An aldolase mutant and use thereof
By mutating thermophilic aldolases with F184Y and W199E, a highly active and tolerant aldolase mutant was constructed, solving the substrate tolerance and activity problems of DERA enzymes in the catalytic synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran, and realizing efficient industrial production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NINGBO HEHENG TECH CO LTD
- Filing Date
- 2023-05-16
- Publication Date
- 2026-04-28
AI Technical Summary
Existing industrial DERA enzymes exhibit poor substrate tolerance and low activity when catalyzing the synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran, making them unsuitable for large-scale industrial production.
By site-directed mutagenesis of wild-type aldolase from thermophilic bacterium Thermotoga maritima, two amino acid mutations, F184Y and W199E, an aldolase mutant with higher substrate tolerance and catalytic activity was constructed and expressed in Escherichia coli BL21, forming a genetically engineered strain.
The aldolase mutant exhibits nearly four times the catalytic activity and significantly improved substrate tolerance, making it suitable for industrial production in high-concentration substrate environments and reducing production costs.
Smart Images

Figure BDA0004238505420000081
Abstract
Description
Technical Field
[0001] This invention belongs to the field of enzyme engineering technology, specifically relating to an aldolase mutant and its applications. Background Technology
[0002] Statins are a class of cholesterol-lowering drugs. As inhibitors of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reduction, they competitively bind to this enzyme, preventing HMG-CoA from being converted into mevalonic acid, an endogenous cholesterol precursor, thereby blocking cholesterol synthesis and lowering cholesterol levels.
[0003] Statin drug side chain intermediates have two chiral centers. Currently, they are generally synthesized through a step-by-step biocatalytic reaction, which results in low yields and high costs for statin drug side chain synthesis. If it were possible to generate both chiral centers in a single step via biocatalysis, the number of reaction steps could be greatly reduced and production costs lowered.
[0004] The most widely studied aldolases in *E. coli* (DERA enzymes) catalyze the formation of (3R,5S)-dihydroxy esters with two chiral centers, exhibiting enantiomeric and diastereomeric excess values greater than 99.5% and 99%, respectively. For example, they catalyze the aldol condensation of acetaldehyde and chloroacetaldehyde to produce 6-chloro-(3R,5S)-dihydroxyaldehyde, which then spontaneously cyclizes to (4R,6S)-2,4-dihydroxy-6-chloromethylpyran. However, *E. coli* aldolases suffer from low aldol condensation activity and poor resistance to substrate denaturation, making them unsuitable for large-scale industrial production.
[0005] DERA enzymes can catalyze the synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran. The resulting target product, (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran, serves as an important intermediate in the synthesis of statins; therefore, DERA enzymes have significant application value in the pharmaceutical field.
[0006] Currently, the industrial DERA enzymes used in the industrial synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran have poor catalytic synthesis performance and poor substrate tolerance, making it difficult to catalyze the synthesis reaction under high substrate concentrations.
[0007] Therefore, a site-directed mutagenesis technique was proposed to modify industrial DERA enzymes. The gene sequence encoding the DERA enzyme protein from the thermophilic bacterium *Thermotoga maritima* was ligated into pET-11a to construct a recombinant plasmid, and *Escherichia coli* BL21(DE3) was used as the recombinant expression system. A mutant strain with higher substrate tolerance and higher catalytic synthesis capacity was designed for industrial production, thereby improving the yield of the target product.
[0008] For example, Chinese invention application CN103409402A discloses a high-performance DERA enzyme that catalyzes aldol condensation. This enzyme introduces one or more site mutations against wild-type Escherichia coli DERA enzyme: V29A, T142P, M185V, K196E, and F199I. Compared with wild-type Escherichia coli DERA enzyme, the mutant has improved substrate tolerance and more efficient catalytic ability.
