Galactose-1-phosphate uridylyltransferase mutant and its application in the preparation of L-lysine

Abstract

The present invention discloses a galactose-1-phosphate uridylyltransferase mutant and its application in the preparation of L-lysine. The galactose-1-phosphate uridylyltransferase of the present invention is as follows A1) or A2): A1) a protein with an amino acid sequence of SEQ ID No. 2; A2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1). The present invention discovers that after prematurely terminating or knocking out the encoding gene of galactose-1-phosphate uridylyltransferase, the L-lysine production in cells can be increased, and L-lysine can be prepared by mutating or knocking out the encoding gene of galactose-1-phosphate uridylyltransferase in cells. The present invention has good application prospects.

Description

Technical Field

[0001] The present invention relates to a galactose-1-phosphate uridylyltransferase mutant in the field of biotechnology and its application in the preparation of L-lysine. Background Art

[0002] L-lysine has physiological effects such as promoting development, enhancing immunity, and improving the function of the central nervous tissue. It is one of the 8 essential amino acids that cannot be synthesized by the human body and animals themselves and are essential for growth. At present, L-lysine is the second largest amino acid variety in the world. The main production method is fermentation. Corynebacterium glutamicum and the like are important production strains of lysine. Approximately 90% of the industrial output of L-lysine is used as a nutritional fortifier in the feed industry, 10% is used as a flavor enhancer and sweetener in the food industry, and as a pharmaceutical intermediate in the pharmaceutical industry.

[0003] Currently, L-lysine is mainly produced by direct fermentation. The direct fermentation method uses strains with a complete L-lysine biosynthesis pathway, using molasses, starch hydrolysate, etc. as substrates, and producing through aerobic fermentation. Currently, the main L-lysine fermentation strains at home and abroad are mutant strains of Corynebacterium glutamicum. The main factor affecting its yield lies in the production bacteria. Improving the production capacity of L-lysine production strains is the current research focus. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to prepare L-lysine.

[0005] To solve the above technical problem, the present invention first provides the application of a substance that knocks out a protein-coding gene or inhibits the content or activity of the protein in the preparation of L-lysine;

[0006] The protein is as follows A1) or A2):

[0007] A1) A protein with an amino acid sequence of SEQ ID No.2;

[0008] A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1).

[0009] In the above application, the coding gene can be as follows b1) or b2) or b3):

[0010] b1) The DNA molecule shown in SEQ ID No.1 in the sequence listing;

[0011] b2) A DNA molecule having 75% or more identity with the nucleotide sequence defined by b1) and encoding the protein;

[0012] b3) A DNA molecule that hybridizes, under stringent conditions, to the nucleotide sequence defined in b1) or b2) and encodes said protein.

[0013] As used herein, the term "identity" refers to sequence similarity to a native nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity to the nucleotide sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID No. 1 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0014] The stringent conditions may be as follows: Hybridization at 50 °C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, and 1 mM EDTA, and washing at 50 °C in 2×SSC, 0.1% SDS; alternatively: Hybridization at 50 °C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and washing at 50 °C in 1×SSC, 0.1% SDS; alternatively: Hybridization at 50 °C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and washing at 50 °C in 0.5×SSC, 0.1% SDS; alternatively: Hybridization at 50 °C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and washing at 50 °C in 0.1×SSC, 0.1% SDS; alternatively: Hybridization at 50 °C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and washing at 65 °C in 0.1×SSC, 0.1% SDS; alternatively: Hybridization in a solution of 6×SSC, 0.5% SDS at 65 °C, followed by washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS; alternatively: Hybridization and washing the membrane twice in a solution of 2×SSC, 0.1% SDS at 68 °C for 5 min each time, and then hybridization and washing the membrane twice in a solution of 0.5×SSC, 0.1% SDS at 68 °C for 15 min each time; alternatively: Hybridization and washing the membrane under the conditions of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65 °C.

[0015] The above 75% or more identity may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0016] In the above application, the substance may be B1) or B2):

[0017] B1) A nucleic acid molecule that reduces the expression level of the protein;

[0018] B2) An expression cassette, recombinant vector, recombinant microorganism or transgenic cell line containing the nucleic acid molecule described in B1).

[0019] The nucleic acid molecule described in B1) may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0020] The expression cassette described in B2) refers to DNA that can express the gene in a host cell. This DNA not only includes a promoter that initiates gene transcription, but also includes a terminator that terminates gene transcription. Further, the expression cassette may also include an enhancer sequence.

