.10 U / mL. If it is not within this range, the enzyme dilution should be changed and the analysis should be performed again.

[0070] Formula (2): X = X D ×D f .

[0071] In the formula:

[0072] X—Xylanase activity in the sample, U / mL;

[0073] D f —The dilution factor of the sample.

[0074] The calculated enzyme activity values ​​are retained to three significant figures.

[0075] 2. Protein content determination method

[0076] The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it obeys Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.

[0077] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and then the protein content was determined using the Coomassie Brilliant Blue (Bradford) binding method.

[0078] 3. Specific vitality calculation

[0079] "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.

[0080] Specific activity calculation formula: Specific activity (U / mg) = Enzyme activity (U / mL) / Protein content (mg / mL).

[0081] The specific calculation results are shown in Table 1.

[0082] Table 1 Comparison of specific activities of xylanase and its mutants

[0083]

[0084]

[0085] As can be seen from the results in Table 1, compared with wild-type xylanase H1, the specific activity of the xylanase mutant provided by the present invention was increased by 23.97%, reaching 1469 U / mg, achieving unexpected technical results.

[0086] In summary, the specific activity of the alkaline xylanase mutant provided by this invention is significantly improved, which helps to reduce the production cost of the enzyme and promote its widespread application in the industrial field.

Claims

1. A xylanase mutant, characterized in that, The mutant is obtained by mutating the 61st amino acid of xylanase with amino acid sequence of SEQ ID NO: 1 from His to Leu.

2. A DNA molecule encoding the xylanase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid of claim 3.

5. The host cell of claim 4, wherein The host cell is Pichia pastoris Pichia pastoris ).

Citation Information

Patent Citations

  • ISOLATED POLYPEPTIDE, COMPOSITION, RECOMBINANT HOST CELL, METHODS FOR PRODUCING THE POLYPEPTIDE, A POLYPEPTIDE HAVING CELLULOLYTIC ENHANCER ACTIVITY, A PRECURSOR CELL MUTANT, A PROTEIN AND A FERMENTATION PRODUCT, TRANSGENIC PLANT, PLANT PART OR PLANT CELL, DOUBLE-STRAND INHIBITING RNA MOLECULE (RSRNA), AND METHODS FOR INHIBITING THE EXPRESSION OF A POLYPEPTIDE HAVING CELLULOLYTIC ENHANCER ACTIVITY IN A CELL, DEGRADING OR CONVERTING AN ISOLATED POLYPEPTIDE, COMPOSITION, RECOMBINANT HOST CELL, METHODS FOR PRODUCING THE A polypeptide, a polypeptide having cellulolytic enhancing activity, a mutant of a precursor cell, a protein and a fermentation product, a transgenic plant, a plant part or plant cell, a double-stranded RNA inhibitor molecule (DSRNA), and methods for inhibiting the expression of a polypeptide having cellulolytic enhancing activity in a cell.To degrade or convert a cellulosic material and to ferment a cellulosic material.

    BR112012006032A2

  • Heat resistant xylanase as well as coding gene and application thereof

    CN101659948A