[0009] Chinese invention application CN111876404A discloses an aldolase mutant, its encoding gene, and its application in the production of statin drug intermediates, belonging to the field of molecular biology technology. The amino acid sequence of the aldolase mutant is shown in SEQ ID NO.1. Based on the wild-type aldolase of the thermophilic bacterium *Thermotoga maritima*, this invention introduces site-directed mutations into its encoding gene, changing the codon at position 184 (TTT) encoding phenylalanine to the codon encoding isoleucine (ATT), and changing the serine at position 233 (Ser) to alanine (Ala). The resulting aldolase mutant exhibits significantly improved activity in aldol condensation reactions using acetaldehyde and chloroacetaldehyde as substrates, with a 0.86-fold increase in catalytic efficiency. Summary of the Invention
[0010] To address the issues of poor substrate tolerance and low activity of current industrial DERA enzymes in the industrial production of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran, this paper presents a site-directed mutagenesis mutant of DERA enzyme, its gene, and its application. Compared with the original industrial DERA enzyme, it exhibits better substrate tolerance and catalytic synthesis ability.
[0011] An aldolase mutant, the amino acid sequence of which is shown in SEQ ID No. 4. This aldolase mutant was obtained by double mutation of wild-type DERA enzyme from Escherichia coli with the amino acid sequence shown in SEQ ID No. 2. The double mutations are: phenylalanine (F) at position 184 is mutated to tyrosine (Y), and tryptophan (W) at position 199 is mutated to glutamic acid (E).
[0012] The present invention further provides a gene encoding the aldolase mutant. Preferably, the nucleotide sequence is shown in SEQ ID No. 3.
[0013] The present invention also provides a gene expression cassette containing the aforementioned gene.
[0014] The present invention further provides a recombinant expression vector comprising the aforementioned gene expression cassette. The plasmid backbone used in the recombinant expression vector can be a commonly used gene expression vector, and is selected according to the host cell to which it is to be introduced, such as the pET-11a plasmid used in Escherichia coli.
[0015] This invention also provides a genetically engineered bacterium comprising a host cell and the recombinant expression vector transferred into the host cell. Preferably, the host cell is *Escherichia coli*, such as the commonly used expression strain *Escherichia coli* BL21(DE3).
[0016] The present invention also provides the application of the aldolase mutant in the catalytic synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran.
[0017] The present invention also provides the application of the genetically engineered bacteria in the catalytic synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran.
[0018] The present invention also provides a method for catalytic synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran, using acetaldehyde and chloroacetaldehyde as substrates, and using the aldolase mutant of claim 1 or the genetically engineered bacteria of claim 6 or 7 to catalytically synthesize (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran.
[0019] Beneficial effects of this invention:
[0020] The aldolase mutant of this invention, after double mutation with F184Y and W199F, exhibits a specific activity of nearly 4 times that of the wild-type enzyme in catalyzing the synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran, and also shows superior substrate tolerance compared to the wild-type enzyme. Detailed Implementation
[0021] The nucleotide sequence of the encoding gene for the wild-type DERA enzyme of this invention is shown in SEQ ID No. 1 and was synthesized by Shanghai Jierui Biotechnology Co., Ltd. The amino acid sequence of the wild-type DERA enzyme is shown in SEQ ID No. 2. This wild-type DERA enzyme is derived from *Escherichia coli*.
[0022] A double mutation was introduced into the wild-type DERA enzyme of this invention, with phenylalanine (F) at position 184 mutated to tyrosine (Y) and tryptophan (W) at position 199 mutated to glutamic acid (E). The nucleotide sequence of the coding gene of this mutant DERA enzyme is shown in SEQ ID No. 3 and was synthesized by Shanghai Jierui Biotechnology Co., Ltd. The amino acid sequence of the double-mutated DERA enzyme is shown in SEQ ID No. 4.
[0023] Example 1
[0024] Construction of wild-type enzyme engineered bacteria.
[0025] Based on the codon preference of Escherichia coli, the amino acid sequence of the wild-type DERA enzyme, as shown in SEQ ID No. 2, was converted into a nucleotide sequence. The nucleotide sequence was then fully synthesized chemically (commissioned by Shanghai Jierui Biotechnology Co., Ltd.) and integrated into the expression vector pET-11a to obtain a recombinant expression plasmid. Finally, the constructed recombinant expression plasmid was introduced into Escherichia coli BL21(DE3) to construct the wild-type DERA enzyme engineered bacteria.