[0021] A recombinant vector containing the gene expression cassette can be constructed using a plant expression vector.

[0022] In the above application, the substance may be a substance that mutates the codon of the 414th glutamate residue of SEQ ID No. 2 into a terminator;

[0023] Or, the substance may be a substance that mutates the 1240th guanine nucleotide of SEQ ID No. 1 into a thymine nucleotide.

[0024] The present invention also provides a method for preparing L-lysine. The method includes: reducing the content or activity of the protein in the receptor biological cell, or knocking out the coding gene of the protein in the receptor biological cell to obtain a recombinant biological cell; culturing the recombinant biological cell to obtain L-lysine.

[0025] The biological cell contains the coding gene of the protein.

[0026] In the above context, knocking out the coding gene of the protein in the receptor biological cell can be achieved by methods such as gene knockout or gene silencing.

[0027] In the above context, the gene knockout gene refers to: Knockout is an exogenous DNA introduction technique in which a DNA fragment containing a certain known sequence undergoes homologous recombination with a gene in the receptor cell genome that has the same or similar sequence, integrates into the receptor cell genome and is expressed. It can change the genetic genes of an organism, render the function of a specific gene ineffective, and thus shield some functions.

[0028] In the above text, gene silencing refers to: Gene Silencing, also known as gene quiescence, is a special physiological phenomenon in the process of eukaryotic cell gene expression regulation. It refers to the phenomenon that "quiescence" occurs in partial segments of a cell gene due to the combined action of various factors during the gene expression process, resulting in the loss of transcriptional activity and no expression or reduced expression.

[0029] In the above method, the biological cell can be yeast, bacteria, algae, fungi, plant cells or animal cells that can synthesize L-lysine.

[0030] In the above method, the bacteria can be Corynebacterium glutamicum, such as Corynebacterium glutamicum YP097158.

[0031] The bacteria of the present invention include but are not limited to Corynebacterium glutamicum. Any bacteria containing the gene shown in SEQ ID No.1 in the sequence listing can have its mutation or knockout to produce L-lysine. For example, the bacteria can be Corynebacterium glutamicum, Escherichia coli, Pantoea ananatis, Bacillus brevis or Brevis lactobacillus.

[0032] The above method can be achieved by mutating the codon of the 414th glutamate residue in SEQ ID No.2 in the receptor biological cell into a terminator, or mutating the 1240th guanine nucleotide in SEQ ID No.1 into a thymine nucleotide, or knocking out the gene shown in SEQ ID No.1.

[0033] In the above method, the recombinant biological cell can be cultured using a culture medium that can enable the growth of the recombinant biological cell;

[0034] and / or, the recombinant biological cell can be cultured under conditions that can enable the growth of the recombinant biological cell.

[0035] The recombinant biological cell can be used to produce a variety of products, including but not limited to lysine in the examples. The products produced can also be glutamate, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, etc.

[0036] The present invention also provides a biological material, which is any one of the following b1), b2), b3), b4), or b5):

[0037] b1) A DNA molecule encoding a protein with the amino acid sequence shown in SEQ ID No. 6;

[0038] b2) A DNA molecule having 75% or more identity with the DNA molecule sequence defined in b1) and encoding the protein shown in SEQ ID No. 6;

[0039] b3) A DNA molecule that hybridizes with the nucleotide sequence defined in b1) or b2) under stringent conditions and encodes the protein shown in SEQ ID No. 6;

[0040] b4) An expression cassette, recombinant vector, recombinant microorganism, or transgenic cell line containing the DNA molecule described in b1), b2), or b3);

[0041] b5) The recombinant biological cell described in any one of claims 5 - 7.

[0042] The present invention also provides a product for preparing L-lysine, and the product contains (or its active ingredient is) the substance or the biological material described above.

[0043] Experimental results show that after mutating or knocking out the coding gene of the protein shown in SEQ ID No. 2, the L-lysine production in cells can be increased. L-lysine can be prepared by mutating or knocking out the coding gene of the protein shown in SEQ ID No. 2 in cells, and the present invention has good application prospects.

[0044] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present invention in any way.