[0026] Example 2
[0027] The F single mutant enzyme was constructed by mutating phenylalanine (F) at position 184 to tyrosine (Y).
[0028] (1) Activation of engineered bacteria and plasmid extraction.
[0029] All engineered bacteria were activated and cultured using LB medium with the following formula: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl, dissolved in deionized water and brought to a final volume. The medium was then sterilized at 120°C for 30 minutes and set aside for use. The solid medium was LB medium with 2% agar added.
[0030] The wild-type DRA enzyme engineered bacteria obtained in Example 1 were inoculated into test tubes containing 10 mL of LB medium and cultured at 25°C and 200 rpm for 12 h. After obtaining the cultured bacterial cells, plasmids were extracted according to the instructions of the Axygen plasmid extraction kit. The obtained plasmids can be used directly for point mutagenesis or stored at -20°C for long-term storage.
[0031] (2) Site-directed gene mutation.
[0032] Gene mutations were identified using whole-plasmid PCR. The primers required for the mutation of phenylalanine (F) at position 184 of the DERA enzyme to tyrosine (Y) are as follows:
[0033] Upstream primer: CCTCTACCGGTTATGGTACCGGTGG;
[0034] Downstream primer: CCACCGGTACCATAACCGGTAGAGG.
[0035] PCR amplification system:
[0036] 30 μL of deionized water;
[0037] dNTP Mix 4μL;
[0038] Buffer (5x) 10μL;
[0039] Upstream primer 2 μL;
[0040] 2 μL of downstream primer;
[0041] 1 μL of plasmid;
[0042] 1 μL of DNA polymerase.
[0043] PCR amplification conditions:
[0044] 1) Pre-denaturation: 95℃ for 6 min;
[0045] 2) Denaturation: 95℃ for 55s; Annealing: 46℃ for 30s; Extension: 72℃ for 150s; 35 cycles in total;
[0046] 3) Post-extension: 72℃ for 7 minutes;
[0047] 4) Store at 4℃.
[0048] After PCR amplification, the amplification product was detected by 0.9% agarose gel electrophoresis. The results showed that the amplification product was a single band with a size of about 7500 bp.
[0049] (3) Digestion and transformation of PCR products, and construction of F mutant engineered bacteria.
[0050] Take 50 μL of the PCR product obtained in step (2) of this embodiment, add 1 μL of DpnI, and let it stand in a 37°C water bath for 2 hours to digest.
[0051] Take 100 μL of competent BL21 cells (E. coli BL21(DE3)), add 5 μL of PCR digestion product, and incubate on ice for 30 min. Heat shock in a water bath at 42℃ for 70 s, then incubate on ice for 3 min.
[0052] Add 500 μL of antibody-free LB to the competent BL21 cells that have been prepared in an ice bath, and incubate at 37°C with shaking at 200 rpm for 2 h.
[0053] 100 μL of the cultured bacterial suspension was added to a plate containing kanamycin, spread evenly with a spreader, inverted, and transferred to a 37°C constant temperature and humidity incubator for overnight culture. Single colonies were picked and transferred to LB liquid medium. The successfully constructed positive transformants were identified by PCR, and the correctness of the mutation site was verified by sequencing. After verification, the F single mutant engineered bacteria were obtained. After adding 25% sterile glycerol, the bacteria were numbered and stored at -80°C for later use.
[0054] Example 3
[0055] The FW double mutant enzyme was constructed by mutating phenylalanine (F) at position 184 to tyrosine (Y) and tryptophan (W) at position 199 to phenylalanine (F).
[0056] (1) Activation and plasmid extraction of F single mutant engineered bacteria.
[0057] The F single mutant engineered bacteria were activated and cultured using LB medium.
[0058] The preserved F single mutant engineered bacteria were inoculated into test tubes containing 10 mL of LB medium and cultured at 25 °C and 200 rpm for 12 h. After obtaining the cultured bacterial cells, plasmids were extracted according to the instructions of the Axygen plasmid extraction kit. The obtained plasmids can be used directly for point mutagenesis or stored at -20 °C for long-term storage.
[0059] (2) Site-directed gene mutation.
[0060] Gene mutation was determined using whole-plasmid PCR. The primers required for the mutation of tryptophan (W) at position 199 of the DERA enzyme to glutamate (E) are:
[0061] Upstream primer: CACCTGATGAAAGAGATCGTTGGTGAC;
[0062] Downstream primer: GTCACCAACGATCTCTTTCATCAGGTG.
[0063] PCR amplification system:
[0064] 30 μL of deionized water;
[0065] dNTP Mix 4μL;
[0066] Buffer (5x) 10μL;
[0067] Upstream primer 2 μL;
[0068] 2 μL of downstream primer;
[0069] 1 μL of plasmid;
[0070] 1 μL of DNA polymerase.
[0071] PCR amplification conditions:
[0072] 1) Pre-denaturation: 95℃ for 6 min;
[0073] 2) Denaturation: 95℃ for 55s; Annealing: 46℃ for 30s; Extension: 72℃ for 150s; 35 cycles in total;
[0074] 3) Post-extension: 72℃ for 7 minutes;
[0075] 4) Store at 4℃.
[0076] After PCR amplification, the amplification product was detected by 0.9% agarose gel electrophoresis. The results showed that the amplification product was a single band, approximately 7500 bp in size. The amplification product was then purified and recovered using a DNA recovery kit; the specific steps were described in the kit's instructions.
[0077] (3) Digestion and transformation of PCR products, and construction of FW double mutant engineered bacteria.
[0078] Take 50 μL of the PCR product obtained in step (2) of this embodiment, add 1 μL of DpnI, and let it stand in a 37°C water bath for 2 hours to digest.
[0079] Take 100 μL of competent BL21 cells, add 5 μL of PCR digestion product, and incubate on ice for 30 min. Heat shock in a water bath at 42℃ for 70 s, then incubate on ice for 3 min.
[0080] Add 500 μL of antibody-free LB to the competent BL21 cells that have been prepared in an ice bath, and incubate at 37°C with shaking at 200 rpm for 2 h.
[0081] 100 μL of the cultured bacterial suspension was added to a plate containing kanamycin, spread evenly with a spreader, inverted, and transferred to a 37°C constant temperature and humidity incubator for overnight culture. Single colonies were picked and transferred to LB liquid medium. The successfully constructed positive transformants were identified by PCR, and the correctness of the mutation site was verified by sequencing. If the verification was correct, the FW double mutant engineered bacteria were obtained. After adding 25% sterile glycerol, the bacteria were numbered and stored at -80°C for later use.
[0082] Example 4
[0083] Preparation of crude enzyme solution of FW double mutant enzyme.
[0084] (1) Cultivation of FW double mutant engineered bacteria.
[0085] After activation by streaking on culture medium, single colonies of the FW double mutant strain were inoculated into 5 mL of LB broth containing 50 μg / mL kanamycin and cultured at 25°C with shaking for 12 h. Then, 2% of the inoculum was transferred to 5 mL of LB broth containing 50 μg / mL kanamycin and cultured at 30°C with shaking until OD (outlet count) was reached. 528 When the concentration reaches 0.8, add IPTG to a final concentration of 0.5 mM and induce culture at 25°C for 12 h. After the culture is completed, centrifuge the culture medium at 5000 rpm for 15 min, discard the supernatant, collect the bacterial cells, and store them in an ultra-low temperature freezer at -80°C for later use.
[0086] (2) Preparation of crude enzyme solution.
[0087] After the culture was completed, the bacterial cells were washed twice with 50 mM pH 7.0 imidazole phosphate buffer. Then, the bacterial cells were resuspended in 50 mM pH 7.0 imidazole phosphate buffer and sonicated at 300 W for 50 cycles, with each sonication lasting 5 seconds and a 10-second interval. The cell lysate was then centrifuged at 12000 rpm at 4°C for 5 minutes to remove the precipitate. The supernatant obtained was the crude enzyme solution containing FW double mutant DERA enzyme.
[0088] Example 5
[0089] Determination of the catalytic performance of DERA enzyme double mutants.
[0090] (1) Enzyme activity detection of FW double mutant.