[0045] Instructions for Deposit of Biological Material

[0046] Taxonomic name: Corynebacterium glutamicum

[0047] Strain number: YP097158

[0048] Name of the depositary institution: General Microbiology Center of the China Committee for Culture Collection of Microorganisms

[0049] Abbreviation of the depositary institution: CGMCC

[0050] Address of the depositary institution: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101, Postcode: 100101

[0051] Date of deposit: August 16, 2016

[0052] Accession number registered by the preservation center: CGMCC No. 12856 Detailed implementation manners

[0053] Unless otherwise specified, the experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, instruments, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. In the following examples, for quantitative tests, three repeated experiments are set, and the results are averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0054] In the following examples, SPSS 11.5 statistical software was used to process the data, and One-way ANOVA test was used.

[0055] Example 1: Construction and screening of mutants of galactose-1-phosphate uridylyltransferase NCgl2002 gene that are beneficial to L-lysine synthesis

[0056] I. Construction of galactose-1-phosphate uridylyltransferase NCgl2002 mutant plasmid

[0057] First, the wild-type NCgl2002 gene (sequence as SEQ ID No.1) and its promoter sequence were cloned into the expression vector pXMJ19. Using the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI as a template, PCR amplifications were carried out with primers pXMJ19-PF and pXMJ19-PR respectively to obtain the wild-type NCgl2002 gene and its promoter sequence (sequence as SEQ ID No.3). After recovery, it was ligated with the expression vector pXMJ19 (TaKaRa Co., Ltd., containing chloramphenicol resistance) digested and recovered with BamHI / EcoRI using NEBuilder enzyme (NEB Co., Ltd.) at 50°C for 30 min. The ligation product was transformed into DH5α and spread onto a 2-YT agar plate containing chloramphenicol (34 mg / L) and cultured at 37°C to obtain the pXMJ19 transformant pXMJ19-NCgl2002 containing the NCgl2002 gene and its promoter sequence (sequence as SEQ ID No.3). The monoclonal colonies grown from the culture were identified by primers M13R(-48) / P1 and r Taq PCR. The pXMJ19 positive transformant pXMJ19-NCgl2002 containing the NCgl2002 gene and its promoter sequence was the one that PCR amplified a fragment of 1465 bp in size (sequence as SEQ ID No.4).

[0058] In SEQ ID No.3, positions 42 - 113 are its promoter sequence.

[0059] To obtain mutants of the galactose-1-phosphate uridylyltransferase gene NCgl2002, a plasmid of the NCgl2002 mutant gene was prepared using a random mutagenesis kit (Agilent Technologies, USA). Using the plasmid pXMJ19-NCgl2002 as a template, PCR amplifications were carried out with primers pXMJ19-PF / pXMJ19-PR respectively to obtain a 1441-bp NCgl2002 gene fragment containing random point mutations. The pXMJ19 positive transformant containing the NCgl2002 gene was pXMJ19-NCgl2002-MT (sequence as SEQ ID No.3, but there are random point mutations in the NCgl2002 coding region).

[0060] The recovered DNA fragment and the expression vector pXMJ19 (purchased from TaKaRa, containing chloramphenicol resistance) recovered by digestion with BamH I / EcoRI were ligated with NEBuilder enzyme (NEB) at 50 °C for 30 min. The ligation product was transformed into DH5α and spread on a 2-YT agar plate containing chloramphenicol (34 mg / L) and cultured at 37 °C. The monoclonal colonies grown from the culture were identified by primers M13R(-48) / P1 and rTaq PCR. The positive transformants of pXMJ19 containing the NCgl2002 random mutation were those that amplified a fragment of 1465 bp in size (the sequence was as shown in SEQ ID No. 4, but there were random point mutations in the NCgl2002 coding region) by PCR.

[0061] The primers were designed as follows (synthesized by Invitrogen, Shanghai):

[0062] pXMJ19-PF:

[0063] 5'- AATTAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCC aacaccacagtagacaatagccttg-3' (the underlined nucleotide sequence is the pXMJ19 homologous arm sequence),

[0064] pXMJ19-PR:

[0065] 5'- GAAAATCTTCTCTCATCCGCCAAAACAGCCAAGCTGAATTC ttataggaggggattgtatttaagg-3' (the underlined nucleotide sequence is the pXMJ19 homologous arm sequence).

[0066] M13R(-48): 5'-AGCGGATAACAATTTCACACAGGA-3';

[0067] P1: 5'-CTCTCATCCGCCAAAACAG-3'.

[0068] II. Screening for mutants of galactose-1-phosphate uridylyltransferase NCgl2002 gene that are beneficial to L-lysine synthesis

[0069] To identify the L-lysine production performance of the mutant vector constructed in Step 1. Specifically, the randomly mutated plasmid of NCgl2002 constructed in Step 1 was electrotransformed into Corynebacterium glutamicum YP097158 (Deposit No.: CGMCC No. 12856, Deposit Date: August 16, 2016, Deposit Institution: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Tel: 010 - 64807355), and cultured in a medium containing chloramphenicol (34 mg / L). The medium components and culture conditions are shown in Table 1. The monoclonal colonies grown from the culture were identified by primers M13R(-48) / P1 and r Taq PCR. The pXMJ19 positive transformants containing NCgl2002 random mutations were those with a PCR amplified fragment of 1465 bp in size (the sequence is as shown in SEQ ID No. 4, but there are random point mutations in the NCgl2002 coding region).

[0070] The positive transformants were cultured in a medium containing chloramphenicol (34 mg / L). The medium components and culture conditions are shown in Table 1. After continuous passage three times, they were inoculated into a 500 mL Erlenmeyer flask containing 30 mL of rich medium and shake-flask fermented at 37°C for 24 h. When the fermented culture reached an OD 600 = 0.1, IPTG with a final concentration of 0.1 mM was added to induce the overexpression of NCgl2002 protein.

[0071] After the fermentation culture was completed, the concentration of L-amino acids was analyzed by high performance liquid chromatography (HPLC), as shown in Table 2. Strains with superior production capacity of each L-amino acid compared to the control of Corynebacterium glutamicum YP097158 were selected, which were the YP097158-pXMJ19-NCgl2002 mutant strains.

[0072] Rich medium: The solvent is water, and the solutes and their concentrations are glucose 30 g / L, (NH4)2SO4 2 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.05 g / L, MnSO4·H2O 0.05 g / L, FM902 yeast powder 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, betaine 0.5 g / L, citric acid 2 g / L, VH 20 mg / L, VB1 1.5 mg / L, VB3 1.5 mg / L, VB 12 1.5 g / L, and the pH was adjusted to 7.0 with sodium hydroxide.

[0073] Table 1. Composition and culture conditions of the medium

[0074]

[0075] Table 2. HPLC analysis results of L - amino acids in YP097158 - NCgl2002 mutant strain

[0076]

[0077] As shown in Table 2, among the Corynebacterium glutamicum YP097158 - NCgl2002 mutant strains, YP097158 - NCgl2002 mutant strain 3 can maintain the production capacity of L - lysine, while the others will reduce the production capacity of L - lysine. This indicates that this gene plays a role in inhibiting the production of L - lysine, and NCgl2002 mutant strain 3 may inactivate this gene, thus maintaining the ability to synthesize L - lysine.

[0078] The result of sequencing the NCgl2002 gene by extracting the plasmid from Corynebacterium glutamicum YP097158 mutant strain 3 confirmed that the NCgl2002 mutation site was the mutation of guanine (G) at the 1240th position in the coding region of this gene to thymine (T) (the gene containing this mutation is denoted as NCgl2002 G1240T gene), and glutamic acid (E) at the 414th position in the amino acid sequence of its mutant protein NCgl2002 was mutated to a stop codon (*) (the protein containing this mutation is denoted as NCgl2002 G1240T protein). This plasmid is pXMJ19 - E414* (the sequence is as shown in SEQ ID No.3, and the 1353rd position in this sequence is mutated to T). Among them, the DNA sequence shown in SEQ ID No.1 is the wild - type NCgl2002 gene, encoding a protein amino acid sequence of SEQ ID No.2 (the protein name is wild - type NCgl2002 protein); the DNA sequence shown in SEQ IDNo.5 is the mutant NCgl2002 G1240T gene, the thymine (T) at the 1240th position in the gene sequence of the mutant NCgl2002 G1240T gene (SEQIDNo.5) mutated from guanine (G), encoding a protein amino acid sequence of SEQIDNo.6 (the mutant protein name is mutant NCgl2002 E414* protein), and the stop codon (*) at the 414th position in the amino acid sequence of the mutant protein NCgl2002 E414* mutated from glutamic acid (E).