[0091] Weigh 200 mg of the crude enzyme solution containing the FW double mutant DERA enzyme obtained in Example 4, add 10 mL of imidazole phosphate buffer at pH 7.0, add 0.53 g of acetaldehyde aqueous solution with a mass concentration of 40% and 0.47 g of chloroacetaldehyde aqueous solution with a mass concentration of 40%, that is, 0.212 g of acetaldehyde and 0.188 g of chloroacetaldehyde were added to the reaction system, with a total of 0.4 g of acetaldehyde and chloroacetaldehyde. The reaction temperature was 25℃, 200 rpm, and the reaction was carried out in a shaker for 3 h before taking a sample.
[0092] Add 500 μL of the reaction solution sample to a 1.5 mL centrifuge tube containing 0.05 g of NaCl solid, and sonicate for 60 s. Then add 1 mL of anhydrous ethanol (analytical grade), extract thoroughly, and centrifuge at 4 °C and 14800 rpm for 2 min. Take 200 μL of the supernatant.
[0093] DERA enzyme activity definition: Under the above reaction system and reaction conditions, the amount of enzyme required to produce 1 μmol (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran per minute is defined as one enzyme activity unit.
[0094] The crude enzyme solution of the wild-type enzyme was obtained by following the same steps as in Example 4, and then used as a comparison for enzyme activity detection.
[0095] The enzyme activity of DERA enzyme is shown in Table 1.
[0096] Table 1
[0097] experimental group Specific activity (U / g) FW double mutant enzyme 4.553191 Wild-type enzymes 1.204032
[0098] (2) Substrate tolerance test of FW double mutant enzyme.
[0099] The enzyme-to-substrate ratio refers to the mass ratio of enzyme to substrate added to the reaction, used to represent different substrate concentrations. For example, an enzyme-to-substrate ratio of 1:1 means that the mass of substrate and enzyme in the reaction system is the same. In this application, the substrate is calculated as the total mass of acetaldehyde and chloroacetaldehyde, and the enzyme mass is calculated as the mass of the crude enzyme solution obtained in Example 4.
[0100] The enzyme-to-bioreactor ratios were set to 0.5:1, 1:1, 1.25:1, 1.5:1, and 2:1, with other reaction conditions remaining the same. Enzyme activity was measured after 3 hours of reaction. The enzyme activity results of the FW mutant enzyme are shown in Table 2.
[0101] Table 2
[0102]
[0103] Table 2 shows that the catalytic effects of the DERA enzyme double mutant and the wild type differ significantly at different enzyme-to-substrate ratios. The wild type exhibits almost no catalytic effect at an enzyme-to-substrate ratio of 0.5:1, but the FW double mutant can still catalyze the reaction. As the enzyme-to-substrate ratio decreases, the enzyme activity of the FW mutant is consistently higher than that of the wild type, indicating that the substrate tolerance of the DERA enzyme mutant is superior to that of the wild type.
Claims
1. An aldolase mutant, characterized in that, The amino acid sequence is shown in SEQ ID No.
4.
2. The gene encoding the aldolase mutant of claim 1.
3. The gene according to claim 2, characterized in that, The nucleotide sequence is shown in SEQ ID No.
3.
4. A gene expression cassette comprising the gene of claim 3.
5. A recombinant expression vector comprising the gene expression cassette of claim 4.
6. A genetically engineered bacterium, characterized in that, The recombinant expression vector of claim 5 comprises a host cell and the recombinant expression vector transferred into the host cell.
7. The genetically engineered bacterium according to claim 6, characterized in that, The host cell is Escherichia coli.
8. The use of the aldolase mutant of claim 1 in the catalytic synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran.
9. The use of the genetically engineered bacteria of claim 6 or 7 in the catalytic synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran.
10. A method for the catalytic synthesis of (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran, characterized in that, Using acetaldehyde and chloroacetaldehyde as substrates, (4R,6S)-6-chloromethyl-2,4-dihydroxy-2H-pyran is synthesized by using the aldolase mutant of claim 1 or the genetically engineered bacteria of claim 6 or 7 as catalytic agents.
Citation Information
Patent Citations
Aldolase mutant as well as coding gene and application thereof
CN111876404A
Aldolase mutant
CN103409402A
Aldolase and encoding gene and application thereof
CN104293757A