[0079] Example 2: Construction of an engineered strain with a mutated NCgl2002 gene in the genome

[0080] Based on the genomic sequences of Corynebacterium glutamicum YP097158 or the wild-type Corynebacterium glutamicum strain ATCC13032, the NCgl2002 gene and the mutant NCgl2002 were further studied in high-yield strains by allelic replacement E414* to investigate the effect of the gene on L-lysine production

[0081] A point mutation was introduced into the coding region (SEQ ID No.1) of the NCgl2002 gene. The point mutation was to mutate the 1240th guanine (G) in the nucleotide sequence (SEQ ID No.1) of the NCgl2002 gene to thymine (T) to obtain the DNA molecule shown in SEQ ID No.5 (mutant NCgl2002 gene, named mutant NCgl2002 E414* gene).

[0082] Among them, the DNA molecule shown in SEQ ID No.1 encodes a protein with an amino acid sequence of SEQ ID No.2 (the protein is named wild-type NCgl2002 protein). The DNA molecule shown in SEQ ID No.5 encodes a protein with an amino acid sequence of SEQ ID No.6 (the mutant protein is named mutant NCgl2002 E414* protein), and the 414th glutamate (E) in the amino acid sequence (SEQ ID No.6) of the mutant protein NCgl2002 E414* is mutated to a stop codon (*).

[0083] I. Construction of a recombinant vector for the mutant NCgl2002 E414* gene coding region

[0084] Using the genomic DNA of Corynebacterium glutamicum YP097158 or the wild-type Corynebacterium glutamicum strain ATCC13032 as a template, PCR amplifications were carried out with primers P2 / P3, P4 / P5 and KAPA HiFi HotStart respectively to obtain two NCgl2002 E414* DNA fragments (NCgl2002 E414* Up and NCgl2002 E414* Down) with mutated bases of 525bp and 533bp in size respectively. After the PCR reaction, the column-type DNA gel recovery kit was used to perform agarose gel electrophoresis to recover NCgl2002E414* Up and NCgl2002 E414* Down. The recycled DNA was used as a template to obtain the point-mutated integrative homologous arm DNA fragment Up-NCgl2002 by primer P2 / P5 overlap PCR E414* -Down (SEQ ID No.7), 1022 bp.

[0085] The primers were designed as follows (synthesized by Invitrogen, Shanghai):

[0086] P2: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GAACTGCATCATCTACGTGG-3', (the underlined nucleotide sequence is the sequence on pK18)

[0087] P3: 5'-GCGTTCAACG GAGCATTACA TGGCGATGCG-3',

[0088] P4: 5'-GATCTG CGCATCGCCATGTAATGCTCCGTTG -3',

[0089] P5: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCACCAAGCAGCGCGGTGAC-3', (the underlined nucleotide sequence is the sequence on pK18)

[0090] The point-mutated integrative homologous arm DNA fragment (Up-NCgl2002 E414* -Down) obtained by overlap PCR above was separated and purified by agarose gel electrophoresis, and then ligated with the pK18mobsacB plasmid (Addgene) purified after digestion with Xbal I and BamHI using NEBuilder enzyme (NEB) at 50°C for 30 min. The monoclonal colonies grown after the ligation product was transformed into Escherichia coli DH5α were identified by PCR using primers M13F / M13R (M13F: 5′-TGTAAAACGACGGCCAGT-3′, M13R: 5′-CAGGAAACAGCTATGACC-3′). The positive recombinant vector with the correct sequence was obtained by plasmid extraction and denoted as pK18-NCgl2002 G1240T , and this recombinant vector contains a kanamycin resistance marker.

[0091] This recombinant vector pK18-NCgl2002 G1240T contains NCgl2002 G1240TUp-Down DNA is 1022 bp in size (SEQ ID No. 7), containing a mutation site (G-T), which will cause the guanine (G) at the 1240th position in the coding region of the NCgl2002 gene in the strain Corynebacterium glutamicum YP097158 and the wild-type Corynebacterium glutamicum strain ATCC13032 to mutate into thymine (T), ultimately resulting in the glutamic acid (E) at the 414th position of the encoded protein being changed to a stop codon (*).

[0092] Recombinant vector pK18-NCgl2002 G1240T is a recombinant vector obtained by replacing the fragment (small fragment) between the Xbal I and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown in SEQ ID No. 7 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged. Recombinant vector pK18-NCgl2002 G1240T contains the mutant gene NCgl2002 shown in SEQ ID No. 5 G1240T with the mutation site (G-T).

[0093] II. Construction of engineering strains containing NCgl2002 in the genome G1240T of

[0094] The above allelic replacement plasmid (pK18-NCgl2002 G1240T ) was transformed into the L-lysine-producing strain Corynebacterium glutamicum YP097158 and the wild-type Corynebacterium glutamicum strain ATCC13032 (using the same transformation method as above) by electroporation and cultured on a solid culture plate containing kanamycin (for the medium components and culture conditions, see Table 1). The single colonies obtained from the culture were identified separately using the above primers P2 and the universal primer M13R. The strains that could amplify a band of 1070 bp in size were positive strains. The positive strains were cultured on a medium containing 15% sucrose (this medium was obtained by increasing the sucrose concentration in the medium in Table 1 to 15 g / L). The single colonies obtained from the culture were cultured separately on media with and without kanamycin, and the strains that grew on the medium without kanamycin but did not grow on the medium with kanamycin were further amplified by PCR using the following primers (synthesized by Invitrogen, Shanghai):

[0095] P6: 5′-CTACCCTGGCAGGTTTTGAAG-3′;

[0096] P7: 5′-GAAGTTCTGA AATGCGGCTC-3′.

[0097] The obtained DNA fragment (256 bp) was processed (denatured at 95 °C for 10 min and rapidly ice-bathed for 5 min), and then subjected to SSCP (Single-Strand Conformation Polymorphis) electrophoresis (using the plasmid pK18-NCgl2002 G1240T amplification fragment as a positive control, the amplification fragment of Corynebacterium glutamicum ATCC13032 as a negative control, and water as a blank control). The preparation and electrophoresis conditions of the PAGE for SSCP electrophoresis are shown in Table 3. Since the fragment structures are different, the electrophoresis positions are different. Therefore, the strains in which the electrophoresis position of the fragment is inconsistent with that of the negative control fragment and consistent with that of the positive control fragment are the strains with successful allelic replacement. The positive strain NCgl2002 G1240T gene fragment was amplified again by primers P6 / P7 PCR and ligated to the PMD19-T vector for sequencing. By sequence alignment, the strains with a mutation (G-T) in the base sequence are the positive strains with successful allelic replacement. The positive strains obtained from Corynebacterium glutamicum YP097158 and the wild-type Corynebacterium glutamicum strain ATCC13032 were named YPL-NCgl2002-1 and L2002-1.

[0098] Both the recombinant strains YPL-NCgl2002-1 and L2002-1 contain the mutant gene NCgl2002 shown in SEQ ID No. 5 G1240T and can express the protein shown in SEQ ID No. 6. The difference between the recombinant strain YPL-NCgl2002-1 and Corynebacterium glutamicum YP097158 is only that: YPL-NCgl2002-1 is a strain obtained by replacing the NCgl2002 gene of Corynebacterium glutamicum YP097158 with the NCgl2002 G1240T gene while keeping other sequences unchanged. The difference between the recombinant strain L2002-1 and ATCC13032 is only that: L2002-1 is a strain obtained by replacing the NCgl2002 gene of ATCC13032 with the NCgl2002 G1240T gene while keeping other sequences unchanged.

[0099] Table 3. Preparation and electrophoresis conditions of the PAGE for SSCP electrophoresis

[0100]

[0101] Example 3. Construction of an engineered strain with a deletion of the NCgl2002 gene on the genome

[0102] According to the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify the fragments at both ends of the coding region of the NCgl2002 gene, which were used as upstream and downstream homologous arm fragments. The primer design is as follows (synthesized by Invitrogen, Shanghai):

[0103] P8: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CGTGATGCAGGCCGAAGGATC-3′ (the underlined nucleotide sequence is the sequence on pK18),

[0104] P9: 5′-GCGACACTAAAACTCTTGGCGGTGCGAATGGGGGTGACAG-3′,

[0105] P10: 5′-CTGTCACCCCCATTCGCACCGCCAAGAGTTTTAGTGTCGC-3′,

[0106] P11: 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GGAGTTTTCCTCCGATGGCTG-3′ (the underlined nucleotide sequence is the sequence on pK18).

[0107] Construction method: Using Corynebacterium glutamicum ATCC13032 as the template, PCR amplification was carried out with primers P8 / P9 and P10 / P11 respectively to obtain the upstream homologous arm fragment of 571 bp and the downstream homologous arm fragment of 566 bp for knocking out NCgl2002. The amplified products were electrophoresed and purified using a column DNA gel recovery kit. The recovered DNA fragments were ligated with the pK18mobsacB plasmid (Addgene) purified after digestion with Xbal I / BamHI enzymes using NEBuilder enzyme (NEB) at 50 °C for 30 min. The monoclonal colonies grown after transformation of the ligation products were identified by PCR with M13 primers to obtain the positive knockout vector pK18-ΔNCgl2002. This plasmid contains the entire homologous arm fragment of 1097 bp for knocking out NCgl2002 (the sequence is shown in SEQ ID No. 8) and kanamycin resistance as a screening marker, and this plasmid was sent for sequencing.

[0108] The correctly sequenced knockout plasmid pK18-ΔNCgl2002 was electrotransformed into Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032, and cultured in a medium. The medium components and culture conditions are shown in Table 1. The single colonies generated from the culture were identified by PCR using primers P8 / P11: Strains that simultaneously amplified bands of 1097 bp and 2384 bp in size were positive strains, and strains that only amplified the 2384 bp band were the original bacteria. The positive strains were screened on 15% sucrose solid medium and then cultured on media with and without kanamycin. Strains that grew on the medium without kanamycin but did not grow on the medium with kanamycin were further identified by PCR using primers P8 / P11. Strains that amplified a band of 1097 bp in size were positive strains with the coding region of the NCgl2002 gene knocked out. The NCgl2002 fragment of the positive strain was amplified by PCR using primers P8 / P11 again, ligated into the pMD19-T vector for sequencing, and the strains with correct sequencing were named YPL-NCgl2002-2 (the NCgl2002 gene on the genome of Corynebacterium glutamicum YP097158 was knocked out) and L2002-2 (the NCgl2002 gene on the genome of wild-type Corynebacterium glutamicum ATCC13032 was knocked out).

[0109] Example 4: L-Lysine Fermentation Experiment

[0110] The strains constructed in Examples 2 and 3, and the original strains of Corynebacterium glutamicum YP097158 and ATCC13032 were used for fermentation experiments in a fermenter of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 4 and the control process shown in Table 5. After the fermentation ended, the L-lysine yield was detected by the ninhydrin colorimetric method. Each strain was repeated three times, and the results are shown in Table 6.

[0111] Table 4: Fermentation Medium Formulation

[0112]

[0113]

[0114] Table 5: Fermentation Control Process

[0115]

[0116] Table 6: L-Lysine Yield of NCgl2002 Engineered Strains

[0117]

[0118]

[0119] As shown in Table 6, point mutation and knockout of the coding region of the NCgl2002 gene in Corynebacterium glutamicum are helpful for improving the L-lysine yield and growth rate. G1240T

[0120] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use or improvement of the present invention, including those that depart from the scope disclosed in this application and are made by conventional techniques known in the art. Some basic features can be applied according to the scope of the appended claims below.​

Claims

1. A method for preparing L-lysine, comprising: Knock out the protein-coding gene in the recipient biological cell to obtain a recombinant biological cell; culture the recombinant biological cell to obtain L-lysine; The protein is as follows A1) or A2): A1) A protein with an amino acid sequence of SEQ ID No. 2; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1); The recombinant biological cell is a recombinant Corynebacterium glutamicum.

2. A method for preparing L-lysine, characterized in that: The method obtains a recombinant biological cell by mutating the codon of the 414th glutamate residue in SEQ ID No. 2 in the recipient biological cell to a stop codon, or by mutating the 1240th guanine nucleotide in SEQ ID No. 1 to a thymine nucleotide; culture the recombinant biological cell to obtain L-lysine; The recombinant biological cell is a recombinant Corynebacterium glutamicum.

3. The method according to claim 1 or 2, characterized in that: The recombinant biological cell is cultured using a medium capable of growing the recombinant biological cell; And / or, the recombinant biological cell is cultured under conditions capable of growing the recombinant biological cell.

4. A biological material, which is as follows b1) or b2) or b3): b1) A DNA molecule encoding a protein with an amino acid sequence shown in SEQ ID No. 6; b2) An expression cassette, recombinant vector or recombinant microorganism containing the DNA molecule described in b1); b3) The recombinant biological cell described in claim 1 or 2, and the recombinant biological cell is a recombinant Corynebacterium glutamicum.

5. A product for preparing L-lysine, containing the biological material described in claim 4.

Images